DOCSLIB.ORG

WO 2019/046815 Al 07 March 2019 (07.03.2019) W 1P O PCT

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2019/046815 Al 07 March 2019 (07.03.2019) W 1P O PCT (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/046815 Al 07 March 2019 (07.03.2019) W 1P O PCT (51) International Patent Classification: OSTERTAG, Eric [US/US]; 4242 Campus Point Court, C12N 15/90 (2006.01) Suite 700, San Diego, California 82121 (US). RICHTER, Maximilian [US/US]; 473 1Kansas Street, San Diego, Cal¬ (21) International Application Number: ifornia 921 16 (US). CRANERT, Stacey Ann [US/US]; PCT/US20 18/049257 7693 Palmilla Dr. Apt. 2103, San Diego, California 92122 (22) International Filing Date: (US). 31 August 2018 (3 1.08.2018) (74) Agent: MILLER, Katherine J. et al.; COOLEY LLP, (25) Filing Language: English 1299 Pennsylvania Avenue, NW, Suite 700, Washington, District of Columbia 20004 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/552,861 31 August 2017 (3 1.08.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/558,286 13 September 2017 (13.09.2017) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, 62/608,546 20 December 2017 (20. 12.2017) US DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (71) Applicant: POSEIDA THERAPEUTICS, INC. HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, [US/US]; 4242 Campus Point Court, Suite 700, San Diego, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, California 92121 (US). MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (72) Inventors; and SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (71) Applicants: SHEDLOCK, Devon [US/US]; 4242 Cam¬ TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. pus Point Court, Suite 700, San Diego, California 92121 (US). HERMANSON, David [US/US]; 4242 Campus (84) Designated States (unless otherwise indicated, for every Point Court, Suite 700, San Diego, California 92121 (US). kind of regional protection available): ARIPO (BW, GH, (54) Title: TRANSPOSON SYSTEM AND METHODS OF USE Day 1 post EP FIGU RE 1 [ GFP+% M Viability (7'AAD 4D nucleofector Neon Lonza 4D nucieofector Neon eiectroporation system Cell number 1E6 4E6 Transfection volume 2 i ( w l strip) 100ul < Transfection solution P3 kit Solution T Transfection program Severai recommended 2400V/20ms/1 pulse DMA amount g 5ug 00 Eiectroporation technology Polymer electrodes Gold-plated tip © (57) Abstract: Disclosed are methods for the ex-vivo genetic modification of an immune cell comprising delivering to the immune cell, o (a) a nucleic acid or amino acid sequence comprising a sequence encoding a transposase enzyme and (b) a recombinant and nonnaturally o occurring DNA sequence comprising a DNA sequence encoding a transposon. [Continued on nextpage] W O 2019/046815 A l Illlll II lllll lllll lllll llll III III lllll lllll lllll lllll lllll llll llll llll llll GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Published: — with international search report (Art. 21(3)) — with sequence listing part of description (Rule 5.2(a)) TRANSPOSON SYSTEM AND METHODS OF USE RELATED APPLICATIONS [01] This application claims the benefit of provisional application USSN 62/552,861, filed August 31, 2017, USSN 62/558,286, filed September 13, 2017 and USSN 62/608,546, filed December 20, 2017, the contents of each of which are herein incorporated by reference in their entirety. INCORPORATION OF SEQUENCE LISTING [02] The contents of the text file named "POTH-029/001WO_SeqList.txt," which was created on August 31, 2018 and is 44,366 KB in size, are hereby incorporated by reference in their entirety. FIELD OF THE DISCLOSURE [03] The present invention is directed to compositions and methods for targeted gene modification. BACKGROUND [04] Ex vivo genetic modification of non-transformed primary human T lymphocytes using non-viral vector-based gene transfer delivery systems has been extremely difficult. As a result, most groups have generally used viral vector-based transduction such as retrovirus, including lentivirus. A number of non-viral methods have been tested and include antibody- targeted liposomes, nanoparticles, aptamer siRNA chimeras, electroporation, nucleofection, lipofection, and peptide transduction. Overall, these approaches have resulted in poor transfection efficiency, direct cell toxicity, or a lack of experimental throughput. [05] The use of plasmid vectors for genetic modification of human lymphocytes has been limited by low efficiency using currently available plasmid transfection systems and by the toxicity that many plasmid transfection reagents have on these cells. There is a long-felt and unmet need for a method of nonviral gene modification in immune cells. SUMMARY [06] When compared with viral transduction of immune cells, such as T lymphocytes, delivery of transgenes via DNA transposons, such as piggyBac and Sleeping Beauty, offers significant advantages in ease of use, ability to delivery much larger cargo, speed to clinic and cost of production. The piggyBac DNA transposon, in particular, offers additional advantages in giving long-term, high-level and stable expression of transgenes, and in being significantly less mutagenic than a retrovirus, being non-oncogenic and being fully reversible. Previous attempts to use DNA transposons to deliver transgenes to T cells have been unsuccessful at generating commercially viable products or manufacturing methods because the previous methods have been inefficient. For example, the poor efficiency demonstrated by previous methods of using DNA transposons to deliver transgenes to T cells has resulted in the need for prolonged expansion ex vivo. Previous unsuccessful attempts by others to solve this problem have all focused on increasing the amount of DNA transposon delivered to the immune cell, which has been a strategy that worked well for non-immune cells. This disclosure demonstrates that increasing the amount of DNA transposon makes the efficiency problem worse in immune cells by increasing DNA-mediated toxicity. To solve this problem, counterintuitively, the methods of the disclosure decrease the amount of DNA delivered to the immune cell. Using the methods of the disclosure, the data provided herein demonstrate not only that decreasing the amount of DNA transposon introduced into the cell increased viability but also that this method increased the percentage of cells that harbored a transposition event, resulting in a viable commercial process and a viable commercial product. Thus, the methods of the disclosure demonstrate success where others have failed. [07] The disclosure provides a nonviral method for the ex-vivo genetic modification of an immune cell or an immune cell precursor comprising delivering to the immune cell or the immune cell precursor, (a) a nucleic acid or amino acid sequence comprising a sequence encoding a transposase enzyme and (b) a recombinant and non-naturally occurring DNA sequence comprising a DNA sequence encoding a transposon. In certain embodiments, the method further comprises the step of stimulating the immune cell or the immune cell precursor with one or more cytokine(s). [08] In certain embodiments of the methods of the disclosure, the sequence encoding a transposase enzyme is an mRNA sequence. The mRNA sequence encoding a transposase enzyme may be produced in vitro. [09] In certain embodiments of the methods of the disclosure, the sequence encoding a transposase enzyme is a DNA sequence. The DNA sequence encoding a transposase enzyme may be produced in vitro. The DNA sequence may be a cDNA sequence. [010] In certain embodiments of the methods of the disclosure, the sequence encoding a transposase enzyme is an amino acid sequence. The amino acid sequence encoding a transposase enzyme may be produced in vitro. A protein Super piggybac transposase (SPB) may be delivered following pre-incubation with transposon DNA. [Oil] In certain embodiments of the methods of the disclosure, the delivering step comprises electroporation or nucleofection of the immune cell or the immune cell precursor. [012] In certain embodiments of the methods of the disclosure, the method further comprises the step of stimulating the immune cell or the immune cell precursor with one or more cytokines. In certain embodiments, the step of stimulating the immune cell or the immune cell precursor with one or more cytokine(s) occurs following the delivering step. Alternatively, or in addition, in certain embodiments, the step of stimulating the immune cell or the immune cell precursor with one or more cytokine(s) occurs prior to the delivering step. In certain embodiments, the one or more cytokine(s) comprise(s) IL-2, IL-21, IL-7 and/or IL- 15. [013] In certain embodiments of the methods of the disclosure, the immune cell or the immune cell precursor is an autologous immune cell or immune cell precursor. The immune cell or immune cell precursor may be a human immune cell, a human immune cell precursor, an autologous immune cell, and/or an autologous immune cell precursor. The immune cell may be derived from a non-autologous source, including, but not limited to a primary cell, a cultured cell or cell line, an embryonic or adult stem cell, an induced pluripotent stem cell or a transdifferentiated cell.
Load more

Recommended publications
  • Novel Binding Partners of PBF in Thyroid Tumourigenesis
    NOVEL BINDING PARTNERS OF PBF IN THYROID TUMOURIGENESIS By Neil Sharma A thesis presented to the College of Medical and Dental Sciences at the University of Birmingham for the Degree of Doctor of Philosophy Centre for Endocrinology, Diabetes and Metabolism, School of Clinical and Experimental Medicine August 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. SUMMARY Thyroid cancer is the most common endocrine cancer, with a rising incidence. The proto-oncogene PBF is over-expressed in thyroid tumours, and the degree of over-expression is directly linked to patient survival. PBF causes transformation in vitro and tumourigenesis in vivo, with PBF-transgenic mice developing large, macro-follicular goitres, effects partly mediated by the internalisation and repression of the membrane-bound transporters NIS and MCT8. NIS repression leads to a reduction in iodide uptake, which may negatively affect the efficacy of radioiodine treatment, and therefore prognosis. Work within this thesis describes the use of tandem mass spectrometry to produce a list of potential binding partners of PBF. This will aid further research into the pathophysiology of PBF, not just in relation to thyroid cancer but also other malignancies.
    [Show full text]
  • University of California, San Diego
    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
    [Show full text]
  • Identification of a Novel CHN1 P.(Phe213val) Variant in a Large Han Chinese Family with Congenital Duane Retraction Syndrome
    www.nature.com/scientificreports OPEN Identifcation of a novel CHN1 p.(Phe213Val) variant in a large Han Chinese family with congenital Duane retraction syndrome Tai‑Cheng Zhou1,3, Wen‑Hua Duan1,3, Xiao‑Lin Fu2,3, Qin Zhu1, Li‑Yun Guo1, Yuan Zhou1, Zhi‑Juan Hua1, Xue‑Jiao Li1, Dong‑Mei Yang1, Jie‑Ying Zhang1, Jie Yin1, Xiao‑Fan Zhang1, Guang‑Long Zhou1 & Min Hu1* Duane retraction syndrome (DRS) is a neuromuscular dysfunction of the eyes. Although many causative genes of DRS have been identifed in Europe and the United States, few reports have been published in regard to Chinese DRS. The aim of the present study was to explore the genetic defect of DRS in a Chinese family. Exome sequencing was used to identify the disease‑causing gene for the two afected family members. Ophthalmic and physical examinations, as well as genetic screenings for variants in chimerin 1 (CHN1), were performed for all family members. Functional analyses of a CHN1 variant in 293T cells included a Rac‑GTP activation assay, α2‑chimaerin translocation assay, and co‑immunoprecipitation assay. Genetic analysis revealed a NM_001822.7: c.637T > G variant in the CHN1 gene, which resulted in the substitution of a highly conserved C1 domain with valine at codon 213 (NP_001813.1: p.(Phe213Val)) (ClinVar Accession Number: SCV001335305). In-silico analysis revealed that the p.(Phe213Val) substitution afected the protein stability and connections among the amino acids of CHN1 in terms of its tertiary protein structure. Functional studies indicated that the p.(Phe213Val) substitution reduced Rac‑GTP activity and enhanced membrane translocation in response to phorbol‑myristoyl acetate (PMA).
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Differential Epigenomic and Transcriptomic Responses in Subcutaneous Adipose Tissue Between Low and High Responders to Caloric Restriction1–3
    Differential epigenomic and transcriptomic responses in subcutaneous adipose tissue between low and high responders to caloric restriction1–3 Luigi Bouchard, Re´mi Rabasa-Lhoret, May Faraj, Marie-E`ve Lavoie, Jonathan Mill, Louis Pe´russe, and Marie-Claude Vohl ABSTRACT weight loss responses to caloric restriction show considerable Background: Caloric restriction is recommended for the treatment interindividual variability (7). Studies of genetically identical of obesity, but it is generally characterized by large interindividual monozygotic twins have been particularly useful in disentangling variability in responses. The factors affecting the magnitude of the role of environmental and heritable factors in determining the weight loss remain poorly understood. Epigenetic factors (ie, heri- degree of weight loss. It has been shown that within-pair changes table but reversible changes to genomic function that regulate gene in body fat variability after a caloric deficit is significantly lower expression independently of DNA sequence) may explain some of than between-pair variability, which suggests that genetic factors the interindividual variability seen in weight-loss responses. have an important influence on an individual’s response to caloric Objective: The objective was to determine whether epigenetics and deficit (8, 9). However, the concordance between twin pairs was gene expression changes may play a role in weight-loss responsiveness. not complete, which suggests that environmental factors or other Design: Overweight/obese postmenopausal women were recruited DNA sequence–independent mechanisms may be involved. for a standard 6-mo caloric restriction intervention. Abdominal sub- It has been suggested that monozygotic twin discordance for cutaneous adipose tissue biopsy samples were collected before (n = complex traits such as body weight could be accounted for by 14) and after (n = 14) intervention, and the epigenomic and tran- epigenetic factors (10, 11).
    [Show full text]
  • Natural Course of Congenital Hypothyroidism by Dual Oxidase 2 Mutations from the Neonatal Period Through Puberty
    Y Maruo and others Clinical features of DUOX2 174:4 453–463 Clinical Study defects Natural course of congenital hypothyroidism by dual oxidase 2 mutations from the neonatal period through puberty Yoshihiro Maruo1, Keisuke Nagasaki, Katsuyuki Matsui, Yu Mimura, Asami Mori, Maki Fukami2 and Yoshihiro Takeuchi Correspondence should be addressed Department of Pediatrics, Shiga University of Medical Science, Tsukinowa, Seta, Otsu, Shiga 520-2192, Japan, to Y Maruo 1Department of Pediatrics, Niigata University, Niigata, Japan and 2Department of Molecular Endocrinology, Email National Research Institute for Child Health and Development, Tokyo, Japan [email protected] Abstract Aim: We previously reported that biallelic mutations in dual oxidase 2 (DUOX2) cause transient hypothyroidism. Since then, many cases with DUOX2 mutations have been reported. However, the clinical features and prognosis of individuals with DUOX2 defects have not been clarified. Objective: We investigated the prognosis of patients with congenital hypothyroidism (CH) due to DUOX2 mutations. Patients: Twenty-five patients were identified by a neonatal screening program and included seven familial cases. Their serum TSH values ranged from 18.9 to 734.6 mU/l. Twenty-two of the patients had low serum free thyroxine (fT4) levels (0.17–1.1 ng/dl). Twenty-four of the patients were treated with L-thyroxine. Methods: We analyzed the DUOX2, thyroid peroxidase, NaC/IK symporter, and dual oxidase maturation factor 2 genes of these 25 patients by PCR-amplified direct sequencing. An additional 11 genes were analyzed in 11 of the 25 patients using next-generation sequencing. Results: All patients had biallelic DUOX2 mutations, and seven novel alleles were detected.
    [Show full text]
  • Identification of New Substrates and Physiological Relevance
    Université de Montréal The Multifaceted Proprotein Convertases PC7 and Furin: Identification of New Substrates and Physiological Relevance Par Stéphanie Duval Biologie Moléculaire, Faculté de médecine Thèse présentée en vue de l’obtention du grade de Philosophiae doctor (Ph.D) en Biologie moléculaire, option médecine cellulaire et moléculaire Avril 2020 © Stéphanie Duval, 2020 Résumé Les proprotéines convertases (PCs) sont responsables de la maturation de plusieurs protéines précurseurs et sont impliquées dans divers processus biologiques importants. Durant les 30 dernières années, plusieurs études sur les PCs se sont traduites en succès cliniques, toutefois les fonctions spécifiques de PC7 demeurent obscures. Afin de comprendre PC7 et d’identifier de nouveaux substrats, nous avons généré une analyse protéomique des protéines sécrétées dans les cellules HuH7. Cette analyse nous a permis d’identifier deux protéines transmembranaires de fonctions inconnues: CASC4 et GPP130/GOLIM4. Au cours de cette thèse, nous nous sommes aussi intéressé au rôle de PC7 dans les troubles comportementaux, grâce à un substrat connu, BDNF. Dans le chapitre premier, je présenterai une revue de la littérature portant entre autres sur les PCs. Dans le chapitre II, l’étude de CASC4 nous a permis de démontrer que cette protéine est clivée au site KR66↓NS par PC7 et Furin dans des compartiments cellulaires acides. Comme CASC4 a été rapporté dans des études de cancer du sein, nous avons généré des cellules MDA- MB-231 exprimant CASC4 de type sauvage et avons démontré une diminution significative de la migration et de l’invasion cellulaire. Ce phénotype est causé notamment par une augmentation du nombre de complexes d’adhésion focale et peut être contrecarré par la surexpression d’une protéine CASC4 mutante ayant un site de clivage optimale par PC7/Furin ou encore en exprimant une protéine contenant uniquement le domaine clivé N-terminal.
    [Show full text]
  • An Overview of the Kallikrein Gene Families in Humans and Other Species: Emerging Candidate Tumour Markers૾
    Clinical Biochemistry 36 (2003) 443–452 An overview of the kallikrein gene families in humans and other species: Emerging candidate tumour markers૾ George M. Yousefa,b, Eleftherios P. Diamandisa,b,* aDepartment of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, Ontario, Canada bDepartment of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada Abstract Kallikreins are serine proteases with diverse physiologic functions. They are represented by multigene families in many animal species, especially in rat and mouse. Recently, the human kallikrein gene family has been fully characterized and includes 15 members, tandemly localized on chromosome 19q13.4. A new definition has now been proposed for kallikreins, which is not based on function but, rather, on close proximity and structural similarities. In this review, we summarize available information about kallikreins in many animal species with special emphasis on human kallikreins. We discuss the common structural features of kallikreins at the DNA, mRNA and protein levels and overview their evolutionary history. Kallikreins are expressed in a wide range of tissues including the salivary gland, endocrine or endocrine-related tissues such as testis, prostate, breast and endometrium and in the central nervous system. Most, if not all, genes are under steroid hormone regulation. Accumulating evidence indicates that kallikreins are involved in many pathologic conditions. Of special interest is the potential role of kallikreins in the central nervous system. In addition, many kallikreins seem to be candidate tumor markers for many malignancies, especially those of endocrine-related organs. © 2003 The Canadian Society of Clinical Chemists. All rights reserved. Keywords: Kallikrein; Tumor markers; Cancer biomarkers; Prostate cancer; Breast cancer; Ovarian cancer; Alzheimer’s disease; Serine proteases; Chromosome 19; Kallikrein evolution; Rodent kallikreins; Hormonally regulated genes 1.
    [Show full text]
  • Joint Gene Network Construction by Single-Cell RNA Sequencing Data
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452387; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Biometrics xx, 1–24 DOI: pending...... xxxx 2021 Joint Gene Network Construction by Single-Cell RNA Sequencing Data Meichen Dong1, Yiping He2, Yuchao Jiang 1,3, Fei Zou1,3,∗ 1Department of Biostatistics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, U.S.A. 2Department of Pathology, Duke University, Durham, North Carolina, U.S.A. 3Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, U.S.A. email: [email protected] Summary: In contrast to differential gene expression analysis at single gene level, gene regulatory networks (GRN) analysis depicts complex transcriptomic interactions among genes for better understandings of underlying genetic architectures of human diseases and traits. Recently, single-cell RNA sequencing (scRNA-seq) data has started to be used for constructing GRNs at a much finer resolution than bulk RNA-seq data and microarray data. However, scRNA- seq data are inherently sparse which hinders direct application of the popular Gaussian graphical models (GGMs). Furthermore, most existing approaches for constructing GRNs with scRNA-seq data only consider gene networks under one condition. To better understand GRNs under different but related conditions with single-cell resolution, we propose to construct Joint Gene Networks with scRNA-seq data (JGNsc) using the GGMs framework.
    [Show full text]