Plant Syst Evol (2015) 301:1843–1850 DOI 10.1007/s00606-015-1197-y

ORIGINAL ARTICLE

Use of chloroplast DNA barcodes to identify Osmunda japonica and its adulterants

Si H. Zheng • Wei G. Ren • Zeng H. Wang • Lin F. Huang

Received: 4 November 2013 / Accepted: 9 January 2015 / Published online: 1 February 2015 Ó Springer-Verlag Wien 2015

Abstract Osmunda japonica Thunb., a medicinal plant and its adulterants, which was helpful for further clinical newly recorded in the Chinese pharmacopoeia, has been application of the materials. used for centuries for treatment of viral influenza, dysen- tery, and bleeding. Although O. japonica and its adulter- Keywords Osmunda japonica Á Adulterants Á ants have different medicinal effects and clinical Identification Á Chloroplast Á DNA barcoding applications, it is difficult to differentiate O. japonica from its adulterants used in medicine. To distinguish O. japonica from its adulterants, two chloroplast barcodes (psbA-trnH and rbcL) were tested for the first time. Genetic distance, Introduction genetic divergence, maximum likelihood tree, barcoding gap, and identification efficiency were calculated and Osmunda japonica Thunb., a newly recorded species in the analyzed for identification of O. japonica and its adulter- Chinese Pharmacopoeia (2010 edition) (National Pharma- ants. The results showed the two barcodes could be used to copoeia Committee 2010), has been used for centuries for identify O. japonica and its adulterants, and the perfor- treatment of viral influenza, dysentery, bleeding, and for its mance of psbA-trnH was better in terms of amplification, antiviral, antitumor, and anthelminthic properties. Dryop- sequencing, genetic divergence, and variation. The psbA- teris crassirhizoma was the only fern species recorded in trnH region resulted in less overlap than rbcL, and greater the Chinese Pharmacopoeia (2005 and earlier editions); interspecific divergence. On the basis of psbA-trnH this was named ‘‘Guan Zhong’’ in traditional Chinese. In sequences, a pair of primers was designed for specific addition, another 56 fern species (belonging to 18 genera identification of O. japonica. Our findings indicated that and 11 families) were sold for medicinal use as ‘‘Guan psbA-trnH was the optimum barcode, and rbcL could be as Zhong’’ in local and commercial markets in China, and a complementary barcode for authenticating O. japonica were often confused, especially Dennstaedtia scabra, Ci- botium barometz, Cyrtomium fortunei, Matteuccia strut- Handling editor: Jochen Heinrichs. hiopteris, Pentarhizidium orientale, and Adiantum capillus-veneris, when used in medicinal slices (Lou and S. H. Zheng Á W. G. Ren Á Z. H. Wang Á L. F. Huang (&) Qin 1995). Hence, ‘‘Guan Zhong’’ was used as a homonym Institute of Medicinal Plant Development, Chinese Academy of (same name, different botanical origins) in the Chinese Medical Sciences, Peking Union Medical College, Room 402, No.151, Malianwa North Road, HaiDian District, medicinal market. However, these 58 closely related fern Beijing 100193, People’s Republic of China species might have different effects, chemical components, e-mail: [email protected] and clinical applications. For example, O. japonica, D. S. H. Zheng crassirhizoma, and C. fortunei are toxic when used clini- e-mail: [email protected] cally above a specific dose whereas M. orientalis and M. struthiopteris could be used as food (Li et al. 2012). W. G. Ren Guang’ anmen Hospital, China Academy of Chinese Medical Therefore, it was necessary to establish a method to iden- Sciences, Beijing 100053, China tify O. japonica and its adulterants. 123 1844 S. Zheng et al.

DNA barcoding, a term first coined in 2003 by Hebert adulterants, to compare identification efficiency, and a pair et al. (2003a, b), uses the sequence of a short DNA segment of specific primers were designed for accurate differentia- for species discrimination. Mitochondrial gene cytochrome tion of O. japonica from its adulterants. c oxidase I (COI) was proposed as the basis of a global bio- identification system for animals. However, the perfor- mance of the COI region was not as robust in plants as in Materials and methods animals, because of low rates of substitution of mito- chondrial DNA (Hollingsworth et al. 2009). DNA barcodes Taxon sampling have been used to identify medicinal plants (Chen et al. 2010; Asahina et al. 2010; Yao et al. 2010; Huang et al. Forty-seven fresh samples comprising 17 of O. japonica 2014; Zheng et al. 2014a, b). Ferns have lost the flanking and 30 of adulterants were collected (Table 1). One-hun- trnK exons typically used to design stable priming sites. In dred and forty-seven sequences of O. japonica and its comparison, organelle regions are superior for recon- closely related species were downloaded from the Gen- structing the tree of life because they are easily amplified, Bank database for identification (Table 2). Species identi- their rates of duplication are low, and they are uniparen- fication of collected samples was performed by Professor tally inherited, unlike nuclear genomes. Therefore, previ- Lin YL (Institute of Medical Plant Development (IMP- ous study of phylogeny and identification of ferns have LAD), Chinese Academy of Medicinal Sciences) on the mainly focused on chloroplastid DNA barcodes, including basis of morphological characteristics. Samples were rbcL, rbcL-accD IGS, rbcL-atpB IGS, trnG-trnR, trnL- deposited in the IMPLAD herbarium. trnF, and psbA-trnH in the intergenic region and the trnL- F and rpL16 introns (Yatabe et al. 2001; Korall et al. 2007; DNA extraction, PCR amplification, sequencing Ma et al. 2010; Ebihara et al. 2010; Groot et al. 2011;Li et al. 2011; Dauphin et al. 2014). However, few studies Fresh leaf tissue was first dried over silica gel. The dry have focused on molecular identification of O. japonica tissue (20 mg) was powdered for 2 min at a frequency of and its adulterants, which limits further application of these 30 times/s in a FastPrep bead mill (Retsch MM400, Ger- medicinal materials and herbal drugs. many). DNA was extracted by use of a Plant Genomic In this study, two candidate chloroplast regions (psbA- DNA kit (Tiangen Biotech, China) in accordance with the trnH and rbcL) were used to identify O. japonica and its manufacturer’s instructions. We made two modifications to

Table 1 Taxon sampling information for Osmunda japonica and its adulterants Collector Family Species Collection GenBank accession GenBank accession number location number (psbA-trnH) number (rbcL)

WJ1–WJ2 Dennstaedtiaceae Dennstaedtia scabra ShanXi China KC795765 (WJ2) KC795808 (WJ2) JM Dicksoniaceae Cibotium barometz YunNan China KC795770 (JM) TZ1–TZ6 Dryopteridaceae Cyrtomium fortunei ShanXi China KC795774–KC795779 KC795814–KC795815 (TZ1/TZ3/TZ4/TZ5) SN1–SN6 Dryopteridaceae Cyrtomium fortunei ShanXi China KC795780–KC795785 KC795816-KC795819 (SN3/SN6) FP1 Dryopteridaceae Cyrtomium fortunei ShanXi China KC795786 KC795820 DF1–DF3 Dryopteridaceae Cyrtomium fortunei ShanXi China KC795787–KC795789 KC795821–KC795823 GZ18 Dryopteridaceae Cyrtomium fortune ShanXi China KC795790 (GZ18) MM Dryopteridaceae Dryopteris crassirhizoma JiLin China KC795769 (MM) J1–J3 Onocleaceae Matteuccia struthiopteris BeiJing China KC795771–KC795773 KC795811–KC795813 ZQ1– Osmundaceae Osmunda japonica HuNan China KC795747–KC795762 KC795791–C795805 ZQ17 (ZQ17) (ZQ2/ZQ16) Z1–Z2 Onocleaceae Pentarhizidium orientale HuNan China KC795763–KC795764 KC795806–KC795807 TX1–TX3 Pteridaceae Adiantum capillus- ShanXi China KC795766–KC795768 KC795809–KC795810 veneris (TX3) Species for which no sequences were obtained are given in parentheses

123 Use of chloroplast DNA barcodes to identify Osmunda japonica 1845

Table 2 Sequences from GenBank for identification by use of the psbA-trnH and rbcL regions Region Family Species Accession number psbA-trnH Dryopteridaceae Cyrtomium fortunei AB575729, AB575730, AB575731 Dryopteridaceae Dryopteris crassirhizoma AB575746, GU592467, GU592468, JN189435 Onocleaceae Matteuccia struthiopteris AB575690, GU592471, GU592472, HQ243691 HQ243692, HQ243693, HQ243694, HQ243695 HQ243698, HQ243699, HQ243700, HQ243701 HQ243705, HQ243706, HQ243696, HQ243697 JF912403 Osmundaceae Osmunda lancea AB575360 Osmundaceae Osmunda claytoniana AB575359 Osmundaceae Osmundastrum cinnamomeum JN575776 Osmundaceae Osmunda banksiifolia AB575358 Dennstaedtiaceae Dennstaedtia scabra AB575433 Pteridaceae Adiantum capillus-veneris AB575450 Dicksoniaceae Cibotium barometz AB575405, GQ434937, GU592448 rbcL Dryopteridaceae Cyrtomium fortune AB575105, AB575106, AB575107, AB598689 AB598690, AF537227, EF394237 Dryopteridaceae Dryopteris crassirhizoma AB575122, AY268870, EF463177, JN189543 Onocleaceae Matteuccia struthiopteris AB232415, AB575062, D43917, JF832074 MSU05930, U62032 Dennstaedtiaceae Dennstaedtia scabra AB574778, JF303966 Pteridaceae Adiantum capillus-veneris AB574796, DQ432659, JF935318, JF935320 JF935322, JF935332, JF935334, JF935345 Dicksoniaceae Cibotium barometz AB574749, AM177328, CBU05610 Osmundaceae Osmunda japonica AB024947, AB076261, AB494711, AB494712 AB494713, AB494714, AB574698, AB639162 AB639163, AB639164, AB667969, EF588701 Osmundaceae Leptopteris superba DQ646004 Osmundaceae Leptopteris hymenophylloides AB024957, EF588695, EF588696 Osmundaceae Leptopteris wilkesiana AB024958, AY612678 Osmundaceae Osmunda angustifolia FJ262723 Osmundaceae Osmunda banksiifolia EF588698, AB024955, AB024956, AB574696 Osmundaceae Osmunda claytoniana EF588700, AB024950, AB024951, AB639186 AB672747, AB574697, EF588699 Osmundaceae Osmunda hybrida AB639183, AB639184, AB639185 Osmundaceae Osmunda lancea EF588703, AB024952, AB574699 Osmundaceae Osmunda mildei AB672746, FJ262722, FJ262723 Osmundaceae Osmunda regalis EF588704, EF588705, EF588706, AB076258 AB076259, AB639165, AB639166, AB639167 AB639168, AB639169, AB639170, AB639171 AB639172, AB639173, AB639174, AB639175 AB639176, AB639177, AB639178, AB639179 AB639180, AB639181, AB639182 Osmundaceae Osmunda vachellii AB024954, AB672749 Osmundaceae Osmundastrum cinnamomeum D14882, EF588709, EF588710, EF588711 AB024949, AB672750, AB574700 Osmundaceae Todea barbara DQ646005, EF588712, AY612686, AB024959 AB076260, AB672751

123 1846 S. Zheng et al. the procedure: chloroform was diluted 24:1 (v/v) with bioinformatics analysis (Ross et al. 2008); this was the main isoamyl alcohol and buffer solution GP2 was diluted 24:1 reflection of the success and reliability of identification by (v/v) with isopropanol. The powder was added to 700 lL use of the DNA barcodes. The BLAST1 method determines chloroform–isoamyl alcohol mixture and the mixture was the identity of a sample on the basis of the best hit of the query centrifuged at 12,000 rpm (*13,4009g) for 5 min. sequence; the E value for the match must be less than a cutoff Supernatant was removed and placed in a new tube before value. The nearest-distance method determines the identity adding 700 lL isopropanol and blending for 15–20 min. of a sample on the basis of which sequence in the database The mixture was centrifuged in CB3 spin columns at has the smallest genetic distance from the query sequence, 12,000 rpm for 40 s. The filtrate was discarded and 500 lL and this distance must be less than a distance threshold. GD (adding a certain amount of anhydrous ethanol before Genetic divergence analysis based on six variables was use according to the introduction of manufacturer) was calculated by use of the Perl programming language (Meyer added before centrifuging at 12,000 rpm for 40 s. The fil- and Paulay 2005). Six variables, theta (average_intra), coa- trate was discarded and 700 lL PW (adding a certain lescent depth (average_intra_max), all intraspecific distance amount of anhydrous ethanol before use according to the (average between intra-species), theta prime (average_int- introduction of manufacturer) was used to wash the erbyG average), minimum interspecific distance (aver- membrane before centrifuging for 40 s at 12,000 rpm. This age_interspecific_min), and all inter-specific distance step was repeated with 500 lL PW, followed by final (average_between interbyG), were calculated to analyze centrifugation at 12,000 rpm for 2 min to remove residual inter-specific divergence and intra-specific variation (Chen wash buffer. The spin column was dried at room temper- et al. 2010; Zhu et al. 2010). On the basis of the sequence ature for 3–5 min and then centrifuged for 2 min at variation analysis method proposed by Meyer, we added 12,000 rpm to obtain the total DNA. The primers and PCR coalescent depth and minimum interspecific distance as reaction conditions used in this work are listed in Table 3. alternatives, to better reflect the genetic divergence. An ideal PCR products were subjected to direct sequencing by use barcode should be significantly different for intra and inter of an ABI3730 XL sequencer (Applied Biosystems, USA). variation; this was denoted the ‘‘barcoding gap’’, which was also calculated by use of the Perl programming language. Sequence alignment, genetic analysis, and maximum likelihood tree building Specific primers for identification of O. japonica and its adulterants The sequences obtained were assembled by CodonCode Aligner V3.7.1 (CodonCode, USA), aligned by use of the On the basis of analysis of psbA-trnH sequences, a pair of Clustal W method, and submitted to the GenBank database specific primers which could exclusively and accurately (Table 1). Genetic distance and GC content were calcu- identify O. japonica and its adulterants were designed by lated by use of MEGA 5.0 (Tamura et al. 2011). Maximum MEGA 5.0 (Tamura et al. 2011) and Primer premier 6.0 likelihood (M-L) trees were built by MEGA 5.0 by use of (Premier Biosoft International, Palo Alto, CA, USA). the Tamura-Nei method and the maximum likelihood model, and submitted to the TreeBASE database. Results Identification efficiency, genetic divergence, and barcoding gap Efficiency of PCR amplification, sequencing and identification Comparing the identification ability of different barcodes is an important means of evaluating their performance. The Information about the sequences are listed in Table 4. The identification efficiency of barcodes was investigated by use success of amplification of psbA-trnH and rbcL was 93.60 of BLAST1 and the nearest-distance method, by use of and 78.70 %, respectively. The success of sequencing of the

Table 3 Primers and PCR conditions used in this study Primer Primer sequences (50–30) PCR reaction conditions References psbA-trnH fwd PA GTTATGCATGAACGTAATGCTC 94 °C 5 min; 94 °C 1 min, 55 °C 1 min, 72 °C 1.5 min, Chen et al. (2010) rev TH CGCGCATGGTGGATTCACAATCC 30 cycles; 72 °C 7 min rbcL 1f ATGTCACCACAAACAGAAAC 95 °C 2 min; 94 °C 1 min, 55 °C30s,72°C 1 min, Chen et al. (2010) 724r TCGCATGTACCTGCAGTAGC 34 cycles; 72 °C 7 min

123 Use of chloroplast DNA barcodes to identify Osmunda japonica 1847

Table 4 Identification efficiency of the two DNA barcodes by use of Table 5 Analysis of inter-specific divergence and intra-specific different methods variation of barcodes Marker rbcL psbA-trnH Marker rbcL psbA-trnH

Number of sequences 139 77 Theta 0.0052 ± 0.0080 0.0110 ± 0.0195 Length range/bp 1,141–1,245 400–588 Coalescent depth 0.0102 ± 0.0163 0.0177 ± 0.0295 Average GC content/% 40.57 46.42 All intraspecific distance 0.0042 ± 0.0094 0.0018 ± 0.0073 Efficiency of PCR amplification/% 78.70 93.60 Theta prime 0.0153 ± 0.0095 0.0748 ± 0.0467 Success rate of sequencing/% 71.74 95.65 Minimum interspecific 0.0087 ± 0.0112 0.0647 ± 0.0510 Genetic distance distance Min 0.0000 0.0000 All inter-specific distance 0.0143 ± 0.0085 0.0635 ± 0.0393 Max 0.2209 1.5986 Average 0.1080 0.5813 Identification efficiency/% BLAST 1 25.18 20.78 Nearest distance 82.01 77.92 psbA-trnH and rbcL regions was 95.65 and 71.74 %, respectively. The result show that the psbA-trnH spacer was more efficient for both amplification and sequencing than the rbcL region. Identification efficiency of rbcL and psbA-trnH based on the BLAST 1 method was smaller than calculated on the basis of the nearest-distance method (82.01, 77.92 %).

Genetic divergence analysis

The values of six variables are listed in Table 5. A favor- able barcode should have high inter-specific divergence to distinguish different species. As shown in Table 5, the minimum interspecific distance for psbA-trnH was larger than the coalescent depth (maximum intraspecific dis- tance), which indicated that psbA-trnH performed well in respect of genetic divergence. Compared with rbcL, the psbA-trnH region had a smaller intraspecific distance and a larger interspecific distance. Fig. 1 Relative distribution of inter and intro-specific variation

Barcoding gap japonica was clustered into one branch only, significantly separated from its adulterants. The adulterants were equally The barcoding gap is shown in Fig. 1. The outlying intra- distinguished from one another. The M-L tree of rbcL specific distance in rbcL shows that intraspecific variation indicated that O. japonica and its adulterants also clustered existed in the rbcL, distributed in the range 0.060–0.070. into clearly distinguishable species, although it did not Although psbA-trnH and rbcL had no significant barcoding perform as well as the psbA-trnH region. The dendrograms gap, overlap was smaller for psbA-trnH than for rbcL; this demonstrated that the psbA-trnH region performed better enabled easy identification of species. than rbcL in M-L tree building.

Maximum likelihood tree Specific primers for Osmunda japonica

Dendrograms based on M-L analysis of the psbA-trnH and A pair of primers were designed to specifically differentiate rbcL regions were constructed by use of MEGA 5 software O. japonica form its adulterants by use of the psbA-trnH (Fig. 2), and submitted to the TreeBASE database (sub- region. The primer sequences were F: 50-TAGAATTAGT mission ID 15715). Combined with GenBank sequence GTCAGTAGGAT-30 and R: 50-GAAAATCAGAGAGAC data, the M-L tree of the psbA-trnH region shows that O. CCTAA-30. The PCR conditions were the same as for the 123 1848 S. Zheng et al.

Fig. 2 M-L trees of Osmunda japonica and its adulterants, on the basis of the maximum likelihood model for the rbcL and psbA-trnH regions

123 Use of chloroplast DNA barcodes to identify Osmunda japonica 1849

Numbers Species 1-5 Osmunda japonica 6-7 Cyrtomium fortune 8-9 Matteuccia orientalis 10 Matteuccia struthiopteris 11-15 Osmunda japonica 16-17 Dryopteris crassirhizoma 18 Adiantum capillus-veneris 19 Cibotium barometz 20 Dennstaedtia scabra M DNA marker CK negative control ab

Fig. 3 Electrophoresis gel figure of specific primers for amplification of Osmunda japonica and its adulterants. a Electrophoresis gel figure; b correspondence of numbers with species universal primers (fwd PA-rev TH) listed in Table 3 except variation for the psbA-trnH region showed that intra-spe- for the annealing temperature. The annealing temperature cific distance was smaller and inter-specific distance was was changed to 46 °C because of the difference in primer higher, so psbA-trnH resulted in easier identification of O. sequences. According to detection by use of agarose gel japonica and its adulterants than the rbcL region. The electrophoresis (Fig. 3), O. japonica could be amplified barcoding gap indicated that the range of distribution of specifically whereas the other species in this experiment genetic distance was wider for psbA-trnH. The M-L tree could not be amplified under the same conditions. built based on the maximum likelihood model revealed that psbA-trnH performed well in identifying O. japonica and its adulterants. Although the success of identification was Discussion slightly higher for the rbcL region than for the psbA-trnH region, comprehensive analysis revealed the psbA-trnH The two chloroplastid barcodes psbA-trnH and rbcL were region was the optimum barcode for authenticating O. tested for identification of O. japonica and its adulterants. japonica and its adulterants. On the basis of the psbA-trnH The results showed that the psbA-trnH region was the more sequences, a pair of primers was designed, for the first suitable barcode than the rbcL region for identifying O. time, for specific identification of O. japonica. japonica and its adulterants. The noncoding psbA-trnH In conclusion, the psbA-trnH region was the more locus is the most widely used plastid barcoding marker suitable barcode for identification of O. japonica and its other than the core rbcL?matK barcode, and is one of the adulterants. Further studies of DNA barcoding should focus most variable intergenic spacers in plants (Hollingsworth more attention on identification of herbal drugs containing et al. 2011; Shaw et al. 2007). High amplification and O. japonica. sequencing success, but smaller interspecific variation, were obtained for the rbcL region, which demonstrated that Acknowledgments The research was funded by grants from the rbcL was suitable for combining with barcodes with sig- National Natural Science Foundation (No. 81274013 and 81473315); the National Natural Foundation of the Major Program of China (No. nificant interspecies variation (Groot et al. 2011; Asahina 81130069) and the Program for Changjiang Scholars and Innovative et al. 2010; Li et al. 2011). Although the psbA-trnH and Research Team in University of Ministry of Education of China rbcL regions have been used to identify fern flora (Ma et al. (IRT1150). We thank Shi LC, Yao H, Luo K, Ma XC for part support 2010; Ebihara et al. 2010; Dauphin et al. 2014; Korall et al. of the data analysis. 2007), studies focused on identifying O. japonica and its adulterants, and on comprehensive evaluation of different References aspects of identification efficiency for different barcodes, were limited. In this study, the psbA-trnH and rbcL regions Asahina H, Shinozaki J, Masuda K, Morimitsu Y, Satake M (2010) Identification of medicinal Dendrobium species by phylogenetic were used to identify O. japonica and its adulterants, and analyses using matK and rbcL sequences. J Nat Med 64:133–138 evaluated on the basis of identification efficiency, inter and Chen SL et al (2010) Validation of the ITS2 region as a novel DNA intraspecific variation, barcoding gap, and building the barcode for identifying medicinal plant species. PLoS ONE M-L tree. The results showed that the psbA-trnH region 5:e8613 Dauphin B, Vieu J, Grant JR (2014) Molecular phylogenetics resulted in better amplification and sequencing success and supports widespread cryptic species in Moonworts (Botrychium greater genetic distance. Analysis of inter and intra-specific S.S., Ophioglossaceae). Amer J Bot 101:128–140

123 1850 S. Zheng et al.

Ebihara A, Nitta JH, Ito M (2010) Molecular species identification Meyer CP, Paulay G (2005) DNA barcoding: error rates based on with rich floristic sampling: DNA barcoding the pteridophyte comprehensive sampling. PLoS Biol 3:e422 flora of Japan. PLoS ONE 5:e15136 National Pharmacopoeia Committee (2010) Pharmacopoeia of Groot GA, During HJ, Maas JW, Schneider H, Vogel JC, Erkens RH People’s Republic of China. Chinese medical science Press, (2011) Use of rbcL and trnL-F as a two-locus DNA barcode for Beijing identification of NW-European ferns: an ecological perspective. Ross HA, Murugan S, Li WL (2008) Testing the reliability of genetic PLoS ONE 6:e16371 methods of species identification via simulation. Syst Biol Hebert PD, Cywinska A, Ball SL, Waard JR (2003a) Biological 57:216–230 identifications through DNA barcodes. Proc Roy Soc London Ser Shaw J, Lickey EB, Schilling EE, Small RL (2007) Comparison of B Biol Sci 270:313–321 whole chloroplast genome sequences to choose noncoding Hebert PD, Ratnasingham S, Waard JR (2003b) Barcoding animal regions for phylogenetic studies in angiosperms: the tortoise life: cytochrome c oxidase subunit 1 divergences among closely and the hare III. Amer J Bot 94:275–288 related species. Proc Roy Soc London Ser B Biol Sci 270:S96– Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S S99 (2011) MEGA5: molecular evolutionary genetics analysis using Hollingsworth PM et al (2009) A DNA barcode for land plants. Proc maximum likelihood, evolutionary distance, and maximum Natl Acad Sci USA 106:12794–12797 parsimony methods. Molec Biol Evol 28:2731–2739 Hollingsworth PM, Graham SW, Little DP (2011) Choosing and Yao H et al (2010) Use of ITS2 region as the universal DNA barcode using a plant DNA barcode. PLoS ONE 6:e19254 for plants and animals. PLoS ONE 5:e13102 Huang LF, Zheng SH, Wu LB, Jiang X, Chen SL (2014) Ecotypes of Yatabe Y, Masuyama S, Darnaedi D, Murakami N (2001) Molecular Cistanche deserticolabased on chemical component and molec- systematics of the Asplenium nidus complex from Mt. Halimun ular traits. Sci Sin Vitae 44:318–328 National Park, Indonesia: evidence for reproductive isolation Korall P, Connat DS, Metzgar JS, Schneider H, Pryer KM (2007) A among three sympatric rbcL sequence types. Amer J Bot molecular phylogeny of scaly tree ferns (Cyatheaceae). Amer J 88:1517–1522 Bot 94:873–886 Zheng SH, Jiang X, Wu LB, Wang ZH, Huang LF (2014a) Chemical Li FW et al (2011) rbcL and matK earn two thumbs up as the core and genetic discrimination of cistanches herba based on UPLC- DNA barcode for ferns. PLoS ONE 6:e26597 QTOF/MS and DNA barcoding. PLoS ONE 9:e98061 Li SB, Zhang D, Yang L, Yang HJ (2012) Research advances in Zheng SH, Liu DW, Ren WG, Fu J, Huang LF, Chen SL (2014b) chemical constituents of plants in Matteuccia Todaro and their Integrated analysis for identifying radix astragali and its pharmacological activities. Drugs Clin 27:292–296 adulterants based on DNA barcoding. Evidence-Based Comple- Lou ZC, Qin B (1995) species systematics and quality control of ment Altern Med 2014:843923 commonly used traditional Chinese medicine, 2nd edn. Unions- Zhu YJ et al (2010) DNA barcoding the medicinal plants of the genus verlag of Beijing Medical University and Peking Union Medical Paris. Acta Pharm Sin 45:376–382 College, Beijing Ma XY et al (2010) Species identification of medicinal Pteridophytes by a DNA Barcode Marker, the chloroplast trnH-psbA intergenic region. Biol Pharm Bull 33:1919–1924

123