A Substrate-Specific Cytochrome P450 Monooxygenase

Insect Biochemistry and Molecular Biology 41 (2011) 244e253

Contents lists available at ScienceDirect

Insect Biochemistry and Molecular Biology

journal homepage: www.elsevier.com/locate/ibmb

A substrate-speciﬁc cytochrome P450 monooxygenase, CYP6AB11, from the polyphagous navel orangeworm (Amyelois transitella)

Guodong Niu a, Sanjeewa G. Rupasinghe b, Arthur R. Zangerl a, Joel P. Siegel c, Mary A. Schuler b, May R. Berenbaum a,* a Department of Entomology, University of Illinois, Urbana, IL 61801, USA b Department of Cell and Developmental Biology, University of Illinois, Urbana, IL 61801, USA c USDA-ARS, S. Riverbend, Parlier, CA 93648, USA article info abstract

Article history: The navel orangeworm Amyelois transitella (Walker) (Lepidoptera: Pyralidae) is a serious pest of many tree Received 13 August 2010 crops in California orchards, including almonds, pistachios, walnuts and figs. To understand the molecular Received in revised form mechanisms underlying detoxification of phytochemicals, insecticides and mycotoxins by this species, 30 December 2010 full-length CYP6AB11 cDNA was isolated from larval midguts using RACE PCR. Phylogenetic analysis of this Accepted 31 December 2010 insect cytochrome P450 monooxygenase established its evolutionary relationship to a P450 that selec- tively metabolizes imperatorin (a linear furanocoumarin) and myristicin (a natural methylenedioxyphenyl Keywords: compound) in another lepidopteran species. Metabolic assays conducted with baculovirus-expressed Amyelois transitella Cytochrome P450 monooxygenase P450 protein, P450 reductase and cytochrome b5 on 16 compounds, including phytochemicals, myco- fi Imperatorin toxins, and synthetic pesticides, indicated that CYP6AB11 ef ciently metabolizes imperatorin (0.88 pmol/ Piperonyl butoxide min/pmol P450) and slowly metabolizes piperonyl butoxide (0.11 pmol/min/pmol P450). LC-MS analysis Insecteplant interactions indicated that the imperatorin metabolite is an epoxide generated by oxidation of the double bond in its extended isoprenyl side chain. Predictive structures for CYP6AB11 suggested that its catalytic site contains a doughnut-like constriction over the heme that excludes aromatic rings on substrates and allows only their extended side chains to access the catalytic site. CYP6AB11 can also metabolize the principal insecticide synergist piperonyl butoxide (PBO), a synthetic methylenedioxyphenyl compound, albeit slowly, which raises the possibility that resistance may evolve in this species after exposure to synergists under field conditions. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction more hydrophilic metabolites that can be excreted either directly or after conjugation to glucuronides or glutathiones mediated by phase The membrane-bound cytochrome P450 monooxygenases II detoxiﬁcation enzymes (Feyereisen, 1999, 2006; Li et al., 2007). (P450s) found in the endoplasmic reticulum of aerobic eukaryotes Insect P450s have been subdivided into four major clades (clans generally mediate oxidation and release of water through an elec- or subclasses) (Nelson,1998). Clade 3 in insects is further subdivided tron-transport system that involves cytochrome P450 reductase and into the CYP6 and CYP9 families, which participate primarily in cytochrome b5 (Ortiz de Montellano, 2005). Among the insect xenobiotic metabolism (Feyereisen, 1999, 2006; Li et al., 2007). monooxygenases in the large P450 superfamily, several metabolize Within the genus Papilio (Lepidoptera: Papilionidae), CYP6 family endogenous compounds critical for growth and development, members are known to detoxify furanocoumarins, secondary including steroid hormones, juvenile hormones, and fatty acids metabolites characteristic of the host plant families consumed by (Feyereisen, 1999, 2006; Li et al., 2007). Many more are phase I these insects (Cohen et al., 1992; Hung et al., 1995a,b, 1997; Wen detoxiﬁcation enzymes important for converting xenobiotics to et al., 2003, 2005, 2006a,b; Li et al., 2003; Pan et al., 2004). Across four Papilio species, close to a dozen P450s have been demonstrated to metabolize furanocoumarins; these include CYP6B1 and CYP6B3 from Papilio polyxenes (Cohen et al.,1992; Hung et al.,1995a,b,1997; * Corresponding author at: Department of Entomology, 320 Morrill Hall, Wen et al., 2003, 2005, 2006a,b; Pan et al., 2004), CYP6B4, CYP6B17 University of Illinois, 505 S Goodwin, Urbana, IL 61801-3795, USA. Tel.: þ1 217 333 7784; fax: þ1 217 244 3499. and CYP6B21 from Papilo glaucus (Li et al., 2002a,b, 2003); CYP6B25 E-mail address: [email protected] (M.R. Berenbaum). and CYP6B26 from Papilio canadensis (Li et al., 2003), and CYP6B33

0965-1748/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2010.12.009 G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 245 from P. multicaudatus (Mao et al., 2007a, 2008a). Beyond the Pap- modes in its catalytic site allowed us to compare it with the closely ilionidae, other P450s in Clade 3 metabolizing furanocoumarins related CYP6AB3 in the more specialized D. pastinacella, which is include CYP6AB3v1 and CYP6AB3v2 from the oecophorid Depres- continuously exposed to high concentrations of furanocoumarins saria pastinacella (Mao et al., 2006b, 2007b), which is a specialist on and methylenedioxyphenyl compounds. only two genera of furanocoumarin-containing plants, and CYP6B8 and CYP321A1 from Helicoverpa zea (Li et al., 2000, 2004a,b; Sasabe 2. Experimental procedures et al., 2004; Rupasinghe et al., 2007), which is a polyphagous noctuid occasionally encountering furanocoumarins in a small 2.1. Chemicals number of its host plants. In general, across all lepidopteran families examined to date, Four furanocoumarins (xanthotoxin, angelicin, bergapten, P450 activity against furanocoumarins is correlated with the imperatorin), a coumarin (coumarin), a phenylpropanoid (myr- frequency with which these compounds are encountered in host isticin), four flavonoids (quercetin, kaempferol, flavone, a-naphtho- plants (Li et al., 2000, 2002a,b, 2004a,b, 2007; Mao et al., 2006a,b, flavone), a phenolic acid (chlorogenic acid), a mycotoxin (AFB1), and 2007a,b, 2008a,b). CYP6AB3 from D. pastinacella, a specialist that two synthetic compounds (the insecticide a-cypermethrin, the feeds on reproductive structures of two furanocoumarin- containing synergist PBO) were used to test substrate specificity of heterolo- host species, is the most specialized insect xenobiotic-metabolizing gously expressed P450 proteins. The sixteen chemicals tested as P450 yet characterized (Mao et al., 2006b, 2007b). Of the many substrates were selected based on their availability in recorded host prospective substrates in its host plants, this enzyme can metabolize plants and relationship with known substrates for related P450s. only imperatorin, a linear furanocoumarin, and myristicin, a natu- Among them, coumarin, xanthotoxin, angelicin, imperatorin and rally occurring methylenedioxyphenyl (MDP) compound (Mao et al., bergapten, flavone and a-nathoflavone have previously been deter- 2006b, 2007b, 2008b). By contrast, CYP6B8, a P450 identified from mined to be metabolized by CYP6B proteins (Hung et al., 1997; Chen Helicoverpa zea, a highly polyphagous species recorded from over et al., 2002; Li et al., 2000, 2002a,b, 2003, 2004a,b; Wen et al., 2003; 100 plant species in many families, can metabolize many structurally Pan et al., 2004; Mao et al., 2006a, 2007a; Rupasinghe et al., 2007) diverse classes of chemicals, including furanocoumarins, flavonoids and by CYP321A1 in the polyphagous H. zea (Sasabe et al., 2004; and insecticides (Li et al., 2000, 2004a,b; Rupasinghe et al., 2007). Rupasinghe et al., 2007). Myristicin and imperatorin are the The navel orangeworm Amyelois transitella is, like H. zea, substrates for the CYP6AB3 variant in the oligophagous D. pastina- a broadly polyphagous pest of a wide range of crop plants; this cella (Mao et al., 2008b). Aflatoxin B1 is a substrate of H. zea species causes extensive damage to almonds, pistachios, walnuts, CYP321A1 (Niu et al., 2008) and has been frequently found in pomegranate, and figs in California orchards (Connell, 2001; mummy almonds and pistachio. Quercetin and kaempferol are Campbell et al., 2003; Molyneux et al., 2007). In almond orchards, flavonoids that are widely distributed in the host plants of A. tran- eggs are laid on both new crop and mummy nuts on trees, and larvae sitella and chlorogenic acid has been isolated from almonds and bore into nuts and eat the nutmeat until pupation. A. transitella also pistachios infested with A. transitella larvae (Vaya and Mahmood, serves as a vector for the aflatoxin-releasing fungi Aspergillus flavus 2006; Rubilar et al., 2007; Bolling et al., 2009; Teets et al., 2009). and A. parasiticus (Widstrom et al., 1976; Schatzki and Ong, 2000, Quercetin and chlorogenic acid are also efficiently metabolized by 2001; Campbell et al., 2003) and wounds in fruits caused by A. H. zea CYP6B8 (Li et al., 2004a,b). Several synthetic insecticides and transitella damage also facilitate entry of spores. A. transitella their synergists were also tested as P450 substrates including a- infestations have often been linked with substantial aflatoxin cypermethrin, aldrin and diazinon and the insecticide synergist PBO. contamination, rendering the crop unmarketable (Schatzki and Of these, a-cypermethrin (a pyrethroid insecticide) has been widely Ong, 2000, 2001; Campbell et al., 2003). Demand for almonds applied in orchards to control A. transitella (UC IPM online, 2009, worldwide is reaching unprecedented levels, leading to rapid http://www.ipm.ucdavis.edu/PMG/r605300111.html). expansion of almond acreage. Accordingly, to meet export All of these compounds and nicotinamide adenine dinucleotide requirements for aflatoxin contamination, minimizing A. transitella phosphate (NADPH) were purchased from Sigma (St. Louis, MO). infestations is an important priority. Aldrin, diazinon and methoprene were bought from Indofine In comparison with most other insects, A. transitella is remark- Chemical Company Inc. (San Francisco, CA). All reagents for heter- ably resistant to aflatoxin toxins (Niu et al., 2009) due at least in ologous expression in Sf9 insect cells, including Sf9 cells, SF-900 part to an extremely active P450 detoxification system, which can serum-free medium and fetal bovine serum (FBS), were purchased rapidly convert aflatoxin B1 (AFB1) into less toxic metabolites, from GibcoBRL/Life Technology (Grand Island, NY). All of the including aflatoxin M1 (AFM1), aflatoxin B2a (AFB2a) and aflatox- chemicals analyzed were dissolved in methanol and prepared as icol (AFL) (Lee and Campbell, 2000). This active P450 detoxification 10 mM stock solutions stored at 20 C. All HPLC solvents were system is likely also involved in allowing A. transitella to thrive on bought from Fisher Scientific L.L.C. (Pittsburgh, PA). House fly P450 a broad range of chemically diverse host plants. Moreover, in the reductase and fruit fly cytochrome b5 recombinant viruses were absence of completely effective cultural or biological controls, constructed by Dr. Zhimou Wen. growers have remained heavily reliant on a variety of insecticides for A. transitella management and its P450 detoxification system 2.2. Insects may also serve this species as a preadaptation for acquiring resistance to synthetic organic insecticides. A laboratory colony of A. transitella was established and subse- To understand the extent to which the ability of A. transitella to quently enriched with specimens from Parlier, California. The function in an environment presenting a diversity of toxicological colony was maintained in an insectary at University of Illinois at challenges, including phytochemicals, mycotoxins, and insecticides, Urbana-Champaign at 28 4 C with16-h L/8-h D light cycle. depends on P450 detoxification, we cloned a full-length P450 cDNA A. transitella larvae were reared in 1000 ml plastic cups containing expressed constitutively in A. transitella larvae and expressed it in a wheat bran diet as described by Tebbets et al. (1978) and modified baculovirus-infected Sf9 insect cells. Our expectation was that this by one author (JPS); small holes were punched in the lid of each cup constitutively expressed P450 likely contributes to the metabolism to control moisture levels. A. transitella moths emerged approxi- of a broad diversity of host phytochemicals. Characterization of mately one month after the first instar stage. For breeding, 20e30 the metabolites for CYP6AB11 and prediction of substrate binding adults were transferred to a clean 1000 ml plastic cup with a piece 246 G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 of tissue paper placed inside the cup and a piece of tissue paper 70 C for 30 s, 72 C for 3 min; 30 cycles at 94 C for 30 s, 68 C for covering the top. 30 s, 72 C for 3 min; the final extension at 72 C for 10 min. The reaction mixture was then diluted 50 times and 5 ml of the diluted PCR product was used to set up a nested PCR amplification with 1 ml 2.3. Isolation of the full-length cDNA from Amyelois transitella 10 mM of a nested gene-specific primer (62SM-NGSP1) and 5 ml 10 UPM primer stock. These reactions were PCR-amplified with 1 2.3.1. RNA isolation and 30 RACE PCR amplification cycle at 94 C for 5 min; 25 cycles at 94 C for 30 s, 68 C for 30 s, Total RNA was extracted using TRIzol reagent (Invitrogen, 72 C for 3 min; and 1 cycle of final extension at 72 C for 10 min. Carlsbad, CA) according to manufacturer’s directions from 30 The PCR products were electrophoresed on a 1% agarose gel and midguts dissected from larvae one day after molting to the final those at approximately 1.5 kb were excised and purified using instar. Superscript II (Invitrogen) was used to synthesize the first a QIAquick gel extraction kit and then cloned into pGEM-T-easy strand, with C3PT as the oligo (dT) primer (Table 1) and 1 mgof 17 vector. Plasmid DNAs isolated from white colonies on plates con- total RNA as the template. The first strand cDNA was purified using taining ampicillin, isopropyl b-D-1-thiogalactopyranoside (IPTG) a QIAquick PCR purification kit (Qiagen, Valencia, CA) to remove the and X-gal were sequenced at the Core DNA Sequencing Facility at primers and short cDNA; this product then became the 30 RACE UIUC. Ready DNA for use in the next RACE amplification. A degenerate primer based on the conserved amino acid 2.3.3. Generation of the full length cDNA sequence of FDPER approximately 80 nucleotides upstream of the The 30 RACE-Ready cDNA described here was used as the heme-binding region (Li et al., 2004a,b) and a C3 adaptor primer template with a 50 gene-specific primer (GN6AB11_CDS_forward) (Table 1) were used to amplify putative 30 cDNA sequences of P450 corresponding to the start codon and a 30 gene-specific primer genes. The PCR reaction (50 ml) was heated to 94 C for 5 min, fol- (GN6AB11_CDS_reverse) corresponding to the stop codon was lowed by 30 cycles of amplification (94 C for 30 sec, 55 C for 30 mixed with other PCR components including 2.5 ml30 RACE cDNA, sec and 72 C for 1 min) and by a final extension at 72 C for 10 min. 1 ml Advantage 2 polymerase, and 5 ul 10 Advantage PCR buffer, After 1.5% agarose gel fractionation of the PCR products, DNA 1 ml dNTP (10 mM) and sterile water to a final volume of 50 ml. The fragments in the size range of 300e700 bp were cut out, purified PCR amplification was conducted with 1 cycle at 94 C for 5 min, 30 using a QIAquick gel extraction kit (Qiagen), and cloned into the cycles at 94 C for 30 s, 60 C for 30 s, 72 C for 2 min and a final pGEM-T-easy vector (Invitrogen). Recombinant plasmids were cycle at 72 C for 10 min. The PCR products were electrophoresed isolated from 46 positive clones and their inserts were sequenced on a 1% agarose gel and each approximately 1.5 kb fragment was from both ends by the Core DNA Sequencing Facility at UIUC using excised and purified with a QIAquick PCR purification kit (Qiagen). vector primers. Among these clones, nine putative P450 fragments To insert the PCR product into the pFastbac vector for sequencing corresponding to three independent P450 sequences were identi- and expression, the purified PCR product and pFastbac vector were fied by BLAST analysis. digested with enzymes whose recognition sites were incorporated into their primers (Table 1) and purified with a QIAquick PCR 2.3.2. 50 RACE PCR purification kit. A ligation reaction was conducted in a reaction The 50 ends of the P450 sequences were amplified with the mixture containing 3 ml (150 ng) PCR product, 1 ml (100 ng) pFast- SMARTÔ RACE cDNA Amplification kit (Clontech, Mountain View, bac, 1 ml T4 DNA ligase (Invitrogen), 1 ml10 T4 DNA ligase buffer CA) following the manufacturer’s instructions. First-strand cDNA and 4 ml sterile water and incubated at 4 C overnight. The ligated synthesis was performed using 1 mg total RNA, 1 ml CDS primer A DNA was transformed into Top10 competent cells (Invitrogen) and and 1 ml SMART II A oligo and sterile water to a final volume of 5 ml. plated on ampicillin plates, and plasmids were isolated with After the mixture was incubated at 70 C for 2 min and cooled on QIAprep Spin Miniprep Kit (Qiagen) from the ampicillin-resistant ice for 2 min, 2 ml5 first-strand buffer, 1 ml 20 mM DDT, 1 ml colonies and sequenced at the Core DNA Sequencing Facility at 10 mM dNTP mix and 1 ml MMLV reverse transcriptase were added UIUC. and the mixture was incubated at 42 C for 1.5 h. After this incubation, the final mixture was diluted with the addition of 100 ml 2.4. Phylogenetic analysis Tricin-EDTA buffer. and the 50 RACE PCR amplification was set up by mixing 1 ml 10 mM of a gene-specific primer (62SM-GSP1) A phylogenetic analysis was performed for 15 protein sequences (Table 1), 5 ml10 Advantage PCR buffer, 1 ml 10 mM dNTP, 1 ml selected to represent lepidopteran P450s involved in xenobiotic 50 Advantage 2 Polymerase Mix, 5ul 10 UPM primer stock and metabolism; these included CYP6B1 from P. polyxenes (black sterile water to a final volume of 50 ml. A PCR amplification reaction swallowtail), CYP321A1 and CYP6B8 from H. zea (corn earworm), was set up sequentially with a program of 1 cycle at 94 C for 5 min; CYP6B10 from tobacco budworm Heliothis virescens (tobacco 5 cycles at 94 C for 30 s, 72 C for 3 min; 5 cycles at 94 C for 30 s, budworm), CYP6B11 from Papilio canadensis (Canadian tiger swallowtail), CYP6B12 from P. glaucus (Eastern tiger swallowtail), Table 1 CYP6B29, CYP6AB4 and CYP6AB5 from Bombyx mori (domesticated Primers used for 50 and 30 RACE amplification of Amyelois transitella P450s. silkworm), CYP321C1, CYP6AB11 and CYP6B44 from A. transitella, Primers Sequences (50 to 30) CYP6AB3v1 and CYP6B7 from D. pastinacella (parsnip webworm) and CYP321B1 from H. armigera (cotton bollworm). A phylogenetic FDPER primer GCGGATCCTT(T/C)GA(T/C)CC(I/A)GA(A/G)AG(A/G)TT C3PT GAC TCG AGT CGG ATC CAT CGT TTT TTT TTT TTT TTT T tree was built using the neighbor-joining method in Mega 3.0 C3 GAC TCG AGT CGG ATC CAT CG software and the inferred phylogeny was tested by bootstrap 62SM-GSP1 CAG CAC AGC CGC CAA TCC AGC CAA T analysis with 1000 replicates (version 3.1, Kumar et al., 2004). The 62SM-NGSP1 TAGGTCCCGTACCAAAGGGCAGATAAAT alignments, with amino acid substitutions labeled as strongly GN6AB11_ GGCGGTCCGGAATTCATGATCATACCAATTGCCGTAATTG CDS_forward conservative, weakly conservative or nonconservative, were Rsr II Ecor I generated with ClustalW functions in SDSC Biology Software GN6AB11_ GGGCGGCCGCAAGCTTTTAATTAAAATTGACCACATTTCGC (http://workbench.sdsc.edu). The substrate recognition sites (SRS) CDS_reverse in these proteins were determined by alignment with the CYP6B8 Not I Hind III and CYP321A1 sequences described in Rupasinghe et al. (2007). G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 247

2.5. Baculovirus-mediated expression of A. transitella P450s and activity. In the final assays, the MOI ratio (P450: P450 reductase: cytochrome b5) used for CYP6AB11 analysis was 1:1:0.1. The The CYP6AB11 cDNA was introduced into the pFASTBac bacu- infected cells were grown at 28 C and harvested after 72 hr with lovirus expression vector as described in Niu et al. (2008) by 10 ml 5 mg/g heme stock dissolved in 50% ethanol and 50% 1 N transposing the pFASTBac clones containing the cDNA into DH10 NaOH added to each 10 ml culture plate 24 h after the initial competent cells and selecting on kanamycin/gentamicin/tetracy- transfection. After this incubation, the virus particles were cline/blue-gal/IPTG plates. Recombinant bacmid DNAs were iso- precipitated by centrifugation at 5000 rpm for 10 min at 4 C and lated with a QIAprep Spin Miniprep kit (Qiagen), with the exception the cell pellets were washed once with an equal amount of 0.1 M that, due to the large size of the bacmid DNA (>135 kb), the isolated phosphate buffer (pH 7.8) and resuspended in one-tenth volume DNA was washed once with 70% alcohol instead of being column- cell lysis buffer [0.1 M phosphate buffer (pH 7.8), 1 mM EDTA, purified (as for smaller plasmids). To determine whether the P450 0.5 mM PMSF, 0.1 mM DTT, 20% glycerol]. The resuspended pellets sequence was successfully inserted into the bacmid vector, PCR were sonicated for 15 sec per ml of protein pellet and centrifuged at amplifications were conducted with an internal gene-specific and 5000 rpm for 10 min, and the final supernatant was frozen in liquid M13 vector primers (Table 1) and the products were electro- nitrogen and stored at 80 C prior to metabolism assays. phoresed on 1% agarose gels. The recombinant viruses were generated by transfecting 1.5 mg(5ml) recombinant bacmid DNA 2.6. Metabolism assays by the heterologously expressed P450 containing the correctly sized insert into Sf9 cells using Cellfectin Reagent (Invitrogen) following manufacturer’s procedure. The Metabolism assays were carried out in 0.5 ml reactions con- recombinant baculoviruses were harvested after 72 h and amplified taining 0.1 M phosphate buffer (pH 7.8), 0.3 nmol P450 in cell lysis by infecting Sf9 cells with 500 ml of the recombinant virus stock and buffer and 10 nmol substrate. Reaction were initiated with the collecting the amplified virus particles after 48 h. Plaque assays addition of 50 nmol NADPH (0.2 mM) and incubated at 30 C for 1 h were used to determine the virus titer. with shaking and stopped with the addition of 100 ml of 1 M HCl. The P450 protein was co-expressed in Sf9 cells with two redox For the samples analyzed by either normal-phase HPLC or GC-MS, partners, house fly P450 reductase and fruit fly cytochrome b5, and 400 ml of ethyl acetate including an internal standard (Table 2)were the P450 content of each sample was determined by reduced CO added to each reaction and the reaction mixtures were centrifuged difference analysis (Omura and Sato, 1964). In preliminary assays, at 10,000 rpm for 10 min at room temperature, after which 1 mlor the MOI (multiplicity of infection) ratios of the P450, P450 reduc- 10 ml ethyl acetate extracted phase was injected for analysis. For the tase and cytochrome b5 were varied to balance P450 production samples analyzed by reverse-phase HPLC, 0.5 ml acetone was

Table 2 Analytical methods for substrates of metabolism assays.

Substrates Internal standard Analysis method Elution solvent Detection Elution time (nm) (min) Xanthotoxin Bergapten Normal HPLCa 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 5.1 1.5 ml/min flow rate Bergapten Xanthotoxin Normal HPLC 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 4.2 1.5 ml/min flow rate Angelicin Xanthotoxin Normal HPLC 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 3.1 1.5 ml/min flow rate Coumarin Xanthotoxin Normal HPLC 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 3.5 1.5 ml/min flow rate Imperatorin Xanthotoxin Normal HPLC 80% cyclohexane, 19% diethyl ether and 2% butanol; 254 3.8 1.5 ml/min flow rate Flavone Xanthotoxin Normal HPLC 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 3.9 1.5 ml/min flow rate a-naphthoflavone Xanthotoxin Normal HPLC 80% cyclohexane, 18% diethyl ether and 2% butanol; 254 3.0 1.5 ml/min flow rate Quercetin None Reverse HPLCb 45% methanol, 55% water in 0.2% acetic acid; 375 20.1 1 ml/min flow rate Kaempferol None Reverse HPLC 60% methanol, 40% water in 0.2% acetic acid 375 8.9 Chlorogenic acid None Reverse HPLC 7% acetonitrile, 93% water in 0.01% formic acid; 328 22.1 1 ml/min flow rate Imperatorin Xanthotoxin Reverse HPLC Gradient solvent system: pump A water in 0.05% formic acid; 254 19.6 B methanol; start from 80%A for 2 min; condition the column from 80%A to 100%B in 13 min; remain in 100%B for 5 min; condition the column from 100%B to 80%A 2 min; remain in 80% A for 10 min. Myristicin Methoprene GC-MSc In legend. 14.1 PBO Methoprene GC-MS In legend. 27 a-cypermethrin Methoprene GC-MS In legend. 32.4 Aldrin Methoprene GC-MS In legend. 19.5 Diazinon Methoprene GC-MS In legend. 16.7 Aflatoxin B1 Aflatoxin G1 Reverse HPLC 60% water, 20% acetonitrile; 20% methanol; 1 ml/min flow rate 14.5

a Normal phase HPLC system consist of Waters WISP 710B autosampler, Waters M-45 solvent delivery system, Waters 440 absorbance detector, Hewlett Packard 3390A integrator and Waters silica column (4.6 50 mm). b Reverse-phase HPLC system consists of Waters 501 pump, Waters WISPC autosampler and Waters 996 photodiode array (PDA) and Supercosil LC-18 column (250 mm 4.6 mm). c GC-MS system: GC-2010 chromatograph spectrometer, GCMS-QP2010 plus mass spectrometer, AOC-20S Shimadzu autosampler and column (Shimadza, Kyoto, JP). GC-MS program: injection temperature 290 C, column temperature starts from 40 C, hold for 1 min, 30 C/min to 130 C, at 5 C/min to 250 C, at 10 C/min to 300 C, hold for 5 min; ion source temperature 230 C, interface temperature 280 C. The purified helium flow for GC-MS is 1.5 ml/min. The area of the chemical was integrated based on total ion chromagraph profile by the software with the system. 248 G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 added to each reaction, samples were centrifuged at 10,000 rpm for around the substrate were selected as substrate contact residues 10 min and then a 10-ml sample was injected into the reverse-phase and secondary structural elements containing these residues were HPLC for analysis. Details of the analytical methods are summarized selected as SRS. in Table 2; sixteen compounds representing a range of substrates known to be metabolized by other lepidopteran CYP6 proteins 3. Results were selected for assay. The turnover rates of the parent compounds due to the activity of the P450 protein were calculated 3.1. Gene analysis of P450s identified from A. transitella based on substrate disappearance. Each metabolism assay was fi replicated three times. The signi cant and consistent disappear- To identify P450s involved in detoxification of phytochemicals, ance rate of 3% detected with either GC or HPLC in three replicates insecticides and mycotoxins, full-length P450 cDNAs from A. tran- was set as the detection limit. PBO and imperatorin have been sitella larval midguts were amplified using 30 RACE strategies with tested in metabolism reactions at 1 h, 2 h and 3 h. Because the rate a degenerate primer corresponding to the conserved FDPER region fi stabilized after 1 h and was unchanged at 2 and 3 h, the nal in P450s approximately 30 amino acids upstream of the heme- metabolism rate was based on the measurement taken at 1 h. binding region. These 30 RACE clones were subsequently extended to their translation start sites using 50 RACE strategies and gene- fi 2.7. Identi cation of the metabolite of imperatorin specific primers. The isolated P450 cDNAs classified as CYP6AB11 contain 516 amino acids. The phylogenetic tree was built with the The imperatorin metabolite generated by CYP6AB11 was amino acid sequences from the CYP6AB subfamily and other P450s analyzed by reverse phase HPLC to separate the metabolite from its in Lepidoptera known to be involved in metabolism of phyto- m parent compound. A 200 l aliquot of the ethyl acetate- extracted chemicals, insecticides and mycotoxins. The CYP6AB P450s are phase from a 0.5 ml metabolism reaction containing 0.3 nmol P450 more closely related to P450s from the CYP6B subfamily than those and 10 nmol imperatorin was incubated for 1 h at 30 C, dried from the CYP321 family (Fig. 1). Within the CYP6AB subfamily, m under nitrogen and then dissolved in methanol. A 10 l sample was primary sequence alignments with CYP6AB11 indicated that it injected onto the reverse-phase HPLC according to the method shares higher amino identity with CYP6AB4 and CYP6AB5 from m described in Table 2. After this step, a 10 l sample from the same B. mori (67% and 57%) than with CYP6AB3v1 and CYP6AB7 from reaction was examined by LC-MS (Shimadzu, model 2010EV, Kyoto, D. pastinacella (55%). The 13 identified CYP6AB sequences are JP) using positive electrospray ionization (ESI) with the same distributed across five species in Lepidoptera, including A. tran- solvent system but with a Luna C18 column (250 mm 2 mm, sitella, B. mori, D. pastinacella, Trichoplusia ni, and Papilio multi- m 5 m, Phenomenex). caudatus: http://drnelson.utmem.edu/cytochromeP450.html. The alignment between CYP6AB11 and CYP6AB3v1, which is the only 2.8. Molecular modeling and substrates docking in the P450s functionally known P450 in the CYP6AB subfamily, shows that, of the 88 amino acids in the SRS regions of the CYP6AB proteins, 39 P450 structures were predicted using MOE programs (Chemical amino acids are absolutely conserved, 15 amino acids are strongly Computing Group, Montreal, Canada) as previously described in conserved, 3 amino acids are weakly conserved and 31 amino acids Mao et al. (2006b) using several templates, including CYP2C5 are not conserved (Fig. 2). (1N6B; Wester et al., 2003), CYP2C8 (1PQ2; Schoch et al., 2004), CYP2C9 (1OG5; Williams et al., 2003), CYP3A4 (1TQN; Yano et al., 3.2. Characterization of the substrates of the P450s 2004) and CYP102 (2HPD; Ravichandran et al., 1993). After energy from A. transitella minimization with CHARMm22 force field (MacKerell et al., 1998), each model was tested for its quality with Profiles 3D (Insight To characterize its substrates, the P450 cDNA was co-expressed in Homology Accelerys, CA, USA) and ProsaII (CAME Salzburg, Austria) Sf9 insect cells with house fly P450 reductase and Drosophila mela- and the model tested with the best quality was selected for nogaster cytochrome b5 cDNAs. Expression conditions were opti- substrate docking experiments. mized by adjusting the ratio of P450: P450 reductase:cytochrome The energy-minimized substrate-free protein structures were docked with substrate molecules, using the Monte-Carlo docking procedure of MOE with the MMFF94s force field (Halgren, 1996) for the oxygen-free heme as distributed in MOE 2004. The structures were initially placed above the heme plane and allowed to vary through Monte-Carlo simulations. Hundreds of possible confor- mations were generated for each substrate inside the catalytic site and ranked according to the sum of the ligand’s internal energy, van der Waals and electrostatic energy terms of the potential energy function. The lowest energy conformation was selected as the most feasible binding mode; the binding energy for each compound was calculated using the MMFF94s force field and the best-ranked binding modes for each compound were selected, included in the protein, and energy-minimized, assuring that the final energy gradient was less than 0.01 kcal/mol per Å. In the protein/ligand minimizations, the heme coordinates were kept fixed to avoid any distortion of the heme plane due to the lack of bonded parameters for the heme in the MMFF94s force field. Interaction energies between the minimized protein and the ligand were calculated as Fig. 1. Phylogenetic analysis A rooted phylogenetic tree was constructed using the the difference between the total potential energy of the minimized neighbor-joining method built in Mega 3.1 and the inferred phylogeny was tested by complex and the sum of the individual protein and minimized bootstrap analysis with 500 replicates. The branch lengths are proportional to components of the complex. Amino acids within a 4.5 Å radius p-distance with numbers representing the bootstrap calculated. G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 249

Fig. 2. Protein alignments. The sequences of Amyelois transitella CYP6B11v1 and Depressaria pastinacella CYP6AB3v1 and CYP6AB3v2 are aligned with substrate recognition sites (SRS) indicated in gray boxes. Amino acid conservations are: “*”single, fully conserved residue; “:”conservation of strong groups; “.”conservation of weak groups; “no label” represents no consensus.

b5 to achieve maximum activity toward test substrates. The sixteen HPLC, where the metabolite of imperatorin generated in reactions chemicals tested as potential substrates are either known to occur in containing NADPH eluted at the retention time of 16.1 min (Fig. 3A) A. transitella host plants (phytochemicals/mycotoxins) and A. tran- while, without the addition of NADPH, no metabolite was detected sitella habitats (insecticides) or are structurally related to such (Fig. 3B). This analysis indicated that the metabolite has a spectrum compounds and are known substrates for related P450s in other with maximum absorbance peaks at 299 nm, 249 nm and 213 nm, lepidopterans. Analysis of substrate disappearance in these assays typical of the spectral characteristics of furanocoumarins (Fig. 3C). indicated that imperatorin is efﬁciently metabolized by CYP6AB11 LC-MS analysis was performed to further characterize the (0.88 nmol/min/nmol P450), PBO is more slowly turned over structure of the imperatorin metabolite. In positive mode electro- (0.11 nmol/min/nmol P450) and, surprisingly, none of the other spray, the metabolite yielded four fragments: 203, 269, 287 and 309 substrates were metabolized at the detection level (3% disappear- (Fig. 4). Like the mass spectrum of imperatorin, the metabolite ance rate) and no metabolites of these substrates could be detected. produces a fragment of mass equal to 202 (the plus 1 being 203 CYP6B enzymes characterized from other polyphagous lepidop- m/z), which is equivalent to the fragment obtained from thermal terans (Papilio glaucus, Li et al., 2003; Helicoverpa zea, Li et al., degradation in GC-MS and is identical to xanthotoxol, the tricyclic 2004a,b; Rupasinghe et al., 2007) metabolize many of these same structure with only an alcohol remaining from the isoprenyl side compounds. chain. The generation of the xanthotoxol fragment indicates that the aromatic rings are not the target of this enzyme. The fragment 3.3. Identiﬁcation of the metabolite of imperatorin produced of mass 309 ion is the adduct of the metabolite attached to by CYP6AB11 a sodium ion and the intact metabolite appears to be an epoxide formed by the insertion of an oxygen atom into the double bond in Imperatorin disappearance detected by normal phase HPLC the isoprenyl side chain. The fragment of mass 286 is equivalent to analysis was accompanied by the appearance of a new peak eluting the addition of exactly one atom of oxygen and the fragment of at 3.3 min. To further separate the metabolite from its parent mass 287 is the þ1 ion of this metabolite. The last fragment of mass compound, samples were subsequently analyzed by reverse phase 268 is an adduct attached to a sodium ion which may result from 250 G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253

3.4. Structure predictions and substrate docking

Alignment of CYP6AB11 with the available mammalian P450 templates indicated that the template with the highest sequence identity for CYP6AB11 was CYP3A4 (31% sequence identity). The CYP3A4 template was, in fact, used to build the original D. pastinacella CYP6AB3 model (Mao et al., 2006b) and we used it as the template to predict the CYP6AB11 structure. At the level of primary sequence alignments, CYP6AB11 is 55% identical to CYP6AB3 and the molecular models of both proteins are structurally similar. Overlays of their active sites (Fig. 5) indicate that most of the active site residues are conserved, particularly those close to the heme, where they form a doughnut-like structure similar to that described in the CYP6AB3 molecular model (Mao et al., 2006b). Even so, CYP6AB11 and CYP6AB3 do not exactly align because there are amino acid insertions of Pro105 (in SRS1) and Pro235 (between SRS2 and SRS3) in CYP6AB3. Interestingly, all of the amino acids creating the doughnut-like structure constricting the catalytic site are conserved except for Ile310 (CYP6AB3) vs. Val308 (CYP6AB11) (Fig. 5). Docking of imperatorin in the active site predicts that imperatorin binds in the same orientation as in CYP6AB3 but with a slightly higher interaction energy of 38.4 kcal/mol and at a slightly greater distance from the heme estimated to be 7.2 Å. The Ile310- to-Val308 replacement in CYP6AB11 enlarges the opening to the heme and is predicted to allow imeratorin to be slightly more mobile than in the CYP6AB3 catalytic site.

4. Discussion

Without a fully sequenced genome, characterizing the xenobiotic-metabolizing P450 inventory of a particular species is experi- mentally challenging. Our effort to identify the subset of P450s in the A. transitella genome associated with xenobiotic metabolism, however, was greatly facilitated by the use of bioinformatics, homology modeling, and comparative ecology, which allowed us to Fig. 3. Imperatorin metabolite analysis. Metabolic reactions conducted with heterolo- fi gously expressed CYP6AB11 and imperatorin were fractionated by reverse-phase HPLC build on prior work identifying substrate speci cities in related as described in Materials and Methods. The metabolite of imperatorin eluted at 16.1 min P450s. Thus, we were able to demonstrate that CYP6AB11 is able to in reactions containing NADPH (B) and was absent from reactions lacking NAPDH (A); metabolize imperatorin at a significant rate (0.88 pmol/min/pmol the internal standard xanthotoxin eluted at 16.6 min. Analysis of the imperatorin P450). metabolite scanned with the HPLC photodiode array detector is shown in (C). Imperatorin is a toxic furanocoumarin that has been isolated primarily from a range of plant species in the Apiaceae and Ruta- the loss of three carbons at the trailing end of the epoxide. This ceae (Berenbaum, 1991; Berenbaum and Zangerl, 1998; Baek et al., product is identical to that reported for CYP6AB3-mediated 2000). While A. transitella has no known apiaceous host plants, it is metabolism of imperatorin; CYP6AB3 also appears to target the commonly found on fig(Ficus carica), a moraceous plant reported double bond in the isoprenyl side chain (Mao et al., 2006b, 2007b). to contain several linear furanocoumarins, including both oxy- No metabolite of PBO was observed in our GC-MS analysis. peucedanin and oxypeucedanin hydrate, which, like imperatorin,

Fig. 4. LC-MS spectrum of the imperatorin metabolite produced by CYP6AB11. G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 251

same orientation as it does in CYP6AB3. Comparison of the predicted interaction energies suggests that imperatorin binds in the CYP6AB11 catalytic site with a slightly higher interaction energy consistent with our metabolic assays. Protein alignments within the CYP6AB families indicate that CYP6AB11 does not have the Ala92Val replacement that characterizes the CYP6AB3v2 variant and enhances its rate of imperatorin metabolism by increasing electron transfer from P450 reductase (Mao et al., 2007b). The absence of this replacement helps to explain why the catalytic activity of CYP6AB11 is closer to that of CYP6AB3v1 than that of CYP6AB3v2. PBO is known as a general P450 inhibitor and has historically been used as a synergist for pyrethroid insecticides. It has two rings, a long side chain (C9H19O3) and a short side chain (C3H7). Mecha- nisms of PBO metabolism are complex and not fully clear; most studies conducted with mammalian P450s have identified more than 10 metabolites, but the specific biochemical pathways leading to their formation have not yet been fully elucidated (Byard and Needham, 2006). Despite the ability of CYP6AB11 to metabolize small amounts of PBO, it displayed no consistent detectable activity against myristicin, another MDP compound that shares both a core structure and synergistic activity with PBO. The fact that myristicin levels declined less than 5% in the metabolism reactions incubated for 2 h indicates that any activity which might exist is close to the detection limit for myristicin metabolism and is significantly less than for CYP6AB3v2, which actively metabolizes myristicin (Mao et al., 2008b). The presence of a seemingly fairly specialized CYP6AB11 in Fig. 5. Predicted imperatorin binding mode in the CYP6AB3 and CYP6AB11 models. the broadly polyphagous A. transitella appears to contrast with The predicted structures for CYP6AB3 and CYP6AB11 are overlaid with conserved previous findings that CYP6B genes in polyphagous lepidopterans contact residues within 4.5 Å of imperatorin shown in green and nonconserved contact fi residues in elemental colors. In each of the four sets of residues forming the doughnut- are as a rule broadly substrate-speci c. Our effort to identify more like constriction over the heme, the first designated is that in CYP6AB3 and the second substrates by subjecting a whole-plant extract to metabolism is that in CYP6AB11. The binding modes for imperatorin in CYP6AB3 and CYP6AB11 are assays (cf., Mao et al., 2008b) failed to reveal any additional suitable shown in aqua and orange, respectively (For interpretation of the references to color in substrates, despite considerable chemical complexity present in this figure legend, the reader is referred to the web version of this article.). these extracts. This seemingly specialized enzyme may be an evolutionary vestige of a closer association with a particular subset contain an 8-O-prenylated side chain (Zaynoun et al., 1984; Towers, of host plants. The navel orangeworm, as the name suggests, was 1986). In other lepidopteran species, furanocoumarins with an originally described from Citrus spp. (Mote, 1922). Although this extended side chain at the 8-position are metabolized by different host association is rarely reported (Mahoney et al., 1989) and this P450s from those that metabolize 8- or 5-methoxy-substituted New World native species (Mexico into South America) has not furanocoumarins. For example, whereas CYP6B1 in P. polyxenes, the been reported to occur on native rutaceous hostplants (Heppner, black swallowtail, metabolizes both xanthotoxin (8-methoxypsor- 2003), it is intriguing to note that citrus and other rutaceous alen) and bergapten (5-methoxypsoralen) at high rates, it appar- species are rich in isoprenylated and/or prenylated coumarins ently has little to no catalytic activity against imperatorin (Cohen (Murray et al., 1982), which may have played a key role in the et al., 1992). Conversely, CYP6AB3 from D. pastinacella, which is evolution of this pest species. highly active against imperatorin, has little to no catalytic activity An examination of the host use patterns and detoxification against either bergapten or xanthotoxin (Mao et al., 2006b, 2007b). capacity of close relatives of A. transitella may shed light on the Among lepidopteran furanocoumarin-metabolizing P450s, only significance of O-isoprenylated compounds in A. transitella evolu- CYP6B4 from the polyphagous P. glaucus can metabolize imper- tion. Approximately one-third of the native hostplants recorded for atorin as well as 5-methoxy substituted furanocoumarins, possibly this species, the largest proportion, are legumes (Heppner, 2003) because several amino acid differences in substrate recognition and its close relative Ectomyelois decolor is also reported to feed on sites enlarge the catalytic pocket to accommodate a greater range of pods of legumes (Kimball, 1965), as do larvae of the related Any- substrates (Li et al., 2003). psipyla univitella and Anypsipyla sp. nr. univitella (Samanea saman) CYP6AB11 shares 55% identity with CYP6AB3 and, based on (Staples and Elevitch, 2006; McKay and Gandalfo, 2007). Prior to a comparison of their predicted 3-dimensional structures, also the introduction of a wide variety of nonindigenous tree fruit crops, shares a doughnut-like structure immediately above the heme that A. transitella may thus have fed primarily on fallen and/or dried limits substrate access to the catalytic site. Key residues limiting fruits of tree species in the Fabaceae. Legumes, including many access include Phe118 in SRS1 and Ala314 and Thr318 in SRS4 and known host genera of A. transitella, are rich in isoflavonoids and Leu380 in SRS5, which are conserved both in CYP6AB3 and related compounds that often contain isoprenyl substituents CYP6AB11 (Fig. 5)(Mao et al., 2006b). The doughnut structure in (Veitch, 2009). Whether such isoprenyl groups attached to iso- CYP6AB11 and CYP6AB3 has not been found in other CYP6 family flavonoids or other structures can fit into the “doughnut hole” of proteins modeled to date. The imperatorin metabolite generated by CYP6AB11 and subsequently undergo epoxidation and detoxifica- CYP6AB11 possesses an epoxide side chain, the result of attachment tion has not yet been determined, but if such is the case the of oxygen to the side chain double bond; the CYP6AB11 model evolution of CYP6AB11 may well have contributed to the successful docked with imperatorin shows that this substrate can bind in the colonization and exploitation of fallen and/or dried fruits of tree 252 G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 species of legumes by A. transitella. This preadaption in turn may Li, X., Berenbaum, M.R., Schuler, M.A., 2000. Molecular cloning and expression of have enabled A. transitella to utilize a wide variety of nonindige- CYP6B8: a xanthotoxin-inducible cytochrome P450 cDNA from Helicoverpa zea. Insect Biochem. Mol. Biol. 30, 75e84. nous tree fruit crops in Moraceae, Rosaceae, Rutaceae and other Li, X., Schuler, M.A., Berenbaum, M.R., 2007. Molecular mechanisms of metabolic families containing prenylated compounds (Murray et al., 1982; resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52, 231e253. Sang et al., 2002; Monteiro et al., 2002). MacKerell Jr., A.D., Bashford, D., Bellott, M., Dunbrack Jr., R.L., Evanseck, J.D., Field, M.J., Fischer, S., Gao, J., Guo, H., Ha, S., 1998. All-atom empirical potential for molecular modeling and dynamics studies of proteins. J. Phys. Chem. B 102, Acknowledgments 3586e3616. Mahoney, N.E., Roitman, J.N., Chan, B.C., 1989. Structure-activity relationship of flavones as growth inhibitors of the navel orangeworm. J. Chem. Ecol. 15, We thank Zhimou Wen for advice and assistance in the bacu- 285e290. lovirus expression and metabolism assays and Terry Harrison for Mao, W., Berhow, M.A., Zangerl, A.R., McGovern, J., Berenbaum, M.R., 2006a. Cyto- pointing us toward hostplant records for the navel orangeworm chrome P450-mediated metabolism of xanthotoxin by Papilio multicaudatus. J. Chem. Ecol. 32, 523e536. and its relatives. This project was funded by a grant from the Mao, W., Rupasinghe, S., Zangerl, A.R., Schuler, M.A., Berenbaum, M.R., 2006b. Almond Board of California (ABC-C6480). Remarkable substrate-specificity of CYP6AB3 in Depressaria pastinacella, a highly specialized caterpillar. Insect Mol. Biol. 15, 169e179. Mao, W., Schuler, M.A., Berenbaum, M.R., 2007a. Cytochrome P450s in Papilio References multicaudatus and the transition from oligophagy to polyphagy in the Papil- ionidae. Insect Mol. Biol. 16, 481e490. Baek, N.I., Ahn, E.M., Kim, H.Y., Park, Y.D., 2000. Furanocoumarins from the root of Mao, W., Rupasinghe, S.G., Zangerl, A.R., Berenbaum, M.R., Schuler, M.A., 2007b. Angelica dahurica. Arch. Pharm. Res. 23, 467e470. Allelic variation in the Depressaria pastinacella CYP6AB3 protein enhances Berenbaum, M.R., 1991. In: Rosenthal, G., Berenbaum, M. (Eds.), Coumarins in metabolism of plant allelochemicals by altering a proximal surface residue and Herbivores: Their Interactions with Secondary Plant Metabolites, vol 1, pp. potential interactions with cytochrome P450 reductase. J. Biol. Chem. 282, 221e249. San Diego. 10544e10552. Berenbaum, M.R., Zangerl, A.R., 1998. Chemical phenotype matching between Mao, W., Berenbaum, M.R., Schuler, M.A., 2008a. Modifications in the N-terminus of a plant and its insect herbivore. Proc. Natl. Acad. Sci. U.S.A. 95, 13743e13748. an insect P450 enhance production of catalytically active protein in baculovi- Bolling, B.W., DolnikowskiG.Blumberg, J.B., Oliver Chen, C.Y., 2009. Quantification of rus-Sf9 cell expression systems. Insect Biochem. Mol. Biol. 38, 66e75. almond skin polyphenols by liquid chromatography-mass spectrometry. J. Food Mao, W., Zangerl, A.R., Berenbaum, M.R., Schuler, M.A., 2008b. Metabolism of Sci. 74, C326eC332. myristicin by Depressaria pastinacella CYP6AB3v2 and inhibition by its metab- Byard, J., Needham, D., 2006. Metabolism and excretion of piperonyl butoxide in the olite. Insect Biochem. Mol. Biol. 38, 645e651. rat. Xenobiotica 36, 1259e1272. McKay, F., Gandalfo, D., 2007. Phytophagous insects associated with the reproduc- Campbell, B.C., Molyneux, R.J., Schatzi, T.F., 2003. Current research on reducing pre- tive structures of mesquite (Prosopis spp.) in Argentina and their potential as and post-harvest aflatoxin contamination of US almond, pistachio, and walnut. biological control agents in South Africa. Afr. Entomol. 15, 121e131. J. Toxicol. Toxin Rev. 22, 225e266. Molyneux, R.J., Mahoney, N., Kim, J.H., Campbell, B.C., 2007. Mycotoxins in edible Chen, J.S., Berenbaum, M.R., Schuler, M.A., 2002. Amino acids in SRS1 and SRS6 are tree nuts. Int. J. Food Microbiol. 119, 72e78. critical for furanocoumarin metabolism by CYP6B1v1, a cytochrome P450 Monteiro, V.de F.F., Mathias, L., Vieira, I.J.C., Schripsema, J., Braz-Filho, R., 2002. monooxygenase. Insect Mol. Biol. 11, 175e186. Prenylated coumarins, chalcones and new cinnamic acid and dihydrocinnamic Cohen, M.B., Schuler, M.A., Berenbaum, M.R., 1992. A host-inducible cytochrome P- acid derivatives from Brosimum gaudichaudii. J. Brazil. Chem. Soc. 13. 450 from a host-specific caterpillar: molecular cloning and evolution. Proc. Natl. Mote, D.C., 1922. A new orange pest in Arizona. California State Dept. Agric. Mon. Acad. Sci. U.S.A. 89, 10920e10924. Bull. 11, 628. Connell, J.H., 2001. Leading edge of plant protection for almond. Hort. Technol. 12, Murray, R.D.H., Brown, S.A., Mendez, J., 1982. The Natural Coumarins: Occurrence, 619e622. Chemistry and Biochemistry. J. Wiley, New York. Feyereisen, R., 1999. Insect P450 enzymes. Annu. Rev. Entomol. 44, 507e533. Nelson, D.R., 1998. Metazoan cytochrome P450 evolution. Comp. Biochem. Physiol. Feyereisen, R., 2006. Evolution of insect P450. Biochem. Soc. Trans. 34, 1252e1255. C Pharmacol. Toxicol. Endocrinol. 121, 15e22. Halgren, T.A., 1996. Merck molecular force field: I. basis, form, scope, parameteri- Niu, G., Wen, Z., Rupasinghe, S.G., Zeng, R.S., Berenbaum, M.R., Schuler, M.A., 2008. zation and performance of MMFF94. J. Comp. Chem. 17, 490e519. Aflatoxin B1 detoxification by CYP321A1 in Helicoverpa zea. Arch. Insect Bio- Heppner, J.B., 2003. Arthropods of Florida and neighboring land areas. In: Lepi- chem. Physiol. 69, 32e45. doptera of Florida Part 1. Introduction and Catalogue, vol. 17. Florida Depart- Niu, G., Siegel, J., Schuler, M.A., Berenbaum, M.R., 2009. Comparative toxicity of ment of Agriculture and Consumer Services, Gainesville. mycotoxins to navel orangeworm (Amyelois transitella) and corn earworm Hung, C.F., Prapaipong, H., Berenbaum, M.R., Schuler, M.A., 1995a. Differential (Helicoverpa zea). J. Chem. Ecol. 35, 951e957. induction of cytochrome P450 transcripts in Papilio polyxenes by linear and Omura, T., Sato, R.,1964. The carbon monoxide-binding pigment of liver microsomes. angular furanocoumarins. Insect Biochem. Mol. Biol. 25, 89e99. II. Solubilization, purification, and properties. J. Biol. Chem. 239, 2379e2385. Hung, C.F., Harrison, T.L., Berenbaum, M.R., Schuler, M.A., 1995b. CYP6B3: a second Ortiz de Montellano, P.R., 2005. Cytochrome P450: Structure, Mechanism, and furanocoumarin-inducible cytochrome P450 expressed in Papilio polyxenes. Biochemistry, third ed. Kluwer Academic/Plenum Publishers, New York. Insect Mol. Biol. 4, 149e160. Pan, L., Wen, Z., Baudry, J., Berenbaum, M.R., Schuler, M.A., 2004. Identification of Hung, C.F., Berenbaum, M.R., Schuler, M.A., 1997. Isolation and characterization of variable amino acids in the SRS1 region of CYP6B1 modulating furanocoumarin CYP6B4, a furanocoumarin-inducible cytochrome P450 from a polyphagous metabolism. Arch. Biochem. Biophys. 422, 31e41. caterpillar (Lepidoptera: Papilionidae). Insect Biochem. Mol. Biol. 27, 377e385. Ravichandran, K.G., Boddupalli, S.S., Hasemann, C.A., Peterson, J.A., Deisenhofer, J., Kimball, C.P., 1965. The Lepidoptera of Florida: An Annotated Checklist. Florida 1993. Crystal structure of hemoprotein domain of P450BM-3, a prototype for Department of Agriculture, Gainesville. microsomal P450s. Science 261, 731e736. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular Rubilar, M., Pinelo, M., Shene, C., Sineiro, J., Nuñez, M.J., 2007. Separation and HPLC- evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, MS identification of phenolic antioxidants from agricultural residues: almond 150e163. hulls and grape pomace. J. Agric. Food Chem. 55, 10101e10109. Lee, S.E., Campbell, B.C., 2000. In vitro metabolism of aflatoxin B1 by larvae of navel Rupasinghe, S.G., Wen, Z., Chiu, T.L., Schuler, M.A., 2007. Helicoverpa zea CYP6B8 and orangeworm, Amyelois transitella (Walker) (Insecta, Lepidoptera, Pyralidae) and CYP321A1: different molecular solutions to the problem of metabolizing plant codling moth, Cydia pomonella (L.) (Insecta, Lepidoptera, Tortricidae). Arch. toxins and insecticides. Protein Eng. Design Select 20, 615e624. Insect Biochem. Physiol. 45, 166 e174. Sang, S., Lapsley, K., Rosen, R.T., Ho, C.T., 2002. New prenylated benzoic acid and Li, W., Petersen, R.A., Schuler, M.A., Berenbaum, M.R., 2002a. CYP6B cytochrome other constituents from almond hulls (Prunus amygdalus Batsch). J. Agric. Food P450 monooxygenases from Papilio canadensis and Papilio glaucus, potential Chem. 50, 607e609. contributions of sequence divergence to host plant associations. Insect Mol. Sasabe, M., Wen, Z., Berenbaum, M.R., Schuler, M.A., 2004. Molecular analysis of Biol. 11, 543e551. CYP321A1, a novel cytochrome P450 involved in metabolism of plant alle- Li, X., Berenbaum, M.R., Schuler, M.A., 2002b. Plant allelochemicals differentially lochemicals (furanocoumarins) and insecticides (cypermethrin) in Helicoverpa regulate Helicoverpa zea cytochrome P450 genes. Insect Mol. Biol. 11, 343e351. zea. Gene 338, 163e175. Li, W., Schuler, M.A., Berenbaum, M.R., 2003. Diversification of furanocoumarin- Schatzki, T.F., Ong, M.S., 2000. Distribution of aflatoxin in almonds. 2. Distribution in metabolizing cytochrome P450 monooxygenases in two papilionids: specificity almonds with heavy insect damage. J. Agric. Food Chem. 48, 489e492. and substrate encounter rate. Proc. Natl. Acad. Sci. U.S.A. 100 (Suppl. 2), Schatzki, T.F., Ong, M.S., 2001. Dependence of aflatoxin in almonds on the type and 14593e14598. amount of insect damage. J. Agric. Food Chem. 49, 4513e4519. Li, W., Zangerl, A.R., Schuler, M.A., Berenbaum, M.R., 2004a. Characterization and Schoch, G.A., Yano, J.K., Wester, M.R., Griffin, K.J., Stout, C.D., Johnson, E.F., 2004. evolution of furanocoumarin-inducible cytochrome P450s in the parsnip Structure of human microsomal cytochrome P450 2C8. Evidence for a periph- webworm, Depressaria pastinacella. Insect Mol. Biol. 13, 603e613. eral fatty acid binding site. J. Biol. Chem. 279, 9497e9503. Li, X., Baudry, J., Berenbaum, M.R., Schuler, M.A., 2004b. Structural and functional Staples, W.G., Elevitch, C.R., 2006. Samanea saman (rain tree) Fabaceae (legume divergence of insect CYP6B proteins: from specialist to generalist cytochrome family). In: Elevitch, C.R. (Ed.), Traditional Trees of Pacific Islands: Their Culture, P450. Proc. Natl. Acad. Sci. U.S.A. 101, 2939e2944. Environment, and Use, pp. 661e674. G. Niu et al. / Insect Biochemistry and Molecular Biology 41 (2011) 244e253 253

Tebbets, J.S., Curtis, C.E., Fries, R.D., 1978. Mortality of immature stages of the navel Wen, Z., Berenbaum, M.R., Schuler, M.A., 2006a. Inhibition of CYP6B1-mediated orangeworm stored at 3.5 C. J. Econ. Entomol 71, 875e876. detoxification of xanthotoxin by plant allelochemicals in the black swallowtail Teets, A.S., Minardi, C.S., Sundararaman, M., Hughey, C.A., Were, L.M., 2009. (Papilio polyxenes). J. Chem. Ecol. 32, 507e522. Extraction, identification, and quantification of flavonoids and phenolic Wen, Z., Rupasinghe, S., Niu, G., Berenbaum, M.R., Schuler, M.A., 2006b. CYP6B1 and acids in electron beam-irradiated almond skin powder. J. Food Sci. 74, CYP6B3 of the black swallowtail (Papilio polyxenes): adaptive evolution through C298eC305. subfunctionalization. Mol. Biol. Evol. 23, 2434e2443. Towers, G.H.N., 1986. Significance of phototoxic phytochemicals in insect herbivory. Wester, M.R., Johnson, E.F., Marques-Soares, C., Dansette, P.M., Mansuy, D., J. Chem. Ecol. 12, 813e821. Stout, C.D., 2003. Structure of a substrate complex of mammalian cytochrome UC IPM Online, 2009. UC Pest Management guidelines: almond, navel orangeworm. P450 2C5 at 2.3 Å resolution: evidence for multiple substrate binding modes. www.ipm.ucdavis.edu/PMG/r3300311.html. Biochemistry 42, 6370e6379. Vaya, J., Mahmood, S., 2006. Flavonoid content in leaf extracts of the fig(Ficus carica Widstrom, N.W., Lillehoj, B.E., Sparks, N.A., Kwolek, F.W., 1976. Corn earworm L.), carob (Ceratonia siliqua L.) and pistachio (Pistacia lentiscus L.). Biofactors 28, damage and aflatoxin B, on corn ears protected with insecticide. J. Econ. 169e175. Entomol. 69, 677e679. Veitch, N.C., 2009. Isoflavonoids of the Leguminosae. Nat. Prod. Rep. 24, 417e464. Williams, P.A., Cosme, J., Ward, A., Angove, H.C., Vinkovic, D.M., Jhoti, H., 2003. Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear Crystal structure of human cytochrome P450 2C9 with bound warfarin. Nature and angular furanocoumarins by Papilio polyxenes CYP6B1 co-expressed 424, 464e468. with NADPH cytochrome P450 reductase. Insect Biochem. Mol. Biol. 33, Yano, J.K., Wester, M.R., Schoch, G.A., Griffin, K.J., Stout, C.D., Johnson, E.F., 2004. The 937e947. structure of human microsomal cytochrome P450 3A4 determined by X-ray Wen, Z., Baudry, J., Berenbaum, M.R., Schuler, M.A., 2005. Ile115Leu mutation in the crystallography to 2.05-A resolution. J. Biol. Chem. 279, 38091e38094. SRS1 region of an insect cytochrome P450 (CYP6B1) compromises substrate Zaynoun, S.T., Aftimos, B.G., Abi Ali, L., Tenekjian, K.K., Khalidi, U., Kurban, A.K., 1984. turnover via changes in a predicted product release channel. Prot. Eng. Design Ficus carica: isolation and quantification of the photoactive components. Select 18, 1e199. Contact Dermatitis 11, 21e25.