DOCSLIB.ORG

Reviewed Scientific Articles and P

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reviewed Scientific Articles and P Notes Notes from the Group of Editors This version of Scientifur, which is the third issue of Please note that the papers in the proceedings have volume 28, contains the proceedings of the VIII been divided into the following two groups: International Scientific Congress in Fur Animal Production, held in ‘s-Hertogenbosch, The RP – reviewed scientific articles and Netherlands, 15 – 18 September 2004. P – short communications On behalf of the Group of Editors Birthe Damgaard Erratum Erratum to table 5, page 124, in the article “Ideal Protein for Mink (Mustela vison) in the Growing and Furring Periods” Peter Sandbol, T.N. Clausen and C. Hejlesen. Scientifur, Vol 28, No 3, proceedings, VIII International Scientific Congress in Fur Animal Production, ’s-Hertogenbosch, The Netherlands, 15-18 September 2004, Due to faulty conversion from g/100 kcal ME to g/MJ, the whole table in the publication shows incorrect values. However this does not change anything else in the publication. The correct figures are as shown below: Table 5. Estimated content of amino acids in gram/MJ during the growing period, compared to an Ideal Protein (IP) and the present norm. 22 ME from protein, → → → → → Present % 32 28 24 20 16 30 26 22 18 14 IP Norm Met incl, MHA* 0.62 0.53 0.46 0.38 0.31 0.57 0.50 0.43 0.34 0.26 0.38 0.38 Met 0.34 0.30 0.25 0.21 0.17 0.31 0.28 0.23 0.19 0.15 0.38 0.38 Cys 0.23 0.20 0.17 0.14 0.11 0.22 0.19 0.16 0.13 0.10 0.14 0.14 Lys 1.03 0.91 0.77 0.65 0.53 0.98 0.83 0.72 0.57 0.46 0.65 0.65 Thr 0.72 0.65 0.55 0.46 0.36 0.67 0.60 0.50 0.41 0.31 0.46 0.46 Trp 0.23 0.20 0.17 0.14 0.11 0.21 0.18 0.15 0.13 0.10 0.14 0.14 His 0.43 0.36 0.31 0.26 0.21 0.38 0.34 0.29 0.23 0.19 0.26 0.36 Phe 0.89 0.79 0.67 0.55 0.46 0.83 0.72 0.62 0.50 0.38 0.53 0.69 Tyr 0.69 0.60 0.53 0.43 0.34 0.65 0.55 0.48 0.38 0.31 0.43 0.43 Leu 1.68 1.46 1.27 1.05 0.83 1.58 1.37 1.15 0.93 0.74 0.95 1.20 Ile 0.77 0.67 0.57 0.48 0.38 0.72 0.62 0.53 0.43 0.34 0.41 0.62 Val 1.03 0.89 0.77 0.65 0.50 0.95 0.83 0.69 0.57 0.46 0.53 0.83 Arg 1.20 1.03 0.89 0.74 0.60 1.13 0.95 0.81 0.67 0.53 0.74 0.74 Gly 1.15 1.01 0.86 0.72 0.57 1.07 0.93 0.79 0.65 0.50 Ala 1.10 0.95 0.81 0.69 0.55 1.03 0.89 0.74 0.62 0.48 Ser 0.91 0.79 0.67 0.57 0.46 0.83 0.74 0.62 0.50 0.41 Asp 1.39 1.20 1.03 0.86 0.69 1.29 1.13 0.95 0.77 0.60 Glu 2.49 2.18 1.86 1.56 1.25 2.32 2.01 1.70 1.39 1.07 Pro 1.15 1.01 0.86 0.72 0.57 1.07 0.93 0.79 0.65 0.50 VIII International Scientific Congress in Fur Animal Production - ‘s-Hertogenbosch, The Netherlands, 15-18 September 2004 Table of Content Welfare and Ethics I Author Title Number Page Ahola Group housing may impair fur quality in raccoon dogs I – 4 4 Korhonen Comparison of hall and shed as housing environments for blue foxes I – 6 7 Mink welfare improved by combined implementation of several small Jeppesen initiatives I – 7 11 The anticipatory behaviours of mink expecting a positive or negative Hansen reward I – 8 19 Trapezov Have fur bearers become domesticated ? I – 9 24 Evaluation of comfort of fur-bearing animal keeping by analyzing Plotnikov behaviour I – 11 33 Trapezov Conflicts arise between minks of different behavioral types I – 12 36 Effect of coat color mutation in mink on the adrenal cortex function at Trapezov pelting time in siberian climate I – 13 42 Bespyatykh Young nutria behaviour in runs of different types I - 14 44 Health II Author Title Number Page Møller Management of health in mink, Møller (keynote) II – 1 50 Christensen A preliminary linkage map of the mink (Mustela vison) genome II – 2 58 Slugin Not diagnosed stage of aleutian disease. II – 3 61 Characteristics of some morphological and biochemical indices of Fedoseeva marmots bred in cages II – 5 65 A level of some indices of the oxidation state in blood plasma of mink at Bis-Wencel slaughter period under the definite maintenance and feeding conditions II – 6 68 Rouvinen- Watt Mink nursing sickness survey in North America II – 7 71 Hynes Body condition and glycemic control in mink females during reproduction and lactation II – 8 79 Clausen Wet kits in mink, a review II – 10 87 Domski Oral immunization of fur-bearing animals against salmonellosis II – 14 91 Nutrition III Author Title Number Page Polonen/ Sonderup/ A systematic approach to sustainable fur farming, with special reference to Koenen feed and feeding (keynote) III - 1 96 Influence of using enzymatic preparations: α-amylase, β-glucanase Brzozowski and xylanase on fur quality and nutrient digestibility in polar foxes III - 2 100 Different ratio between n-6 and n-3 fatty acids in diets for lactating mink (Mustela vison) dams – effect on milk and kit tissue fatty acid Hansen composition. III - 3 103 Physico-chemical properties of different carbohydrate sources in the gut of Laerke mink III - 4 110 Effect of lactic acid bacteria and β-glucanase treatments on the nutritive Valaja value of barley for growing blue fox III - 5 116 VIII International Scientific Congress in Fur Animal Production - ‘s-Hertogenbosch, The Netherlands, 15-18 September 2004 Nutrition III Author Title Number Page Sandbol Ideal Protein for Mink (Mustela vison) in the Growing and Furring Period. III – 6 120 Rouvinen- Effect of feeding intensity on body condition and glycemic control in mink Watt Mustela vison III – 7 129 The effect of ad libitum and restricted feeding on growth curves and Nielsen growth rate curves in mink selection lines III – 8 136 Leoschke Sodium BiSulfate As A Mink Feed Preservative III – 9 140 Gas-producing microorganisms in formic acid preserved poultry by- Ahlstrom products III – 10 142 Kulikov The importance of protein for young mink fed with dry feed III – 12 147 Kvartnikova Nourishing qualities of APK concentrate for minks, cubs III – 13 150 Individual ad libitum feeding of male + female pairs of mink kits during Møller the growth period increases feed intake, weight gain and feed efficiency III – 14 154 Effects of intensive fasting and methyl groups of feed on liver metabolism Nenonen and welfare in breeding blue fox (Alopex lagopus) vixens III - 15 159 The biochemical parameters in serum of mink fed high energy feedstuff Bis-Wencel with antioxidants and preservatives supplement. III – 16 165 Clausen Correlation between liver fat and dry matter in mink (Mustela vison) III – 17 168 Effects of feeding strategy on behaviour, physiological parameters and Damgaard feed residues in mink females III - 18 170 Regulation of lipid and glucose metabolism in the mink (Mustela vison) – Glover Sequence analysis and development of molecular probes III - 19 174 Hejlesen The effect of protein level on N-balance in adult mink (Mustela vison) III - 20 182 Bacterial protein produced on natural gas as a protein scource in dry diets Skrede for the growing-furring blue fox III - 21 188 Genetics and Reproduction IV Author Title Number Page Stochastic simulation of breeding schemes to improve economic genetic Hansen merit in mink production IV – 1 194 Johannessen Inbreeding in a commercial fur animal breeding programme IV – 2 201 Genetics of littersize, age at first insemination and animal size in blue fox Peura (Alopex lagopus) IV – 3 206 Diapause, implantation and placentation in the mink: A critical role for Murphy embryonic signaling. IV - 6 211 Nowakowicz- The effects of air pollutants on the cortisol and progesterone secretion in Debek polar fox (Alopex lagopus) IV - 7 218 The influence of antioxidant emicidin on minks’ physiological condition Sugrobova and reproduction IV - 8 222 The measurements of the skin electrical conductivity in the acupuncture points affecting reproduction in female polar foxes, Alopex lagopus, Sciesinski during the estrus period IV - 9 225 Farid Isolation of microsatellite markers for American mink (Mustela vison) IV - 10 228 Liter size, weaning success, and nursing mortality in chinchillas Felska (Chinchilla lanigera) in relation to cage illumination IV -11 234 Jakubczak Evaluation of pastel fox breeding results in Poland - body confirmation IV - 12 238 Jezewska Genetic variability of choosen conformation traits in chinchilla IV - 13 244 VIII International Scientific Congress in Fur Animal Production - ‘s-Hertogenbosch, The Netherlands, 15-18 September 2004 Genetics and Reproduction IV Author Title Number Page Genetic and phenotypic parameters of animal size and fur traits in Socha Common Silver Fox (Vulpes vulpes L.) IV - 14 248 Genetic parameters of size and fur quality Socha in a mink population (mustela vison sch.) IV - 15 251 Comparison of reproduction management intensity of three genetic lines of Sulik female chinchillas (Chinchilla lanigera M.) IV - 16 254 Morphological changes of spermatozoa in breeding Raccoon dogs semen Szeleszczuk during cryopreservetion IV - 17 259 Induction of estrus and ovulation in breeding chinchilla by GnRh Szeleszczuk analogues IV - 18 263 Growth parameters and organ size of American marten (Martes americana) Collins born in captivity IV - 19 266 Fur Properties V Author Title Number Page The influence of pelting time on pelt characteristics in blue fox (Alopex Blomstedt lagopus) V - 2 272 Population genetics and registration of fox pelts in warehouses.
Load more

Recommended publications
  • Microbial Community Structure Dynamics in Ohio River Sediments During Reductive Dechlorination of Pcbs
    University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2008 MICROBIAL COMMUNITY STRUCTURE DYNAMICS IN OHIO RIVER SEDIMENTS DURING REDUCTIVE DECHLORINATION OF PCBS Andres Enrique Nunez University of Kentucky Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Nunez, Andres Enrique, "MICROBIAL COMMUNITY STRUCTURE DYNAMICS IN OHIO RIVER SEDIMENTS DURING REDUCTIVE DECHLORINATION OF PCBS" (2008). University of Kentucky Doctoral Dissertations. 679. https://uknowledge.uky.edu/gradschool_diss/679 This Dissertation is brought to you for free and open access by the Graduate School at UKnowledge. It has been accepted for inclusion in University of Kentucky Doctoral Dissertations by an authorized administrator of UKnowledge. For more information, please contact [email protected]. ABSTRACT OF DISSERTATION Andres Enrique Nunez The Graduate School University of Kentucky 2008 MICROBIAL COMMUNITY STRUCTURE DYNAMICS IN OHIO RIVER SEDIMENTS DURING REDUCTIVE DECHLORINATION OF PCBS ABSTRACT OF DISSERTATION A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Agriculture at the University of Kentucky By Andres Enrique Nunez Director: Dr. Elisa M. D’Angelo Lexington, KY 2008 Copyright © Andres Enrique Nunez 2008 ABSTRACT OF DISSERTATION MICROBIAL COMMUNITY STRUCTURE DYNAMICS IN OHIO RIVER SEDIMENTS DURING REDUCTIVE DECHLORINATION OF PCBS The entire stretch of the Ohio River is under fish consumption advisories due to contamination with polychlorinated biphenyls (PCBs). In this study, natural attenuation and biostimulation of PCBs and microbial communities responsible for PCB transformations were investigated in Ohio River sediments. Natural attenuation of PCBs was negligible in sediments, which was likely attributed to low temperature conditions during most of the year, as well as low amounts of available nitrogen, phosphorus, and organic carbon.
    [Show full text]
  • Bordetella Trematum Infection: Case Report and Review of Previous Cases
    y Castro et al. BMC Infectious Diseases (2019) 19:485 https://doi.org/10.1186/s12879-019-4046-8 CASEREPORT Open Access Bordetella trematum infection: case report and review of previous cases Thaís Regina y Castro1, Roberta Cristina Ruedas Martins2, Nara Lúcia Frasson Dal Forno3, Luciana Santana4, Flávia Rossi4, Alexandre Vargas Schwarzbold1, Silvia Figueiredo Costa2 and Priscila de Arruda Trindade1,5* Abstract Background: Bordetella trematum is an infrequent Gram-negative coccobacillus, with a reservoir, pathogenesis, a life cycle and a virulence level which has been poorly elucidated and understood. Related information is scarce due to the low frequency of isolates, so it is important to add data to the literature about this microorganism. Case presentation: We report a case of a 74-year-old female, who was referred to the hospital, presenting with ulcer and necrosis in both legs. Therapy with piperacillin-tazobactam was started and peripheral artery revascularization was performed. During the surgery, a tissue fragment was collected, where Bordetella trematum, Stenotrophomonas maltophilia, and Enterococcus faecalis were isolated. After surgery, the intubated patient was transferred to the intensive care unit (ICU), using vasoactive drugs through a central venous catheter. Piperacillin- tazobactam was replaced by meropenem, with vancomycin prescribed for 14 days. Four days later, levofloxacin was added for 24 days, aiming at the isolation of S. maltophilia from the ulcer tissue. The necrotic ulcers evolved without further complications, and the patient’s clinical condition improved, leading to temporary withdrawal of vasoactive drugs and extubation. Ultimately, however, the patient’s general condition worsened, and she died 58 days after hospital admission.
    [Show full text]
  • Structural and Functional Effects of Bordetella Avium Infection in the Turkey Respiratory Tract William George Van Alstine Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1987 Structural and functional effects of Bordetella avium infection in the turkey respiratory tract William George Van Alstine Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Animal Sciences Commons, and the Veterinary Medicine Commons Recommended Citation Van Alstine, William George, "Structural and functional effects of Bordetella avium infection in the turkey respiratory tract " (1987). Retrospective Theses and Dissertations. 11655. https://lib.dr.iastate.edu/rtd/11655 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS While the most advanced technology has been used to photograph and reproduce this manuscript, the quality of the reproduction is heavily dependent upon the quality of the material submitted. For example: • Manuscript pages may have indistinct print. In such cases, the best available copy has been filmed. • Manuscripts may not always be complete. In such cases, a note will indicate that it is not possible to obtain missing pages. • Copyrighted material may have been removed from the manuscript. In such cases, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, and charts) are photographed by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.
    [Show full text]
  • Unveiling Bacterial Interactions Through Multidimensional Scaling and Dynamics Modeling Received: 06 May 2015 Pedro Dorado-Morales1, Cristina Vilanova1, Carlos P
    www.nature.com/scientificreports OPEN Unveiling Bacterial Interactions through Multidimensional Scaling and Dynamics Modeling Received: 06 May 2015 Pedro Dorado-Morales1, Cristina Vilanova1, Carlos P. Garay3, Jose Manuel Martí3 Accepted: 17 November 2015 & Manuel Porcar1,2 Published: 16 December 2015 We propose a new strategy to identify and visualize bacterial consortia by conducting replicated culturing of environmental samples coupled with high-throughput sequencing and multidimensional scaling analysis, followed by identification of bacteria-bacteria correlations and interactions. We conducted a proof of concept assay with pine-tree resin-based media in ten replicates, which allowed detecting and visualizing dynamical bacterial associations in the form of statistically significant and yet biologically relevant bacterial consortia. There is a growing interest on disentangling the complexity of microbial interactions in order to both optimize reactions performed by natural consortia and to pave the way towards the development of synthetic consor- tia with improved biotechnological properties1,2. Despite the enormous amount of metagenomic data on both natural and artificial microbial ecosystems, bacterial consortia are not necessarily deduced from those data. In fact, the flexibility of the bacterial interactions, the lack of replicated assays and/or biases associated with differ- ent DNA isolation technologies and taxonomic bioinformatics tools hamper the clear identification of bacterial consortia. We propose here a holistic approach aiming at identifying bacterial interactions in laboratory-selected microbial complex cultures. The method requires multi-replicated taxonomic data on independent subcultures, and high-throughput sequencing-based taxonomic data. From this data matrix, randomness of replicates can be verified, linear correlations can be visualized and interactions can emerge from statistical correlations.
    [Show full text]
  • Transfer of Several Phytopathogenic Pseudomonas Species to Acidovorax As Acidovorax Avenae Subsp
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Jan. 1992, p. 107-119 Vol. 42, No. 1 0020-7713/92/010107-13$02 .OO/O Copyright 0 1992, International Union of Microbiological Societies Transfer of Several Phytopathogenic Pseudomonas Species to Acidovorax as Acidovorax avenae subsp. avenae subsp. nov., comb. nov. , Acidovorax avenae subsp. citrulli, Acidovorax avenae subsp. cattleyae, and Acidovorax konjaci A. WILLEMS,? M. GOOR, S. THIELEMANS, M. GILLIS,” K. KERSTERS, AND J. DE LEY Laboratorium voor Microbiologie en microbiele Genetica, Rijksuniversiteit Gent, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium DNA-rRNA hybridizations, DNA-DNA hybridizations, polyacrylamide gel electrophoresis of whole-cell proteins, and a numerical analysis of carbon assimilation tests were carried out to determine the relationships among the phylogenetically misnamed phytopathogenic taxa Pseudomonas avenue, Pseudomonas rubrilineans, “Pseudomonas setariae, ” Pseudomonas cattleyae, Pseudomonas pseudoalcaligenes subsp. citrulli, and Pseudo- monas pseudoalcaligenes subsp. konjaci. These organisms are all members of the family Comamonadaceae, within which they constitute a separate rRNA branch. Only P. pseudoalcaligenes subsp. konjaci is situated on the lower part of this rRNA branch; all of the other taxa cluster very closely around the type strain of P. avenue. When they are compared phenotypically, all of the members of this rRNA branch can be differentiated from each other, and they are, as a group, most closely related to the genus Acidovorax. DNA-DNA hybridization experiments showed that these organisms constitute two genotypic groups. We propose that the generically misnamed phytopathogenic Pseudomonas species should be transferred to the genus Acidovorax as Acidovorax avenue and Acidovorax konjaci. Within Acidovorax avenue we distinguished the following three subspecies: Acidovorax avenue subsp.
    [Show full text]
  • Physiological and Genomic Features of Highly Alkaliphilic Hydrogen-Utilizing Betaproteobacteria from a Continental Serpentinizing Site
    ARTICLE Received 17 Dec 2013 | Accepted 16 Apr 2014 | Published 21 May 2014 DOI: 10.1038/ncomms4900 OPEN Physiological and genomic features of highly alkaliphilic hydrogen-utilizing Betaproteobacteria from a continental serpentinizing site Shino Suzuki1, J. Gijs Kuenen2,3, Kira Schipper1,3, Suzanne van der Velde2,3, Shun’ichi Ishii1, Angela Wu1, Dimitry Y. Sorokin3,4, Aaron Tenney1, XianYing Meng5, Penny L. Morrill6, Yoichi Kamagata5, Gerard Muyzer3,7 & Kenneth H. Nealson1,2 Serpentinization, or the aqueous alteration of ultramafic rocks, results in challenging environments for life in continental sites due to the combination of extremely high pH, low salinity and lack of obvious electron acceptors and carbon sources. Nevertheless, certain Betaproteobacteria have been frequently observed in such environments. Here we describe physiological and genomic features of three related Betaproteobacterial strains isolated from highly alkaline (pH 11.6) serpentinizing springs at The Cedars, California. All three strains are obligate alkaliphiles with an optimum for growth at pH 11 and are capable of autotrophic growth with hydrogen, calcium carbonate and oxygen. The three strains exhibit differences, however, regarding the utilization of organic carbon and electron acceptors. Their global distribution and physiological, genomic and transcriptomic characteristics indicate that the strains are adapted to the alkaline and calcium-rich environments represented by the terrestrial serpentinizing ecosystems. We propose placing these strains in a new genus ‘Serpentinomonas’. 1 J. Craig Venter Institute, 4120 Torrey Pines Road, La Jolla, California 92037, USA. 2 University of Southern California, 835 W. 37th St. SHS 560, Los Angeles, California 90089, USA. 3 Delft University of Technology, Julianalaan 67, Delft, 2628BC, The Netherlands.
    [Show full text]
  • Emended Descriptions of the Genus Alcaligenes and of Alcaligenes
    INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY Vol. 24, No. 4 Oct. 1974, p. 534-550 Printed in U.S.A. Copyright 0 1914 International Association of Microbiological Societies Emended Descriptions of the Genus Alcaligenes and of Alcaligenes faecalis and Proposal That tfie Generic Name Achromobacter be Rejected: Status of the Named Species of Alcaligenes and A c h romo bac ter Request for an Opinion MARGARET S. HENDRIE, A. J. HOLDING, and J. M. SHEWAN Torry Research Station, Aberdeen, Scotland, United Kingdom, and Department of Microbiology, University of' Edinburgh, Scotland, United Kingdom The descriptions of the genus Alcaligenes Castellani and Chalmers and Alcaligenes faecalis Castellani and Chalmers have been emended. It is requested that the Judicial Commission issue an Opinion rejecting the name Achromobacter Bergey et al. as a nomen dubium. It is proposed, on the basis of a comparison of type and reference strains, that Alcaligenes denitrificans Leifson and Hugh, Achromobacter arsenoxy- dans-tres Turner, and Alcaligenes odorans (Mhlek and Kazdovii-KoiiSkovii) MBlek et al. be considered as subjective synonyms of A.faecalis. The proposed taxonomic status of all known previously described species of the genera Alcaligenes and Achromobacter is indicated in appendixes. Emendation of description of the genus Aha- Rods or coccoid cells, 0.5 to.0.6 by 1.2 to 2.6 ligenes Castellani and Chalmers. Extensive stud- gm, usually occurring singly. Motile by means of ies on the morphology and physiology of the one to four (occasionally up to eight) flagella; the gram-negative asporogenous rods have been un- flagella may be degenerate. Cells are peritrichous.
    [Show full text]
  • Emended Descriptions of the Genus Alcaligenes and of Alcaligenes
    INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY Vol. 24, No. 4 Oct. 1974, p. 534-550 Printed in U.S.A. Copyright 0 1914 International Association of Microbiological Societies Emended Descriptions of the Genus Alcaligenes and of Alcaligenes faecalis and Proposal That tfie Generic Name Achromobacter be Rejected: Status of the Named Species of Alcaligenes and A c h romo bac ter Request for an Opinion MARGARET S. HENDRIE, A. J. HOLDING, and J. M. SHEWAN Torry Research Station, Aberdeen, Scotland, United Kingdom, and Department of Microbiology, University of' Edinburgh, Scotland, United Kingdom The descriptions of the genus Alcaligenes Castellani and Chalmers and Alcaligenes faecalis Castellani and Chalmers have been emended. It is requested that the Judicial Commission issue an Opinion rejecting the name Achromobacter Bergey et al. as a nomen dubium. It is proposed, on the basis of a comparison of type and reference strains, that Alcaligenes denitrificans Leifson and Hugh, Achromobacter arsenoxy- dans-tres Turner, and Alcaligenes odorans (Mhlek and Kazdovii-KoiiSkovii) MBlek et al. be considered as subjective synonyms of A.faecalis. The proposed taxonomic status of all known previously described species of the genera Alcaligenes and Achromobacter is indicated in appendixes. Emendation of description of the genus Aha- Rods or coccoid cells, 0.5 to.0.6 by 1.2 to 2.6 ligenes Castellani and Chalmers. Extensive stud- gm, usually occurring singly. Motile by means of ies on the morphology and physiology of the one to four (occasionally up to eight) flagella; the gram-negative asporogenous rods have been un- flagella may be degenerate. Cells are peritrichous.
    [Show full text]
  • Table S1 List of the Group Specific Probes
    Table S1 List of the group specific probes. Probe Sequence (5’ – 3’) Target References EUB338 GCTGCCTCCCGTAGGAGT EUB338 II GCAGCCACCCGTAGGTGT Bacteria [1][2] EUB338 III GCTGCCACCCGTAGGTGT Delta495a AGTTAGCCGGTGCTTCTT Delta495b AGTTAGCCGGCGCTTCCT Deltaproteobacteria [3,4] Delta495c AATTAGCCGGTGCTTCCT Lgc354a TGGAAGATTCCCTACTGC Firmicutes (Gram+ Lgc354b CGGAAGATTCCCTACTGC bacteria with low GC [5] Lgc354c CCGAAGATTCCCTACTGC content) Chloroflexi (green Gnsb941 AAACCACACGCTCCGCT [6] nonsulfur bacteria) Alphaproteobacteria Alf968 GGTAAGGTTCTGCGCGTT [7] (except Rickettsiales) Bet42a GCCTTCCCACTTCGTTT Betaproteobacteria [8] Gam2a GCCTTCCCACATCGTTT Gammaproteobacteria [8] Actinobacteria (high GC Hgc69a TATAGTTACCACCGCCGT [9] Gram+ bacteria) Pla46 GACTTGCATGCCTAATCC Planctomycetales [10] Flavobacteria, Cf319a TGGTCCGTGTCTCAGTAC Bacteroidetes, [11] Sphingobacteria Arc915 GTGCTCCCCCGCCAATTCCT Archaea [12] TM7905 CCGTCAATTCCTTTATGTTTTA Candidate division TM7 [13] DF988* GATACGACGCCCATGTCAAGGG Defluvicoccus [14] DF1020* CCGGCCGAACCGACTCCC TFO-DF218 GAAGCCTTTGCCCCTCAG Defluvicoccus related [15] TFO-DF618 GCCTCACTTGTCTAACCG TFO SBR9-1a AAGCGCAAGTTCCCAGGTTG Sphingomonas [16] THAU646 TCTGCCGTACTCTAGCCTT Thauera sp. [17] AZO644 GCCGTACTCTAGCCGTGC Azoarcus sp. [18] PAR651 ACCTCTCTCGAACTCCAG Paracoccus [19] AMAR839 CCGAACGGCAAGCCACAGCGTC Amaricoccus sp. [20] ACI145 TTTCGCTTCGTTATCCCC Acidovorax spp. [21] Table S2 Primers used in PCR and Sequencing. Primers Sequence (5’ – 3’) PCR 27f AGAGTTTGATCMTGGCTCAG 1492r TACGGYTACCTTGTTACGACTT T7f TAATACGACTCACTATAGGG
    [Show full text]
  • Alcaligenes Faecalis: Identification and Study of Its Antagonistic Properties Against Botrytis Cinerea
    Alcaligenes faecalis: Identification and study of its antagonistic properties against Botrytis cinerea by Dagoberto Rodriguez Gonzalez, B. Sc. A Thesis submitted to the Department of Biological Sciences in partial fulfillment of the requirements for the degree of Master of Science October, 1998 Brock University St. Catharines, Ontario Canada © Dagoberto Rodriguez Gonzalez, 1998 2 Abstract A Gram negative aerobic flagellated bacterium with fungal growth inhibitory properties was isolated from a culture of Trichoderma harzianum. According to its cultural characteristics and biochemical properties it was identified as a strain of Alcaligenes (aeca/is Castellani and Chalmers. Antisera prepared in Balbc mice injected with live and heat-killed bacterial cells gave strong reactions with the homologous immunogen and with ATCC 15554, the type strain of A. taeca/is, but not with Escherichia coli or Enterobacter aerogens in immunoprecipitation and dot immunobinding assays. Growth of Botrytis cinerea Pers. and several other fungi was significantly affected when co-cultured with A. taeca/is on solid media. Its detrimental effect on germination and growth of B. cinerea has been found to be associated with antifungal substances produced by the bacterium and released into the growth medium. A biotest for the antibiotic substances, based on their inhibitory effect on germination of B. cinerea conidia, was developed. This biotest was used to study the properties of these substances, the conditions in which they are produced, and to monitor the steps of their separation during extraction procedures. It has been found that at least two substances could be involved in the antagonistic interaction. One of these is a basic volatile substance and has been identified as ammonia.
    [Show full text]
  • Identification of Pseudomonas Species and Other Non-Glucose Fermenters
    UK Standards for Microbiology Investigations Identification of Pseudomonas species and other Non- Glucose Fermenters Issued by the Standards Unit, Microbiology Services, PHE Bacteriology – Identification | ID 17 | Issue no: 3 | Issue date: 13.04.15 | Page: 1 of 41 © Crown copyright 2015 Identification of Pseudomonas species and other Non-Glucose Fermenters Acknowledgments UK Standards for Microbiology Investigations (SMIs) are developed under the auspices of Public Health England (PHE) working in partnership with the National Health Service (NHS), Public Health Wales and with the professional organisations whose logos are displayed below and listed on the website https://www.gov.uk/uk- standards-for-microbiology-investigations-smi-quality-and-consistency-in-clinical- laboratories. SMIs are developed, reviewed and revised by various working groups which are overseen by a steering committee (see https://www.gov.uk/government/groups/standards-for-microbiology-investigations- steering-committee). The contributions of many individuals in clinical, specialist and reference laboratories who have provided information and comments during the development of this document are acknowledged. We are grateful to the Medical Editors for editing the medical content. For further information please contact us at: Standards Unit Microbiology Services Public Health England 61 Colindale Avenue London NW9 5EQ E-mail: [email protected] Website: https://www.gov.uk/uk-standards-for-microbiology-investigations-smi-quality- and-consistency-in-clinical-laboratories
    [Show full text]
  • The Effect of Alcaligenes Faecalis on Inhibition of Candida Albicans Biofilm and Planktonic Growth
    East Tennessee State University Digital Commons @ East Tennessee State University Undergraduate Honors Theses Student Works 5-2020 The Effect of Alcaligenes faecalis on Inhibition of Candida albicans Biofilm and Planktonic Growth Nausheen A. Siddiqui East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/honors Part of the Bacteria Commons, and the Fungi Commons Recommended Citation Siddiqui, Nausheen A., "The Effect of Alcaligenes faecalis on Inhibition of Candida albicans Biofilm and Planktonic Growth" (2020). Undergraduate Honors Theses. Paper 575. https://dc.etsu.edu/honors/575 This Honors Thesis - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Undergraduate Honors Theses by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. The Effect of Alcaligenes faecalis on Candida albicans Biofilm and Planktonic Growth Inhibition by Nausheen Siddiqui An Undergraduate Thesis Submitted in Partial Fulfillment of the Requirements for the Honors In Discipline Health Sciences Program Department of Health Sciences College of Public Health East Tennessee State University ___________________________________________ Nausheen A. Siddiqui Date ___________________________________________Sean James Fox 4/20/2020 Dr. Sean Fox, Thesis Mentor Date Laraine Powers 4/20/2020 ___________________________________________ Dr. Laraine Powers, Reader Date ___________________________________________4/20/2020 Dr. Lindsey King, Reader Date 1 Abstract Candida albicans is a fungal microorganism commonly found on the normal flora of the human body and the environment. An opportunistic pathogen causing local and systemic infection, this fungus is one of the leading causes of nosocomial infections through contamination of inserted medical devices.
    [Show full text]