A Revised Model of Xenopus Dorsal Midline Development: Differential and Separable Requirements for Notch and Shh Signaling

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Developmental Biology 352 (2011) 254–266

Contents lists available at ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/developmentalbiology

A revised model of Xenopus dorsal midline development: Differential and separable requirements for Notch and Shh signaling

Sara M. Peyrot a,b,1, John B. Wallingford a,b,c, Richard M. Harland a,⁎

a Dept. of Molecular and Cell Biology and Center for Integrative Genomics, University of California, Berkeley, CA 94720, USA b Dept. of Molecular Cell and Developmental Biology, University of Texas, Austin, TX 78712, USA c Howard Hughes Medical Institute, USA

article info abstract

Article history: The development of the vertebrate dorsal midline (floor plate, notochord, and hypochord) has been an area of Received for publication 8 November 2010 classical research and debate. Previous studies in vertebrates have led to contrasting models for the roles of Revised 18 January 2011 Shh and Notch signaling in specification of the floor plate, by late inductive or early allocation mechanisms, Accepted 19 January 2011 respectively. Here, we show that Notch signaling plays an integral role in cell fate decisions in the dorsal Available online 27 January 2011 midline of Xenopus laevis, similar to that observed in zebrafish and chick. Notch signaling promotes floor plate and hypochord fates over notochord, but has variable effects on Shh expression in the midline. In contrast to Keywords: fi fl Floor plate previous reports in frog, we nd that Shh signaling is not required for oor plate vs. notochord decisions and Notochord plays a minor role in floor plate specification, where it acts in parallel to Notch signaling. As in zebrafish, Shh Hypochord signaling is required for specification of the lateral floor plate in the frog. We also find that the medial floor Dorsal midline plate in Xenopus comprises two distinct populations of cells, each dependent upon different signals for its Notch specification. Using expression analysis of several midline markers, and dissection of functional relationships, Shh we propose a revised allocation mechanism of dorsal midline specification in Xenopus. Our model is distinct from those proposed to date, and may serve as a guide for future studies in frog and other vertebrate organisms. © 2011 Elsevier Inc. All rights reserved.

Introduction et al., 2000; Strahle et al., 2004). The “induction” model, based on classical embryology experiments in chick and mutant phenotypes in The floor plate (FP) is a specialized population of cells in the mouse, states that Shh secreted by the notochord induces the ventral portion of the vertebrate neural tube, morphologically and formation of the FP in the overlying naïve neurectoderm (Artinger molecularly distinct from other regions of the central nervous system and Bronner-Fraser, 1993; Marti et al., 1995; Placzek et al., 2000, (Kingsbury, 1940; McKanna, 1993). FP cells do not give rise to neurons 1993, 1990b; Roelink et al., 1995; Yamada et al., 1991). However, the and adopt a wedge-shaped morphology. The FP expresses Shh and finding that all midline structures—notochord, FP, and dorsal FoxA2 and has signaling activities crucial to neural development endoderm—arise at the same time from the organizer in chick (Placzek et al., 1990a,b; Tessier-Lavigne et al., 1988). The FP specifies indicated that the FP was pre-determined prior to notochord signals, the identity of neurons along the dorsoventral axis of the spinal cord, and gave rise to the “allocation” model (Catala et al., 1996, 1995; an activity mediated by the secreted morphogen Sonic Hedgehog Teillet et al., 1998). (Shh) (Briscoe and Ericson, 2001; Yamada et al., 1993). In addition, A “revised allocation” model has been proposed for zebrafish Netrin and F-spondin, two chemoattractants secreted by the FP, (Odenthal et al., 2000) and supported in chick (Charrier et al., 2002). function along with Shh to direct commissural axonal guidance In zebrafish, the FP consists of two distinct populations, medial (MFP) (Charron et al., 2003; Klar et al., 1992; Serafini et al., 1996). and lateral (LFP), which are Shh-independent and Shh-dependent, Given the critical role of the FP in neural development, it is respectively (Etheridge et al., 2001; Odenthal and Nusslein-Volhard, important to understand how the FP is specified. Several models have 1998; Odenthal et al., 2000; Schauerte et al., 1998). The MFP is been proposed for the development of the FP, as a result of work in allocated from a midline precursor cell population, which also gives different model systems (Le Douarin and Halpern, 2000; Placzek rise to the notochord and dorsal endoderm (hypochord in non- amniotes); Nodal, Notch, and midkine signaling have been implicated in MFP specification (Appel et al., 1999, 2001; Gritsman et al., 1999; ⁎ Corresponding author at: 571 Life Sciences Addition #3200, University of California, Hatta et al., 1991; Muller et al., 2000; Rebagliati et al., 1998; Sampath Berkeley, CA 94720, USA. Fax: +1 510 643 6791. et al., 1998; Schafer et al., 2005b; Strahle et al., 1997; Tian et al., 2003). E-mail address: [email protected] (R.M. Harland). 1 Present address: Dept. of Biochemistry, Stanford University, Stanford, CA 94305, The LFP is then induced by Shh secreted from the notochord and MFP USA. (Odenthal et al., 2000).

Despite the long-standing interest in FP development and extensive (Gene Tools, LLC), microinjections (10 nL) were performed bilaterally examination in several animals, comparatively little attention has been at the 2-cell stage, with 4 ng fluoresceinated standard control paid to this process in Xenopus. Early overexpression experiments morpholino plus Shh morpholinos as follows: Shh splice MO (5′ indicated that induction mechanisms can operate in Xenopus, as Shh and CACGTATGGCCGTACCTGAGTCATG 3′) 75 ng, and Shh ATG MO (5′ FoxA2 can induce other FP markers such as F-spondin (Roelink et al., ATCTCGTCCGAGCGAAGCCAATTAC 3′) 50 ng per injection. Synthetic 1994; Ruiz i Altaba et al., 1995), but notably in a temporally and spatially capped mRNAs were produced with the Ambion mMessage machine restricted manner unlike endogenous FP development. Importantly, no kit. An alternate expression construct for Shh was made by cloning the loss-of-function experiments had been conducted to determine HindIII/Spe1 insert of X-Shh T7TS (Ekker et al., 1995) into CS2+. This whether Shh signaling is required for FP specification in the frog until construct (CS2+Shh), as well as CS2-NLS-MT-NICD and CS2-Xsu(H) recently. Thus, the induction model of FP specification has not been DBM, gifts of Dr. C. Kintner (Wettstein et al., 1997), and CS2+ rigorously tested in Xenopus. memEGFP and CS2+βgal, gifts of Dr. D. Turner, were linearized with Because the sheet-like gastrulation movements in frog appear so Not1 and transcribed with SP6. To target the dorsal midline, mRNA different from ingression at the node/shield in chick, mouse, and (10 nL) was injected equatorially into both dorsal blastomeres at the zebrafish, we decided to investigate whether “allocation” mechanisms 4-cell stage, on either side of the cleavage plane. Embryos were operate in Xenopus FP development. Classical transplantation experi- screened by epifluorescence (eGFP) at stage 10 for correct targeting ments by Spemann and Mangold (1924),aswellasmorerecentlineage and some were stained for lacZ to lineage trace injected cells. Total analysis (Bauer et al., 1994; Dale and Slack, 1987; Keller, 1975, 1976), embryo doses are as follows: NICD and SDBM, 1 ng; Shh, 400 pg; β-gal show that the organizer gives rise to dorsal midline structures. This and eGFP, 200 pg. demonstrates the existence of a midline precursor cell (MPC) population in the frog, and therefore the cell lineage aspect of the Cyclopamine treatment allocation model. However, little functional analysis has been performed to ascertain what signaling pathways influence the allocation of these A stock solution of cyclopamine (LC Laboratories) was made at cells to midline tissues. Because Notch signaling regulates cell fate 10 mM in 100% ethanol and diluted to 100 μMin1/3×MRforembryo choices in the midline in zebrafish (Appel et al., 1999) and chick, (Gray treatment. Embryos at stage 8–9 were transferred to 1/3× MR+100 μM and Dale, 2010), we initially chose to focus on this pathway to test the cyclopamine or 1/3× MR with an equivalent volume of ethanol (solvent) allocation model in frog. Previous findings on Notch in Xenopus midline as a control and allowed to develop to the desired stage, then fixed in development (Lopez et al., 2003, 2005) mostly conform to the allocation MEMFA. model proposed by original work on the zebrafish deltaA mutant, indicating a high degree of conservation in this process. However, these RT-PCR results in frog do not agree with more recent experiments in zebrafish, which indicate that Notch signaling plays a minor role in FP Whole embryos were lysed and RNA isolated and reverse- development (Latimer and Appel, 2006; Schafer et al., 2007). transcribed by standard methods (Wills et al., 2009). RNA was Given the amphibians' close evolutionary relationship with prepared from 3 individual embryos for each treatment, then pooled amniotes, the paucity of data concerning the mechanism of FP for RT and PCR. For semi-quantitative PCR, PCR was performed with specification in these animals, and recent discrepancies between trace [α-32P] dCTP, with primers and conditions as follows: zebrafish and frog on the role of Notch signaling in the midline, we Shh-splice (fwd) 5′ AGCGGCAGATACGAAGGAAAG have reexamined midline development in Xenopus.Wehaveusedboth (rev) 5′ TCCCCTCATAATGTAGCGACTCC, 57 °C anneal, 25 gain- and loss-of-function approaches, and examined both early and cycles definitive markers of FP and notochord. We found that the Notch EF1α (fwd) 5′ CAGATTGGTGCTGGATATGC pathway promotes formation of FP at the expense of notochord, as (rev) 5′ ACTGCCTTGATGACTCCTAG, 55° anneal, 21 cycles. reported (Lopez et al., 2003, 2005), and that Notch signaling plays a major role in hypochord development in the frog, consistent with data PCR samples were resolved on polyacrylamide gels and exposed to from the zebrafish (Appel et al., 1999; Latimer and Appel, 2006; Latimer film. et al., 2002). Surprisingly, we find that Shh signaling is not downstream of Notch as previously suggested (Lopez et al., 2003, 2005). Rather, Shh Whole mount in situ hybridization, immunohistochemistry, and sectioning acts in parallel to Notch to contribute modestly to FP specification and has no role in hypochord or notochord specification. Finally, through Embryos were fixed in MEMFA for 2 h at room temperature or examination of several gene expression patterns over time, we find overnight at 4 °C for in situ hybridization (Sive et al., 2000). For lacZ unexpected complexity in the development of the Xenopus floor plate. staining, embryos were fixed for 30 min in MEMFA, rinsed in Ptw (1× We identify an Nkx2.2+ LFP as observed in other animals, but we also PBS, 0.1% Tween20), and incubated in lacZ staining solution (5 mM identify spatially, temporally, and molecularly distinct cell populations ferricyanide, 5 mM ferrocyanide, 2 mM MgCl2, 1 mg/ml X-gal or Red-gal in the Xenopus MFP. Early MFP cells develop independent of Notch (Research Organics) in PTw) until the desired color was achieved, then signaling and express Shh, while specification of a later population of fixed as above for in situ hybridization. Fixed embryos were dehydrated Netrin-expressing MFP cells is Notch-dependent. We have interpreted in methanol and stored at −20 °C for further processing. In situ our results in the context of the revised allocation model of MFP and LFP hybridization was performed in baskets as described (Sive et al., 2000) specification and current research on the roles of Notch and Shh with probes at 1 μg/mL. Plasmids were linearized and transcribed as signaling in the development of these structures. We propose a new follows: AXPC (Kim et al., 1998) Not1, T7; chordin (Sasai et al., 1994) model for midline specification in Xenopus that may serve as a paradigm EcoR1, T7; FoxA4b (Dirksen and Jamrich, 1992) BamH1, T7; FoxA4a (Ruiz for further experimentation in other vertebrates. i Altaba and Jessell, 1992) Not1, T7; FoxA1b (Bolce et al., 1993)EcoR1,T3; FoxD5a (Solter et al., 1999) Sma1, T7; F-spondin (Klar et al., 1992)Sal1, Materials and methods T7; FoxA2 (IMAGE clone 8319281) Xma, T7; Netrin (de la Torre et al., 1997) Xho1, T3; Nkx2.2(Saha et al., 1993) Not1, T7; Ptc2 (Takabatake General methods and microinjection et al., 2000) Not1, T7; Shh (Ruiz i Altaba et al., 1995) Not1, T3; VEGF (Cleaver et al., 1997)BamH1,T7;Xbra (Smith et al., 1991) XhoI, SP6; Xenopus laevis embryos were generated, microinjected, and XencR1 (Haigo et al., 2003) BamH1, T7; and Xnot (von Dassow et al., cultured by standard methods (Sive et al., 2000). For morpholinos 1993), HindIII, T7. Templates were transcribed as described (Sive et al., 256 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266

2000) using trace [α-32P]UTP for quantification of yield. In cases where Results both in situ hybridization and immunohistochemistry were carried out on embryos, in situ hybridization was performed first, followed by Notch signaling promotes formation of both floor plate and hypochord at immunohistochemistry. the expense of notochord Antibody washes and incubations (4 °C overnight) used PBT (PBS+ 0.1% Triton-X-100+2 mg/mL BSA). Embryos were blocked in PBT+10% The zebrafish deltaA mutant has increased notochord and decreased goat serum at least 1 h at room temperature, then incubated with Tor70 floor plate (FP) and hypochord development (Appel et al., 1999). at 1:5 and goat anti-mouse IgM-HRP 2° Ab (Jackson ImmunoResearch) Previous reports in Xenopus have shown that Notch signaling regulates at 1:200 for the notochord; the myc epitope was stained with 9E10 at cell fate choices between the FP and notochord during gastrulation, 1:5 and goat anti-mouse IgG-HRP 2° Ab (Jackson ImmunoResearch) at affecting the early notochord marker chordin and the early midline 1:200. To aid in visualization of staining, some embryos were bisected markers shh and FoxA4a (Lopez et al., 2003). Here, we targeted with a razor blade prior to or following lacZ staining and in situ injections to the entire dorsal midline (see Materials and methods), hybridization. Except for Figs. 1D–F and S3, all neurula and older and subsequently examined definitive markers of FP, notochord, and embryos were bleached in dilute hydrogen peroxide (1%) and tailbud hypochord fates. We manipulated Notch signaling with proven Xenopus embryos were cleared with benzyl benzoate/benzyl alcohol (2:1) after reagents—mRNAs encoding the constitutively active intracellular thorough dehydration in methanol. For sectioning, processed embryos domain of Notch (NICD) and the dominant-negative, DNA-binding were embedded in 4% low melt agarose and sectioned at 50–100 μm mutant of Supressor-of-Hairless (SDBM) (Wettstein et al., 1997), which using a vibratome (Oxford). activate and block Notch signaling, respectively (Artavanis-Tsakonas et al., 1999; Mumm and Kopan, 2000; Wettstein et al., 1997). Blockade of Notch signaling resulted in embryos with greatly reduced or absent mature FP. This was evidenced by loss of functional FP markers such as Netrin (Fig. 1B) and F-spondin (Fig. 1H), two molecules necessary for proper commissural axon migration (Klar et al., 1992; Serafini et al., 1996), and FoxA2 (Fig. 1K), a hallmark FP marker (Ruiz i Altaba et al., 1993). Upon activation of Notch signaling, we saw a drastic increase in Netrin (Fig. 1C), F-spondin (Fig. 1I), and FoxA2 (Fig. 1L), with concomitant loss of the differentiated notochord, assayed by markers Axial Protocadherin (AxPC, Fig. 1F) (Kuroda et al., 2002), Tor70 (Figs. 1I, L, O), and Xbrachyury (Fig. 4I). The amount of notochord tissue formed in NICD embryos is variable (compare Figs. 1I, L to F, O), due to variable distribution/amount of the injected RNA (Fig. S1), but in all cases NICD protein is excluded from the notochord (Fig. S1). In SDBM embryos, we did not observe robust or reproducible expansion of notochord size (Figs. 1E, H, K, N and Xbra, data not shown). This is likely due to the relatively large number of cells in the notochord relative to both FP and hypochord in Xenopus, and so the addition of a few cells to the notochord would not cause as noticeable a change in size as the addition of many cells to FP and hypochord. In wildtype late tailbud embryos, we detected expression of F-spondin in a thin strand of cells underlying the notochord, the hypochord. We hypothesized that the expanded F-spondin staining in NICD embryos represents expansion of the hypochord, as well as the FP. Using a hypochord-specific marker, VEGF (Cleaver et al., 1997), we saw that hypochord tissue is decreased in SDBM embryos (Fig. 1N) and greatly expanded in NICD embryos (Fig. 1O). Thus, our results confirm previous studies showing that Notch signaling is required for the formation of the FP and represses notochord development in Xenopus (Lopez et al., 2003, 2005). In addition, we find that Notch signaling is required for hypochord formation in frog as it is in zebrafish (Appel et al., 1999; Latimer and Appel, 2006; Latimer et al., 2002).

Shh expression is uncoupled from ﬂoor plate formation in Xenopus

Shh expression is one of the most notable features of the ﬂoor plate, as Shh is required to pattern the dorsoventral identity of neurons within the spinal cord, as well as for axon guidance (Briscoe et al., 2000; Charron et al., 2003; Chiang et al., 1996). Thus, we examined Shh expression in our Notch-perturbed embryos (Fig. 2). ﬂ Fig. 1. Notch signaling promotes formation of oor plate and hypochord and represses Interestingly, we found that Shh expression in the FP did not respond notochord.Notch signaling was repressed by injection of mRNA encoding Su(H) DNA- binding mutant (SDBM, B, E, H, K, N) and activated by Notch intracellular domain mRNA as other FP markers did to changes in Notch signaling. Upon blockade (NICD, C, F, I, L, O). Floor plate development was assayed by expression of Netrin (A–C), of Notch signaling, we sometimes observed a slight decrease in Shh F-spondin (G–I), and FoxA2 (J–L). Notochord formation was assayed by Axial expression in the FP (31% of 211 embryos, Figs. 2B, B'), but often the FP protocadherin (AxPC,D–F) and Tor70 staining (brown, G–O). Tor70 staining has high expression was unperturbed (69%, Fig. 2J' and not shown). Surpris- variability and background, and thus should not be considered quantitative. Hypochord ingly, we also observed two different classes of phenotypes in NICD development was assayed by F-spondin (G–I, staining ventral to notochord) and VEGF (M–O). (A–F) Dorsal views, anterior up. (G–O) Transverse vibratome sections through embryos. In 27% of NICD embryos, Shh expression was increased middle of spinal cord at tailbud stages. throughout the midline (N=86, Figs. 2C, C', F), while in 69% of S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 257

Fig. 2. Perturbation of Notch signaling has variable effects on Shh expression.Shh expression in neurula (st.16, A–H) and tadpole (st.35, I–L) embryos upon blockade (B, F, J) and activation (C, D, E–H, K, L) of Notch signaling. Shh is expressed in the floor plate and notochord (A, A', I, I'). Blockade of Notch signaling led to a slight reduction in the floor plate domain of Shh in 31% of embryos (B, B'), but many embryos showed normal expression (J', 69%). Activated Notch signaling led to increased expression throughout the midline (C, C'), though the floor plate domain was normal (F, K'), in 27% of embryos. In a significant proportion of embryos (69%, pb0.05), activated Notch led to a decrease in Shh expression throughout the midline (H, L') or in the floor plate domain (G). In NICD tadpoles, Shh expression was decreased and/or patchy in the spinal cord (K, L). The variable response of Shh to Notch activation is not correlated with amount or distribution of NICD protein (E–H, αnti-myc staining for NICD-myc in brown). NICD in the lateral neural plate does not cause ectopic Shh expression (E), while NICD in the FP domain can result in Shh expression (F), or repression (G, H). (A'–D') Transverse sections of (A–D); faint notochord expression of Shh is not visible in thin sections. (E–H) αnti-myc staining (brown) was performed on transversely bisected embryos after ISH for Shh (purple). The notochord is outlined in red and the ventral boundary of the neural plate in blue. (I–L) Lateral view of tailbud stage embryos. (I'–L') Transverse vibratome sections through middle of spinal cord at tailbud stages. embryos, Shh expression was decreased, especially in the FP region ulating Shh signaling in Xenopus. Shh is expressed in the dorsal (N=86, Figs. 2D, D', G, H). When we stained these embryos for the marginal zone during gastrula stages and in all the dorsal midline presence of NICD protein (Figs. 2E–H, anti-myc, brown), we found tissues (floor plate and hypothalamus, notochord, and hypochord) that this variable expression of Shh in the FP did not correlate with from neurula through tailbud stages (Ekker et al., 1995). Shh acts variable expression of NICD protein. FP cells can either express Shh through its receptor Patched (Ptc), which is a transcriptional target of (Fig. 2F) or not (Figs. 2G, H), but all express NICD protein (Figs. 2F–H). Hh signaling and expressed in tissues adjacent to the dorsal midline Notably, NICD expressed outside of the FP does not induce ectopic Shh (Takabatake et al., 2000). Upon Shh binding to Ptc, repression of expression (Fig. 2E). At tailbud stages, all NICD embryos showed Smoothened (Smo) by Ptc is relieved, resulting in active signal patchy (Figs. 2K, K') or reduced, diffuse Shh (Figs. 2L, L') in the midline transduction. In order to block Hedgehog signaling, and Shh signaling (67%, N=76). in particular, we used several reagents, all of which had similar effects Since all other markers of FP differentiation examined showed an on Ptc expression (Fig. S2) and embryo morphology (Fig. S3), opposite increase upon activation of Notch signaling (Fig. 1), while Shh to those of Shh mRNA overexpression (Figs. S2 and S3). expression was often downregulated (Fig. 2), we conclude that Shh To specifically block Shh signaling, we designed a splice-blocking expression can be uncoupled from FP formation. This raises two morpholino that overlaps the first splice donor site of the Shh important questions: 1) Is Shh signaling required for floor plate transcript (Fig. S2A). RT-PCR of Shh spliceMO-injected embryos show specification in Xenopus? and 2) Why does Shh expression respond a dose-dependent reduction of correctly spliced Shh mRNA (Fig. S2B), differently than other markers to perturbation of Notch signaling? To and Ptc expression is reduced in Shh spliceMO embryos (Fig. S2E). answer the first, we used several reagents to perturb Shh signaling Overexpression of Shh mRNA activates Ptc expression (Fig. S2D) and and examined their effects on dorsal midline cell fates. To address the rescues the effect of Shh spliceMO (Fig. S2F). We saw similar effects second, we looked at the effect of Notch signaling on several more (Fig. S3) and Shh mRNA rescue (data not shown) for a morpholino markers of dorsal midline fate. designed to overlap the transcriptional start site of Shh. We also obtained several existing reagents for blocking Hedgehog Validation of reagents for manipulating Shh signaling in Xenopus signaling in general: the naturally-occurring small molecule inhibitor of Smo, cyclopamine (Chen et al., 2002), and a dominant-negative To further explore the relationship between Shh and floor plate version of the receptor Ptc lacking the Hh-interaction loop, development, we tested the efficacy of several reagents for manip- XptcΔloop2 (Koebernick et al., 2003). These reagents produced 258 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 phenotypes similar to our Shh MOs and to Shh mutants (e.g. reduction of Ptc expression, partial cyclopia, defective gut looping) (Figs. S2 and S3 and data not shown). Furthermore, we saw no enhancement of Ptc downregulation when cyclopamine was combined with Shh MO (Fig. S2G–J), indicating that most of the effects of Hedgehog signaling in the early frog embryo are Shh-dependent. We therefore present and designate embryos of the most severe phenotype from any of the loss-of-function reagents as “−Shh.” We have used the maximal doses of cyclopamine and Shh MO that allow for embryo viability, but it is unlikely that we have achieved the complete loss of function that would result from a genetic null. Although we do not observe a complete loss of Patched expression (Fig. S2) or cyclopia (Fig. S3), we do see profound effects on Hh pathway target gene Gli1 (data not shown) with all of our reagents. In addition, we have previously reported substantial effects on muscle development with these doses of cyclopamine and Shh mRNA (Martin et al., 2007; Peyrot et al., 2010). It should be noted that even Smo−/− cells and Gli2 mutant mice have some Ptc expression by ISH (Ding et al., 1998; Wijgerde et al., 2002), and zebrafish Shh pathway mutants do not have fused eyes (Brand et al., 1996). Indeed, in zebrafish and frog, it appears that only the loss of prechordal plate signals, which include Nodals and Wnt-antagonists, results in true cyclopia (Brand et al., 1996; Glinka et al., 1998; Sander et al., 2007).

Shh is not a major regulator of dorsal midline fates in Xenopus

In NICD embryos, we see upregulation of several markers of differentiated floor plate in the absence of notochord development (Fig.1 and not shown). Indeed, in NICD embryos we observe Shh expression in the FP despite the total lack of a mesodermal source of Shh (Fig. 2C') and no Shh expression in the FP despite the presence of Shh+ notochord tissue (Figs. 2D', G). These results suggest that Shh signaling from the notochord is not absolutely required for Shh expression in the FP, or even for formation of the FP. This finding is quite intriguing, as Shh signaling is necessary for FP formation in the mouse (Chiang et al., 1996; Ding et al., 1998; Matise et al., 1998), but is required only for formation of the lateral floor plate (LFP) in zebrafish (Schauerte et al., 1998). In Xenopus, Shh has been proposed to be induced downstream of Notch signaling and required in FP cells to specify FP fate and repress notochord fate (Lopez et al., 2003). However, in our experiments with activated Notch signaling, we see a consistent upregulation of several markers of differentiated floor plate (Fig. 1), but not of Shh (Fig. 2). In order to resolve these discrepancies, we used the various reagents previously described to perturb Shh Fig. 3. Shh is not a major regulator of dorsal midline fates.Shh signaling was blocked by injection of Shh MO or by cyclopamine treatment (“−Shh” B, E, G, J, M, P) and activated signaling and analyzed dorsal midline patterning. by injection of Shh mRNA (“+Shh,” C, H, K, N, Q). Netrin expression in the floor plate We found that FP markers Netrin and Shh were only modestly was decreased in 42% of −Shh embryos (B, N=387) and slightly upregulated in 44% affected (Figs. 3A–E) in a minority of embryos upon perturbation of of +Shh embryos (C, N=139). Floor plate expression of Shh was slightly narrower in Shh signaling (42% of “−Shh” embryos had reduced Netrin expression, 29% of embryos with blockade of Shh signaling (E inset, N=194). Perturbation of Shh – – – N=387; 29% had reduced Shh expression, N=194; 44% of “+Shh” signaling had no effect on notochord (AxPC,F H and Tor70, I Q) or hypochord (O Q) or floor plate markers F-spondin and FoxA2 in the spinal cord of tadpoles (I–N). (A–H) embryos had increased Netrin, N=139). At tailbud stages, any robust Dorsal views, anterior up, with transverse bisection in inset (A–E). (G–O) Transverse effect of modulating Shh signaling on FP markers was limited to the vibratome sections through middle of spinal cord at tailbud stages. brain, where F-spondin and FoxA2 were expanded dorsally upon activation of Shh signaling and staining was disrupted in some cyclopamine-treated embryos (48% N=149, Fig. S4). However, we we found that cells injected with either Shh or NICD mRNA still had saw little effect of perturbation of Shh signaling on FP markers in the robust expression of chd at stage 10 (pink, Figs. 4A–C). NICD mRNA region of the spinal cord at this stage (Figs. 3I–N). We also saw no often resulted in minor gastrulation defects, delay of mesoderm consistent effect of activating or blocking Shh signaling on the involution, and a slight repression in the vegetal portion of the Xbra development of the notochord (AxPC, Fig. 3F–H and Tor70, I–Q) and domain (Fig. 4F and data not shown). This phenomenon may indicate no effect whatsoever on the hypochord (Figs. 3O–Q). expansion of dorsal endoderm and repression of notochord in these We were quite surprised to see relatively normal FP and notochord embryos. However, Xbra was still expressed in many cells injected formation in embryos injected with Shh mRNA, as it has been with either Shh or NICD mRNA at gastrula stages (pink, Figs. 4D–F). reported that Shh signaling plays a major role in dorsal midline cell While Xbra is presumed to mark notochord precursors in the DMZ at fate specification in Xenopus, repressing notochord and promoting FP, this stage (as well as other mesoderm in the rest of the marginal zone) downstream of Notch (Lopez et al., 2003). These authors found that (Smith et al., 1991), we note that the expression domains of chd and both Notch and Shh repress expression of the notochord marker Xbra are not identical and that the Xbra expression domain does not chordin at gastrula stages. When we performed similar experiments, directly abut the dorsal blastopore lip. Thus, early Xbra expression S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 259

markers Shh and Netrin, and in two stripes in the ventral neural tube (Saha et al., 1993), making it a possible marker of LFP in the frog as well. We examined the expression of these genes in the spinal cord at stage 22, just after Nkx2.2 begins to be expressed. Shh and Netrin are expressed in the FP, while Nkx2.2 is expressed just laterally, overlapping with a part of the Netrin domain (Figs. 5A–C). At tadpole stages, it is clear that Shh, Netrin, and Nkx2.2 mark distinct populations of FP (Figs. 5D–F). If this Nkx2.2+ domain represents LFP, then it should be regulated by Shh signaling. We found that Nkx2.2 expression was vastly reduced when Shh signaling was abrogated (Fig. 5H), while Shh mRNA misexpression resulted in a robust expansion throughout the brain and upregulation in the spinal cord (Fig. 5I). It is possible that the Nkx2.2+ expression domain demarcates p3 neural progenitors, which also require Shh signaling in the mouse (Matise et al., 1998; Wijgerde et al., 2002). However, our results are distinct from these Shh loss-of- function mouse mutants, in which both FP and Nkx2.2+ ventral neuronal precursors are lost. Because several markers of differentiated FP do not require Shh signaling (Fig. 3), while Nkx2.2 does (Figs. 5H–I), we conclude that the development of FP in the frog is similar to that of zebrafish, in which there are two distinct populations of FP, and only the LFP (Nkx2.2+) requires Shh signaling (Schafer et al., Fig. 4. Ectopic Shh does not affect notochord formation and Notch signaling acts after 2005a). In addition, the robust effects observed on Nkx2.2, a gene that specification to repress the notochord fate.Shh mRNA overexpression does not repress requires high levels of Hh signaling for its expression, validates our notochord specification at stage 10, assayed by chd (B) and Xbra (E), or notochord reagents for perturbing Shh signaling and indicates that we have formation during gastrulation (Xbra, H). Activated Notch signaling does not affect achieved sufficient knockdown of Shh activity to observe effects on FP notochord specification (C, F), but potently represses subsequent notochord formation (I). Pink is lacZ staining of co-injected lineage tracer. development, were this pathway required.

Shh is not required downstream of Notch to promote floor plate or may not correspond to notochord precursors, or chd may be expressed repress notochord in cells other than notochord precursors. Nevertheless, Xbra marks the involuted chordal mesoderm after gastrulation, and we see identical Our results contrast with several previous results from studies on effects of Shh and Notch on this Xbra expression domain as we see for the roles of Notch and Shh signaling in dorsal midline cell fate other markers of notochord (compare Figs. 4G–I to 1 and 3). specification in Xenopus (Lopez et al., 2003). We found that neither Our results show that Shh signaling does not play a role in FP vs. Notch nor Shh activation repressed induction of notochord, as shown notochord fate decisions in the frog, nor is it a major regulator of FP specification. Interestingly, our data indicate that Notch signaling represses notochord differentiation, not specification, as Notch activation has little effect on early notochord markers chd and Xbra during gastrula stages. This is surprising, as Brachyury is a major regulator of notochord fate (Beddington et al., 1992).

Shh is required for lateral ﬂoor plate in Xenopus

Because our reagents to reduce S/Hh signaling do not result in phenotypes that completely resemble mouse mutants in this pathway, it is possible that the mild effects on midline development that we observe are due to a failure to completely block signaling. While it is true that we have likely not completely blocked signaling to the degree that would be expected in a genetic mutant of Shh or Smo, we observe robust effects on Ptc expression (Fig. S2), indicating a sufficient degree of functional knockdown. In the gradient model of Shh action, those tissues that require the highest level of Shh signal (FP), are those most affected by small changes in Shh signal levels (Dessaud et al.; Ding et al., 1998; Matise et al., 1998; Ribes et al., 2010; Roelink et al., 1995). Thus, we would expect to observe affected expression of FP markers in our embryos if Shh signaling were required for FP specification in Xenopus. Another possible explanation for our observations comes from fi investigations into zebra sh FP development. Interestingly, in zebra- Fig. 5. Lateral floor plate is regulated by Shh signaling.Nkx2.2 is a marker of the LFP in fish, Shh signaling is required only for the formation of the lateral floor zebrafish and chick. At onset in frog (stage 22), it is expressed in two stripes in the plate (LFP), which expresses Nkx2.2 specifically (Schafer et al., 2005a). ventral neural tube (C) lateral to Shh (A) and Netrin (B). At tadpole stages, Shh (D), Nkx2.2 also marks the LFP in chick, a population with FP character- Netrin (E), and Nkx2.2 (F) clearly mark distinct domains. LFP formation requires Shh signaling (H) and Shh overexpression can induce ectopic Nkx2.2 throughout the brain istics that is not derived from the node but can be induced by and upregulation in the spinal cord (I) at stage 22. (A–F) Transverse vibratome sections notochord signals (Charrier et al., 2002). According to previous following ISH and Tor70 staining of the notochord (brown, D–F). (G–I) Dorsal views, reports, Xenopus Nkx2.2 expression starts at stage 20, later than the FP anterior up. 260 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 by Xbra and chd expression in early gastrulae. We also found that and Shh MO or cyclopamine-treated NICD embryos, we observed a Notch activation only sporadically led to upregulation of Shh slight “rescue” of increased Netrin staining, but the morphology of the expression in the floor plate, and that Shh signaling is not absolutely midline was still robustly affected (Figs. 6D, H). Moreover, we required for formation of the FP. All of these results indicate that Shh observed no true epistasis; i.e. NICD+ShhMO/cyclopamine embryos signaling is not regulated by Notch signaling, nor is it required were significantly different from both NICD and ShhMO/cyclopamine downstream of Notch signaling to regulate dorsal midline cell fates. To populations, in both intensity of phenotype and number of embryos test these observations further, we performed epistasis experiments. affected (Figs. 6D, F and S5). This appears to be a compound We processed embryos in parallel for Netrin ISH and Tor70 IHC (see phenotype and suggests that Notch and Shh are in parallel pathways Materials and methods). We then scored FP development by the in FP development. intensity of Netrin staining and notochord development by the size of We can conclude that Shh signaling is not required downstream of the Tor70+ structure. Examples of representative phenotypes are Notch signaling in order to repress notochord development, as we shown in Fig. 6, with quantification and statistical analysis in Fig. S5. saw no rescue of notochord formation in NICD+ShhMO/cyclopamine If Notch and Shh signaling function strictly in a linear pathway, embryos (Fig. S5 and data not shown). In contrast, co-injection of with Shh required downstream of Notch, then embryos with activated SDBM with NICD mRNA efficiently blocks the effects of Notch Notch and reduced Shh should have a Shh loss-of-function phenotype. activation, leading to substantial rescue in terms of Netrin expression As previously shown, activation of Notch signaling by injection of and notochord formation (compare Figs. 6B with L) in over 80% of NICD led to highly penetrant, intense upregulation of Netrin staining embryos (Fig. S5). As expected from the recovery of notochord in the FP, as well as loss of notochord (Figs. 6B, F and S5). Netrin also development, overall morphology of the midline returned to normal occupies a wider domain in the ventral neural tube in NICD embryos, as well in NICD+SDBM embryos. but we noticed that the neural tube and other midline structures We also performed the opposite epistasis experiment, in which we appear much larger in cross-section in NICD embryos than controls activated Shh signaling and blocked Notch signaling in the same (Figs. 6B, D, F, H, P). NICD embryos are also shorter and wider than embryo. Surprisingly, we found evidence for Notch signaling being controls, most likely due to the reduced extension of the embryos required downstream of Shh signaling. Netrin expression was slightly owing to a lack of notochord tissue. Shh MO and cyclopamine led to elevated in most embryos injected with Shh mRNA alone (Figs. 6I, S5), reduced Netrin staining in some embryos (Figs. 6C, G and S5), with no while embryos injected with SDBM mRNA or Shh+SDBM mRNAs had effect on notochord as assessed by Tor70 staining of these same reduced or normal Netrin levels (Figs. 6J, K) in similar proportions (not embryos (Fig. S5 and data not shown). In embryos injected with NICD significantly different, pN0.05, Fig. S5). These results show true

Fig. 6. Shh and Notch signaling act in parallel to specify floor plate.Epistasis (A–L) and enhancement (M–P) experiments to determine the contribution of Notch and Shh signaling to floor plate formation. Embryos were injected and/or treated with reagents listed, fixed at stage 20–22, bisected and stained for co-injected lineage tracer (pink), then processed for Netrin ISH. Activated Notch signaling upregulates Netrin (B, F), while blockade of Shh signaling slightly reduces Netrin (C, G). Activation of Notch and blockade of Shh in the same embryo results in a Notch phenotype (D, H). Shh overexpression leads to a slight increase in FP (I), and blockade of Notch signaling leads to a decrease (J). Activation of Shh and blockade of Notch in the same embryo results in a Notch phenotype (K). Blockade of Notch signaling downstream of NICD with SDBM is able to rescue FP and notochord development to normal (L). Blockade (M, O) or activation (P) of both Notch and Shh signaling in the same embryo gives more severe phenotypes than perturbing either pathway alone. S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 261 epistasis, with Shh+SDBM embryos showing the same phenotype as Keller, 1975, 1976), as well as our own lineage tracing (see Fig. S1), show SDBM embryos, and indicate that Notch signaling is required that DMZ gives rise to FP and notochord, we conclude that the cells in downstream of Shh signaling in FP specification. These results the DMZ expressing these markers at gastrula stages are midline contradict the current model of Shh signaling operating downstream precursor cells that populate the notochord and posterior FP at neurula of Notch in dorsal midline cell fate specification (Lopez et al., 2003, stages, i.e. the expression domain marks a common lineage pool. 2005). However, since Notch perturbations are more severe than Shh However, it is possible that the early gastrula expression of some perturbations, it is still possible that the phenotype of Shh+SDBM markers is only in notochord precursors, and that these genes are embryos also represents a compound phenotype, which is consistent induced in the FP during gastrulation. This is very likely the case for FP with parallel roles for Shh and Notch signaling in FP specification. expression of Shh, which extends anterior to the organizer fate map. Because the prospective FP domain is quite compressed at gastrula Shh and Notch signaling act in parallel to specify FP stages and the NIMZ and IMZ are not easily distinguished by morphology or gene expression, it is difficult for us to rule out this Our epistasis experiments led to conflicting conclusions, support- possibility. ing two possible models of Notch and Shh signaling in a linear Notably, the FP expression domain of genes that turn on during pathway for FP development. In addition, we found that individual gastrulation is narrower during neurula stages than the domain of loss of either Notch or Shh signaling alone fails to block FP markers in Netrin. Netrin is reported to be first expressed at stage 13 in two all embryos. These results led us to hypothesize that Notch and Shh stripes just adjacent to the medial Shh domain, then expands medially signaling may instead be acting redundantly during FP development. (de la Torre et al., 1997). We were able to see this expression pattern To test this possibility, we conducted enhancement experiments. If in a minority of embryos (Fig. S6O'–P'), indicating that the expression Notch and Shh signaling are functioning strictly in a linear pathway, of Netrin is quite dynamic at these stages. While early midline markers then loss of both pathways (double knockdown) should produce a (except for Shh) fade during neurulation, Netrin expression expands phenotype similar to loss of a single pathway (single knockdown), medially to mark the entire FP. while an enhanced phenotype upon loss of both pathways would According to the revised allocation model, the MFP forms early, indicate that they are acting in parallel. during gastrulation, while the LFP is induced later, during neurulation. In these experiments, SDBM, ShhMO, and cyclopamine caused Because of the temporal and spatial differences in expression domains, reduction of Netrin staining in a significant number of embryos we suspected that Shh, FoxA4a, and the other early-expressed genes (Figs. 6C, G, J and S5). We observed a more severe loss of Netrin in might delineate the MPCs and then medial floor plate (MFP), while embryos depleted of both pathways (Figs. 6M–O), with some embryos Netrin marks the lateral floor plate (LFP). In order to test this hypothesis, showing a complete loss of floor plate (Fig. 6M). In addition, we we looked at expression of Nkx2.2, the hallmark of LFP in zebrafish and observed a statistically significant enhancement in the penetrance of chick (Charrier et al., 2002; Odenthal et al., 2000). As discussed the reduced Netrin phenotype in embryos with both pathways previously, we found that Nkx2.2 is expressed in an area distinct from blocked, compared to either alone (Fig. S5). Finally, we saw a marked and adjacent to Netrin (Figs. 5A–F). In addition, Nkx2.2 expression increase in the intensity of Netrin staining (Fig. 6P) in almost all absolutely requires Shh signaling in Xenopus (Figs. 5G–I), as LFP does in embryos co-injected with NICD and Shh mRNAs, over either alone. zebrafish, while Netrin and F-spondin are not robustly affected by Shh These results suggest that Notch and Shh signaling act in parallel to perturbation (Fig. 3). Thus, we conclude that Xenopus has LFP, by virtue promote FP development in Xenopus. However, the robust effects of of expression of Nkx2.2 and a requirement for Shh signaling. perturbing Notch signaling compared to the mild effects of perturbing Furthermore, this LFP is distinct from the earlier-forming and popula- Shh signaling indicate that Shh signaling plays a less significant role in tions of FP, which express Shh and Netrin. Since these populations are this process. mostly Shh-independent, we deem them to be MFP. Furthermore, the temporal and spatial differences in FP gene expression indicate that Xenopus floor plate consists of several distinct domains there are two distinct MFP populations. We have designated these 1° MFP (gastrula origin, Shh-expressing) and 2° MFP (neurula origin, The question remained: why does Shh expression respond differ- Netrin-expressing), based on their order of development. ently from other FP markers to changes in Notch signaling? We hypothesized that this phenomenon could result from differences in the Notch signaling acts during neurulation to promote secondary specification timing and/or location of Shh expression compared to the other markers of the medial floor plate used. Shh expression starts in the dorsal marginal zone (DMZ) during early gastrulation, unlike the other markers we had examined. When By examining the spatiotemporal expression of several midline examined at the same stage, Shh expression was in a narrower domain markers in normal embryos (Fig. S6), we generated a hypothesis that than Netrin (Figs. 5A–B, D–E; S6H', P'). To characterize these domains the MFP is elaborated in two steps, during gastrulation (1° MFP) and further, we examined other floor plate markers expressed early during during neurulation (2° MFP). Furthermore, based on our experimental gastrulation, including FoxA4a, FoxA4b, FoxA1b, Xnot, FoxD5a,and results for Shh and Netrin expression (Figs. 1 and 2), 1° MFP is Notch- XencR1 (Fig. S6, Table S1). independent and 2° MFP Notch-dependent. We found that expression of these markers began during gastrula- To test this model, we examined the effect of Notch signaling on tion (Figs. S6A, C, E, G, I, K, M) and, except for Shh, faded by the end of Shh expression in gastrulae and expression of FoxA4a, another of the neurulation. During gastrula stages, these markers were expressed in early midline markers, during gastrulation and neurulation. We found the DMZ (Fig. S6, asterisk), which includes notochord and hypochord that gastrula expression of neither marker is changed upon blockade precursors in the involuting marginal zone (IMZ) and floor plate or activation of Notch signaling (Figs. 7A–F), and FoxA4a expression precursors in the non-involuting marginal zone (NIMZ) (Keller, 1975, was virtually identical to Shh expression in SDBM and NICD embryos 1976). Some markers were also expressed broadly in the marginal zone, at neurula stages (compare Figs. 7G–I with 2A–D). We performed in non-midline tissues. At early-mid neurula, all markers were similar experiments with other 1° MFP markers, with similar results expressed in the notochord (Fig. S6, outline) and FP and, except for (Table S1, data not shown). We conclude that Notch signaling is not Shh, expressed in a posterior (high) to anterior (low) gradient in the FP. required for formation of the 1° MFP during gastrulation, though All midline markers that began expression during gastrulation occupied Notch activation does sometimes have an effect on later expression of a similar domain in the FP at neurula stages (Figs. S6B, D, F, H, J, L, N). these genes. In embryos with reduced 1° MFP (Figs. 2D, H, L), it is Because previous lineage maps (Bauer et al., 1994; Dale and Slack, 1987; possible that NICD activity converts 1° MFP to 2° MFP prematurely. 262 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266

all animals. Here, using marker gene expression to deﬁne the FP, we have addressed several key points of the various models of FP development in Xenopus, as well as revisited the role of Notch signaling in dorsal midline cell fate choices in this animal. To enable comparison with other studies, we have analyzed a wide variety of markers and developmental time points. We present a model of Xenopus dorsal midline development (Fig. 8) that will be valuable for instructing and interpreting future studies in the frog and other vertebrate systems.

A revised model for dorsal midline development in Xenopus

Notch signaling regulates dorsal midline cell fate decisions, promoting FP and hypochord over the default notochord fate (Fig. 1), as in zebrafish (Appel et al., 1999). Unlike in mouse (Chiang et al., 1996; Ding et al., 1998; Lee et al., 1997; Matise et al., 1998; Wijgerde et al., 2002) and in previous reports in frog (Lopez et al., 2003, 2005), we find that Shh signaling plays a minor role in FP development and has no role in FP vs. notochord decisions (Figs. 3 and 4). Nevertheless, we do find evidence in Xenopus for a lateral floor plate (LFP), defined by Nkx2.2 expression, which does require Shh signaling (Fig. 5), as in zebrafish and chick (Charrier et al., 2002; Odenthal et al., 2000). Since we observe a role for Notch signaling in cell fate decisions that occur during gastrulation, when midline precursor cells sort into distinct tissues, and find that Shh signaling is absolutely required for only LFP specification, we propose that Xenopus is a model for the “revised allocation” mechanism of FP development (Figs. 8A–B), similar to zebrafish and chick, rather than the “induction” mechanism operating in Fig. 7. Notch signaling does not regulate gastrula midline markers or 1° MFP.Shh and mouse (Strahle et al., 2004). plvs are markers of 1° MFP (Fig. S6). Blockade (B, E, H) and activation (C, F, I) of Notch – signaling does not affect gastrula stage expression of these markers (A F). Expression of fl plvs upon perturbation of Notch signaling (G–I) looks much like that of Shh (see Fig. 2), Several distinct populations of oor plate with FP expression only mildly affected (G'–I'). (G'–I') Transverse bisections of G–I. While the role of Notch signaling in dorsal midline development appears similar in non-amniotes, our results indicate that floor plate Discussion development may be more complicated in frog than in zebrafish. Unlike in zebrafish, formation of the frog medial floor plate (MFP) The floor plate (FP) is an important signaling center in the ventral seems to involve two separate processes at distinct times during portion of the vertebrate neural tube. Although FP gene expression and development. Several genes expressed in the gastrula stage dorsal function are widely conserved amongst vertebrates, there has been marginal zone/organizer are expressed throughout the dorsal midline considerable debate on the mechanism by which the FP is specified, based (in floor plate, notochord, and endoderm) at early neurula stages on work in various vertebrate models. While it is certainly possible that FP (Fig.S6).Followingthenomenclaturefromchicklineageand is specified differently in each, there remains disagreement even within expression analyses (Catala et al., 1996; Charrier et al., 2002; Teillet individual model systems, and all models have not been fully addressed in et al., 1998), we call the FP cells expressing these markers (e.g. Shh)

A B C D NIMZ

? IMZ N D NN D N D SHH N SHH N

Dorsal Marginal Zone (st.10-11) neural plate (st.14) neural tube (st.20) spinal cord (st.26) MPCs - Shh, FoxA4a 1° MFP - Shh, FoxA4a LFP - Nkx2.2 MFP - F-spondin, 2° MFP - Netrin FoxA2 HC - VEGF

Fig. 8. Model of Xenopus dorsal midline development.(A) Vegetal view (left) and sagittal slice (right) at gastrula stage, with sagittal slice taken at the level of the blue line in left panel (Shook et al., 2004). Midline Precursor Cells (MPCs: purple, red, yellow) in the DMZ/ organizer give rise to medial floor plate (MFP, purple), notochord (red), and dorsal endoderm (yellow), which will become hypochord (HC in panel D). Notochord and hypochord precursors are located in the superficial layer of the involuting marginal zone (IMZ), while the deep layer of the IMZ becomes notochord. Notch signaling reinforces cell fate choices between notochord and hypochord at the boundary of superficial and deep layers in the involuting marginal zone (IMZ) during gastrulation, promoting hypochord (Notch+, “N”) over notochord (Delta+, “D”). MPCs in the non-involuting marginal zone (NIMZ) give rise to MFP in a Notch-independent manner. MPCs express Shh, FoxA4a, and other early markers (Fig. S6).(B) In early neural plate stages, MPCs occupy the 1° MFP (purple), notochord (red), and dorsal endoderm (yellow). During neurulation, the midline cells of the archenteron roof (red) ingress to join the notochord, while dorsal endoderm migrates medially. 1° MFP expresses Shh, FoxA4a, and other MPC markers. Notch (N) plays a major role and Shh a minor parallel role in specification of 2° MFP (green), which expresses Netrin.(C) After neural tube closure, Shh secreted from the 1° MFP and notochord specifies the lateral floor plate (LFP, orange), which expresses Nkx2.2.(D) During tailbud stages, MFP (blue) and hypochord (yellow) mature and express differentiation markers. LFP (orange) continues to express Nkx2.2. S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 263 the medial floor plate (MFP, Fig. 8B), and the cells in the organizer beginning at early neurula, but has not been tested for a requirement midline precursor cells (MPCs) (Fig. 8A). During mid-neurulation, in either of these tissues (Pichon et al., 2002). most of these markers fade, and then markers of mature, differentiated FP begin to be expressed (Figs. S6; 8B). Netrin is the first of these, Notch signaling in floor plate specification and it is expressed in a slightly wider domain than Shh (Fig. S6), but medial to the LFP marker Nkx2.2 (Fig. 4), which begins to be expressed We saw no effect of perturbing Notch signaling on expression of 1° even later still, after the end of neurulation (Saha et al., 1993) MFP markers at gastrula stages, in the MPCs (Figs. 7A–F). At neurula (Figs. 8B–C). stages, we observed little to no decrease of 1° MFP markers upon loss The spatial and temporal differences in MFP marker gene of Notch signaling, and variable responses to activated Notch signaling expression we describe indicate that there are two distinct popula- (Figs. 2A–H, 7G–I). However, the 2° MFP marker, Netrin, as well as late tions of MFP (Fig. 8B). This interpretation is supported by functional MFP markers F-spondin and FoxA2, were robustly affected by both criteria as well. Our experiments with Notch perturbation show that activation and blockade of Notch signaling (Figs. 1A–C, G–L). Thus, the early-forming (Shh+) MFP is not regulated by Notch signaling, Notch signaling seems to be required for a late step in MFP formation, either in MPCs during gastrulation or in MFP during neurulation while initial specification is Notch-independent. This is similar to a (Figs. 2 and 7; Table S1), while the later-forming (Netrin+) MFP is proposed model of FP development in zebrafish, whereby Nodal (Fig. 1). Therefore, we propose that in the frog there are two distinct signaling specifies MFP in a midline precursor population, and Notch populations of MFP that are specified at different times, by different signaling is required for expansion (proliferation) of this population mechanisms, and likely arise from a different developmental origin (Latimer and Appel, 2006). It would be interesting to know whether + (Fig. 8B): 1° MFP—Shh , arising from MPCs during gastrulation, cell proliferation plays a significant role in formation of the 2° MFP in Notch-independent—and 2° MFP—Netrin+, induced during neurula- the frog, and whether this process is regulated by Notch signaling. tion, Notch-dependent. A role for Notch signaling in FP development is conserved between frog and fish, and there is recent evidence that it may be for amniotes as well. In chick, Notch signaling regulates allocation of cells in Dorsal midline cell fate choices Hensen's node to FP and notochord, in a manner analogous to its role The MPCs in the organizer give rise to 1° MFP, notochord, and in fish and frog (Gray and Dale, 2010). There is also evidence that hypochord during gastrulation (Catala et al., 1996; Spemann and Notch signaling is required to maintain FP identity during neurogen- Mangold, 1924) (Fig. S6). While the 1° MFP is not greatly affected by esis in chick (le Roux et al., 2003). Mice lacking both presenilin genes Notch signaling in our experiments (Figs. 2; 7), perturbation of Notch have reduced Shh expression in the neural tube and loss of FP profoundly affected notochord and hypochord development (Fig. 1). morphology, despite Shh expression in the notochord (Donoviel et al., Studies in zebrafish have yielded similar results, with notochord and 1999). However, the Dll1 mouse has increased FP and decreased hypochord formation more strongly affected than FP in Notch notochord (Przemeck et al., 2003), a phenotype opposite that of fish pathway mutants (Appel et al., 2001, 2003; Julich et al., 2005; Latimer Notch mutants and SDBM frog embryos. While the Shh/induction et al., 2002). We propose, then, that Notch signaling is important for model of FP specification is fully supported in mouse, little work has cell-fate choices between notochord and dorsal endoderm that occur investigated the presence of distinct FP populations or a hypochord- between MPCs in the organizer throughout early gastrulation, when like population of cells in the dorsal endoderm of this animal. It would these tissues are involuting (Fig. 8A). Notch+ cells in the organizer be particularly interesting to investigate more thoroughly the populate the endoderm, while Delta+ cells become notochord outcomes of perturbing Notch signaling in mouse with respect to (Fig. 8A). According to gastrula fate maps, deep cells of the IMZ these issues, to see if some aspects of frog and fish dorsal midline become the notochord, while the superficial layer gives rise to the specification mechanisms are conserved in mammals. archenteron roof; cells in the midline ingress into the notochord (Fig 8B) while cells just lateral migrate and become hypochord (Keller, Shh signaling in floor plate development 1975, 1976; Minsuk and Keller, 1997; Shook et al., 2004). We propose that Notch signaling functions to reinforce cell fate boundaries within Notch activation leads to increased FP development in our and between tissue layers during gastrulation. experiments, assayed by several markers of differentiated FP A minor role for Notch signaling in 1° MFP makes sense in light of (Fig. 1). In mouse and chick, Shh signaling induces FP, and it has gastrula fate maps (Keller, 1975, 1976; Minsuk and Keller, 1997), as been reported that Shh in the FP maintains FP fate in Xenopus (Lopez the floor plate arises from the non-involuting marginal zone (NIMZ), et al., 2003). Thus, we expected to see increased Shh expression in the whereas notochord and dorsal endoderm (hypochord) arise from the FP, as for other markers. On the contrary, we do not see uniform involuting marginal zone (IMZ). Thus, only at the border of these upregulation of Shh expression upon activation of Notch signaling in domains would Notch signaling be expected to be able to play a role in the midline, and in fact see a decrease in Shh in the floor plate in a cell fate choices between FP and notochord by a typical lateral small, but significant, number of embryos (Fig. 2C, D). Furthermore, inhibition mechanism, which requires juxtaposition of signaling and we do not see loss of Shh expression upon blockade of Notch signaling receiving cells (Mumm and Kopan, 2000). This may explain why we (Fig. 2B). These results show that Notch signaling is not required for see little effect on 1° MFP (Shh et al.) when Notch signaling is blocked Shh expression (Fig. 2B), though it is required for FP fate (Fig. 1). Thus, (Figs. 2B, J; 7H). Later, Notch signaling is required for, and leads to, these results indicate that FP formation can be uncoupled from Shh robust upregulation of the 2° MFP fate (Netrin, Figs. 1; 8B). It is function. possible that premature activation of the 2° MFP fate in the MPCs of Our results differ from previous work in Xenopus, which showed Notch-activated embryos results in loss of 1° MFP in some embryos that activation or blockade of Notch signaling with the same reagents (Figs. 2D, H). used here resulted in increased or decreased Shh expression, Our results indicate that Notch signaling controls more than one step respectively, in the FP (Lopez et al., 2003). One possible explanation in the acquisition of dorsal midline fates (Figs. 8A, B). Interestingly, there is that we have examined Shh expression at a later developmental are two genes of the Hairy family of Notch effectors expressed in the timepoint, when small changes in the level and distribution of dorsal midline. Hairy2a, implicated in choices between FP and transcript at gastrula stages might be revealed through the process of notochord (Gray and Dale, 2010; Lopez et al., 2005), is expressed axis extension. In addition, the previous study employed a unilateral during gastrula stages, but has not been tested for a role in hypochord injection technique that did not target the entire midline, while we development. XHRT1 is expressed in FP and hypochord domains used targeted injections that hit the entire midline (Fig. S1). Unilateral 264 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 injections of the type employed previously (Lopez et al., 2003) result lation is required for MFP (Tian et al., 2003). There is also evidence that in less severe and mosaic phenotypes, again due to the extensive cell Nodal signaling from the prechordal plate cooperates with Shh signaling rearrangements that form the dorsal axis (data not shown). to specify FP in the anterior neural tube (“area a”) in chick during Because we observed uncoupling between Shh expression/function gastrula stages (Patten et al., 2003). It is not definitively known whether and FP formation, we investigated whether Shh signaling was required Nodal signaling plays a role in mouse FP, as mice lacking Nodal fail to for FP development in Xenopus.Wefind that perturbation of Shh form the primitive streak and node, which give rise to all midline signaling had very little effect on several markers of FP (Fig. 3), which structures (Conlon et al., 1994). However, chimeric embryos made from were, in contrast, extremely responsive to Notch signaling. These data cells mutant for Nodal (Varlet et al., 1997) or its downstream effector show that Shh signaling is not absolutely required for FP formation in Smad2 (Heyer et al., 1999) do form FP, indicating that Nodal signaling the frog, as it is in mouse, though it may play a minor role. While we may not be required for FP in mouse. found no evidence that Shh signaling is required downstream of Notch Nodal signaling plays similar early germ layer patterning roles in signaling for adoption of FP fate or repression of notochord fate, as frog and mouse, and so is not as amenable to traditional injection proposed by previous frog experiments (Lopez et al., 2003), our strategies or simple knock-out alleles for dissection of its function in experiments do support a minor role for Shh signaling in FP formation the dorsal midline. We have used the chemical inhibitor SB431542 to in parallel to Notch (Fig. 6). Interestingly, recent experiments have block Nodal signaling after germ layer specification, during gastrula- shown that Shh signaling is required in parallel to Nodal signaling for full tion, but find no effect on any FP markers (data not shown). Nodal specification of the MFP in zebrafish (Ribes et al., 2010). Thus, a minor may not be required for MFP in Xenopus, or perhaps it is impossible to role for Shh signaling, in parallel to other signals, seems conserved in temporally separate the roles of Nodal in mesoderm induction and FP non-amniote FP development. induction in the frog. However, it would be interesting to see whether Since Shh signaling has been reported to be required only for the conditional inactivation of Nodal signaling during gastrulation leads specification of the lateral floor plate (LFP) in zebrafish (Odenthal to loss of FP in the mouse. et al., 2000; Schauerte et al., 1998), we looked at the effect of Shh In zebrafish, a midkine factor, mdka, is responsible for MFP signaling on the LFP marker Nkx2.2.Wefind that, as in zebrafish, Shh formation in the trunk spinal cord following gastrulation (Schafer signaling is absolutely required for development of LFP in Xenopus, et al., 2005b). Like Notch signaling, midkine signaling seems to play a and promotes LFP formation when ectopically activated (Fig. 5). In role in dorsal midline cell fate decisions, as there are reciprocal gains addition, ectopic notochord grafts robustly induce LFP in chick and losses in the number of MFP and notochord cells upon (Charrier et al., 2002). Thus, the existence of Nkx2.2+, Shh-dependent perturbation of signaling, without evidence of cell proliferation. LFP is conserved amongst fish, frog, and chick. Midkines and their related family members, pleiotrophins, are Recently, it has been shown that FP specification in mouse requires heparin-binding growth factors with diverse roles in embryonic a short burst of high level Shh signaling during gastrulation and early development. None of these factors have been examined in Xenopus somitogenesis in vivo, and 24–48 hours in explant culture (Ribes et al., for a role FP formation, but our model predicts that these molecules 2010). This is apparently different from the frog, in which markers of would function in the MPCs during gastrulation and affect 1° MFP FP are expressed in the neurula stage embryo at 12 hours of markers (Fig. 8). development, only a few hours after Shh begins to be expressed. In Our experiments have revealed unforeseen complexity in dorsal addition, Nkx2.2 is expressed in the FP prior to mature FP markers midline formation in Xenopus and demonstrate the necessity of such as Shh and FoxA2 in mouse (Ribes et al., 2010). In contrast, Nkx2.2 examining several markers at various developmental time points. is never expressed in the FP in Xenopus (Fig. 5,(Saha et al., 1993), and There are still several open questions about dorsal midline specifica- Shh is expressed in the FP long before Nkx2.2 (Fig. S6). These tion in Xenopus, including: What molecules regulate choices between differences in expression patterns highlight differences between frog notochord and 1° MFP? Does hypochord specification require path- and mouse FP development, and may also explain why Shh is not ways other than Delta/Notch? What are the effectors of Notch sufficient or required for FP formation in the Xenopus embryo. It is signaling during gastrulation and neurulation? The markers and possible that the neurectoderm does not receive a sufficient level or concepts presented in this study will prove useful in further duration of Shh signal during gastrulation and neurulation to endeavors to identify regulators of midline development in Xenopus influence FP development. However, Shh signaling has built to a and other vertebrates. significant level by early tailbud stages (24 hours of development) to Supplementary materials related to this article can be found online induce Nkx2.2 in the LFP (Figs. 5; 8C). Although, this model would at doi:10.1016/j.ydbio.2011.01.021. predict that the late FP markers F-spondin and FoxA2 would be perturbed in our Shh assays, which they were not (Figs. 3, 8D), it is Acknowledgments possible that Shh signaling is required for induction of other late FP markers and/or FP maintenance at more advanced tadpole and larval This work is supported by a Burroughs Wellcome Fund Career Award stages. and N.I.H. R01-GM074104-01 to J.B.W. and NIH GM 42341 to R.M.H. We thank C. Kintner, T. Hollemann, P. Krieg, and T. Pieler for reagents and Other possible modes of floor plate specification A. Monsoro-Burq and members of the Harland lab for excellent advice and technical assistance. We thank Dave Shook for correcting our fate maps. We have shown that Notch signaling plays a major role in development of FP that differentiates during neurulation and is characterized by expression of Netrin, a tissue we have named the 2° MFP (Figs. 1;S6), References while Shh signaling drives specification of the LFP after neurulation Appel, B., Fritz, A., Westerfield, M., Grunwald, D.J., Eisen, J.S., Riley, B.B., 1999. Delta- (Fig. 5). However, we saw no effect of perturbing either Notch or Shh mediated specification of midline cell fates in zebrafish embryos. Curr. Biol. 9, signaling on gastrula stage markers of the midline (Fig. 7), which 247–256. occupied a slightly more narrow domain of the floor plate (1° MFP) Appel, B., Givan, L.A., Eisen, J.S., 2001. Delta-Notch signaling and lateral inhibition in zebrafish spinal cord development. BMC Dev. Biol. 1, 13. during neurula stages (Fig. S6). The signaling pathways leading to the Appel, B., Marasco, P., McClung, L.E., Latimer, A.J., 2003. lunatic fringe regulates Delta- development of 1° MFP in Xenopus are as yet unknown (Fig. 8). Notch induction of hypochord in zebrafish. Dev. Dyn. 228, 281–286. Nodal signaling plays a major role in specification of the MFP in Artavanis-Tsakonas, S., Rand, M.D., Lake, R.J., 1999. Notch signaling: cell fate control and – fi signal integration in development. Science 284, 770 776. zebra sh (Hatta et al., 1991; Muller et al., 2000; Rebagliati et al., 1998). Artinger, K.B., Bronner-Fraser, M., 1993. Delayed formation of the floor plate after Specifically, Nodal signaling from the prechordal plate during gastru- ablation of the avian notochord. Neuron 11, 1147–1161. S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266 265

Bauer, D.V., Huang, S., Moody, S.A., 1994. The cleavage stage origin of Spemann's Kingsbury, B.F., 1940. The developmental significance of the floor-plate of the brain and Organizer: analysis of the movements of blastomere clones before and during spinal cord. J. Comp. Neurol. 50, 177–207. gastrulation in Xenopus. Development 120, 1179–1189. Klar, A., Baldassare, M., Jessell, T.M., 1992. F-spondin: a gene expressed at high levels in Beddington, R.S., Rashbass, P., Wilson, V., 1992. Brachyury—a gene affecting mouse the floor plate encodes a secreted protein that promotes neural cell adhesion and gastrulation and early organogenesis. Development 157–165 (Suppl). neurite extension. Cell 69, 95–110. Bolce, M.E., Hemmati-Brivanlou, A., Harland, R.M., 1993. XFKH2, a Xenopus HNF-3 Koebernick, K., Hollemann, T., Pieler, T., 2003. A restrictive role for Hedgehog signalling alpha homologue, exhibits both activin-inducible and autonomous phases of during otic specification in Xenopus. Dev. Biol. 260, 325–338. expression in early embryos. Dev. Biol. 160, 413–423. Kuroda, H., Inui, M., Sugimoto, K., Hayata, T., Asashima, M., 2002. Axial protocadherin is Brand, M., Heisenberg, C.P., Warga, R.M., Pelegri, F., Karlstrom, R.O., Beuchle, D., Picker, a mediator of prenotochord cell sorting in Xenopus. Dev. Biol. 244, 267–277. A.,Jiang,Y.J.,Furutani-Seiki,M.,vanEeden,F.J.,Granato,M.,Haffter,P., Latimer, A.J., Appel, B., 2006. Notch signaling regulates midline cell specification and Hammerschmidt, M., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal, J., Nusslein- proliferation in zebrafish. Dev. Biol. 298, 392–402. Volhard, C., 1996. Mutations affecting development of the midline and general Latimer, A.J., Dong, X., Markov, Y., Appel, B., 2002. Delta-Notch signaling induces body shape during zebrafish embryogenesis. Development 123, 129–142. hypochord development in zebrafish. Development 129, 2555–2563. Briscoe, J., Ericson, J., 2001. Specification of neuronal fates in the ventral neural tube. Le Douarin, N.M., Halpern, M.E., 2000. Discussion point. Origin and specification of the Curr. Opin. Neurobiol. 11, 43–49. neural tube floor plate: insights from the chick and zebrafish. Curr. Opin. Neurobiol. Briscoe, J., Pierani, A., Jessell, T.M., Ericson, J., 2000. A homeodomain protein code specifies 10, 23–30. progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101, 435–445. le Roux, I., Lewis, J., Ish-Horowicz, D., 2003. Notch activity is required to maintain Catala, M., Teillet, M.A., Le Douarin, N.M., 1995. Organization and development of the floorplate identity and to control neurogenesis in the chick hindbrain and spinal tail bud analyzed with the quail-chick chimaera system. Mech. Dev. 51, 51–65. cord. Int. J. Dev. Biol. 47, 263–272. Catala, M., Teillet, M.A., De Robertis, E.M., Le Douarin, M.L., 1996. A spinal cord fate map Lee, J., Platt, K.A., Censullo, P., Ruiz i Altaba, A., 1997. Gli1 is a target of Sonic hedgehog in the avian embryo: while regressing, Hensen's node lays down the notochord and that induces ventral neural tube development. Development 124, 2537–2552. floor plate thus joining the spinal cord lateral walls. Development 122, 2599–2610. Lopez, S.L., Paganelli, A.R., Siri, M.V., Ocana, O.H., Franco, P.G., Carrasco, A.E., 2003. Notch Charrier, J.B., Lapointe, F., Le Douarin, N.M., Teillet, M.A., 2002. Dual origin of the floor activates sonic hedgehog and both are involved in the specification of dorsal plate in the avian embryo. Development 129, 4785–4796. midline cell-fates in Xenopus. Development 130, 2225–2238. Charron, F., Stein, E., Jeong, J., McMahon, A.P., Tessier-Lavigne, M., 2003. The morphogen Lopez, S.L., Rosato-Siri, M.V., Franco, P.G., Paganelli, A.R., Carrasco, A.E., 2005. The sonic hedgehog is an axonal chemoattractant that collaborates with netrin-1 in Notch-target gene hairy2a impedes the involution of notochordal cells by midline axon guidance. Cell 113, 11–23. promoting floor plate fates in Xenopus embryos. Development 132, 1035–1046. Chen, J.K., Taipale, J., Cooper, M.K., Beachy, P.A., 2002. Inhibition of Hedgehog signaling Marti, E., Bumcrot, D.A., Takada, R., McMahon, A.P., 1995. Requirement of 19 K form of by direct binding of cyclopamine to Smoothened. Genes Dev. 16, 2743–2748. Sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., Beachy, P.A., 375, 322–325. 1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene Martin, B.L., Peyrot, S.M., Harland, R.M., 2007. Hedgehog signaling regulates the amount of function. Nature 383, 407–413. hypaxial muscle development during Xenopus myogenesis. Dev. Biol. 304, 722–734. Cleaver, O., Tonissen, K.F., Saha, M.S., Krieg, P.A., 1997. Neovascularization of the Matise, M.P., Epstein, D.J., Park, H.L., Platt, K.A., Joyner, A.L., 1998. Gli2 is required for Xenopus embryo. Dev. Dyn. 210, 66–77. induction of floor plate and adjacent cells, but not most ventral neurons in the Conlon, F.L., Lyons, K.M., Takaesu, N., Barth, K.S., Kispert, A., Herrmann, B., Robertson, E.J., mouse central nervous system. Development 125, 2759–2770. 1994. A primary requirement for nodal in the formation and maintenance of the McKanna, J.A., 1993. Primitive glial compartments in the floor plate of mammalian primitive streak in the mouse. Development 120, 1919–1928. embryos: distinct progenitors of adult astrocytes and microglia support the Dale, L., Slack, J.M., 1987. Fate map for the 32-cell stage of Xenopus laevis. Development notoplate hypothesis. Perspect. Dev. Neurobiol. 1, 245–255. 99, 527–551. Minsuk, S.B., Keller, R.E., 1997. Surface mesoderm in Xenopus: a revision of the stage 10 de la Torre, J.R., Hopker, V.H., Ming, G.L., Poo, M.M., Tessier-Lavigne, M., Hemmati- fate map. Dev. Genes Evol. 207, 389–401. Brivanlou, A., Holt, C.E., 1997. Turning of retinal growth cones in a netrin-1 gradient Muller, F., Albert, S., Blader, P., Fischer, N., Hallonet, M., Strahle, U., 2000. Direct action of mediated by the netrin receptor DCC. Neuron 19, 1211–1224. the nodal-related signal cyclops in induction of sonic hedgehog in the ventral Dessaud,E.,Ribes,V.,Balaskas,N.,Yang,L.L.,Pierani,A.,Kicheva,A.,Novitch,B.G.,Briscoe,J., midline of the CNS. Development 127, 3889–3897. Sasai, N., 2010. Dynamic assignment and maintenance of positional identity in the ventral Mumm, J.S., Kopan, R., 2000. Notch signaling: from the outside in. Dev. Biol. 228, neural tube by the morphogen sonic hedgehog. PLoS Biol. 8, e1000382. 151–165. Ding, Q., Motoyama, J., Gasca, S., Mo, R., Sasaki, H., Rossant, J., Hui, C.C., 1998. Diminished Odenthal, J., Nusslein-Volhard, C., 1998. fork head domain genes in zebrafish. Dev. Sonic hedgehog signaling and lack of floor plate differentiation in Gli2 mutant mice. Genes Evol. 208, 245–258. Development 125, 2533–2543. Odenthal, J., van Eeden, F.J., Haffter, P., Ingham, P.W., Nusslein-Volhard, C., 2000. Two Dirksen, M.L., Jamrich, M., 1992. A novel, activin-inducible, blastopore lip-specificgeneof distinct cell populations in the floor plate of the zebrafish are induced by different Xenopus laevis contains a fork head DNA-binding domain. Genes Dev. 6, 599–608. pathways. Dev. Biol. 219, 350–363. Donoviel, D.B., Hadjantonakis, A.K., Ikeda, M., Zheng, H., Hyslop, P.S., Bernstein, A., 1999. Patten, I., Kulesa, P., Shen, M.M., Fraser, S., Placzek, M., 2003. Distinct modes of floor Mice lacking both presenilin genes exhibit early embryonic patterning defects. plate induction in the chick embryo. Development 130, 4809–4821. Genes Dev. 13, 2801–2810. Peyrot, S.M., Martin, B.L., Harland, R.M., 2010. Lymph heart musculature is under distinct Ekker, S.C., McGrew, L.L., Lai, C.J., Lee, J.J., von Kessler, D.P., Moon, R.T., Beachy, P.A., 1995. developmental control from lymphatic endothelium. Dev. Biol. 339, 429–438. Distinct expression and shared activities of members of the hedgehog gene family Pichon, B., Taelman, V., Kricha, S., Christophe, D., Bellefroid, E.J., 2002. XHRT-1, a hairy of Xenopus laevis. Development 121, 2337–2347. and Enhancer of split related gene with expression in floor plate and hypochord Etheridge, L.A., Wu, T., Liang, J.O., Ekker, S.C., Halpern, M.E., 2001. Floor plate develops during early Xenopus embryogenesis. Dev. Genes Evol. 212, 491–495. upon depletion of tiggy-winkle and sonic hedgehog. Genesis 30, 164–169. Placzek, M., Tessier-Lavigne, M., Jessell, T., Dodd, J., 1990a. Orientation of commissural Glinka, A., Wu, W., Delius, H., Monaghan, A.P., Blumenstock, C., Niehrs, C., 1998. axons in vitro in response to a floor plate-derived chemoattractant. Development Dickkopf-1 is a member of a new family of secreted proteins and functions in head 110, 19–30. induction. Nature 391, 357–362. Placzek, M., Tessier-Lavigne, M., Yamada, T., Jessell, T., Dodd, J., 1990b. Mesodermal Gray, S.D., Dale, J.K., 2010. Notch signalling regulates the contribution of progenitor cells from control of neural cell identity: floor plate induction by the notochord. Science 250, the chick Hensen's node to the floor plate and notochord. Development 137, 561–568. 985–988. Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W.S., Schier, A.F., 1999. The EGF- Placzek, M., Jessell, T.M., Dodd, J., 1993. Induction of floor plate differentiation by CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97, 121–132. contact-dependent, homeogenetic signals. Development 117, 205–218. Haigo, S.L., Harland, R.M., Wallingford, J.B., 2003. A family of Xenopus BTB-Kelch repeat Placzek, M., Dodd, J., Jessell, T.M., 2000. Discussion point. The case for floor plate proteins related to ENC-1: new markers for early events in floorplate and placode induction by the notochord. Curr. Opin. Neurobiol. 10, 15–22. development. Gene Expr. Patterns 3, 669–674. Przemeck, G.K., Heinzmann, U., Beckers, J., Hrabe de Angelis, M., 2003. Node and Hatta, K., Kimmel, C.B., Ho, R.K., Walker, C., 1991. The cyclops mutation blocks specification midline defects are associated with left–right development in Delta1 mutant of the floor plate of the zebrafish central nervous system. Nature 350, 339–341. embryos. Development 130, 3–13. Heyer, J., Escalante-Alcalde, D., Lia, M., Boettinger, E., Edelmann, W., Stewart, C.L., Kucherlapati, Rebagliati, M.R., Toyama, R., Haffter, P., Dawid, I.B., 1998. cyclops encodes a nodal-related R., 1999. Postgastrulation Smad2-deficient embryos show defects in embryo turning and factor involved in midline signaling. Proc. Natl Acad. Sci. USA 95, 9932–9937. anterior morphogenesis. Proc. Natl Acad. Sci. USA 96, 12595–12600. Ribes, V., Balaskas, N., Sasai, N., Cruz, C., Dessaud, E., Cayuso, J., Tozer, S., Yang, L.L., Julich, D., Hwee Lim, C., Round, J., Nicolaije, C., Schroeder, J., Davies, A., Geisler, R., Lewis, Novitch, B., Marti, E., Briscoe, J., 2010. Distinct Sonic Hedgehog signaling dynamics J., Jiang, Y.J., Holley, S.A., 2005. beamter/deltaC and the role of Notch ligands in the specify floor plate and ventral neuronal progenitors in the vertebrate neural tube. zebrafish somite segmentation, hindbrain neurogenesis and hypochord differen- Genes Dev. 24, 1186–1200. tiation. Dev. Biol. 286, 391–404. Roelink, H., Augsburger, A., Heemskerk, J., Korzh, V., Norlin, S., Ruiz i Altaba, A., Tanabe, Keller, R.E., 1975. Vital dye mapping of the gastrula and neurula of Xenopus laevis. I. Y., Placzek, M., Edlund, T., Jessell, T.M., et al., 1994. Floor plate and motor neuron Prospective areas and morphogenetic movements of the superficial layer. Dev. Biol. induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord. 42, 222–241. Cell 76, 761–775. Keller, R.E., 1976. Vital dye mapping of the gastrula and neurula of Xenopus laevis. II. Roelink, H., Porter, J.A., Chiang, C., Tanabe, Y., Chang, D.T., Beachy, P.A., Jessell, T.M., 1995. Prospective areas and morphogenetic movements of the deep layer. Dev. Biol. 51, Floor plate and motor neuron induction by different concentrations of the amino- 118–137. terminal cleavage product of sonic hedgehog autoproteolysis. Cell 81, 445–455. Kim, S.H., Yamamoto, A., Bouwmeester, T., Agius, E., Robertis, E.M., 1998. The role of Ruiz i Altaba, A., Jessell, T.M., 1992. Pintallavis, a gene expressed in the organizer and paraxial protocadherin in selective adhesion and cell movements of the mesoderm midline cells of frog embryos: involvement in the development of the neural axis. during Xenopus gastrulation. Development 125, 4681–4690. Development 116, 81–93. 266 S.M. Peyrot et al. / Developmental Biology 352 (2011) 254–266

Ruiz i Altaba, A., Prezioso, V.R., Darnell, J.E., Jessell, T.M., 1993. Sequential expression of Spemann, H., Mangold, H., 1924. Induction of embryonic primordia by implantation of HNF-3 beta and HNF-3 alpha by embryonic organizing centers: the dorsal lip/node, organizers from a different species. 1923. Int. J. Dev. Biol. 45, 13–38. notochord and floor plate. Mech. Dev. 44, 91–108. Strahle, U., Jesuthasan, S., Blader, P., Garcia-Villalba, P., Hatta, K., Ingham, P.W., 1997. Ruiz i Altaba, A., Jessell, T.M., Roelink, H., 1995. Restrictions to floor plate induction by one-eyed pinhead is required for development of the ventral midline of the hedgehog and winged-helix genes in the neural tube of frog embryos. Mol. Cell. zebrafish (Danio rerio) neural tube. Genes Funct. 1, 131–148. Neurosci. 6, 106–121. Strahle, U., Lam, C.S., Ertzer, R., Rastegar, S., 2004. Vertebrate floor-plate specification: Saha, M.S., Michel, R.B., Gulding, K.M., Grainger, R.M., 1993. A Xenopus homeobox gene variations on common themes. Trends Genet. 20, 155–162. defines dorsal–ventral domains in the developing brain. Development 118, 193–202. Takabatake, T., Takahashi, T.C., Takabatake, Y., Yamada, K., Ogawa, M., Takeshima, K., Sampath, K., Rubinstein, A.L., Cheng, A.M., Liang, J.O., Fekany, K., Solnica-Krezel, L., 2000. Distinct expression of two types of Xenopus Patched genes during early Korzh, V., Halpern, M.E., Wright, C.V., 1998. Induction of the zebrafish ventral brain embryogenesis and hindlimb development. Mech. Dev. 98, 99–104. and floorplate requires cyclops/nodal signalling. Nature 395, 185–189. Teillet, M.A., Lapointe, F., Le Douarin, N.M., 1998. The relationships between notochord Sander, V., Reversade, B., De Robertis, E.M., 2007. The opposing homeobox genes and floor plate in vertebrate development revisited. Proc. Natl Acad. Sci. USA 95, Goosecoid and Vent1/2 self-regulate Xenopus patterning. EMBO J. 26, 2955–2965. 11733–11738. Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L.K., De Robertis, E.M., 1994. Xenopus Tessier-Lavigne, M., Placzek, M., Lumsden, A.G., Dodd, J., Jessell, T.M., 1988. chordin: a novel dorsalizing factor activated by organizer-specific homeobox Chemotropic guidance of developing axons in the mammalian central nervous genes. Cell 79, 779–790. system. Nature 336, 775–778. Schafer, M., Kinzel, D., Neuner, C., Schartl, M., Volff, J.N., Winkler, C., 2005a. Hedgehog Tian,J.,Yam,C.,Balasundaram,G.,Wang,H.,Gore,A.,Sampath,K.,2003. and retinoid signalling confines nkx2.2b expression to the lateral floor plate of the A temperature-sensitive mutation in the nodal-related gene cyclops reveals that zebrafish trunk. Mech. Dev. 122, 43–56. the floor plate is induced during gastrulation in zebrafish. Development 130, Schafer, M., Rembold, M., Wittbrodt, J., Schartl, M., Winkler, C., 2005b. Medial floor plate 3331–3342. formation in zebrafish consists of two phases and requires trunk-derived Midkine- Varlet, I., Collignon, J., Robertson, E.J., 1997. nodal expression in the primitive endoderm a. Genes Dev. 19, 897–902. is required for specification of the anterior axis during mouse gastrulation. Schafer, M., Kinzel, D., Winkler, C., 2007. Discontinuous organization and specification Development 124, 1033–1044. of the lateral floor plate in zebrafish. Dev. Biol. 301, 117–129. von Dassow, G., Schmidt, J.E., Kimelman, D., 1993. Induction of the Xenopus organizer: Schauerte, H.E., van Eeden, F.J., Fricke, C., Odenthal, J., Strahle, U., Haffter, P., 1998. Sonic expression and regulation of Xnot, a novel FGF and activin-regulated homeo box hedgehog is not required for the induction of medial floor plate cells in the gene. Genes Dev. 7, 355–366. zebrafish. Development 125, 2983–2993. Wettstein, D.A., Turner, D.L., Kintner, C., 1997. The Xenopus homolog of Drosophila Serafini, T., Colamarino, S.A., Leonardo, E.D., Wang, H., Beddington, R., Skarnes, W.C., Suppressor of Hairless mediates Notch signaling during primary neurogenesis. Tessier-Lavigne, M., 1996. Netrin-1 is required for commissural axon guidance in Development 124, 693–702. the developing vertebrate nervous system. Cell 87, 1001–1014. Wijgerde, M., McMahon, J.A., Rule, M., McMahon, A.P., 2002. A direct requirement for Shook, D.R., Majer, C., Keller, R., 2004. Pattern and morphogenesis of presumptive Hedgehog signaling for normal specification of all ventral progenitor domains in superficial mesoderm in two closely related species, Xenopus laevis and Xenopus the presumptive mammalian spinal cord. Genes Dev. 16, 2849–2864. tropicalis. Dev. Biol. 270, 163–185. Wills, A.E., Choi, V.M., Bennett, M.J., Khokha, M.K., Harland, R.M., 2009. BMP antagonists Sive, H.L., Grainger, R.M., Harland, R.M., 2000. Early Development of Xenopus laevis: and FGF signaling contribute to different domains of the neural plate in Xenopus. A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor. Dev. Biol. 10, 10. Smith, J.C., Price, B.M., Green, J.B., Weigel, D., Herrmann, B.G., 1991. Expression of a Yamada, T., Placzek, M., Tanaka, H., Dodd, J., Jessell, T.M., 1991. Control of cell pattern in Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm the developing nervous system: polarizing activity of the floor plate and notochord. induction. Cell 67, 79–87. Cell 64, 635–647. Solter,M.,Koster,M.,Hollemann,T.,Brey,A.,Pieler,T.,Knochel,W.,1999. Yamada, T., Pfaff, S.L., Edlund, T., Jessell, T.M., 1993. Control of cell pattern in the neural Characterization of a subfamily of related winged helix genes, XFD-12/12'/12" tube: motor neuron induction by diffusible factors from notochord and floor plate. (XFLIP), during Xenopus embryogenesis. Mech. Dev. 89, 161–165. Cell 73, 673–686.