DOCSLIB.ORG

Supplementary Table 6

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 6 Supplementary Table 6 Early-onset Tumor Correlated Genes Entrez Probe Set ID Gene.Symbol Gene Title Gene R2 p serine hydroxymethyl 1425177_at Shmt1 transferase 1 (soluble) 20425 0.633960327 4.76232E-12 S-adenosylhomocysteine 1417125_at Ahcy hydrolase 269378 0.592710209 6.37583E-11 serine hydroxymethyl 1425178_s_at Shmt1 transferase 1 (soluble) 20425 0.585853686 9.56993E-11 ELOVL family member 6, elongation of long chain 1417404_at Elovl6 fatty acids (yeast) 170439 0.580927972 1.27603E-10 serine hydroxymethyl 1425179_at Shmt1 transferase 1 (soluble) 20425 0.576381865 1.65927E-10 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, 1426804_at Smarca4 member 4 20586 0.576190422 1.67762E-10 branched chain aminotransferase 1, 1430111_a_at Bcat1 cytosolic 12035 0.571872005 2.14729E-10 A kinase (PRKA) anchor 1419706_a_at Akap12 protein (gravin) 12 83397 0.569478339 2.45954E-10 DNA segment, Chr 7, ERATO Doi 316, 1446915_at --- expressed --- 0.565290298 3.11355E-10 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, 1426805_at Smarca4 member 4 20586 0.561107982 3.93153E-10 serine hydroxymethyl 1422198_a_at Shmt1 transferase 1 (soluble) 20425 0.560211498 4.13194E-10 ELOVL family member 6, elongation of long chain 1445641_at --- fatty acids (yeast) --- 0.557565123 4.7824E-10 trypsin domain containing 1441856_x_at Tysnd1 1 71767 0.553922978 5.84017E-10 sperm associated antigen 1427498_a_at Spag5 5 54141 0.552028064 6.47593E-10 phosphodiesterase 2A, 1447707_s_at Pde2a cGMP-stimulated 207728 0.550820419 6.91523E-10 branched chain aminotransferase 1, 1450871_a_at --- cytosolic --- 0.544934143 9.49912E-10 leukotriene B4 12- 1417777_at Ltb4dh hydroxydehydrogenase 67103 0.544070792 9.94856E-10 jumonji domain 1455982_at AU020939 containing 4 194952 0.543014627 1.05262E-09 ELOVL family member 6, elongation of long chain 1417403_at Elovl6 fatty acids (yeast) 170439 0.540568298 1.19903E-09 OTU domain, ubiquitin 1417575_at Otub2 aldehyde binding 2 68149 0.537476003 1.41225E-09 1452202_at Pde2a phosphodiesterase 2A, 207728 0.531077953 1.97481E-09 cGMP-stimulated 1452101_at Blmh bleomycin hydrolase 104184 0.529546003 2.13848E-09 1456308_x_at Trim28 tripartite motif protein 28 21849 0.526226057 2.53905E-09 RIKEN cDNA 2610318N02 1429268_at --- gene --- 0.52423078 2.81347E-09 RIKEN cDNA C530043G21 1451668_at C530043G21Rik gene 215015 0.523654077 2.89795E-09 1420454_at Rai1 retinoic acid induced 1 19377 0.523102397 2.98104E-09 cell division cycle 1423683_at Cdca4 associated 4 71963 0.521835856 3.18055E-09 topoisomerase (DNA) II 1458480_at Topbp1 beta binding protein 235559 0.520090055 3.47667E-09 OTU domain, ubiquitin 1417576_a_at Otub2 aldehyde binding 2 68149 0.519521857 3.57864E-09 budding uninhibited by benzimidazoles 1 homolog, beta (S. 1447363_s_at Bub1b cerevisiae) 12236 0.516494311 4.17222E-09 leucine-rich and death 1421397_a_at Lrdd domain containing 57913 0.515803631 4.32032E-09 budding uninhibited by benzimidazoles 1 homolog, beta (S. 1416961_at Bub1b cerevisiae) 12236 0.5154939 4.38836E-09 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate 1415916_a_at Mthfd1 synthase 108156 0.514631311 4.58332E-09 RIKEN cDNA 4833427B12 1452881_at 4833427B12Rik gene 272551 0.505246269 7.31988E-09 RIKEN cDNA 0610009D07 1436681_x_at 0610009D07Rik gene 66055 0.504350929 7.6508E-09 multiple substrate lipid kinase /// similar to multi- substrate lipid kinase /// similar to multi-substrate 1424582_at 2610037M15Rik lipid kinase 69923 0.501545917 8.78315E-09 transformed mouse 3T3 1451053_a_at Mdm1 cell double minute 1 17245 0.500628112 9.18741E-09 coiled-coil domain 1424429_s_at AI225782 containing 95 233875 0.499547382 9.68637E-09 RIKEN cDNA 6230427J02 1452903_at 6230427J02Rik gene 68176 0.49942827 9.74293E-09 1416859_at Fkbp3 FK506 binding protein 3 30795 0.498031873 1.04301E-08 12412 Cbx1 /// chromobox homolog 1 /// 1436266_x_at E430007M08Rik (Drosophila HP1 beta) 319869 0.497927999 1.0483E-08 1421317_x_at Myb myeloblastosis oncogene 17863 0.497137785 1.08943E-08 1426297_at Tcfe2a transcription factor E2a 21423 0.496380823 1.13027E-08 interleukin enhancer 1460669_at Ilf3 binding factor 3 16201 0.495278476 1.1924E-08 sperm associated antigen 1433892_at Spag5 5 54141 0.494523386 1.23683E-08 1427105_at 2610510J17Rik RIKEN cDNA 2610510J17 72155 0.494262414 1.25255E-08 gene 1418036_at Prim2 DNA primase, p58 subunit 19076 0.492877316 1.33926E-08 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate 1415917_at Mthfd1 synthase 108156 0.492219109 1.38247E-08 1452208_at Prdm4 PR domain containing 4 72843 0.492050995 1.39371E-08 RIKEN cDNA C230052I12 1454779_s_at C230052I12Rik gene 101831 0.491875854 1.40552E-08 cell division cycle 2 1448314_at Cdc2a homolog A (S. pombe) 12534 0.491735459 1.41506E-08 1416301_a_at Ebf1 early B-cell factor 1 13591 0.491349723 1.44159E-08 minichromosome maintenance deficient 7 1416030_a_at Mcm7 (S. cerevisiae) 17220 0.489653073 1.56403E-08 1422816_a_at Mutyh mutY homolog (E. coli) 70603 0.489119179 1.60458E-08 timeless interacting 1426612_at Tipin protein 66131 0.488717174 1.63578E-08 RIKEN cDNA 2610040C18 1453067_at 2610040C18Rik gene 69928 0.487050793 1.77145E-08 RIKEN cDNA C530043G21 1451667_at C530043G21Rik gene 215015 0.486092676 1.85428E-08 Nur77 downstream gene 1433720_s_at Ndg2 2 103172 0.484481356 2.00203E-08 DnaJ (Hsp40) related, 1447046_at --- subfamily B, member 13 --- 0.483295599 2.11792E-08 lethal giant larvae 1416621_at Llglh homolog 1 (Drosophila) 16897 0.482819487 2.16624E-08 1439820_at Ebf1 Early B-cell factor 1 13591 0.481646995 2.28981E-08 elongation factor 1 homolog (ELF1, S. 1423820_at 1110011K10Rik cerevisiae) 66126 0.481548627 2.30048E-08 1459348_at Ebf1 Early B-cell factor 1 13591 0.481118392 2.3477E-08 structure specific 1426788_a_at Ssrp1 recognition protein 1 20833 0.481044718 2.35588E-08 1442299_at Mrpl27 --- 94064 0.480719309 2.39234E-08 gem (nuclear organelle) 1436310_at Gemin5 associated protein 5 216766 0.4804075 2.42778E-08 1422547_at Ranbp1 RAN binding protein 1 19385 0.480112483 2.46178E-08 zinc finger, BED domain 1453848_s_at Zbed3 containing 3 72114 0.480059149 2.46798E-08 1422734_a_at Myb myeloblastosis oncogene 17863 0.479986029 2.4765E-08 enhancer of rudimentary 1430536_a_at Erh homolog (Drosophila) 13877 0.479467587 2.5377E-08 small nuclear 1437193_s_at Snrpb ribonucleoprotein B 20638 0.479262686 2.56229E-08 eukaryotic translation initiation factor 4E binding 1436158_at Eif4ebp2 protein 2 13688 0.478950388 2.60021E-08 1427764_a_at Tcfe2a transcription factor E2a 21423 0.478578886 2.64602E-08 expressed sequence 1458374_at C79407 C79407 217653 0.478079244 2.70885E-08 DNA segment, Chr 10, 1416850_s_at D10Ertd214e ERATO Doi 214, 52637 0.478032519 2.7148E-08 expressed Fanconi anemia, 1447935_at C730036B14Rik complementation group M 104806 0.477732991 2.75324E-08 1450194_a_at Myb myeloblastosis oncogene 17863 0.475722504 3.02508E-08 RIKEN cDNA 0610009D07 1417054_a_at 0610009D07Rik gene 66055 0.475454639 3.06319E-08 RIKEN cDNA 1810009N02 1429730_at 1810009N02Rik gene 69099 0.475318016 3.0828E-08 Tnf receptor-associated factor 5 /// similar to TNF receptor-associated factor 1448861_at Traf5 5 22033 0.475172567 3.10382E-08 RIKEN cDNA 2010317E24 1429405_at 2010317E24Rik gene 72080 0.475018737 3.12619E-08 1443325_at --- Transcribed locus --- 0.47500671 3.12795E-08 sperm associated antigen 1433893_s_at Spag5 5 54141 0.473606693 3.33895E-08 1416302_at Ebf1 early B-cell factor 1 13591 0.473237278 3.39687E-08 RIKEN cDNA 4833427B12 1428713_s_at 4833427B12Rik gene 272551 0.472732676 3.47754E-08 1452566_at --- --- --- 0.47248253 3.51821E-08 glutamate-cysteine ligase, 1424296_at Gclc catalytic subunit 14629 0.471979602 3.60137E-08 splicing factor, arginine/serine-rich 2 1415807_s_at Sfrs2 (SC-35) 20382 0.47194415 3.6073E-08 expressed sequence 1434767_at C79407 C79407 217653 0.471146457 3.74331E-08 synaptojanin 2 binding 1417834_at Synj2bp protein 24071 0.470670162 3.82685E-08 Nur77 downstream gene 1436990_s_at Ndg2 2 103172 0.470085569 3.93183E-08 high mobility group AT- 1416184_s_at Hmga1 hook 1 15361 0.468240262 4.2817E-08 SMT3 suppressor of mif 1415782_at Sumo2 two 3 homolog 2 (yeast) 170930 0.468128288 4.30386E-08 RNA binding motif protein, 1416177_at Rbmxrt X chromosome retrogene 19656 0.468024498 4.32451E-08 RIKEN cDNA 2810429O05 1418542_s_at 2810429O05Rik gene 52504 0.467747768 4.38002E-08 thymoma viral proto- 1422078_at Akt3 oncogene 3 23797 0.467707982 4.38805E-08 1448787_at Moap1 modulator of apoptosis 1 64113 0.466635452 4.61012E-08 chromobox homolog 2 1422059_at Cbx2 (Drosophila Pc class) 12416 0.466335982 4.67403E-08 Bromodomain containing 1446644_at --- 3 --- 0.465806707 4.78907E-08 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, 1448401_at Smarcd2 member 2 83796 0.465506135 4.85561E-08 RIKEN cDNA 9630023C09 1441977_at 9630023C09Rik gene 320378 0.464422041 5.10305E-08 mediator of RNA polymerase II transcription, subunit 9 1419377_at BC019367 homolog (yeast) 192191 0.464044583 5.19201E-08 pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1417288_at Plekha2 2 83436 0.463877974 5.23175E-08 RIKEN cDNA 4122402O22 1453182_a_at 4122402O22Rik gene 77626 0.463439529 5.33774E-08 ubiquitin-like, containing PHD and RING finger 1439227_at --- domains, 1 --- 0.463166202 5.40485E-08 RIKEN cDNA 2410005H09 1424490_at 2410005H09Rik
Load more

Recommended publications
  • A Genetic Screening Identifies a Component of the SWI/SNF Complex, Arid1b As a Senescence Regulator
    A genetic screening identifies a component of the SWI/SNF complex, Arid1b as a senescence regulator Sadaf Khan A thesis submitted to Imperial College London for the degree of Doctor in Philosophy MRC Clinical Sciences Centre Imperial College London, School of Medicine July 2013 Statement of originality All experiments included in this thesis were performed by myself unless otherwise stated. Copyright Declaration The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives license. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the license terms of this work. 2 Abstract Senescence is an important tumour suppressor mechanism, which prevents the proliferation of stressed or damaged cells. The use of RNA interference to identify genes with a role in senescence is an important tool in the discovery of novel cancer genes. In this work, a protocol was established for conducting bypass of senescence screenings, using shRNA libraries together with next-generation sequencing. Using this approach, the SWI/SNF subunit Arid1b was identified as a regulator of cellular lifespan in MEFs. SWI/SNF is a large multi-subunit complex that remodels chromatin. Mutations in SWI/SNF proteins are frequently associated with cancer, suggesting that SWI/SNF components are tumour suppressors. Here the role of ARID1B during senescence was investigated. Depletion of ARID1B extends the proliferative capacity of primary mouse and human fibroblasts.
    [Show full text]
  • Identification of the Genes Up- and Down-Regulated by the High Mobility Group A1 (HMGA1) Proteins: Tissue Specificity of the HMGA1-Dependent Gene Regulation
    [CANCER RESEARCH 64, 5728–5735, August 15, 2004] Identification of the Genes Up- and Down-Regulated by the High Mobility Group A1 (HMGA1) Proteins: Tissue Specificity of the HMGA1-Dependent Gene Regulation Josefina Martinez Hoyos,1 Monica Fedele,1 Sabrina Battista,1 Francesca Pentimalli,1,2 Mogens Kruhoffer,3 Claudio Arra,4 Torben F. Orntoft,3 Carlo Maria Croce,2 and Alfredo Fusco1 1Dipartimento di Biologia e Patologia Cellulare e Molecolare e/o Istituto di Endocrinologia ed Oncologia Sperimentale del CNR, Facolta` di Medicina e Chirurgia di Napoli, Universita` degli Studi di Napoli “Federico II,” Naples, Italy; 2Kimmel Cancer Center, Jefferson Medical College, Philadelphia, Pennsylvania; 3Department of Clinical Biochemistry, Aarhus University Hospital, Aarhus, Denmark; and 4Istituto Dei Tumori Di Napoli “Fondazione Pascale,” Naples, Italy. ABSTRACT To identify the differentiation pathways in which HMGA1 is in- volved and to assess the role of the HMGA1 proteins in development, High mobility group A (HMGA) proteins are chromatinic proteins that we generated embryonic stem (ES) cells in which one or both hmga1 do not have transcriptional activity per se, however, by interacting with alleles are disrupted. We reported recently that hmga1Ϫ/Ϫ ES cells the transcription machinery, they regulate, negatively or positively, the expression of several genes. We searched for genes regulated by HMGA1 generate less T-cell precursors than do wild-type ES cells after in proteins using microarray analysis in embryonic stem (ES) cells bearing vitro-specific differentiation. Indeed, they preferentially differentiate one or two disrupted hmga1 alleles. We identified 87 transcripts increased to B cells, probably consequent to decreased IL-2 expression and and 163 transcripts decreased of at least 4-fold in hmga1؊/؊ ES cells.
    [Show full text]
  • Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources
    Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources Chung-Feng Kao1, Yu-Sheng Fang2, Zhongming Zhao3, Po-Hsiu Kuo1,2,4* 1 Department of Public Health and Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan, 2 Institute of Clinical Medicine, School of Medicine, National Cheng-Kung University, Tainan, Taiwan, 3 Departments of Biomedical Informatics and Psychiatry, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, 4 Research Center for Genes, Environment and Human Health, National Taiwan University, Taipei, Taiwan Abstract Background: Large scale and individual genetic studies have suggested numerous susceptible genes for depression in the past decade without conclusive results. There is a strong need to review and integrate multi-dimensional data for follow up validation. The present study aimed to apply prioritization procedures to build-up an evidence-based candidate genes dataset for depression. Methods: Depression candidate genes were collected in human and animal studies across various data resources. Each gene was scored according to its magnitude of evidence related to depression and was multiplied by a source-specific weight to form a combined score measure. All genes were evaluated through a prioritization system to obtain an optimal weight matrix to rank their relative importance with depression using the combined scores. The resulting candidate gene list for depression (DEPgenes) was further evaluated by a genome-wide association (GWA) dataset and microarray gene expression in human tissues. Results: A total of 5,055 candidate genes (4,850 genes from human and 387 genes from animal studies with 182 being overlapped) were included from seven data sources.
    [Show full text]
  • Transcriptional Regulation of RKIP in Prostate Cancer Progression
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences Transcriptional Regulation of RKIP in Prostate Cancer Progression Submitted by: Sandra Marie Beach In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences Examination Committee Major Advisor: Kam Yeung, Ph.D. Academic William Maltese, Ph.D. Advisory Committee: Sonia Najjar, Ph.D. Han-Fei Ding, M.D., Ph.D. Manohar Ratnam, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: May 16, 2007 Transcriptional Regulation of RKIP in Prostate Cancer Progression Sandra Beach University of Toledo ACKNOWLDEGMENTS I thank my major advisor, Dr. Kam Yeung, for the opportunity to pursue my degree in his laboratory. I am also indebted to my advisory committee members past and present, Drs. Sonia Najjar, Han-Fei Ding, Manohar Ratnam, James Trempe, and Douglas Pittman for generously and judiciously guiding my studies and sharing reagents and equipment. I owe extended thanks to Dr. William Maltese as a committee member and chairman of my department for supporting my degree progress. The entire Department of Biochemistry and Cancer Biology has been most kind and helpful to me. Drs. Roy Collaco and Hong-Juan Cui have shared their excellent technical and practical advice with me throughout my studies. I thank members of the Yeung laboratory, Dr. Sungdae Park, Hui Hui Tang, Miranda Yeung for their support and collegiality. The data mining studies herein would not have been possible without the helpful advice of Dr. Robert Trumbly. I am also grateful for the exceptional assistance and shared microarray data of Dr.
    [Show full text]
  • A Preliminary Transcriptome Analysis Suggests a Transitory Effect of Vitamin D on Mitochondrial Function in Obese Young Finnish Subjects
    ID: 18-0537 8 5 E Einarsdottir et al. Effect of vitamin D on gene 8:5 559–570 expression RESEARCH A preliminary transcriptome analysis suggests a transitory effect of vitamin D on mitochondrial function in obese young Finnish subjects Elisabet Einarsdottir1,2,3,†, Minna Pekkinen1,4, Kaarel Krjutškov2,5, Shintaro Katayama3, Juha Kere1,2,3,6, Outi Mäkitie1,4,7,8 and Heli Viljakainen1,9 1Folkhälsan Institute of Genetics, University of Helsinki, Helsinki, Finland 2Molecular Neurology Research Program, University of Helsinki, Helsinki, Finland 3Department of Biosciences and Nutrition, Karolinska Institutet, Huddinge, Sweden 4Children’s Hospital, University of Helsinki and Helsinki University Hospital, Helsinki, Finland 5Competence Centre on Health Technologies, Tartu, Estonia 6School of Basic and Medical Biosciences, King’s College London, Guy’s Hospital, London, United Kingdom 7Department of Molecular Medicine and Surgery and Center for Molecular Medicine, Karolinska Institutet, Stockholm, Sweden 8Department of Clinical Genetics, Karolinska University Hospital, Stockholm, Sweden 9Department of Food and Environmental Sciences, University of Helsinki, Helsinki, Finland Correspondence should be addressed to H Viljakainen: [email protected] †(E Einarsdottir is now at Department of Gene Technology, Science for Life Laboratory, KTH-Royal Institute of Technology, Solna, Sweden) Abstract Objective: The effect of vitamin D at the transcriptome level is poorly understood, Key Words and furthermore, it is unclear if it differs between obese and normal-weight subjects. f vitamin D The objective of the study was to explore the transcriptome effects of vitamin D f gene expression supplementation. f obesity Design and methods: We analysed peripheral blood gene expression using GlobinLock f transcriptome oligonucleotides followed by RNA sequencing in individuals participating in a 12-week f mitochondrial function randomised double-blinded placebo-controlled vitamin D intervention study.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Bppart and Bpmax: RNA-RNA Interaction Partition Function and Structure Prediction for the Base Pair Counting Model
    BPPart and BPMax: RNA-RNA Interaction Partition Function and Structure Prediction for the Base Pair Counting Model Ali Ebrahimpour-Boroojeny, Sanjay Rajopadhye, and Hamidreza Chitsaz ∗ Department of Computer Science, Colorado State University Abstract A few elite classes of RNA-RNA interaction (RRI), with complex roles in cellular functions such as miRNA-target and lncRNAs in human health, have already been studied. Accordingly, RRI bioinfor- matics tools tailored for those elite classes have been proposed in the last decade. Interestingly, there are somewhat unnoticed mRNA-mRNA interactions in the literature with potentially drastic biological roles. Hence, there is a need for high-throughput generic RRI bioinformatics tools. We revisit our RRI partition function algorithm, piRNA, which happens to be the most comprehensive and computationally-intensive thermodynamic model for RRI. We propose simpler models that are shown to retain the vast majority of the thermodynamic information that piRNA captures. We simplify the energy model and instead consider only weighted base pair counting to obtain BPPart for Base-pair Partition function and BPMax for Base-pair Maximization which are 225 and 1350 faster ◦ × × than piRNA, with a correlation of 0.855 and 0.836 with piRNA at 37 C on 50,500 experimentally charac- terized RRIs. This correlation increases to 0.920 and 0.904, respectively, at 180◦C. − Finally, we apply our algorithm BPPart to discover two disease-related RNAs, SNORD3D and TRAF3, and hypothesize their potential roles in Parkinson's disease and Cerebral Autosomal Dominant Arteri- opathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL). 1 Introduction Since mid 1990s with the advent of RNA interference discovery, RNA-RNA interaction (RRI) has moved to the spotlight in modern, post-genome biology.
    [Show full text]
  • 1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1
    Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • Identification of Novel Chemotherapeutic Strategies For
    www.nature.com/scientificreports OPEN Identification of novel chemotherapeutic strategies for metastatic uveal melanoma Received: 17 November 2016 Paolo Fagone1, Rosario Caltabiano2, Andrea Russo3, Gabriella Lupo1, Accepted: 09 February 2017 Carmelina Daniela Anfuso1, Maria Sofia Basile1, Antonio Longo3, Ferdinando Nicoletti1, Published: 17 March 2017 Rocco De Pasquale4, Massimo Libra1 & Michele Reibaldi3 Melanoma of the uveal tract accounts for approximately 5% of all melanomas and represents the most common primary intraocular malignancy. Despite improvements in diagnosis and more effective local therapies for primary cancer, the rate of metastatic death has not changed in the past forty years. In the present study, we made use of bioinformatics to analyze the data obtained from three public available microarray datasets on uveal melanoma in an attempt to identify novel putative chemotherapeutic options for the liver metastatic disease. We have first carried out a meta-analysis of publicly available whole-genome datasets, that included data from 132 patients, comparing metastatic vs. non metastatic uveal melanomas, in order to identify the most relevant genes characterizing the spreading of tumor to the liver. Subsequently, the L1000CDS2 web-based utility was used to predict small molecules and drugs targeting the metastatic uveal melanoma gene signature. The most promising drugs were found to be Cinnarizine, an anti-histaminic drug used for motion sickness, Digitoxigenin, a precursor of cardiac glycosides, and Clofazimine, a fat-soluble iminophenazine used in leprosy. In vitro and in vivo validation studies will be needed to confirm the efficacy of these molecules for the prevention and treatment of metastatic uveal melanoma. Uveal melanoma is the most common primary intraocular cancer, and after the skin, the uveal tract is the second most common location for melanoma1.
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]