DOCSLIB.ORG

MST4 Regulates Epithelial–Mesenchymal Transition of Choriocarcinoma by Mediating TGF- Β1 Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MST4 Regulates Epithelial–Mesenchymal Transition of Choriocarcinoma by Mediating TGF- Β1 Expression OncoTargets and Therapy Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH MST4 Regulates Epithelial–Mesenchymal Transition of Choriocarcinoma by Mediating TGF- β1 Expression This article was published in the following Dove Press journal: OncoTargets and Therapy Hanxi Yu 1,* Background: Mammalian Ste20-like kinase 4 (MST4), also known as serine/threonine Weichen Zhang2,* kinase 26 (STK26), promotes development of several cancers and is found to be highly Peilin Han1 expressed in the placenta. However, in choriocarcinoma that originated from the placenta, the Beng Yang2 expression of MST4 was undetermined and its mechanism was unknown. In this study, the Xiaode Feng 2 expression of MST4 in choriocarcinoma as well as the underlying mechanism was explored. Purpose: To detect the expression of MST4 in patient samples and mechanism of mediating Ping Zhou1 EMT by MST4 in choriocarcinoma. Xiaoxu Zhu1 3 Patients and Methods: The metastatic lesions of choriocarcinoma (n=17) and volunteer Bingqian Zhou villus (n=17) were collected to determine MST4 expression using immunohistochemistry and 4 Wei Chen H&E staining. We use siRNA and lentiviral vector to knockdown MST4 and use plasmid to 1 Jianhua Qian overexpress MST4 in choriocarcinoma. Then, we apply real-time polymerase chain reaction 2 Jun Yu (RT-PCR), Western blot assay and immunofluorescence assay to detect target protein expres­ 1Department of Gynecology, The First sions. Cell invasion and migration and cell proliferation were detected by transwell assay and Affiliated Hospital of Zhejiang University, wound healing assay and CCK-8 and cell colony formation. School of Medicine, Hangzhou 310006, Results: MST4 is lowly expressed in the metastatic lesions of choriocarcinoma patients when People’s Republic of China; 2Division of Hepatobiliary and Pancreatic Surgery, compared with normal villus. Knockdown of MST4 activated epithelial–mesenchymal transition Department of Surgery First Affiliated (EMT) process, significantlyincreasing the ability of invasion and migration in choriocarcinoma Hospital, The First Affiliated Hospital of Zhejiang University, School of Medicine, cell lines (JAR and JEG-3). In contrast, the EMT process was restrained in choriocarcinoma cell Hangzhou 310006, People’s Republic of lines with overexpressed MST4. Meanwhile, genome-wide gene expression array, Western blot 3 China; Department of Gynecology, The and ELISA revealed that tumor growth factor-beta 1 (TGF-β1) has significantly increased. The First Affiliated Hospital of Zhejiang University, School of Medicine, Pujiang EMT process and metastatic prompting biofunction were reversed after using TGF-β1 inhibitor 322200, People’s Republic of China; (LY364947) in the choriocarcinoma cell lines with MST4 knockdown. 4 Department of Medical Oncology, Conclusion: Our studies demonstrated that MST4 was lowly expressed in patient samples. Tongde Hospital of Zhejiang Province, Hangzhou 310012, People’s Republic of Additionally, JAR and JEG-3 increase cell invasion and migration ability while there is no China influence on cell proliferation with MST4 knockdown. Conversely, the metastatic ability of JAR and JEG-3 was decreased with overexpressed MST4. Moreover, TGF-β1 was a key *These authors contributed equally to this work factor after MST4 knockdown. In conclusion, MST4 affects choriocarcinoma EMT by mediating TGF-β1 expression. Keywords: choriocarcinoma, TGF-β1, EMT, MST4 Introduction Choriocarcinoma is a rare and highly malignant epithelial tumor.1 Accounting for Correspondence: Jianhua Qian; Jun Yu 0.3% and 15.1% mortality rate in low risk and high risk patients of China, Tel +86-0571-87236114 respectively.2,3 However, the mechanism of choriocarcinoma still remains to Email [email protected]; [email protected] unclear, and lacks research to demonstrate how it develops. submit your manuscript | www.dovepress.com OncoTargets and Therapy 2020:13 11935–11946 11935 DovePress © 2020 Yu et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php http://doi.org/10.2147/OTT.S269168 and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Yu et al Dovepress Mammalian Ste20-like kinase 4(MST4), also known as transformation epithelial mesenchyme of choriocarcinoma serine/threonine kinase 26 (STK26), is characterized in was focused on to prove the potential practical value of 2001, and located on Xq25-26.3.4 It belongs to the germ­ MST4 as a molecular marker in relapsed and metastatic inal center kinase (GCK) group III kinase family, which choriocarcinoma. includes other kinases of Ste20-like kinases, such as MST1, MST2, and MST3.5 It consists of a C-terminal reg­ Patients and Methods ulatory domain and an N-terminal kinase domain, and the Patient Samples and signaling cascade consists of a series of conserved ele­ Immunohistochemistry ments that control cell polarity.6 Due to its kinase activity, The samples of 17 patients who were underwent lesio­ MST4 is considered to have many biological functions nectomy at the department of gynecology and obstetrics both physiologically and pathologically.7–9 For instance, in the First Affiliated Hospital of Zhejiang University MST4 has been reported to act as an oncogene for EMT, were collected from 2014–2019. All metastatic lesions promoting metastasis and proliferation in pancreatic were removed from the samples, and the diagnosis of cancer10 and stimulating migration in hepatocellular these was pathologically confirmed. The paraffin- carcinoma.11 MST4 has been reported to be highly embedded lesion tissue was used for immunohistochem­ expressed in the placenta. Interestingly, placenta is con­ istry. The lesion tissues were cut into 3 µm sections, sidered as the origin of choriocarcinoma. However, it is dewaxed in xylene (20 min, 60°C), and rehydrated in still unclear as to whether MST4 affects the malignant a series of graded ethanol dilutions. The heat-induced development of choriocarcinoma. epitope repair was performed in the target retrieval solu­ Epithelial–mesenchymal transition (EMT) is a process tion at pH 7.5 (20 min). The sections were incubated that is related to the function of a variety of tumors, with rabbit monoclonal antibody of human MST4 including tumor initiation, malignant progression, tumor (Proteintech, USA) at a dilution of 1:100, and along stemness and tumor drug resistance, promoting metastasis with the rabbit monoclonal antibody (CST, USA) against of various types of tumors.12,13 EMT has been reported to MST4 at a dilution of 1:200 at 4°C overnight. The slides be mediated by some pathways in choriocarcinoma.14,15 were then incubated with HRP at room temperature (30 According to the previous studies, EMT is mediated by min), and DAB was used as chromogen for 5–10 min. MST4 in hepatocellular carcinoma and evidence showed The slides were given scores that are as follows: (nega­ that MST4 acts as an activator of EMT via the p-ERK tive), 0% immunoreactive cells; +≤5% immunoreactive signaling pathway.11 However, the detailed role of MST4 cells; ++>5–50% immunoreactive cells; +++≥50 immunor­ in mediating choriocarcinoma EMT still remains eactive cells. Statistical analysis of the cases with scores 0 unknown. Alternatively, the TGF-β signaling pathway and + were regarded as low expression, while those with played an important role in EMT in the late stage of scores ++ and +++ were regarded as high expression. carcinoma.16 So far, TGF-β1 downregulates various epithelial-derived proteins, including E-cadherin and tight junction protein ZO-1 and upregulates interstitial source Cell Culture proteins like fibronectin, alpha-smooth muscle actin and JAR and JEG-3 JAR and JEG-3 were obtained from the vimentin. The downstream molecules of TGF-β1 like cell library of the Chinese Academy of Sciences SMADs activate the EMT-associated transcriptional factor, (Shanghai, China). JAR was maintained in RPMI1640 such as SNAIL, TWIST and ZEB1.17 In such circum­ (Biological Industries, Israel) and JEG-3 was maintained stances, epithelial cells have adopted some mesenchymal in MEM (Biological Industries, Israel). All the cell lines phenotype, especially susceptible to metastasis.18 were cultured in the culture medium with 10% FBS, 100 In summary, although choriocarcinoma is very sensitive to μg/mL streptomycin and 100 μg/mL penicillin in 5% CO2, chemotherapy regimens, recurrence, metastasis and drug at 37°C with saturated moisture content. resistance associated with it remain difficult. Hence, in this study the tissues of 17 patients with relapsed and metastatic Stable MST4 Knockdown Cell Lines choriocarcinoma were collected and low expression of MST4 Transfection was found in patients’ lesions when compared to normal JAR and JEG-3 were seeded at a density of 2⨰105 per well in villus. The mechanism of MST4 in regulating the a six-well plate. The target sequencing of MST4 (5‘- 11936 submit your manuscript | www.dovepress.com OncoT argets and Therapy 2020:13 DovePress Dovepress Yu et al GATCCCCAGATTGCTACCATGCTAAACTTCCTGTC­
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Structure-Based Screen Identification of a Mammalian Ste20-Like Kinase 4 (MST4) Inhibitor with Therapeutic Potential for Pituitary Tumors
    Published OnlineFirst December 31, 2015; DOI: 10.1158/1535-7163.MCT-15-0703 Small Molecule Therapeutics Molecular Cancer Therapeutics Structure-Based Screen Identification of a Mammalian Ste20-like Kinase 4 (MST4) Inhibitor with Therapeutic Potential for Pituitary Tumors Weipeng Xiong1,3, Christopher J. Matheson2, Mei Xu1,3, Donald S. Backos2, Taylor S. Mills1, Smita Salian-Mehta1, Katja Kiseljak-Vassiliades1,3, Philip Reigan2, and Margaret E. Wierman1,3 Abstract Pituitary tumors of the gonadotrope lineage are often large described as an Aurora kinase inhibitor, exhibited potent inhi- and invasive, resulting in hypopituitarism. No medical treat- bition of the MST4 kinase at nanomolar concentrations. The ments are currently available. Using a combined genetic and LbT2 gonadotrope pituitary cell hypoxic model was used to test genomic screen of individual human gonadotrope pituitary the ability of this inhibitor to antagonize MST4 actions. Under tumor samples, we recently identified the mammalian ster- short-term severe hypoxia (1% O2), MST4 protection from ile-20 like kinase 4 (MST4) as a protumorigenic effector, driving hypoxia-induced apoptosis was abrogated in the presence of increased pituitary cell proliferation and survival in response to hesperadin. Similarly, under chronic hypoxia (5%), hesperadin a hypoxic microenvironment. To identify novel inhibitors of blocked the proliferative and colony-forming actions of MST4 the MST4 kinase for potential future clinical use, computation- as well as the ability to activate specific downstream signaling al-based virtual library screening was used to dock the Sell- and hypoxia-inducible factor-1 effectors. Together, these data eckChem kinase inhibitor library into the ATP-binding site of identify hesperadin as the first potent, selective inhibitor of the the MST4 crystal structure.
    [Show full text]
  • A Semantic Approach for Knowledge Capture of Microrna-Target Gene Interactions
    2015 IEEE International Conference on Bioinformatics and Biomedicine (BIBM) A semantic approach for knowledge capture of microRNA-target gene interactions Jingshan Huang* Fernando Gutierrez Dejing Dou School of Computing, University of South Alabama CIS Dept., University of Oregon CIS Dept., University of Oregon Mobile, Alabama 36688, U.S.A. Eugene, Oregon 97403, U.S.A. Eugene, Oregon 97403, U.S.A. Judith A. Blake Karen Eilbeck Darren A. Natale The Jackson Laboratory School of Medicine, University of Utah Georgetown University Medical Center Bar Harbor, Maine 04609, U.S.A. Salt Lake City, Utah 84112, U.S.A. Washington D.C. 20007, U.S.A. Barry Smith Yu Lin Xiaowei Wang Dept. Philosophy, University at Buffalo University of Miami Washington University School of Medicine Buffalo, New York 14260, U.S.A. Miami, Florida 33146, U.S.A. St. Louis, Missouri 63110, U.S.A. Zixing Liu Ming Tan Alan Ruttenberg MCI, University of South Alabama MCI, University of South Alabama Dental Medicine, University at Buffalo Mobile, Alabama 36604, U.S.A. Mobile, Alabama 36604, U.S.A. Buffalo, New York 14214, U.S.A. Abstract—Research has indicated that microRNAs (miRNAs), Conventionally, data end users (that is, biologists, bioin- a special class of non-coding RNAs (ncRNAs), can perform formaticians, and clinical investigators) need to search for important roles in different biological and pathological processes. (1) biologically validated miRNA targets (for example, by miRNAs’ functions are realized by regulating their respective querying the PubMed database [3]) and (2) computationally target genes (targets). It is thus critical to identify and analyze putative miRNA targets (for example, by initiating inquiries miRNA-target interactions for a better understanding and de- on various prediction databases or websites such as miRDB lineation of miRNAs’ functions.
    [Show full text]
  • STRIPAK Complexes in Cell Signaling and Cancer
    Oncogene (2016), 1–9 © 2016 Macmillan Publishers Limited All rights reserved 0950-9232/16 www.nature.com/onc REVIEW STRIPAK complexes in cell signaling and cancer Z Shi1,2, S Jiao1 and Z Zhou1,3 Striatin-interacting phosphatase and kinase (STRIPAK) complexes are striatin-centered multicomponent supramolecular structures containing both kinases and phosphatases. STRIPAK complexes are evolutionarily conserved and have critical roles in protein (de) phosphorylation. Recent studies indicate that STRIPAK complexes are emerging mediators and regulators of multiple vital signaling pathways including Hippo, MAPK (mitogen-activated protein kinase), nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are extensively involved in a variety of fundamental biological processes ranging from cell growth, differentiation, proliferation and apoptosis to metabolism, immune regulation and tumorigenesis. Growing evidence correlates dysregulation of STRIPAK complexes with human diseases including cancer. In this review, we summarize the current understanding of the assembly and functions of STRIPAK complexes, with a special focus on cell signaling and cancer. Oncogene advance online publication, 15 February 2016; doi:10.1038/onc.2016.9 INTRODUCTION in the central nervous system and STRN4 is mostly abundant in Recent proteomic studies identified a group of novel multi- the brain and lung, whereas STRN3 is ubiquitously expressed in 5–9 component complexes named striatin (STRN)-interacting phos- almost all tissues. STRNs share a
    [Show full text]
  • Structure-Based Screen Identification of a Mammalian Ste20-Like Kinase 4 (MST4) Inhibitor with Therapeutic Potential for Pituitary Tumors
    Published OnlineFirst December 31, 2015; DOI: 10.1158/1535-7163.MCT-15-0703 Small Molecule Therapeutics Molecular Cancer Therapeutics Structure-Based Screen Identification of a Mammalian Ste20-like Kinase 4 (MST4) Inhibitor with Therapeutic Potential for Pituitary Tumors Weipeng Xiong1,3, Christopher J. Matheson2, Mei Xu1,3, Donald S. Backos2, Taylor S. Mills1, Smita Salian-Mehta1, Katja Kiseljak-Vassiliades1,3, Philip Reigan2, and Margaret E. Wierman1,3 Abstract Pituitary tumors of the gonadotrope lineage are often large described as an Aurora kinase inhibitor, exhibited potent inhi- and invasive, resulting in hypopituitarism. No medical treat- bition of the MST4 kinase at nanomolar concentrations. The ments are currently available. Using a combined genetic and LbT2 gonadotrope pituitary cell hypoxic model was used to test genomic screen of individual human gonadotrope pituitary the ability of this inhibitor to antagonize MST4 actions. Under tumor samples, we recently identified the mammalian ster- short-term severe hypoxia (1% O2), MST4 protection from ile-20 like kinase 4 (MST4) as a protumorigenic effector, driving hypoxia-induced apoptosis was abrogated in the presence of increased pituitary cell proliferation and survival in response to hesperadin. Similarly, under chronic hypoxia (5%), hesperadin a hypoxic microenvironment. To identify novel inhibitors of blocked the proliferative and colony-forming actions of MST4 the MST4 kinase for potential future clinical use, computation- as well as the ability to activate specific downstream signaling al-based virtual library screening was used to dock the Sell- and hypoxia-inducible factor-1 effectors. Together, these data eckChem kinase inhibitor library into the ATP-binding site of identify hesperadin as the first potent, selective inhibitor of the the MST4 crystal structure.
    [Show full text]
  • STRIPAK, a Highly Conserved Signaling Complex, Controls Multiple
    Biol. Chem. 2019; 400(8): 1005–1022 Review Ulrich Kück*, Daria Radchenko and Ines Teichert STRIPAK, a highly conserved signaling complex, controls multiple eukaryotic cellular and developmental processes and is linked with human diseases https://doi.org/10.1515/hsz-2019-0173 networks are now known to underlie the transmission and Received February 27, 2019; accepted March 28, 2019; previously modulation of such signals. These networks, controlled published online May 1, 2019 by diverse regulators at different cellular levels, are highly conserved across eukaryotic organisms. Abstract: The striatin-interacting phosphatases and Among the signaling components that have received kinases (STRIPAK) complex is evolutionary highly con- increased attention in the last decade is the STRIPAK served and has been structurally and functionally complex, which was initially identified in mammals by described in diverse lower and higher eukaryotes. In recent mass spectrometry (MS) analysis (Goudreault et al., 2009). years, this complex has been biochemically characterized Here we will provide a summary of the key studies leading better and further analyses in different model systems have to the discovery of striatin, the major regulatory phos- shown that it is also involved in numerous cellular and phatase subunit of the STRIPAK complex. Further, the developmental processes in eukaryotic organisms. Fur- components and architecture as well as the assembly and ther recent results have shown that the STRIPAK complex structural insights of the STRIPAK complex will be com- functions as a macromolecular assembly communicating prehensively reviewed. Another focus will be the control through physical interaction with other conserved signal- of developmental processes as a result of bi-directional ing protein complexes to constitute larger dynamic protein interaction of STRIPAK with other components involved networks.
    [Show full text]
  • MOB (Mps One Binder) Proteins in the Hippo Pathway and Cancer
    Review MOB (Mps one Binder) Proteins in the Hippo Pathway and Cancer Ramazan Gundogdu 1 and Alexander Hergovich 2,* 1 Vocational School of Health Services, Bingol University, 12000 Bingol, Turkey; [email protected] 2 UCL Cancer Institute, University College London, WC1E 6BT, London, United Kingdom * Correspondence: [email protected]; Tel.: +44 20 7679 2000; Fax: +44 20 7679 6817 Received: 1 May 2019; Accepted: 4 June 2019; Published: 10 June 2019 Abstract: The family of MOBs (monopolar spindle-one-binder proteins) is highly conserved in the eukaryotic kingdom. MOBs represent globular scaffold proteins without any known enzymatic activities. They can act as signal transducers in essential intracellular pathways. MOBs have diverse cancer-associated cellular functions through regulatory interactions with members of the NDR/LATS kinase family. By forming additional complexes with serine/threonine protein kinases of the germinal centre kinase families, other enzymes and scaffolding factors, MOBs appear to be linked to an even broader disease spectrum. Here, we review our current understanding of this emerging protein family, with emphases on post-translational modifications, protein-protein interactions, and cellular processes that are possibly linked to cancer and other diseases. In particular, we summarise the roles of MOBs as core components of the Hippo tissue growth and regeneration pathway. Keywords: Mps one binder; Hippo pathway; protein kinase; signal transduction; phosphorylation; protein-protein interactions; structure biology; STK38; NDR; LATS; MST; STRIPAK 1. Introduction The family of MOBs (monopolar spindle-one-binder proteins) is highly conserved in eukaryotes [1–4]. To our knowledge, at least two different MOBs have been found in every eukaryote analysed so far.
    [Show full text]
  • MST4 Antibody A
    Revision 1 C 0 2 - t MST4 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 2 2 Web: [email protected] 8 www.cellsignal.com 3 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H M R Mk B Endogenous 52 Rabbit Q9P289 51765 Product Usage Information 4. Zhao, B. et al. (2011) Nat Cell Biol 13, 877-83. 5. Dan, I. et al. (2002) J Biol Chem 277, 5929-39. Application Dilution 6. Sung, V. et al. (2003) Cancer Res 63, 3356-63. 7. Preisinger, C. et al. (2004) J Cell Biol 164, 1009-20. Western Blotting 1:1000 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity MST4 Antibody recognizes endogenous levels of total MST4 protein independent of phosphorylation. The antibody does not cross-react with MST1-3 proteins. Species Reactivity: Human, Mouse, Rat, Monkey, Bovine Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to the amino-terminal residues of human MST4 protein. Antibodies are purified by protein A and peptide affinity chromatography. Background Mammalian sterile-20-like (MST) kinases are upstream regulators of mitogen-activated protein kinase (MAPK) signaling pathways that regulate multiple biological processes, including apoptosis, morphogenesis, cell migration, and cytoskeletal rearrangements (1). This group of serine/threonine kinases includes a pair of closely related proteins (MST1, MST2) that are functionally distinct from the more distantly related MST3 and MST4 kinases.
    [Show full text]
  • CCM3/PDCD10 Heterodimerizes With
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 28, pp. 25056–25064, July 15, 2011 © 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. CCM3/PDCD10 Heterodimerizes with Germinal Center Kinase III (GCKIII) Proteins Using a Mechanism Analogous to CCM3 Homodimerization*ࡗ Received for publication, December 17, 2010, and in revised form, April 26, 2011 Published, JBC Papers in Press, May 11, 2011, DOI 10.1074/jbc.M110.213777 Derek F. Ceccarelli‡1, Rob C. Laister§1, Vikram Khipple Mulligan¶, Michelle J. Kean‡ʈ2, Marilyn Goudreault‡, Ian C. Scottʈ**, W. Brent Derryʈ**, Avijit Chakrabartty¶‡‡, Anne-Claude Gingras‡ʈ3, and Frank Sicheri‡ʈ4 From the ‡Centre for Systems Biology, Samuel Lunenfeld Research Institute at Mount Sinai Hospital, Toronto, Ontario M5G 1X5, the §Division of Stem Cell and Developmental Biology, Ontario Cancer Institute, Toronto, Ontario M5G 1L7, the ¶Campbell Family Institute for Cancer Research, Ontario Cancer Institute/University Health Network, Department of Biochemistry, University of Toronto, Toronto, Ontario M5G 1L7, the ʈDepartment of Molecular Genetics, University of Toronto, Toronto, Ontario M5S 1A8, the **Program in Developmental and Stem Cell Biology, The Hospital for Sick Children, Toronto, Ontario M5G 1X8, and the ‡‡Department of Medical Biophysics, University of Toronto, Toronto, Ontario M5G 1L7, Canada CCM3 mutations give rise to cerebral cavernous malforma- three distinct genes, denoted CCM1–3, that are causative for tions (CCMs) of the vasculature through a mechanism that the formation of most familial CCM lesions (1, 2). CCM3, also remains unclear. Interaction of CCM3 with the germinal center named PDCD10, is a 212 amino acid protein conserved among Downloaded from kinase III (GCKIII) subfamily of Sterile 20 protein kinases, metazoans (3, 4).
    [Show full text]
  • A Novel, Non-Canonical Mechanism of Regulation of MST3 (Mammalian Sterile20- Related Kinase 3)
    A novel, non-canonical mechanism of regulation of MST3 (mammalian Sterile20- related kinase 3) Article Published Version Fuller, S. J., McGuffin, L. J., Marshall, A. K., Giraldo, A., Pikkarainen, S., Clerk, A. and Sugden, P. (2012) A novel, non- canonical mechanism of regulation of MST3 (mammalian Sterile20-related kinase 3). Biochemical Journal, 442 (3). pp. 595-610. ISSN 0264-6021 doi: https://doi.org/10.1042/BJ20112000 Available at http://centaur.reading.ac.uk/26012/ It is advisable to refer to the publisher’s version if you intend to cite from the work. See Guidance on citing . Published version at: http://dx.doi.org/10.1042/BJ20112000 To link to this article DOI: http://dx.doi.org/10.1042/BJ20112000 Publisher: Portland Press Limited Publisher statement: The final version of record is available at http://www.biochemj.org/bj All outputs in CentAUR are protected by Intellectual Property Rights law, including copyright law. Copyright and IPR is retained by the creators or other copyright holders. Terms and conditions for use of this material are defined in the End User Agreement . www.reading.ac.uk/centaur CentAUR Central Archive at the University of Reading Reading’s research outputs online www.biochemj.org Biochem. J. (2012) 442, 595–610 (Printed in Great Britain) doi:10.1042/BJ20112000 595 A novel non-canonical mechanism of regulation of MST3 (mammalian Sterile20-related kinase 3) Stephen J. FULLER*, Liam J. MCGUFFIN*, Andrew K. MARSHALL*, Alejandro GIRALDO*, Sampsa PIKKARAINEN†, Angela CLERK* and Peter H. SUGDEN*1 *School of Biological
    [Show full text]