PGC-1A Protects from Notch-Induced Kidney Fibrosis Development

BASIC RESEARCH www.jasn.org

PGC-1a Protects from Notch-Induced Kidney Fibrosis Development

† ‡ ‡ Seung Hyeok Han,* Mei-yan Wu, § Bo Young Nam, Jung Tak Park,* Tae-Hyun Yoo,* ‡ † † † † Shin-Wook Kang,* Jihwan Park, Frank Chinga, Szu-Yuan Li, and Katalin Susztak

*Department of Internal Medicine, Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; †Renal Electrolyte and Hypertension Division, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; ‡Severance Biomedical Science Institute, Brain Korea 21 PLUS, Yonsei University College of Medicine, Seoul, Korea; and §Department of Nephrology, The First Hospital of Jilin University, Changchun, China

ABSTRACT Kidney fibrosis is the histologic manifestation of CKD. Sustained activation of developmental pathways, such as Notch, in tubule epithelial cells has been shown to have a key role in fibrosis development. The molecular mechanism of Notch-induced fibrosis, however, remains poorly understood. Here, we show that, that expression of peroxisomal proliferation g-coactivator (PGC-1a) and fatty acid oxidation-related genes are lower in mice expressing active Notch1 in tubular epithelial cells (Pax8-rtTA/ICN1) compared to littermate controls. Chromatin immunoprecipitation assays revealed that the Notch target gene Hes1 directly binds to the regulatory region of PGC-1a. Compared with Pax8-rtTA/ICN1 transgenic animals, Pax8-rtTA/ICN1/Ppargc1a transgenic mice showed improvement of renal structural alterations (on histology) and molecular defect (expression of profibrotic genes). Overexpression of PGC-1a restored mitochondrial content and reversed the fatty acid oxidation defect induced by Notch overexpression in vitro in tubule cells. Furthermore, compared with Pax8-rtTA/ICN1 mice, Pax8-rtTA/ICN1/Ppargc1a mice exhibited improvement in renal fatty acid oxidation gene expression and apoptosis. Our results show that metabolic dysregulation has a key role in kidney fibrosis induced by sustained activation of the Notch developmental pathway and can be ameliorated by PGC-1a.

J Am Soc Nephrol 28: 3312–3322, 2017. doi: https://doi.org/10.1681/ASN.2017020130

Chronic kidney disease (CKD) has become an Renal tubular epithelial cells (RTECs) represent important public health problem worldwide. It is .90% of the kidney mass. RTECs are fundamental diagnosed by either reduction of the eGFR, quan- to maintain fluid and electrolyte balance, and they tified as estimated glomerular filtration rate transport a large amount of water, electrolytes, and (eGFR),60 ml/min per 1.73 m2,orabnormalleak- other small molecules from the primary filtrate. iness of the glomerulus to albumin as urine albu- RTECs have high baseline metabolic needs. RTECs min-to-creatinine ratio .30 mg/g.1 Patients with mostly rely on fatty acids as their primary fuel CKD have at least three- to fivefold greater mortality rate compared with matched subjects without CKD.2–4 Received February 4, 2017. Accepted June 6, 2017. Interstitial fibrosis shows the strongest correla- S.H.H. and M.Y.W. contributed equally to this work. fi tion with future functional decline. Kidney brosis Published online ahead of print. Publication date available at is the final common pathway that is observed in all www.jasn.org. forms of CKD. Fibrosis represents a complex archi- Correspondence: Dr. Katalin Susztak, Perelman School of tectural change characterized by glomerulosclerosis; Medicine, University of Pennsylvania, 415 Curie Boulevard, 405 tubular atrophy; accumulation of myofibroblast, Clinical Research Building, Philadelphia, PA 19104. Email: collagen, and inflammatory cells; and peritubular [email protected] capillary loss.5 Copyright © 2017 by the American Society of Nephrology

3312 ISSN : 1046-6673/2811-3312 JAmSocNephrol28: 3312–3322, 2017 www.jasn.org BASIC RESEARCH

mitochondrial network to support their metabolic and functional needs.6,7 Patients and animal models of CKD are characterized bysustainedexpression of developmental genes, such as Wnt, Notch, and Hedgehog, in RTECs. Studies have shown the critical role and contribution of these pathways to kidney fibrosis development.8–11 Notch is a well known master regulator of cell specification, differentia- tion, and tissue patterning. In mammals, there are four Notch receptors (Notch1 to -4) and two classes of canonical ligands: Jagged 1 and 2 and Delta-like ligand 1, 3, and 4. The canonical Notch signaling pathway is initiated when the ligand binds to Notch receptors, thus causing proteo- lytic cleavage on the extracellular face by an ADAM/TACE protease and the intracellular side of the plasma membrane by g-secretase. After the cleavage, the Notch intracellular domain translocates to the nu- cleus and forms a complex with RBPj and Mastermind-like proteins, leading to transcription of Notch target genes, such as helix-loop-helix proteins of the Hes and Hey families. Notch signaling is a crucial regulator of kidney development, although it is expressed at low level in normal healthy adults.12 It is hypothesized that, in CKD kidneys, Notch is activated in tubule cells in response to injury and cell death, likely as part of an injury repair mechanism.9,10,13,14 Sus- tained and high Notch expression seems to be harmful. Tubule-specific expression of Notch induces severe epithelial dedifferentiation and interstitial fibrosis and death of the animals. Notch is not only sufficient but also, necessary for fibrosis develop- Figure 1. Decreased PGC-1a expression in animal models of kidney disease. (A) ment, because inhibition of Notch signal- Representative periodic acid–Schiff-stained kidney sections of Pax8-rtTA/tetO-ICN1 ing attenuates tubulointersitial fibrosis in a transgenic and control mice. (B and C) Ppargc1a transcript levels in (B) Pax8-rtTA/ mousemodeloffolicacid– and ureteral tetO-ICN1 transgenic animals and (C) cultured renal tubule cells expressing Notch1. obstruction–induced fibrosis.10 (D and E) Western blot images of PGC-1a protein expression levels in (D) Pax8-rtTA/ The mechanism of Notch-induced fi- tetO-ICN1 transgenic animals and (E) cultured renal tubule cells expressing Notch1. brosis is poorly understood. Several path- (F) Immunohistochemical staining of PGC-1a in Pax8-rtTA/tetO-ICN1 transgenic ani- fi ways have been proposed to contribute to mals. (G) Transcript levels of Ppargc1a in whole-kidney lysates of three different - fi brosis models induced by folic acid (FA), unilateral ureteral obstruction (UUO), and Notch-induced development of brosis, APOL1 transgenic expression. including dedifferentiation, partial epithelial-to-mesenchymal transition (EMT), and enhanced proliferation.12,15 The role source and generate energy via mitochondrial oxidative of these pathways has not been substantiated by in vivo studies. phosphorylation. RTECs, therefore, have high levels of perox- We hypothesized that metabolic alteration mediates the Notch isomal proliferator–activated receptor-a (PPARa), peroxi- (development pathway)–induced kidney fibrosis develop- somal proliferator–g coactivator-1a (PGC-1a), and a dense ment, and we particularly tested the role of PGC-1a.

J Am Soc Nephrol 28: 3312–3322, 2017 PGC-1a Protects from Notch1-Induced Kidney Injury 3313 BASIC RESEARCH www.jasn.org

expression of apo L1 (Figure 1G). These ﬁndings suggest that the decrease in expression of PGC-1a is consistent among all of the analyzed animal models of ﬁbrosis and CKD.

Decreased PGC-1a Expression in Human Kidneys with Fibrosis Next, we examined the expression of PGC- 1a in patients with kidney disease. We quantified transcript levels of PPARGC1A in 95 microdissected human kidney tubule samples by Affymetrix microarrays.16,17 CKD was defined by reduced eGFR (,60 ml/min per 1.73 m2) as per the National Kidney Foundation guidelines.1 In our dataset, 39 (41.1%) samples met the crite- ria for CKD.18 As expected, CKD samples also showed significantly higher glomerulosclerosis and interstitial fibrosis. Demo- graphics and clinical characteristics of these samples are shown in Supplemental Table 1. We found that, in patient samples, PPARGC1A transcript levels significantly and positively correlated with fi Figure 2. Decreased PGC-1a expression in human brotic kidney samples. (A) Cor- eGFR (Figure 2A) and negatively corre- relation between eGFR and PPARGC1A transcript level. (B) Correlation between lated with interstitial fibrosis (Figure 2B). interstitial fibrosis and PPARGC1A transcript level. (C) Representative images of fl a Immunohistochemical analysis con- double-immuno uorescence staining with antibodies against PGC-1 and Notch1 in fi control and diseased human samples. rmed the transcript-level data. Double- immunofluorescence study showed that PGC-1a was expressed in bot proximal RESULTS and distal tubules (Supplemental Figure 1). The nuclear expression of PGC-1a was evident by immunostaining of con- Decreased PGC-1a Expression in Animal Models of trolhumankidneys,butitwassignificantly decreased in CKD Kidney Disease (Figure 2C). Notably, the staining remained on healthy seg- As we described earlier, conditional inducible expression of ments of diseased kidneys. In summary, our analysis indicates Notch1 in tubule cells (in the Pax8-rtTA/tetO-ICN1 transgenic that PGC-1a expression correlates with kidney function in mice) resulted in the development of severe fibrosis (Figure patient samples. 1A). Transcript levels of Ppargc1a were significantly reduced in We have also performed double-immunofluorescence whole-kidney samples of these transgenic animals compared staining with antibodies against Notch1 and PGC-1a in hu- with controls (Figure 1B). Similarly, in vitro expression of man kidney samples. Interestingly, in tubules with high ex- Notch1 in cultured tubule cells resulted in reduced PGC-1a pression of Notch1, PGC-1a expression was low. In contrast, expression, indicating an inverse association between Notch Notch1 staining was weak in tubules with high PGC-1a activ- and PGC-1a (Figure 1C). These findings were further con- ity (Figure 2C). This finding suggests an inverse relationship firmed at protein levels by Western blot analyses (Figure 1, D between Notch signaling and PGC-1a. and E) and immunohistochemistry (Figure 1F). Tounderstand the generalizability of these observations, we Notch1 Directly Regulates PGC-1a examined Ppargc1a expression in different mouse models of We then explored the cellular and molecular mechanisms by kidney fibrosis. Gene expression changes were analyzed by which Notch1 signaling regulates PGC-1a in RTECs. Using RNA sequencing of whole-kidney lysates. PGC-1a level was microarray data from human kidney tubule samples, we ex- reduced in toxin (folic acid)–induced kidney fibrosis and mice amined the correlation between PPARGC1A and Notch path- with obstruction (unilateral ureteral obstruction)–related kid- way genes. We found that, among several Notch receptors, ney disease. Furthermore, PGC-1a expression was similarly ligands, and target genes, HES1 shows the strongest correla- reduced in a genetic model of CKD induced by transgenic tion with PPARGC1A (Figure 3A, Supplemental Table 2).

3314 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 3312–3322, 2017 www.jasn.org BASIC RESEARCH

harboring Pax8-rtTA/tetO-ICN1 to create Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a mice (Figure 4A). Littermates of tetO-ICN1 or tetO-Ppargc1a mice (without Pax8-rtTA) served as controls. As expected, transcript levels of ICN1 in whole-kidney tissue of Pax8-rtTA/tetO-ICN1 and Pax8-rtTA/ tetO-ICN1/tetO-Ppargc1a mice were significantly higher than in control animals. In addition, mRNA expression levels of Notch target genes, Hes1 and Hey1,were also higher in mice overexpressing Notch1 (Figure 4B). The mRNA expression of Ppargc1a was significantly increased in mice with tubule-specificPGC-1a expression (Figure 4B). Western blot analyses also confirmed these results (Figure 4C). At baseline, Pax8-rtTA/tetO-Ppargc1a mice did not show gross or histologic abnormalities and were born at the expected Mendelian ratio. As described above, the Figure 3. Hes1 directly regulates PGC-1a. (A) Correlation between PPARGC1A and HES1 transcript levels in 95 microdissected human kidney tubule samples. (B) ChIP Pax8-rtTA/tetO-ICN1 mice became very assay using a primer spanning the putative Hes1-responsive element region within the sick and died at around approximately 6 N-box flanking region of Ppargc1a. (C) ChIP assay after knockdown (KD) of ICN1 and weeks after the initiation of doxycycline- ICN1 plasmid transfection. (D) Luciferase reporter activity assay using TECs obtained containing chow. from primary culture after cotransfection of pGL3-PGC-1a and Hes1 plasmid or Hes1- We did not observe gross phenotypic deficient plasmid. abnormalities or increased mortality in triple-transgenic (Pax8-rtTA/tetO-ICN1/ Therefore, we hypothesized that Hes1 might be directly regu- tetO-Ppargc1a) animals. Animals were euthanized 6 weeks lating the expression of PGC-1a.Totestthishypothesis,we after the initiation of doxycycline-containing food. As seen performed chromatin immunoprecipitation (ChIP) assay us- in our previous studies, kidneys were enlarged in Pax8-rtTA/ ing primers spanning the putative Hes1-responsive element tetO-ICN1 mice compared with controls (Figure 5A). Normal region within the N-box flanking region of Ppargc1a. This re- renal architecture was lost, and kidneys showed severe tubular gion has been reported to have regulatory function in mouse degeneration, dilation, and interstitial fibrosis (Figure 5B). RTECs.19 The ChIP assay indicated direct binding of Hes1 to The interstitium was widened with accumulation of matrix the Ppargc1a promoter region (Figure 3B). The enrichment of and activated myofibroblasts. In contrast, kidney size was Hes1 binding region in the Ppargc1a promoter was signifi- close to normal in Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a cantly decreased by Hes1 knockdown, whereas it was in- mice. Tubule dilation was significantly attenuated, and fibrosis creased by Intracellular Notch1 (ICN1) plasmid transfection was markedly ameliorated in triple-transgenic mice compared (Figure 3C). To substantiate this finding, we also carried out a with Pax8-rtTA/tetO-ICN1 mice (Figure 5B). luciferase reporter assay. Ppargc1a promoter–driven luciferase In line with the morphologic alterations, quantitative real- reporter activity was significantly lower on Hes1 overexpres- time PCR (qPCR) analysis showed that transcript levels sion. In contrast, Hes1 overexpression significantly decreased of profibrotic genes, such as procollagen 1al (Procol1a1), this activity (Figure 3D). These findings together suggest that Procol3a1, fibronectin (Fn), and smooth muscle a-actin, were the transcriptional repressor Hes1 (a downstream target of significantly increased in Pax8-rtTA/tetO-ICN1 mice com- Notch1 signaling) can directly regulate Ppargc1a in RTECs. pared with control and Pax8-rtTA/tetO-Ppargc1a mice (Figure 6A). In addition, expressions of inflammatory markers, such Tubule-Specific Overexpression of Ppargc1a as Cd68 and F4/80, were significantly higher in mice with Ameliorates Notch1-Induced Kidney Injury ICN1 overexpression (Supplemental Figure 2). These changes Next, we hypothesized that decreased PGC-1a expression were significantly reduced in Pax8-rtTA/tetO-ICN1/tetO- and a downstream metabolic defect are involved in Notch-in- Ppargc1a mice. Masson trichrome staining, which showed duced fibrosis development in vivo. To investigate the func- severe fibrosis in mice expressing Notch1, indicated significant tional role of PGC-1a, we generated mice with conditional attenuation in mice expressing PGC-1a (Figure 6B). In sum- inducible overexpression of Ppargc1a in RTECs, and we mary, mice with tubule-specific expression of PGC-1a were crossed mice expressing Pax8-rtTA/tetO-Ppargc1a with mice protected from Notch1-induced kidney fibrosis.

J Am Soc Nephrol 28: 3312–3322, 2017 PGC-1a Protects from Notch1-Induced Kidney Injury 3315 BASIC RESEARCH www.jasn.org

contrast, mitochondrial structure was lost, and mitochondria appeared fragmen- ted small and round in RTECs expressing ICN1. Morphologic alterations in mitochondria were almost abrogated in ICN1- expressing cells on PGC-1a expression (Figure 7A). In parallel, PGC-1a expression also attenuated the Notch-induced reduction of mitochondrial transcripts, such as Tfam and mtDNA, in cells expressing ICNotch1 (Figure 7C). We then examined transcript levels of fatty acid oxidation–related genes induced by Notch expression (Figure 7D). Cells expressing ICN1 plasmid had significantly reduced transcript levels of Ppargc1a, car- nitine palmitoyl transferase 1 (Cpt1), and Acox. These alterations were attenuated by PGC-1a cotransfection. Notch expression in TECs resulted in increased expression of profibrotic genes. The increased expression of profibrotic genes, such as Procol1a and Fn, were attenuated by PGC-1a.Insummary,inculturedcells, Notch induced changes of mitochondrial transcript level and structural mitochondrial defects. PGC-1a reversed mitochondrial defects induced by Notch expression.

PGC-1a Attenuates Alteration of Fatty Acid Oxidation and Notch1- Induced Kidney Injury In Vivo Next, we examined the effects of PGC-1a on Notch1-induced kidney injury in vivo. We quantified transcript levels of genes re- Figure 4. Generation of mice with conditional inducible overexpression of ICN-1 and lated to fatty acid oxidation. In Pax8-rtTA/ Ppargc1a. (A) Schematic figure depicting generation of mice with tubule-specific tetO-ICN1 mice, mRNA expression levels overexpression of ICN-1 and Ppargc1a. (B) qPCR analysis of ICN1, Hes1, Hey1,and of Cpt1 and Acox1 were significantly de- Ppargc1a transcript levels in kidneys of control, Pax8-rtTA/tetO-Ppargc1a, Pax8-rtTA/ creased compared with in control mice. tetO-ICN1, and Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a mice. (C) Western blot images PGC-1a expression almost completely of ICN1, Hes1, and PGC-1a protein levels in the same mice. normalized Cpt1 and Acox1 levels in vivo (Figure 8A). Western blot analysis revealed PGC-1a Restores Impaired Mitochondrial Morphology that protein levels of phosphoacetyl-CoA carboxylase and and Fatty Acid Oxidation Defect Induced by Notch1 CPT1 were significantly decreased in Pax8-rtTA/tetO-ICN1 Overexpression In Vitro mice but restored in Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a PGC-1a is a key regulator of mitochondria biogenesis. Thus, mice (Figure 8B). we then evaluated morphologic changes of mitochondria in Previously, we showed that tubule epithelial cell prolifera- TECs overexpressing ICN1 and/or PGC-1a.Primarytubule tion was increased in Pax8-rtTA/tetO-ICN1 mice.10 Immuno- cells were transfected with Notch1- and PGC-1a–containing histochemical staining showed an increased number of plasmids. Expressions of Notch target genes (such as Hes1) PCNA- and Ki67-positive cells in Pax8-rtTA/tetO-ICN1 were increased after ICN1 transfection (data not shown). Elec- mice, which was significantly lower in Pax8-rtTA/tetO-ICN1/ tron microscopic analysis identified normally looking tetO-Ppargc1a mice (Supplemental Figure 3). and elongated mitochondria with intact cristae in TECs trans- Next, we tested whether Notch1-induced apoptotic cell fected with control (pcDNA3) or PGC-1a plasmids. By death was also attenuated by PGC-1a. qPCR analysis indicated

3316 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 3312–3322, 2017 www.jasn.org BASIC RESEARCH

role of EMT in fibrosis development is a highly controversial issue.21 Here, we specifically asked the ques- tion of whether metabolic alterations are involved in Notch-induced fibrotic pro- cess. Our gene array analysis highlighted the lower expression of PGC-1a, mitochondrial transcripts, and enzymes involved in fatty acid oxidation. In addition, we evaluated the direct interaction between Notch1 and PGC-1a by ChIP and luciferase reporter assays and found that Notch signaling directly modulates transcriptional activity of PGC-1a in RTECs. Sev- eral recent reports suggest that Notch is a key regulator of metabolism.19,22,23 Astudy by Bi et al.19 showed that constitutive activation of Notch signaling inhibits Ppargc1a transcription in white adipo- Figure 5. Phenotypic characterization of kidneys from Pax8-rtTA/tetO-Ppargc1a, cytes, showing the binding of Hes1 to Pax8-rtTA/tetO-ICN1, and Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a mice. (A) Gross mor- the Ppargc1a regulatory region. Taken to- – phology. (B) Representative images of periodic acid Schiff-stained kidney sections gether, these findings suggest that PGC- from control, Pax8-rtTA/tetO-Ppargc1a, Pax8-rtTA/tetO-ICN1,andPax8-rtTA/tetO- 1a seems to be a direct target of RTECs. ICN1/tetO-Ppargc1a mice. PGC-1a is a master regulator of mitochondrial biogenesis.24 Mitochondria that mRNA expression levels of B cell CLL/lymphoma 2 (Bcl2), are the powerhouse of the cell, and they play an important role an antiapoptotic gene, were significantly lower in Pax8-rtTA/ in cellular homeostasis. Because RTECs have high energy– tetO-ICN1 mice (Figure 9A) and RTECs transfected with the demanding function, mitochondrial dysfunction and reduced ICN1 plasmid (Figure 9B). Western blot analysis confirmed energy supply have been described in patients and animal the decreased BCL2 levels in mice with tubule-specific Notch1 models of CKD. Dysfunctional mitochondria eventually overexpression (Figure 9C). Notch transgenic mice also jeopardize cell viability,25,26 leading to cell death and dedif- showed increased cleaved caspase 3 levels, likely consistent ferentiation. PGC-1a orchestrates mitochondrial biogenesis with increased apoptosis. Ppargc1a expression protected by interacting with estrogen-related receptor-a, peroxisome from the Notch induced increased apoptosis as examined by proliferator–activated receptors, and nuclear respiratory cleaved caspase 3 immunostaining (Figure 9D). In summary, factors 1 and 2, thereby increasing mitochondrial mass in vivo expression of PGC-1a improved fatty acid oxidation, and overall mitochondrial function.6,27,28 reduced apoptosis, and ameliorated kidney fibrosis. Earlier studies indicated that mRNA expression of Ppargc1a was decreased in models of AKI by cisplantin.29 Transcript levels of PPARGC1A were notably decreased in patients with DISCUSSION CKD compared with controls.30 In addition, mRNA expression of Ppargc1a was significantly reduced in not only models Sustained Notch activation has been described in patients and of Notch1 but also, unilateral ureteral obstruction–, folic acid– mouse models of CKD.8–10 Notch activation is likely second- and APOL1-induced fibrosis models. Here, we show that ary to kidney injury and a part of a regenerative response. PGC-1a is not only regulated by Notch but is involved in Indeed, increased activity of other regenerative pathways, Notch-induced fibrosis development. Transgenic expression such as Wnt and Hedgehog, has also been shown in fibrosis. of PGC-1a was able to ameliorate Notch-induced fibrosis Increased Notch activity is associated with higher tubule pro- development. Our results indicate that metabolic dysregu- liferation. Notch-induced proliferation may play an impor- lation plays a key role in cellular dedifferentiation and that tant role in epithelial repair and regeneration after an acute providing sufficient metabolic input can prevent RTECs injury.12 In animal models of CKD, sustained Notch expres- from Notch-induced dedifferentiation, death, and fibrosis sioninRTECsisbothsufficient and necessary for fibrosis development. development and disease progression. This study aimed to In conclusion, in this study, we showed that Notch induces elucidate the mechanism of Notch-induced development of downregulation of PGC-1a, impairment of fatty acid oxida- fibrosis in renal tubule cells. During development and in in tion, and mitochondrial dysfunction. PGC-1a is a direct vitro settings, Notch is a strong inducer of EMT,15,20 but the Notch target gene, and genetic re-expression of PGC-1a in

J Am Soc Nephrol 28: 3312–3322, 2017 PGC-1a Protects from Notch1-Induced Kidney Injury 3317 BASIC RESEARCH www.jasn.org

accordance with the National InstitutesofHealthguidelinesand approved by the Animal Care Committee at Perelman School of Medicine, University of Pennsylvania.

qPCR Analyses We compared transcript levels of genes related to Notch signaling, b-oxidation, apoptosis, and dedifferentiation (Procol1a1, Procol3a1, Fn,andsmooth muscle a-actin) by qPCR. To this end, total RNA samples from mouse kidney were prepared using the RNeasy Mini Kit (Qiagen, Valencia, CA). We examined the RNA quality on agarose gels and determined the quantity using NanoDrop. Next, 1 mgtotal RNA was reverse transcribed using the cDNA Archival Kit (Applied Biosystems). We performed qPCR analysis on a ViiA Seven Real- Time PCR System (Life Technologies) with the SYBR Green Master Mix using three-step standard cycling conditions with sequence-specific primers. The sequences of primers are presented inTable1.Weexaminedthemeltingcurvetoconfirm that a single PCR product was amplified. For quantitative analysis, samples were normalized to Ubiquitin C gene expression by the DDCT value method.

Mitochondrial DNA Analyses Genomic DNA was extracted from kidney and cells using a commer- cially available kit (Wizard Genomic DNA Purification Kit; Promega, Madison, WI) according to the manufacturerʼsinstructions.qPCR was then conducted with primers specific for the mtDNA-encoded Cox1 gene and the nuclear-encoded Ndufv1 gene; the relative Figure 6. Tubule-specific overexpression of Ppargc1a amelio- mtDNA copy number was presented as the mtDNA-to-nuclear rates Notch1-induced kidney injury. (A) Transcript levels of Procol1a1, Procol3a1, Fn1,andsmooth muscle a-actin (Acta2) DNA ratio. in whole-kidney lysates of Pax8-rtTA/tetO-Ppargc1a, Pax8- rtTA/tetO-ICN1,andPax8-rtTA/tetO-ICN1/tetO-Ppargc1a Western Blot Analyses mice. (B) Representative images of Masson trichrome staining of Protein expression levels of key enzymes of the fatty acid oxidation each group. pathway and apoptosis markers were examined by Western blot analyses. We prepared cell lysates in RIPA lysis buffer RTECs abrogates Notch-induced kidney fibrosis. Our findings containing a protease inhibitor cocktail (cOmplete Mini; Roche) suggest that metabolic pathways play a key role in Notch (a and phosphatase inhibitor (PhosSTOP; Roche). Proteins were resolved developmental pathway)-induced fibrosis development and by electrophoresis on 5%–15% gradient gels, transferred onto polyviny- that restoration of PGC-1a activity could be a promising lidene difluoride membranes, and probed with the antibodies against treatment strategy against CKD. the following proteins; phosphoacetyl-CoA carboxylase (3661; Cell Signaling Technology), CPT1 (ab176320; Abcam, Cambridge, United Kingdom), Hes1 (ab108937; Abcam), activated Notch1 (ab8925; CONCISE METHODS Abcam), PGC-1a (ab54481; Abcam), BCL2 (sc-509; Santa Cruz Bio- technology, Santa Cruz, CA), cleaved caspase 3 (9664; Cell Signaling Generation of Mice Overexpressing ICN1 and/or Technology), and b-actin (A5316; Sigma-Aldrich). A horseradish Ppargc1a in the RTECs peroxidase–conjugated anti-rabbit (7074; Cell Signaling Technology) or Transgenic mice harboring the tetO-ICN1 transgenehavebeen anti-mouse IgG antibody (7076; Cell Signaling Technology) was served described previously.31 FVB-Tg (tetO-Ppargc1a)1Dpk/J mice were as a secondary antibody. After repeated washes, the membrane was devel- purchased from the Jackson Laboratory. To generate mice with con- oped by chemiluminescence (Western Lightning-ECL; Thermo Scientific). ditional inducible expression of Notch1 and PGC-1a in RTECs, Toquantify the band densities, we used ImageJ v1.49 software (National Pax8-rtTA mice were crossed with tetO-ICN1 and tetO-Ppargc1a Institutes of Health, Bethesda, MD; online at http://rsbweb.nih.gov/ij). mice, respectively. We identified transgenic mice by genomic PCR analysis using transgene-specific primers. The primer sequences for Histology and Immunohistochemistry tetO-ICN1 and tetO-Ppargc1a are presented in Table 1. Mice were put To evaluate histologic features, formalin-fixed, paraffin-embedded on a doxycycline-containing chow diet (Bioserv S3888) starting at kidney sections were stained with periodic acid–Schiff.Wealso 4 weeks of age. Animal care and experiments were performed in performed Masson trichrome staining and immunohistochemical

3318 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 3312–3322, 2017 www.jasn.org BASIC RESEARCH

Figure 7. PGC-1a restores the impaired mitochondrial morphology and fatty acid oxidation pathway induced by Notch1 overexpression. (A) Representative transmission electron microscopy images of TECs transfected with pcDNA3, PGC-1a, ICN1, and ICN1/ PGC-1a plasmids. (B) The mRNA expression of Tfam and mtDNA in control, Pax8-rtTA/tetO-Ppargc1a, Pax8-rtTA/tetO-ICN1,and Pax8-rtTA/tetO-ICN1/tetO-Ppargc1a mice and (C) cultured TECs transfected with pcDNA3, PGC-1a, ICN1, and ICN1/PGC-1a plasmids. (D) qPCR assay for fatty acid oxidation–related proﬁbrotic markers in controls and TECs transfected with PGC-1a, ICN1, and ICN1/PGC-1a plasmids.

analysis. All slide pictures were captured using an Olympus DP73 3% H2O2 for 10 minutes. The slices were blocked in 0.2% fish skin microscope. gelatin for 60 minutes at room temperature and incubated over- For Masson trichrome staining, 5-mm-thick sections of paraffin- night at 4°C with a rabbit anticleaved caspase 3 (1:100; Cell Signal- embedded tissues were deparaffinized, hydrated in ethyl alcohol, ing Technology) antibody, rabbit anti–PGC-1a (1:250; ab54418; washed in tap water, and refixed in Bouin solution at 56°C for 1 Abcam) antibody, a rat anti-mouse F4/80 (1:100; MCA497GA; hour. After washing in running tap water for 10 minutes and staining Bio-Rad) antibody, a mouse anti-mouse CD68 (1:100; ab31630; with Weigert iron hematoxylin working solution for 10 minutes, we Abcam) antibody, a rabbit anti-mouse Ki67 (1:100; ab15580; stained the slices with the Biebrich scarlet acid fuchsin solution for 15 Abcam), and a rabbit anti-PCNA (1:200; PA5–16797; Thermo Sci- minutes followed by a 10-minute wash. The slides were then differ- entific). Staining was visualized using horseradish peroxidase– entiated in phosphomolybdic-phosphotungstic acid solution for conjugated antibodies against rabbit IgG and 3,3-diaminobenzidine 15 minutes, transferred to an aniline blue solution, and stained by means of the Dako Envision Kit as per the manufacturer’s protocol for 10 minutes, and they were reacted with 1% acetic acid solution (Vector Laboratories). for 5 minutes. For double-immunofluorescence staining using human kidney For immunohistochemical staining, the tissue slices were depar- samples, sections were deparaffinized and hydrated followed by mi- affinized, hydrated in ethyl alcohol, and washed in tap water. Anti- crowave antigen retrieval in 10 mM sodium citrate, pH 6.0. Sections gen retrieval was carried out in 1 mM EDTA, pH 8.0, by microwaving were blocked in 5% normal goat serum for 30 minutes at room tem- for 15 minutes. Endogenous peroxidase activity was blocked with perature and incubated in a rabbit anti–PGC-1a (Abcam) and a rabbit

J Am Soc Nephrol 28: 3312–3322, 2017 PGC-1a Protects from Notch1-Induced Kidney Injury 3319 BASIC RESEARCH www.jasn.org

(Invitrogen). Next, 24 hours after transfection, media were changed to serum-free media, and the cells were incubated for an additional 48 hours.

ChIP Assay ChIP assay was conducted as previously described.32 Briefly, 23107 primary culture cells were crosslinked, washed, and sonicated. The resulting lysates were subjected to immunoprecipitation with antibodies against Hes1 (Abcam) or control IgG (Santa Cruz Biotech- nology). Protein A agarose/Salmon Sperm DNA (Temecula, CA) was used to capture the immunoprecipitates. After washing, bound proteins were eluted, and ChIP-enriched DNA was isolated by phe- nol:chloroform extraction. The eluted ChIP DNA and input control samples were analyzed by qPCR using the following primer pair within the Ppargc1a enhancer promoter. The primer sequences were sense 59-TTTCAGTGTTTTTCCTTCATT-39 and antisense 59-CCCAGAAAACAAATGCTAGA-39.Datawereanalyzedbythetwo methods and normalized to the input samples as described else- where.32 Figure 8. PGC-1a improves altered fatty acid oxidation and Notch1-induced kidney injury. (A) qPCR assay for fatty acid Luciferase Assay – oxidation related genes in kidneys of control, Pax8-rtTA/tetO- The PGC-1a promoter luciferase plasmid was purchased from Ppargc1a, Pax8-rtTA/tetO-ICN1,andPax8-rtTA/tetO-ICN1/tetO- Addgene. Primary TECs were obtained as described above and Ppargc1a mice. (B) Representative images and quantification of seeded in six-well plates. The next day, 100 ng Renilla lucifer- Western blot analyses for phosphoacetyl-CoA carboxylase ase–encoding plasmid, 400 ng pGL-basic or pGL3–PGC-1a plas- (P-ACC) and CPT1 in these mice groups. C, control; P, Pax8-rtTA/ tetO-Ppargc1a; N, Pax8-rtTA/tetO-ICN1; NP, Pax8-rtTA/tetO- mid, 600 ng Hes1 plasmid (OriGene), and 100 nM Hes1 siRNA ICN1/tetO-Ppargc1a. (Dharmacon) were cotransfected using Lipofectamine 2000 according to the manufacturer’s instructions. The cells were har- vested 24 hours after transfection and analyzed with the Dual- Luciferase Reporter Assay System (Promega). Luminescence was anti-Notch1 (Abcam) overnight at 4°C. Anti-mouse Alexa Fluor 488 measured on a CentroXS3 LB9601 luminometer. Luciferase activ- (1:200; 4408; Cell Signaling Technology) and anti-rabbit Alexa Fluor ity of each group was normalized to Renilla luciferase activity, and 555 (1:200; 4413; Cell Signaling Technology) were applied, and nuclei between-group differences were expressed as relative fold were stained with DAPI. To examine the localization of PGC-1a changes. expression in tubules, sections were incubated with fluorescein lotus tetraglonolobus lectin (1:200; FL1321; Vector Laboratories), a Electron Microscopic Examination proximal tubule marker, which was added for 60 minutes on the We next examined mitochondrial structure by standard transmis- following day. sion electron microscopy. Primary RTECs were fixed with a mixture of 2% paraformaldehyde and 2.5% glutaraldehyde overnight, washed, Primary Cell Cultures and Transfection dehydrated, and embedded in a resin according to standard proce- RTECs were isolated from wild-type mice. The cells were cultured in dures. Mitochondria were examined under a JEOL 1011 microscope theRPMI1640medium (Gibco)containing10% FBS (Gibco),100U/ml (JEOL, Tokyo, Japan). penicillin G (Sigma-Aldrich), 2.5 mg/ml amphotericin B (Sigma- Aldrich), and 20 ng/ml EGF (Sigma-Aldrich). In short, kidneys were Human Kidney Samples and Microarray Analyses dissected, placed in 1 ml ice-cold DPBS (CellGro), and minced into We compared PPARGC1A transcript levels in the kidneys of healthy pieces of approximately 1 mm3. These pieces were transferred and controls and patients with CKD using microarray data from our ear- digested for 60 minutes at 37°C, and the supernatants were sieved lier work. Human kidney samples were obtained from routine surgi- through a 100-mm nylon mesh. After centrifugation for 10 minutes cal nephrectomies, and tubule and glomerular compartments were at 3000 rpm, the pellet was resuspended in sterile red blood cell lysis separately collected by microdissection. The microdissected tubule buffer (8.26 g NH4Cl, 1 g KHCO3, and 0.037 g EDTA per 1 L ddH2O) samples were subjected to a microarray experiment on the Affymetrix and seeded in 10-cm culture dishes. At confluence of approximately platform. The detailed method was described previously.16,17 Before 70%, the cells were transfected with pCDNA3, ICN1 plasmid, the procedure, all of the samples were deidentified, and the corre- PGC-1a plasmid, scramble siRNA, and ICN1 siRNA (Dharmacon, sponding clinical information was collected by an individual who was Lafayette, CO) or both ICN1 and PGC-1a plasmids (Addgene, not involved in the research protocol (honest broker). The study was Cambridge, MA) using Lipofectamine 2000 and Plus reagents approved by the institutional review board.

3320 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 3312–3322, 2017 www.jasn.org BASIC RESEARCH

Figure 9. PGC-1a overexpression in TECs attenuates Notch1-induced apoptotic cell death. (A) Relative mRNA level of Bcl2 in control, Pax8-rtTA/tetO-Ppargc1a, Pax8-rtTA/tetO-ICN1,andPax8-rtTA/tetO-ICN1/tetO-Ppargc1a mice. (B) Relative mRNA level of Bcl2 in control and TECs transfected with PGC-1a, ICN1, and ICN1/PGC-1a plasmids. (C) Representative images and quan- tiﬁcation of Western blot analyses for BCL2 and cleaved caspase 3 in four mice groups. (D) Representative immunohistochemical staining with cleaved caspase 3 in control, Pax8-rtTA/tetO-Ppargc1a, Pax8-rtTA/tetO-ICN1,andPax8-rtTA/tetO-ICN1/ tetO-Ppargc1a mice. C, control; P, Pax8-rtTA/tetO-Ppargc1a; N, Pax8-rtTA/tetO-ICN1; NP, Pax8-rtTA/tetO-ICN1/tetO- Ppargc1a.

Statistical Analyses results are presented as mean6SD. To analyze a difference be- Statistical analysis was performed using the statistical package SPSS tween two groups, t test was used. Bonferroni correction was ap- software version 20.0 for Windows (SPSS, Chicago, IL). All of the plied when more than two groups were present. Difference with P values ,0.05 were considered statistically sig- Table 1. Sequences of oligonucleotide primers used for qPCR test niﬁcant. Gene Forward Reverse Ubc GCCCAGTGTTACCACCAAGAAG GCTCTTTTTAGATACTGTGGTGAGGAA ACKNOWLEDGMENTS Ppargc1a AGTCCCATACACAACCGCAG CCCTTGGGGTCATTTGGTGA Hes1 CCCCAGCCAGTGTCAACAC TGTGCTCAGAGGCCGTCTT Hey1 GCCTCCGACCCGCTTCT TGGGATGCGTAGTTGTTGAGAT This work was supported by faculty research Procol1a1 GCCAAGAAGACATCCCTGAA GTTTCCACGTCTCACCATTG grant 6-2015-0119 from Yonsei University Procol3a1 ACAGCTGGTGAACCTGGAAG ACCAGGAGATCCATCTCGAC College of Medicine for 2015 and a research Fn ACAAGGTTCGGGAAGAGGTT CCGTGTAAGGGTCAAAGCAT grant from Hanmi Pharmaceuticals, Co., Ltd., Acta2 CTGACAGAGGCACCACTGAA AGAGGCATAGAGGGACAGCA and work in the laboratory of K.S. is supported Cpt1 GGTCTTCTCGGGTCGAAAGC TCCTCCCACCAGTCACTCAC by National Institutes of Health grant DK076077. Acox1 cttggatggtagtccggaga tggcttcgagtgaggaagtt M.W. thanks the China Scholarship Council Bcl-2 TGGGATGCCTTTGTGGAACT CAGCCAGGAGAAATCAAACAGA for fellowship support through grant 3022 Tfam GGAATGTGGAGCGTGCTAAAA TGCTGGAAAAACACTTCGGAATA (2015).

J Am Soc Nephrol 28: 3312–3322, 2017 PGC-1a Protects from Notch1-Induced Kidney Injury 3321 BASIC RESEARCH www.jasn.org

DISCLOSURES 16. Si H, Banga RS, Kapitsinou P, Ramaiah M, Lawrence J, Kambhampati G, The laboratory of K.S. received research support from Biogen, Lilly, Boeh- Gruenwald A, Bottinger E, Glicklich D, Tellis V, Greenstein S, Thomas DB, Pullman J, Fazzari M, Susztak K: Human and murine kidneys show ringer Ingelheim, GSK, Regeneron, ONO Pharma, and Celgene for work not gender- and species-specific gene expression differences in response related to this project. to injury. PLoS One 4: e4802, 2009 17. Woroniecka KI, Park AS, Mohtat D, Thomas DB, Pullman JM, Susztak K: Transcriptome analysis of human diabetic kidney disease. Diabetes 60: REFERENCES 2354–2369, 2011 18. Han SH, Malaga-Dieguez L, Chinga F, Kang HM, Tao J, Reidy K, Susztak K: Deletion of Lkb1 in renal tubular epithelial cells leads to CKD by 1. National Kidney Foundation: K/DOQI clinical practice guidelines for altering metabolism. J Am Soc Nephrol 27: 439–453, 2016 chronic kidney disease: Evaluation, classification, and stratification. Am 19. Bi P, Shan T, Liu W, Yue F, Yang X, Liang XR, Wang J, Li J, Carlesso JKidneyDis39[Suppl 1]: S1–S266, 2002 N, Liu X, Kuang S: Inhibition of Notch signaling promotes browning 2. Saran R, Li Y, Robinson B, Ayanian J, Balkrishnan R, Bragg-Gresham J, of white adipose tissue and ameliorates obesity. Nat Med 20: 911– Chen JT, Cope E, Gipson D, He K, Herman W, Heung M, Hirth RA, 918, 2014 Jacobsen SS, Kalantar-Zadeh K, Kovesdy CP, Leichtman AB, Lu Y, 20. Edeling M, Ragi G, Huang S, Pavenstädt H, Susztak K: Developmental Molnar MZ, Morgenstern H, Nallamothu B, O’Hare AM, Pisoni R, signalling pathways in renal fibrosis: The roles of Notch, Wnt and Plattner B, Port FK, Rao P, Rhee CM, Schaubel DE, Selewski DT, Hedgehog. Nat Rev Nephrol 12: 426–439, 2016 Shahinian V, Sim JJ, Song P, Streja E, Kurella Tamura M, Tentori F, 21. Zavadil J, Cermak L, Soto-Nieves N, Böttinger EP: Integration of TGF- Eggers PW, Agodoa LY, Abbott KC: US Renal Data System 2014 Annual beta/Smad and Jagged1/Notch signalling in epithelial-to-mesenchy- Data Report: Epidemiology of kidney disease in the United States. Am mal transition. EMBO J 23: 1155–1165, 2004 JKidneyDis66[Suppl 1]: S1–S305, 2015 22. Xu J, Chi F, Guo T, Punj V, Lee WN, French SW, Tsukamoto H: NOTCH 3. Hill NR, Fatoba ST, Oke JL, Hirst JA, O’Callaghan CA, Lasserson DS, reprograms mitochondrial metabolism for proinflammatory macro- Hobbs FD: Global prevalence of chronic kidney disease - a systematic phage activation. JClinInvest125: 1579–1590, 2015 review and meta-analysis. PLoS One 11: e0158765, 2016 23. Bi P, Kuang S: Notch signaling as a novel regulator of metabolism. 4. Coresh J, Selvin E, Stevens LA, Manzi J, Kusek JW, Eggers P, Van Lente Trends Endocrinol Metab 26: 248–255, 2015 F, Levey AS: Prevalence of chronic kidney disease in the United States. 24. Liang H, Ward WF: PGC-1alpha: A key regulator of energy metabolism. JAMA 298: 2038–2047, 2007 Adv Physiol Educ 30: 145–151, 2006 5. Boor P, Ostendorf T, Floege J: Renal fibrosis: Novel insights into mecha- 25. Rasbach KA, Schnellmann RG: Signaling of mitochondrial bio- nisms and therapeutic targets. Nat Rev Nephrol 6: 643–656, 2010 genesis following oxidant injury. JBiolChem282: 2355–2362, 6. Handschin C, Spiegelman BM: Peroxisome proliferator-activated re- 2007 ceptor gamma coactivator 1 coactivators, energy homeostasis, and 26. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, metabolism. Endocr Rev 27: 728–735, 2006 Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM: Mechanisms 7. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM: A controlling mitochondrial biogenesis and respiration through the cold-inducible coactivator of nuclear receptors linked to adaptive thermogenic coactivator PGC-1. Cell 98: 115–124, 1999 thermogenesis. Cell 92: 829–839, 1998 27. Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, Kelly DP: 8. Murea M, Park JK, Sharma S, Kato H, Gruenwald A, Niranjan T, Si H, Peroxisome proliferator-activated receptor gamma coactivator-1 Thomas DB, Pullman JM, Melamed ML, Susztak K: Expression of Notch promotes cardiac mitochondrial biogenesis. J Clin Invest 106: 847– pathway proteins correlates with albuminuria, glomerulosclerosis, and 856, 2000 renal function. Kidney Int 78: 514–522, 2010 28. Rasbach KA, Schnellmann RG: PGC-1alpha over-expression promotes 9. Niranjan T, Bielesz B, Gruenwald A, Ponda MP, Kopp JB, Thomas DB, recovery from mitochondrial dysfunction and cell injury. Biochem Bi- Susztak K: The Notch pathway in podocytes plays a role in ophys Res Commun 355: 734– 739, 2007 the development of glomerular disease. Nat Med 14: 290–298, 2008 29. Portilla D, Dai G, McClure T, Bates L, Kurten R, Megyesi J, Price P, Li S: 10. Bielesz B, Sirin Y, Si H, Niranjan T, Gruenwald A, Ahn S, Kato H, Pullman Alterations of PPARalpha and its coactivator PGC-1 in cisplatin-induced J, Gessler M, Haase VH, Susztak K: Epithelial Notch signaling regulates acute renal failure. Kidney Int 62: 1208–1218, 2002 interstitial fibrosis development in the kidneys of mice and humans. J 30. Kang HM, Ahn SH, Choi P, Ko YA, Han SH, Chinga F, Park AS, Tao J, Clin Invest 120: 4040–4054, 2010 Sharma K, Pullman J, Bottinger EP, Goldberg IJ, Susztak K: Defective 11. Bonegio R, Susztak K: Notch signaling in diabetic nephropathy. Exp fatty acid oxidation in renal tubular epithelial cells has a key role in Cell Res 318: 986–992, 2012 kidney fibrosis development. Nat Med 21: 37–46, 2015 12. Sirin Y, Susztak K: Notch in the kidney: Development and disease. J 31. Stanger BZ, Datar R, Murtaugh LC, Melton DA: Direct regulation of Pathol 226: 394–403, 2012 intestinal fate by Notch. Proc Natl Acad Sci USA 102: 12443–12448, 13. Lin CL, Wang FS, Hsu YC, Chen CN, Tseng MJ, Saleem MA, Chang PJ, 2005 Wang JY: Modulation of notch-1 signaling alleviates vascular endo- 32. Sun G, Reddy MA, Yuan H, Lanting L, Kato M, Natarajan R: Epigenetic thelial growth factor-mediated diabetic nephropathy. Diabetes 59: histone methylation modulates fibrotic gene expression. JAmSoc 1915–1925, 2010 Nephrol 21: 2069–2080, 2010 14. Waters AM, Wu MY, Onay T, Scutaru J, Liu J, Lobe CG, Quaggin SE, Piscione TD: Ectopic notch activation in developing podocytes causes glomerulosclerosis. JAmSocNephrol19: 1139–1157, 2008 15. Sharma S, Sirin Y, Susztak K: The story of Notch and chronic kidney This article contains supplemental material online at http://jasn.asnjournals. disease. Curr Opin Nephrol Hypertens 20: 56–61, 2011 org/lookup/suppl/doi:10.1681/ASN.2017020130/-/DCSupplemental.

3322 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 3312–3322, 2017