(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
(19) World Intellectual Property Organization International Bureau
(43) International Publication Date (10) International Publication Number 1 November 2007 (01.11.2007) PCT WO 2007/123699 Al
(51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A61K 45/06 (2006.01) kind of national protection available): AE, AG, AL, AM, AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, (21) International Application Number: CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, EG, ES, PCT/US2007/007935 FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, (22) International Filing Date: 29 March 2007 (29.03.2007) IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY,MA, MD, MG, MK, MN, MW, MX, MY, (25) Filing Language: English MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, PT, RO, RS, (26) Publication Language: English RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW (30) Priority Data: 60/787,552 30 March 2006 (30.03.2006) US (84) Designated States (unless otherwise indicated, for every 60/841,739 1 September 2006 (01.09.2006) US kind of regional protection available): ARIPO (BW, GH, (71) Applicant (for all designated States except US): GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, DANA-FARBER CANCER INSTITUTE, INC. ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), [US/US]; 44 Binney Street, Boston, MA 021 15 (US). European (AT,BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IS, IT, LT,LU, LV,MC, MT, NL, PL, (72) Inventors; and PT, RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, (75) Inventors/Applicants (for US only): FISHER, David, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG). E. [US/US]; 44 Binney Street, Cambridge, MA 021 15 (US). D'ORAZIO, John [US/US]; University of Kentuck Published: College of Medicine, Pediatrics (Hematology-Oncology), — with international search report The Markers, Cancer Center, and The Graduate Center for — before the expiration of the time limit for amending the Toxicol, ogy, Combs Research Building, 800 Rose Street, claims and to be republished in the event of receipt of Lexington, KY 40536-0096 (US). KHALED, Mehdi amendments [US/US]; 44 Binney Street, Cambridge, MA 021 15 (US).
(74) Agent: VINCENT, Matthew, P.; Fish & Neave IP Group, For two-letter codes and other abbreviations, refer to the "G uid Ropes & Gray LLP, One International Place, Boston, MA ance Notes on Codes and Abbreviations" appearing at the beg in 021 10-2624 (US). ning of each regular issue of the PCT Gazette.
(54) Title: METHODS AND COMPOSITIONS FOR MODULATING MELANOGENESIS BY USING A MCLR AGONIST
(57) Abstract: The present invention provides compositions comprising an MClR agonist and methods using these compositions for inducing or inhibiting UV- independent pigmentation of human skin and/or for enhancing UV- dependent pigmentation of human skin. METHODS AND COMPOSITIONS FOR MODULATING MELANOGENESIS BY USING A MClR AGONIST
RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 5 60/787,552, filed on March 30, 2006; and to U.S. Provisional Application No. 60/841,739, filed on September 1, 2006, the entire contents of which applications are incorporated herein by reference.
BACKGROUND O F THE INVENTION Melanocytes (pigment cells) are cells located in the basal layer of the 10 epidermis and in the hair bulb. Melanin pigment is deposited in melanocyte-specific organelles called melanosomes that are then transferred from the melanocyte to surrounding keratinocytes so that the pigment becomes widely dispersed through the epidermis (outer layer) of the skin or the hair shaft. Melanin is a dark pigment that protects against ultraviolet radiation and provides color in the skin, eyes and hair of 15 humans and other animals.
When skin is exposed to ultraviolet radiation, such as that contained in sunlight, melanocytes increase their synthesis of melanin. Melanin is deposited in melanosomes, which are vesicles found within the melanocytes. The melanosomes are extruded from the melanocytes and carried to the surface of the skin by 20 keratinocytes, which internalize the melanin containing melanosomes. The end result is that the visible layers of the skin exhibit a brown color typically known as a "tan."
Solar radiation is a major environmental mutagen, and adaptive tanning is widely recognized as an important defensive mechanism against UV-mediated 25 injury (Gilchrest et al. 1996 Photochem Photobiol 63:1). Fair-skinned individuals have the highest incidence of melanoma and also tend to exhibit minimal adaptive tanning (Sturm 1998 Mutat Res 422:69). Skin "fairness" in humans is largely the result of sequence variants in McIr, the melanocyte receptor for Melanocyte- Stimulating Hormone or melanotropin (MSH), Mountjoy et al. 1992 Science 30 257:1248). hi mankind, more than 60 non-conservative natural variants o McIr have been reported (see Table 1). Population studies demonstrate that several alleles are associated with red hair and fair skin (the RHC phenotype) (Box et al, 1997 Hum. MoI. Genet. 6:1891; Healy et al, 2000 Lancet 355:1072; Smith et al, 1998 Invest. Dermatol. 111:1 19; Valverde et al, 1995 Nat. Genet. 11:328). The strong RHC alleles (designated R) show odds ratios for red hair ranging from 50 to 120. These are the frequent Rl 51C, Rl 6OW and D294H variants and the rare D84E and R142H alleles. The weaker RHC alleles V60L, V92M, R163Q, designated r, have odd ratios for red hair ranging roughly from 2 to 6. The R variants R142H, Rl 51C, Rl 60W and D294H together with the r allele V60L are present in 30 % of the North European population, and account collectively for over 60% of all cases of red hair (Healy et al, 2001 Hum. MoI. Genet. 10:2397).
Table 1. Reported Non-conservative Natural Variants of McIr Variant Codon substitution R160W CGG-TGG R160Q CGG-CAG R162P CGG- CCG R163Q CGA- CAA A164R GCC-CGC A 17 1D GCC-GAC V173del 520_523delGTC V174I GTC-ATC F179ins nt537_538iπsC F196L TTC- CTC R213W CGG—TGG P230L CCG- CTG P256S CCC-TCC H260P CAT-CCT T272M ACG-ATG K278E AAG—GAG N279S AAC-GGC
N279K || AAC—AAA 1287M ATC—ATG D294H JfGAC-CAC Y298H J TAC- CAC A299T ! GCC—ACC A299V J GCC—GTC T308M ACG—ATG C315R TGC—CGC Though other signaling pathways may play a role in pigmentation (Van Raamsdonk et al. 2004 Nat Genet 36:961), variant McJr receptors typically generate weak or absent ligand-induced cAMP second messenger responses (Valverde et al. 1995 Nat Genet 11:328). MSH is produced as a component of the pro- opiomelanocortin (POMC) precursor, POMC in the pituitary and skin, where its expression is induced by UV exposure (Tsatmali et al. 2000 Pigment Cell Res 13 Suppl 8:125). Although deficient tanning in McJr variant individuals is consistent with a critical role for MSH in this response, other studies have suggested that melanocyte DNA damage responses mediate UV-induced pigmentation (Eller et al. 1994 Nature 372:413; and Corre et al. 2004 J Biol Chem 279:51226) and a genetically controlled system has been lacking, in which to determine the precise role of MSH-McJr in this response. Additionally, it was previously unknown whether the pigmentation machinery remains "available" for dark (eumelanin) pigmentation in these individuals.
The data presented herein utilize a mouse model of the fair-skinned phenotype to confirm an essential role for McJr in UV-induced pigmentation, as well as UV-induced MSH production by epidermal keratinocytes. Furthermore, a topical cAMP agonist is seen to robustly rescue eumelanin production on this genetic background thereby affording major UV protection. These results were extended to human skin, and the data presented herein also demonstrates a synergistic effect on skin pigmentation by the topical administration of a combination of cAMP agonists. Increasing skin pigmentation would be desirable both to increase melanin protection from ultraviolet radiation without exposing the skin to UV light, to correct hypopigmentation disorders, and for cosmetic purposes to achieve a "safe" tan or to darken hair color. Conversely, decreasing pigmentation by providing inhibitors of this pathway could be desirable to treat disorders such as melasma, chloasma, post-inflammatory hyperpigmentation, solar lentigines, and the like.
SUMMARY OF THE INVENTION One aspect of the invention provides a composition for inducing UV- independent pigmentation of human skin and/or for enhancing UV-dependent pigmentation of human skin, comprising an McIr agonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
In certain embodiments, the composition comprises micro- or nanoparticles of an McIr agonist and a bioadhesive coating or matrix, wherein (i) said particles penetrate the human skin and release the McIr agonist to contact melanocytes in the skin in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin, and (ii) said composition leaves no visible residue on the skin one hour after administration.
In certain embodiments, the McIr agonist is formulated as a composition comprising a liposome preparation, an organogel, a humectant, a non-ionic surfactant or chitosan to enhance penetration of the stratum corneum.
Another aspect of the invention provides a dermatological or cosmetological composition for an external topical administration to human skin, comprising together with pharmaceutically and/or cosmetologically acceptable excipients: at least one UVA-stabilizing and/or UVB-stabilizing screening agent, and an McIr agonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
Another aspect of the invention provides a composition for inducing UV- indepεndent pigmentation of human skin, comprising an McIr agonist, formulated for oral administration, which acts systemically on melanocytes in the skin to induce melanogenesis, and provided in an amount sufficient to cause macroscopically observable pigmentation.
In certain embodiments, the McIr agonist is an agonist of both a loss-of- function allele of McIr, such as a variant shown in Table 1, as well as MclrE/E or a combination of two or more thereof.
In certain embodiments, the McIr agonist is a cyclic AMP (cAMP) agonist, such as one that activates adenylate cyclase.
In certain embodiments, the cAMP agonist is forskolin or a derivative thereof.
In certain embodiments, the cAMP agonist is a cAMP analog.
In certain embodiments, the cAMP agonist is a phosphodiesterase (PDE) inhibitor, such as a PDE3 inhibitor, a PDE4 inhibitor, a cAMP-specific PDE inhibitor and/or a combination or two or more thereof.
In certain embodiments, the cAMP agonist is rolipram or a derivative thereof.
In certain embodiments, the cAMP agonist comprises one or more compounds in Table 2 and Table 3.
In certain embodiments, the McIr agonist comprises forskolin or a derivative thereof, and rolipram or a derivative thereof.
In certain embodiments, the subject compositions are provided in the form of a gel, a cream or a lotion.
In certain embodiments, the particles have a mean diameter of about 100 microns or less.
In certain embodiments, the particles have a mean diameter of about 1 micron or less.
In certain embodiments, the composition is less irritating when applied to skin than the McIr agonist applied to skin alone.
In certain embodiments, the composition is substantially free of surfactants.
In certain embodiments, the bioadhesive coating or matrix comprises a polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyphosphazines, polyacrylamides, poly(vinyl alcohols), polysiloxanes, polyvinylpyrrolidone, polyglycolides, polyurethanes, polystyrene, polyvinylphenol, polymers of acrylic and methacrylic esters, polylactides, copolymers of polylactides and polyglycolides, poly(butic acid), poly(valeric acid), poly(lactide-co- caprolactone), poly[lactide-co-glycolide], polyanhydrides, polyorthoesters, blends and copolymers thereof.
In certain embodiments, the bioadhesive coating or matrix is a polysaccharide selected from the group consisting of alkyl celluloses, cellulose ethers, cellulose esters, nitrocelluloses, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxymethyl cellulose, cellulose triacetate, and cellulose sulfate sodium salt.
In certain embodiments, the subject compositions further include one or more of a lipid soluble vitamin A, D, E, and K and derivatives, alpha lipoic acid, lipid soluble anti-oxidants, aromatic oils, orange oil, seabuckthom oil, and fragrances.
In certain embodiments, the subject compositions further include at least one photo-protective agent.
In certain embodiments, the subject compositions further include at least one compound selected from the group consisting of: physical sunblocks, sunscreens, and free-radical scavengers.
In certain embodiments, the subject compositions further comprises at least one compound selected from the group consisting of: an anti-inflammatory agent, an anti-acne agent, an anti-wrinkle agent, an anti-scarring agent, an anti-psoriatic agent, an antiproliferative agent, an anti-fungal agent, an anti-viral agent, an anti-septic agent, a local anaesthetic, a keratolytic agent, a hair growth stimulant, and a hair growth inhibitor.
Another aspect of the invention provides a method for inducing UV- independent pigmentation of human skin, comprising administering any of the subject composition in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
Another aspect of the invention provides a method for protecting human skin from the ultraviolet radiation, comprising administering any of the subject composition in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
Another aspect of the invention provides a method for reducing the rate formation of solar erythema, solar allergies or solar elastosis, comprising administering any of the subject composition in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
Another aspect of the invention provides a method for preventing or delaying actinic ageing of human skin, comprising administering any of the subject composition in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
Another aspect of the invention provides a method for treating or preventing a disease or disorder in a mammal caused by ultraviolet radiation, comprising administering an effective amount of any of the subject composition in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin.
In certain embodiments, the disease or disorder is selected from the group consisting of: acne vulgaris, actinic keratoses, photodermatitis, photo-induced lupus erthematosus, xeroderma pigmentosum, photosensitizing effects of a drug (such as tetracycline) and skin cancer.
Another aspect of the invention provides a use of an McIr agonist for the manufacture of a medicament or cosmetic preparation for inducing UV-independent pigmentation of human skin.
Another aspect of the invention provides a packaged cosmetic preparation for inducing UV-independent pigmentation of human skin, comprising an McIr agonist in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin, and a package label or insert providing directions for applying the McIr agonist.
In certain embodiments, the packaged cosmetic preparation includes a package label or insert providing directions for a fair skinned human subject to apply the McIr agonist to an area of skin which is intended to be darkened.
Another aspect of the invention provides a method for conducting a cosmetics business, comprising: (i) providing a cosmetic formulation including any of the subject composition for inducing UV-independent pigmentation of human skin; and (ii) marketing the cosmetic formulation for one or more uses by human subjects selected from sunless tanning, protecting human skin from the ultraviolet radiation, reducing the rate formation of solar erythema, solar allergies or solar elastosis, and/or preventing or delaying actinic ageing.
In certain embodiments, the marketing is directed to individuals having an McIr loss-of-function genotype.
Another aspect of the invention provides a composition for reducing pigmentation of human skin, comprising an McIr antagonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to reduce pigmentation when applied to human skin.
In certain embodiments, the composition comprises micro- or nanoparticles of the McIr antagonist and a bioadhesive coating or matrix, wherein (i) said particles penetrate the human skin and release the McIr antagonist to contact melanocytes in the skin and reduce pigmentation when applied to human skin, and (ii) said composition leaves no visible residue on the skin one hour after administration.
In certain embodiments, the McIr antagonist is formulated as a composition comprising a liposome preparation, an organogel, a humectant, a non-ionic surfactant or chitosan to enhance penetration of the stratum corneum.
Another aspect of the invention provides a dermatological or cosmetological composition for an external topical administration to human skin, comprising, together with pharmaceutically and/or cosmetologically acceptable excipients: at least one UVA-stabilizing and/or UVB-stabilizing screening agent, and an McIr antagonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to reduce UV-dependent pigmentation of treated human skin.
Another aspect of the invention provides a composition for reducing UV- independent pigmentation of human skin, comprising an McIr antagonist, formulated for oral administration, which acts systemically on melanocytes in the skin to reduce melanogenesis. In certain embodiments, the McIr antagonist is a cyclic AMP (cAMP) antagonist.
In certain embodiments, the McIr antagonist is a PKA inhibitor.
It is also contemplated that any of the embodiments described herein can be combined with one or more other embodiments as appropriate.
BRIEF DESCRIPTION O F FIGURES Figure 1. UV-induced tanning depends on an intact MSH receptor. C57BL/6 mice either wild type (Mc7rE/E; panel A) or mutant at the MSH receptor (McIrd c; panel B) were treated five days per week with daily UVB as described for one month. Top-most rows show UV-induced ear skin darkening, with corresponding Fontana-Masson stained skin sections immediately below to show melanin accumulation (black deposits, 400X magnification). Note the UV-induced skin darkening (black triangles) and melanin accumulation (white triangles) in McIr but not in McIr e animals. Note absence of (ear) tanning with MSH receptor mutation.
Figure 2. UV-induced MITF up-regulation is mediated by MSH secreted by keratinocytes. A) MITF induction by qPCR and by Western blot of murine Bl 6 melanoma cells incubated (6h) with 24-hour conditioned supernatants from Pam212 mouse keratinocyte cells either untreated (first lane) or irradiated with 10 mJ/cm2 UVB. Note that pre-incubation of keratinocyte supernatants with anti-MSH antisera (but not control anti-HA antibody) abrogated MITF induction by qRT-PCR and Western blotting. B, C) qPCR-based detection of POMC (MSH precursor) mRNA induction by UV radiation in Pam212 mouse keratinocyte cells (B) or primary human keratinocytes (C). All PCR data are reported as normalized expression relative to GAPDH (control).
Figure 3. Foskolin but not UV rescues eumelanin production in mice with defective MSH signaling. A) Photographs of pheomelanotic (Mclrd ) K14-Scf transgenic C57BL/6 mice treated topically with vehicle control (70% ethanol, 30% propylene glycol) and irradiated with 200 mJ/cm2 UVB or treated topically with 400 mL of C.forskohlii root extract (200 mM forskolin) to the dorsal skin surface for 2 1 days. Only the forskolin-treated animals exhibit skin darkening. B) Reflective colorimetry measurements (CIE L* (white-black) color axis) of skin darkening of McIr*1 Kl 4-Scf transgenic C57BL/6 mice treated as indicated and as described in (A). Lower numbers represent darker skin tones. C) Eumelanin levels of whole, depillated skin from Mclr de K14-Scf mice treated as described in (A). Melanin levels were determined as described (16). D) Side-by-side photographs of vehicle control- or forskolin-treated McIr*1*K14-Scf animals treated as described in (A ), without UV exposure. E) Side-by-side photographs of forskolin-treated McIr*1* mice either containing epidermal melanocytes (K14-Scf) or lacking epidermal melanocytes(AT7^-.?c/ ), treated as described in (A). F) Fontana-Masson (melanin)- stained skin sections of McIr K14-Scf animals treated for 2 1 days with the indicated dose of forskolin derived from C.forskohlii extract (63Ox magnification).
Figure 4. Forskolin-induced melanin deposition protects against UV- mediated keratinocytes apoptosis ("sunburn cells"). McIr 1 K14-Scf animals were pretreated for 15 days with either vehicle control or C. forskohlii root extract (200 mM forskolin) before exposure to 200 mJ/cm 2 UVB. A) Melanin distribution in the skin 24h after UV-exposure as determined by Fontana-Masson (upper panels) or hematoxylin/eosin staining (lower panels). Note the greatly enhanced depositions of epidermal melanin (black staining) in forskolin-treated animals in a keratinocyte nucleus-capping pattern (see asterisks). Also note the presence of "sunburn cells" which represent apoptotic keratinocytes in UV-irradiated animals not pre-treated with forskolin (arrows). B) Sunburn cell quantification in UV-exposed animals pre treated either with vehicle or with C. forskohlii root extract (200 mM forskolin) for 15 days, irradiated with 200 mJ/cm2 and biopsied 24 hours later. Note that forskolin pre-treatment of fair skinned animals yielded as much protection as McIr wild type pigmented (eumelanotic) animals, and that amelanotic (albino) animals had high levels of UV-induced apoptosis regardless of whether they were pre-treated with control or with forskolin prior to UV exposure.
Figure 5. Protective effect of forskolin-induced melanin against direct UV- damage in the skin. A) UV-induced thymine dimer formation as detected by immunofluorescence staining in skin samples harvested from Mclr d* K14-Scf animals pretreated with either vehicle control (first column) or C. forskohlii root extract (200 mM forskolin; column 2). Staining is compared with K14-Scf+ wild type (eumelanotic) animals (maximal protection) and K14-Scf albino animals (7yrc2j/c2j; minimal protection). B) Thymine dimer formation in the skin of animals treated as described in (A) as detected by immuno-histochemistry to investigate the possibility that melanin deposition could interfere with fluorescence-based thymine dimer detection. Note that forskolin-pretreatment of fair-skinned animals provided profound protection (as much as genetically black wild type animals) whereas fair- skinned animals pre-treated with vehicle control exhibited almost as much nuclear thymine dimer staining as amelanotic (albino) animals.
Figure 6. Protective effect of topical forskolin against UV-induced weight loss and skin carcinogenesis. K14-Scf transgenic Mclr animals homozygously deficient for the Xeroderma pigmentosum C (Xpc) gene were pretreated with either vehicle control or topical forskolin and exposed to daily low-dose UVB for 16-20 weeks. A) Forskolin treatment (200 mM) prevented UV-induced weight loss. After 16 weeks of UV treatment, vehicleAJV-irradiated animals were significantly smaller than their forskolin/UV-irradiated counterparts. B) photographs of vehicle-treated or forskolin-treated animals after 16 weeks of UV exposure as indicated. Note the smaller size and the many ulcerative and hyperkeratotic skin changes in control/irradiated animals and no evidence of lesions in forskolin/irradiated animals. C). Kaplan-Meyer analysis of tumor incidence noted in irradiated vehicle control- treated versus irradiated forskolin-treated K14-Scf+ McIr c Xpc treated as described in panel A. The average follow-up time is 65 weeks at the time of preparation of this manuscript. The yellow bar indicates duration of daily UV exposure. D) Tumor formation in vehicle- vs forskolin-treated irradiated K14-Scfi- McIr c Xpc animals as of 65 weeks follow-up. Note that some of the vehicle treated irradiated animals developed multiple and distinct sites of carcinogenesis whereas none of the forskolin treated animals developed more than one tumor.
Figure 7. Modest induction of MSH in UV-exposed melanocytes and rescue of MITF expression by forskolin. Panel A shows MITF induction in B16 mouse melanoma cells by quantitative PCR and by Western blot incubated with 24 h conditioned supernatants from unirradiated (left) or irradiated (10 mJ/cm2; right) Melan-c mouse melanocyte cells. B) quantitative PCR-based detection of POMC mRNA induction at 24 h by UV radiation in Melan-c mouse melanocyte cells. PCR data are reported as normalized expression using GAPDH as a control. C) Induction of MITF by quantitative per (upper panel) or by western analysis of Bl 6 pigmented melanoma cells incubated (6 h) with control medium (first lane), forskolin (20 µM) or with 24 h conditioned supematants of forskolin-exposed (4h) keratinocytes or Bl 6 cells (as labeled). Note the lack of MITF induction in B16 cells exposed to conditioned supematants of either cell type exposed to forskolin (followed by washout) but strong induction of MITF when directly treated with forskolin.
Figure 8. Photographs and melanin quantification from C57BL/6 pigment variants used in this study. Panel A) photographs of 4-8 week-old K14-Scf transgenic mice of the indicated pigmentation phenotype. Genetic status of the tyrosinase gene (Tyr) and melanocyte stimulating hormone receptor (melanocortin 1 receptor; McIr) are indicated. Panel B) Whole skin was collected from three 6-8 week-old K14-Scf transgenic C57BL/6 animals of the indicated pigment phenotype and lyophilized before HPLC-based quantification of pheomelanin (left graph) or eumelanin (right graph) as described (16).
Figure 9. Localized effect of topical forskolin, time course of forskolin- induced melanization, and ability of pure forskolin to induce skin darkening in McJrde K14-Scf mice. A) Photograph of groups of pheomelanotic (McIr* ) K14-Scf transgenic mice treated with either vehicle control or C. forskohlii root extract (200 mM forskolin) as indicated applied to the rump only for 2 1 days. Note that the darkening observed in two of the control-treated mice represents re-growth of anagen hair rather than actual melanization of the skin. B) Time and dose response study of forskolin-induced skin darkening of Mclr d K14-Scf animals treated as indicated. Days that topical treatments began and ended are indicated by the arrows. C) Comparison of skin melanization induced by pure forskolin vs. C.forskohlii root extract. The upper panel shows photographs of representative McIr e K14-Scf animals treated with 15 µl applied to the right ear (see white triangles) of either vehicle control (left column), 100 mM purified forskolin (middle column) or with C. forskohlii root extract (100 mM forskolin; right column) over a two week period. The lower photographs depict Fontana-Masson (melanin) stained sections of treated ears as indicated from the photographed animals. Note that the actual forskolin concentration was the same in the crude preparation used as in the purified preparation.
Figure 10. Protective effect of topical forskolin against UV-induced skin pathology in nucleotide excision repair-deficient mice. K14-Scf transgenic McIr animals deficient for the Xpc gene were treated as described in Figure 7. A) Representative skin histological examination of vehicle control- (left column) or forskolin-treated (right column) irradiated animals after 16 weeks of treatment. Shown are Hematoxylin & eosin stained sections and Fontana-Masson stained sections (in which melanin appears as black) of treated (dorsal skin; upper three panels) vs. untreated (ventral) skin on the same animal. Note that vehicle control- treated irradiated animals had significant epidermal (red bars) and dermal (yellow bars) thickening as compared to their forskolin-treated irradiated counterparts. B) graphical representation of the epidermal thickness of groups of Mclr c K14-Scf Xpc 1 animals as labeled. Note that differences in epidermal thickness were highly statistically significant only between exposed, irradiated vehicle-treated versus forskolin-treated skin sections.
Figures HA —HE. Show extent of MITF expression in melanocytes in human foreskin treated with (A) DMSO (negative control); (B) Forskolin; (C) Rolipram; (D) Forskolin + Rolipram, without arrow pointing out melanocytes; (E) same as (D), but with arrow pointing out melanocytes. Under the condition of this sets of experiments, although Forskolin alone does not clearly stimulate MITF expression, simultaneous treatment by both Forskolin and Rolipram (each at half the concentration used in forskolin alone or rolipram alone experiments) strongly and synergistically stimulates MITF expression in human melanocytes. Rolipram alone is also sufficient to induce similar effects in some experiments (data not shown).
Figure 12. Rolipram and C. forskohlii have a synergistic effect on activation of CREB. MeWo melanoma cells were treated with DMSO ("0" lane), Rolipram (80 µM) or C.forskohlii root extract (80 µM forskolin) for 15 minutes to 4 hours. Cell lysates were analyzed by immunoblotting for the activation of CREB. C. forskohlii root extract alone (80 µM forskolin) and Rolipram alone (80 µM) did not detectably activate CREB in these cells. However, the combination of C. forskohlii and Rolipram (80 µM each) was a strong activator of CREB phosphorylation with a peak activation at 1 h after treatment. Tubulin expression is shown to control for the amount of protein loaded onto the gels.
Figure 13. PDE4 inhibitors synergize with Forskolin to activate pCREB. MeWo cells were treated for 1 hour with DMSO alone, Forskolin (FSK, 0.5 to 40 µ µ M) alone, or in combination with Rolipram (40 x IC50, 80 M), Ro 20-1724 (40 x µ µ ICso, 80 M) or ICI 63,197 (160 x IC50, 5.6 M) in DMSO. All three PDE 4 inhibitors were able to synergize with forskolin to activate pCREB. Tubulin expression is shown to control for the amount of protein loaded onto the gels.
Figures 14A and 14B. Rolipram causes a dose dependent increase in melanization in human skin. Human abdominal skin was treated with DMSO (first, solid black bar), Rolipram (10 mM, second bar), Rolipram (20 mM, third bar) or Rolipram (40 mM, fourth bar) for 30 minutes. Following drug exposure, the skin was incubated in culture medium for 6 hours in a 37°C CO2 incubator. Figure 14A shows Fontana-Masson staining of the treated skin, and illustrates the increased darkening observed in the basal and suprabasal layers with the higher doses of Rolipram. Quantification of the melanin in four representative fields of the treated skin is shown in Figure 14B; n=4; p=O.O333 vs DMSO; p=0.0256 vs Rolipram at 1O mM.
Figures 15A and 15B. PDE 4 inhibitors darken human skin. Human abdominal skin was treated for 4 days with the PDE 4 specific inhibitors: Rolipram (20 µM, second bar), ICI 63,197 (40 µM, third bar) or Ro 20-1724 (40 µM, fourth bar) all in vehicle, or vehicle alone (first, solid black bar). Figure 15A shows Fontana-Masson staining of the treated skin, and illustrates the increased levels of pigment in the skin treated with the PDE4 inhibitors. For the treatment with Ro 20- 1724, it was also possible to see migration of the pigment through the supra-basal layers. Figure 15B shows the quantification of the melanin in four representative fields of the treated skin; n=4; ICI 63,197, p=0.05318 vs vehicle; Ro 20-1724, p=0.00905 vs vehicle.
Figures 16A and 16B. Synergy between Rolipram and Forskolin or C. forskohlii root extract after topical treatment of human skin. Figure 16A shows Fontana-Masson staining of human abdominal skin treated topically with vehicle alone (first, solid black bar), Forskolin (20 inM, second bar), Rolipram (2OmM, third bar), the combination Rolipram and Forskolin (20 mM each, fourth bar), C. forskohlii root extract (20 mM forskolin, fifth bar), the combination of Rolipram and C. forskohlii extract (20 mM each, sixth bar), ICI 63,197 (40 mM, seventh bar) or no treatment (eight / last bar). Quantification of melanin in the treated skin (Figure 16B) indicates that neither Rolipram, forskolin nor C. forskohlii root extract alone were able to increase pigmentation. However, the combinations of Rolipram and forskolin or Rolipram and C. forskohlii root extract were able to induce pigmentation. The combination of Rolipram and forskolin or C. forskohlii root extract was as effective as treatment with ICI 63,197 alone, as determined by quantification of the melanin in four representative fields of the treated skin n= 4; ICI 63,197, p=0.00252 vs vehicle.
DESCRIPTION O F CERTAIN EMBODIMENTS /. Overview
One aspect of this invention relates to the development of an animal model with "humanized" skin based on epidermal expression of stem cell factor together with eumelanotic, pheomelanotic and amelanotic pigment variants on the C57BL/6 background, containing melanocytes in the basal layer of the epidermis. As described in the appended examples, this system was used in the proof-of-principle approach to study the role of the MSH-McIr signaling pathway in the UV adaptive response, and demonstrated that the eumelanin biosynthetic capability of melanocytes defective in McIr signaling is nevertheless intact and can be rescued by the topical adenylate cyclase activator forskolin. In addition, export and keratinocytic uptake of eumelanin-containing melanosomes appears to be robust, based upon the "nuclear capping" pattern within epidermal keratinocytes. In fact, this system affords a means to identify other agents that topically or systemically modulate the signals and machinery which regulate numerous steps within the pigmentation pathway.
UV-induced pigmentation represents a major adaptive defense mechanism against both benign and malignant UV-induced skin pathology. UV-induced pigmentation is defective in fair-skinned individuals largely due to functional disruption of the melanocortin 1 receptor (McIr), a G-protein coupled receptor which employs cAMP as second messenger. As described in further detail below, using the murine model of the fair-skinned human phenotype, the hypothesis that UV-induced pigmentation is dependent upon MSH signaling to melanocytes was tested. UV potently induced expression of Melanocyte Stimulating Hormone (MSH) in human or murine keratinocytes (and/or melanocytes), but failed to stimulate skin pigmentation in the absence of a functional MSH receptor. Nonetheless, pigmentation in the fair-skinned mice was very potently rescued by topical application of the cAMP agonist forskolin, without a need for UV, demonstrating that the pigmentation machinery is available despite absence of functional McIr. This UV-independent, chemically-induced pigmentation was highly protective against UV-induced cutaneous DNA damage, actinic changes and tumorigenesis, when tested in the UV-sensitive, cancer prone Xeroderma Pigmentosum Group C deficient (Xpc ) genetic background. These data highlight the role of intercellular MSH signaling in the tanning response and represent a proof-of-principal for skin cancer prevention through sunless, topical small molecule manipulation of pigmentation.
Previous work with topical cAMP agonists in other animal models showed that while forskolin promoted histologically identifiable (i.e., /w/croscopically observable) melanin accumulation in the epidermis (Lin et al., 2002 J Invest Dermatol 119: 1330) in light-skinned swine, it did not result in a αcroscopically observable darkening of the skin. Based on these published observation, one of ordinary skill in the art would not have had a reasonable basis to believe that cAMP agonists would be able to cause skin darkening, such as in the form of UV- independent tanning, for human subjects. The greater robustness of the forskolin response in the mouse model employed in the examples below serves a biological proof-of-principle. While significant rescue of eumelanization was observed with topical forskolin, the cAMP agonist effect was not explicitly targeted to melanocytes within the skin, which could ultimately be why forskolin applied to pig skin did not show any macroscopically observable effect. The topical rescue of eumelanization in the McIr defective skin confirms the "availability" of the pigmentation machinery to be activated, given appropriate signals. It is likely that forskolin delivery is significantly more efficient to murine epidermal melanocytes than porcine, based upon epidermal thickness and the basal location of melanocytes. As swine epidermis is more likely to mimic human skin, this suggests that small molecule delivery can be optimized to produce observable sunless pigmentation in man. Indeed, data disclosed herein, using human foreskin or discarded human skin from cosmetic surgery, and exemplary McIr agonists forskolin and cAMP-specifϊ c phosphodiesterase (PDE) inhibitors, such as, for example, rolipram, either alone or in combination, provide direct evidence that McIr agonists (e.g., forskolin and rolipram) indeed induce UV-independent darkening of human skin.
Topically induced eumelanization was seen to afford significant UV protection in mice. Sunburn cell formation, pyriπ αidine dimer formation, pathologic skin thickening/actinic changes, weight loss, and carcinogenesis upon chronic UV exposure on a UV-sensitive Xpc deficient background were all observed. While PABA-based sunscreens are highly effective against sun-burning, their protective efficacy against UV carcinogenesis remains less clear (Wang, et al., 2001 Acad Dermatol 44:837). The ability of PABA sunscreens to protect against melanoma remains particularly controversial (Wolfe/ al. 1994 Natl Cancer Inst 86: 99). While melanoma tumors were not seen during the time course of the UV carcinogenesis study reported here, it is notable that skin eumelanin content (i.e. skin phototype) is one of the strongest predictors of melanoma (and other cutaneous cancer) risk in man (Freedberg et al. 2003, Fitzpatrick's Dermatology in General Medicine ed. 6th). An independent benefit to topical eumelanization would be as a means of diminishing incentive for solar-tanning or use of artificial UV tanning salons. This increased melanin would provide a tan without exposure to the sun, and by virtue of its UV absorbing properties, would also provide increased photoprotection from solar radiation. Fair-skinned individuals who tan poorly and are thus at high risk for developing sun-induced skin cancer, would greatly benefit. An agent that increased tan would help reduce the risk of skin cancer in these individuals.
Another aspect of the present invention contemplates the use of agents that, like forskolin and/or cAMP-specific PDE inhibitors, such as, for example, rolipram, can synergistically activate the intracellular signaling pathway(s) that would result from MSH binding to a wild-type McIr. However, unlike MSH, the "McIr agonists" of the present inventions are agents that induce melanogenesis even in a genetic background of reduced-functions or loss-of-functions McIr variants, such as McJrdc variants or the like. In certain embodiments, the McIr agonist acts intracellularly, such as forskolin or other adenylate cyclase activating agents. In other embodiments, the McIr agonist can be a ligand that binds to another cell surface receptor present and melanocytes, such as certain G protein coupled receptors (GPCR's), and induces a cAMP-dependent intracellular signal that overlaps with the signal transductions and second messages induced by MSH (in a wild type McIr background).
Thus, the present invention provides methods for inducing melanin synthesis in melanocytes by treatment with a McIr agonist, e.g., an agent that agonizes or induces activation of a cyclic AMP-dependent signaling pathway common with MSH-induced signaling from wild-type McIr. Such agents can be used to increase the melanin content of melanocytes and, thus, increasing pigmentation. The subject McIr agonists can be used to treat patients having "normal" McIr alleles, e.g., patient who are McIr E. However, as described in the appended examples, an even more surprising observation was that the biosynthetic pathways for melanogenesis are intact in an McIrde genetic background, and the formulations of McIr agonists of the present invention can be used to treat individuals having allelic variants of McJr that otherwise reduce the sensitivity of melanocytes to MSH.
Accordingly, McIr agonists can be used in treating skin conditions where insufficient skin pigmentation is produced. To illustrate, McIr agonists can be used to treat patients suffering from xeroderma pigmentosum or other skin disorders/genetic predispositions that render the patient at higher risk for developing skin cancer as a consequence to UV exposure. Xeroderma pigmentosum is a genetic disease characterized by a photosensitivity which usually results in afflicted individuals developing multiple skin cancers.
In other embodiments, the McIr agonists can be used for cosmetic purposes, such as by individuals simply wishing to develop a "sunless tan" or to augment normal UV-induced tanning. Moreover, unlike previously known indoor tanning compositions, the compounds of the present invention actually produce additional melanin in the skin, and thus can be used as part of pharmaceuticals and/or cosmetic protect the skin from ultraviolet radiation.
Currently, areas of unwanted cutaneous hyperpigmentation are treated with "bleaching" agents. The same preparations are used to lighten normal skin color in persons of darker complexion who wish to appear more fair-skinned. The most common active ingredient in these preparations is hydroquinone, an intrinsically toxic chemical that inhibits melanization by a poorly understood mechanism. At the most effective concentrations, hydroquinone may lead to permanent melanocyte loss. Other "active" ingredients in available bleaching creams, such as kojic acid, have the same problems of minimal efficacy and potential toxicity. Hair is conventionally lightened by "bleaching," a harsh chemical process that damages the hair shaft while reducing its pigment content. As well, "bleaching" treats only that portion of the hair above the skin surface, so that darker "roots" are soon visible, detracting from the desired cosmetic effect.
Another aspect of the present invention comprises a method of decreasing pigmentation in the skin or hair by administration of an effective amount of an McIr antagonist, such as an agent that inhibits cAMP-medical signaling. Antagonists of the present invention can be used to treat animals, particularly humans, that have diseases, conditions, or disorders caused by or associated with the production or overproduction of melanin. These diseases, conditions, or disorders include those that can be characterized by discolorations of the skin or hair such as, for example, hyperpigmentation caused by inflammation or from diseases such as melasma, or brown spots such as "cafe au lait" macules. Alternatively, a subject may wish to use a pigmentation inhibitor to lighten or a pigmentation promoter to stimulate the color of his or her hair or skin.
Thus, McIr antagonists of the present invention are useful in treating disorders of human pigmentation, including solar and simple lentigines (including age/liver spots), melasma/chloasma and post-inflammatory hyperpigmentation. These compounds reduce melanin levels in the skin by inhibiting the production of melanin, whether the melanin is produced constitutively or in response to ultraviolet radiation, such as sun exposure. Thus, some of the active compounds in the present invention can be used to reduce skin melanin content in non-pathological states so as to induce a lighter skin tone, as desired by the user, or to prevent melanin accumulation in the skin that has been exposed to ultraviolet radiation. These compounds can also be used in combination with skin peeling agents, including, but not limited to, glycolic acid, salicylic acid, trichloroacetic acid face peels, and the like, to lighten skin tone and to prevent repigmentation.
One of ordinary skill in the art will appreciate that the endpoint chosen in a particular case, whether darkening or lightening, will vary according to the disease, condition, or disorder being treated, the outcome desired by the patient, subject, or treating physician, and other factors. Where the composition is being used to lighten or darken skin color such as, for example, to reverse hyperpigmentation caused by, for example, inflammation or diseases such as melasma, or to lighten or darken hair color, any one or a number of endpoints can be chosen. For example, endpoints can be defined subjectively such as, for example when the subject is simply "satisfied" with the results of the treatment. For pharmacological compositions, the endpoint can be determined by the patients or by the treating physician's satisfaction with the results of the treatment. Alternatively, endpoints can be defined objectively. For example, the patient's or subject's skin or hair in the treated area can be compared to a color chart. Treatment is terminated when the color of the skin or hair in the treated area is similar in appearance to a color on the chart. Alternatively, the reflectance of the treated skin or hair can be measured, and treatment can be terminated when the treated skin or hair attains a specified reflectance. In another method, the amount of melanin in the skin or hair can be measured.
The subject McIr agonists and antagonists (collectively herein "McIr agents") can be formulated alone or in combination with other agents. When provided in a topical formulation, the McIr agents can be co-formulated with emollients, emulsifiers, solvents, waxes, thickeners, film formers, humectants, preservatives, surfactants, perfumes, buffering agents, chelating agents, emulsion stabilizers, opacifying agents, pH adjusters, propellants, coloring agents, and the like. Such forms of the compositions can be formed into formulations, such as lotions, creams, gels, aerosols and sticks, in accordance with procedures well known in the art. The McIr agents of the present invention can be administered orally in solid or semi-solid dosage forms, such as hard or soft-gelatin capsules, tablets, or powders, or in liquid dosage forms, such as elixirs, syrups, or suspensions. The compounds can also be administered parenterally, in sterile liquid dosage forms. Since topical application is preferred, other dosage forms are possible including mousse or foams, patches, ointments, creams, gels, lotions, solutions, suppositories, or formulation for transdermal administration. Because in vivo use is contemplated, the composition is preferably of high purity and substantially free of potentially harmful contaminants, e.g., at least National Food grade, generally at least analytical grade, and preferably at least pharmaceutical grade. To the extent that a given compound must be synthesized prior to use, such synthesis or subsequent purification shall preferably result in a product that is substantially free of any potentially contaminating toxic agent that may have been used during the synthesis or purification process.
//. Certain Definitions
The term "cAMP agonist" refers to an agent which increases the intracellular level of, or cellular response to cAMP, including agents which act upon adenylate cyclase, cAMP phosphodiesterase, or other molecules which, in turn, regulate cAMP levels or activity. Additionally, cAMP agonists, as the term is used herein, refer to downstream effectors of cAMP activity, such as protein kinase.
The term "cAMP antagonist" refers to an agent which decreases the intracellular level of, or cellular response to cAMP, including agents which inhibit adenylate cyclase or activate/potentiate phosphodiesterase. As described in further detail, cAMP antagonists, as the term is used herein, also refers to upstream and downstream effectors of cAMP activity, such as inhibitors of protein kinase A (PKA) or agents that effect G proteins.
The "corium" or "dermis" refers to the layer of the skin deep to the epidermis, consisting of a dense bed of vascular connective tissue, and containing the nerves and terminal organs of sensation. The hair roots, and sebaceous and sweat glands are structures of the epidermis which are deeply embedded in the dermis.
The term "ED50" or "IC 50" means the dose of a drug which produces 50% of its maximum response or effect.
An "effective amount" of, e.g., a cAMP agonist, with respect to the subject method of treatment, refers to an amount of the agonist in a preparation which, when applied as part of a desired dosage regimen brings about, e.g., a change in the rate of melanogenesis according to clinically or cosmetically acceptable standards. This amount may vary with, among other things, the identity of melanin-increasing agent and carrier, the subject's skin color and condition, and the degree of tanning and/or photoprotection sought.
The terms "epithelia," "epithelial" and "epithelium" refer to the cellular covering of internal and external body surfaces (cutaneous, mucous and serous), including the glands and other structures derived therefrom, e.g., corneal, epidermal, and hair follicle epithelial cells.
The term "epidermis" refers to the outermost and nonvascular layer of the skin, derived from the embryonic ectoderm, varying in thickness from 0.07-1.4 mm. On the palmar and plantar surfaces it comprises, from within outward, five layers: basal layer composed of columnar cells arranged perpendicularly; prickle-cell or spinous layer composed of flattened polyhedral cells with short processes or spines; granular layer composed of flattened granular cells; clear layer composed of several layers of clear, transparent cells in which the nuclei are indistinct or absent; and horny layer composed of flattened, cornified non-nucleated cells. In the epidermis of the general body surface, the clear layer is usually absent.
A "patient" or "subject" or "individual" to be treated by the subject method can mean either a human or non-human animal, and includes males and females, children and adults.
The term "pigmentation" as used herein means the deposition of melanin in the skin, retina, hair or other tissue structure in which melanocytes and keratinocytes are present.
The term "prodrug" is intended to encompass compounds which, under physiological conditions, are converted into the therapeutically active agents of the present invention. A common method for making a prodrug is to include selected moieties which are hydrolyzed under physiological conditions to reveal the desired molecule. In other embodiments, the prodrug is converted by an enzymatic activity of the host animal.
The term "skin" refers to the outer protective covering of the body, consisting of the corium and the epidermis, and is understood to include sweat and sebaceous glands, as well as hair follicle structures. Throughout the present application, the adjective "cutaneous" may be used, and should be understood to refer generally to attributes of the skin, as appropriate to the context in which they are used.
The term "therapeutic index" refers to the therapeutic index of a drug defined
///. Exemplary Embodiments
A. Examples of McIr agonist As described in further detail below, it is contemplated that the subject methods which rely on increasing of cAMP levels i.e. one McIr agonists, can be carried out using a variety of different small molecules which can be readily identified, for example, by such melanogenesis drug screening assays as described herein. For example, compounds which may activate adenylate cyclase include forskolin (FK), cholera toxin (CT), pertussis toxin (PT), prostaglandins (e.g., PGE-I and PGE-2), colforsin and β-adrenergic receptor agonists.
In certain embodiments, the subject cAMP agonists can be chosen on the basis of their selectivity for cAMP-mediated pathways, such as selectivity relative to other cyclic nucleotides and/or selectivity for particular cAMP-dependent enzymes or even isoforms of those enzymes.
Compounds which may inhibit a cAMP phosphodiesterase include amrinone, milrinone, xanthine, anagrelide, cilostamide, medorinone, indolidan, rolipram, 3-isobutyl-l-methylxanthine (LBMX), chelerythrine, cilostazol, glucocorticoids, griseolic acid, etazolate, caffeine, indomethacin, papverine, MDL 12330A, SQ 22536, GDPssS, clonidine, type III and type IV phosphodiesterase (PDE) inhibitors, methylxanthines such as pentoxifylline, theophylline, theobromine, pyrrolidinones and phenyl cycloalkane and cycloalkene derivatives (described in PCT publications Nos. WO 92/19594 and WO 92/10190, incorporated herein by reference), lisophylline, and fenoxamine.
Analogs of cAMP which may be useful in the present method include dibutyryl-cAMP (db-cAMP), (8-(4)-chlorophenylthio)-cAMP (cpt-cAMP), 8-[(4- bromo-2,3-dioxobutyl)thio]-cAMP, 2-[(4-bromo-2,3-dioxobutyl)thio]-cAMP, 8- bromo-cAMP, dioctanoyl-cAMP, Sp-adenosine 3':5'-cyclic phosphorothioate, 8- piperidino-cAMP, N6-phenyl-cAMP, 8-methylamino-cAMP, 8-(6- aminohexyl)amino-cAMP, 2'-deoxy-cAMP, N6,2'-O-dibutryl-cAMP, N6,2'-O- disuccinyl-cAMP, N6-monobutyryl-cAMP, 2'-O-monobutyryl-cAMP, 2'-O- monobutryl-8-bromo-cAMP, N6-monobutryl-2'-deoxy-cAMP, and 2'-O- monosuccinyl-c AMP .
Above-listed compounds useful in the subject methods may be modified to increase the bioavailability, activity, or other pharmacologically relevant property of the compound. For example, forskolin has the formula:
Forskolin
Modifications of forskolin which have been found to increase the hydrophilic character of forskolin without severely attenuating the desired biological activity include acylation of the hydroxyls at C6 and/or C7 (after removal of the acetyl group) with hydrophilic acyl groups hi compounds wherein C6 is acylated with a hydrophilic acyl group, C7 may optionally be deacetylated. Suitable hydrophilic acyl groups include groups having the structure -CO(CH)(OH)CH OH or -
(CO)(CH 2)nX, wherein X is OH, -COOH or N(R) 2; R is independently selected from a hydrogen, a C1-C4 alkyl group, -COCH3, or the two Rs taken together with the nitrogen to which they are attached form a ring comprising 3-8 atoms, preferably 5-7 atoms, which may include heteroatoms (e.g., piperazine or morpholine rings); and n is an integer from 1-6, preferably from 1-4, even more preferably from 1-2. Other suitable hydrophilic acyl groups include hydrophilic amino acids or derivatives thereof, such as aspartic acid, glutamic acid, asparagine, glutamine, serine, threonine, tyrosine, etc., including amino acids having a heterocyclic side chain. Forskolin, or other compounds listed above, modified by other possible hydrophilic acyl side chains known to those of skill in the art may be readily synthesized and tested for activity in the present method.
Since the actions of cAMP are terminated by cyclic nucleotide phosphodiesterases (PDEs, which hydrolyze the 3'-phosphodiesterase bond to form the inactive metabolite 5'-AMP), the intracellular enzyme family of PDEs regulates the level of cAMP in cells. Accordingly, inhibition of PDE function would prevent the conversion of cAMP to the inactive metabolite 5'-AMP and, consequently, maintain higher cAMP levels (see Beavo and Houslay, Cyclic Nucleotide Phosphodiesterases: Structure, Regulation and Drug Action, Wiley, Chichester, pgs 3-14, 1990). Applicants have discovered, based on expression data, that the type 4 cAMP phosphodiesterase (PDE4) is highly expressed within normal human melanocytes. Thus PDE4 constitutes a major mechanism of cAMP degradation in these cells. Accordingly, the various PDE3 and PDE4 inhibitors, especially the cAMP-specifϊ c PDE inhibitors, are all McIr agonists of the invention.
Preferred examples of cAMP-speciflc PDE inhibitors include those compounds recited in Table 2 and Table 3, or elsewhere herein or isomers thereof, prodrugs thereof, salts thereof, and/or combinations of two or more thereof.
One exemplary class of cAMP-speciflc PDE inhibitor are racemic and optically active 4-(polyalkoxyphenyl)-2-pyrrolidones of general Formula I ("rolipram derivatives"): Formula I 4-(polyalkoxyphenyl)-2-pyrrolidones
wherein Ri and R2 each are alike or different, and are hydrocarbon of up to 18 carbon atoms with at least one being other than methyl, a heterocyclic ring, or alkyl of 1-5 carbon atoms which is substituted by one or more of halogen atoms, hydroxy, carboxy, alkoxy, alkoxycarbonyl or an amino group; amino; R' is a hydrogen atom, alkyl, aryl or acyl; and X is an oxygen atom or a sulfur atom.
The compounds of general Formula I possess an asymmetrical carbon atom. Thus, they can be present both as racemates and as optical antipodes thereof.
Examples of hydrocarbon Ri and R2 groups are saturated and unsaturated, straight-chain and branched alkyl of 1-18, preferably 1-5, carbon atoms, cycloalkyl and cycloalkylalkyl, preferably of 3-7 carbon atoms, and aryl and aralkyl, preferably of 6-10 carbon atoms, especially monocyclic.
Examples of alkyl are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert.- butyl, pentyl, 2-methylbutyl, 2,2-dimethylpropyl, hexyl, heptyl, octyl, nonyl, 1,2- dimethylheptyl, decyl, undecyl, dodecyl and stearyl, with the proviso that when one of R i and R2 is methyl, the other is a value other than methyl. Examples of unsaturated alkyl groups are alkenyl and alkinyl, e.g., vinyl, 1-propenyl, 2-propenyl, 2-propinyl and 3-methyl-2-propenyl.
Examples of cycloalkyl and cycloalkylalkyl which preferably contain a total of 3-7 carbon atoms are cyclopropyl, cyclopropylmethyl, cyclopentyl and cyclohexyl.
Examples of aryl and aralkyl are phenyl and benzyl, which are preferred, and tolyl, xylyl, naphthyl, phenethyl and 3-phenylpropyl. Examples of heterocyclic R and R2 groups are those wherein the heterocyclic ring is saturated with 5 or 6 ring members and has a single O, S or N atom as the hetero atom, e.g., 2- and 3-tetrahydrofuryl, 2- and 3-tetrahydropyranyl, 2- and 3-tetrahydrothiophenyl, pyrrolidino, 2- and 3-pyrrolidyl, piperidino, 2-, 3- and 4-piperidyl, and the corresponding N-alkyl-pyrrolidyl and piperidyl wherein alkyl is of 1-4 carbon atoms. Contemplated equivalents are heterocyclic rings having fewer or more, e.g., 4 and 7, ring members, and one or more additional hetero atoms as ring members, e.g., morpholino, piperazino and N-alkylpiperazino.
Examples of substituted alkyl R i and R2 groups, preferably of 1-5 carbon atoms, are those mono- or polysubstituted, for example, by halogen, especially fluorine, chlorine and bromine. Specific examples of such halogen-substituted alkyl are 2-chloroethyl, 3-chloropropyl, 4-bromobutyl, difluoromethyl, trifluoromethyl, l,l,2-trifluoro-2-chloroethyl, 3,3,3-trifluoropropyl, 2,2,3,3,3-pentafluoropropyl and l,l,l,3,3,3-hexafluoro-2-propyl. Examples of other suitable substituents for such alkyl groups are hydroxy groups, e.g., 2-hydroxyethyl or 3-hydroxypropyl; carboxy groups, e.g., carboxymethyl or carboxyethyl; alkoxy groups, wherein each alkoxy group contains 1-5 carbon atoms, e.g., ethoxymethyl, isopropoxymethyl, 2- methoxyethyl, 2-isopropoxyethyl, 2-butyoxyethyl, 2-isobutyoxyethyl, and 3- pentoxypropyl.
Also suitable as preferably terminal-positioned substituents on alkyl groups of 1-5 carbon atoms are alkoxycarbonyl of 1-5 carbon atoms in the alkoxy group. Examples of such alkoxycarbonyl substituted alkyl groups are ethoxycarbonylmethyl and 2-butoxycarbonylethyl.
Alkyl groups of 1-5 carbon atoms can also be substituted, e.g., in the β, γ and preferably terminal position with amino groups wherein the nitrogen atom optionally is mono- or disubstituted by alkyl, preferably of 1-5 carbon atoms, or is part of a 4- to 7-membered ring. Specific examples of amino-substituted alkyl groups are aminomethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethylaminoethyl, 3- dimethylaminopropyl, 3-ethylmethylaminopropyl, pyrrolidino, piperidino, morpholino, N-methylpiperazino and hexamethylenimino. Preferred compounds of general Formula I are those wherein
(a) one of Ri and R2 is methyl;
(b) one of Ri and R2 is methyl and the other is hydrocarbon of 2-18 carbon atoms, e.g., alkyl or alkenyl of 2-18 carbon atoms;
(c) one of Ri and R is methyl and the other is cycloalkyl or cycloalkylalkyl of 3-7 carbon atoms;
(d) one of R and R2 is methyl and the other is hydrocarbon aryl or aralkyl of 6-10 carbon atoms;
(e) one of Ri and R is methyl and the other is a heterocyclic ring, preferably tetrahydrothienyl or tetrahydrofuryl;
(f) one of Ri and R is methyl and the other is substituted alkyl, preferably mono-, di- or trihaloalkyl;
(g) X is O, especially those of (a)-(f);
(h) X is S, especially those of (a)-(f); and
(i) R' is H, especially those of (a)-(h).
Examples of R' groups, in addition to hydrogen, are lower alkyl of 1 to 4 carbon atoms, e.g., methyl and ethyl, aryl, e.g., phenyl or other hydrocarbon aryl as illustrated above for Ri and R2, lower acyl, preferably alkanoyl of 1-6 carbon atoms, e.g., acetyl, propionyl, butyryl and pivaloyl. Other examples of aryl are those as illustrated above for Ri and R2. When R' is acyl, the exact nature of the acylating group is not critical, since activity resides in the N-unsubstituted moiety. Thus, equivalents of the preferred lower-alkanoyl R' groups are those of the formula RCO- - wherein R is a hydrocarbon or substituted alkyl group as illustrated above for Ri and R .
The novel compounds are characterized by a rapid onset of effectiveness and a low order of acute toxicity.
Although a single racemate or optical antipode of Formula I are generally employed in such compositions, mixtures thereof can also be employed, if desired.
For oral administration, the amount of active agent per oral dosage unit usually is 1-20 mg., preferably 5-10 mg. The daily dosage is usually 1-50 mg., preferably 10-30 mg. p.o. For parenteral application, the amount of active agent per dosage unit is usually 0.05-10 mg., preferably 0.1-5 mg. The daily dosage is usually 0.1-20 mg., preferably 0.2-5 mg. i.v. or i.m.
The 4-(polyalkoxyphenyl)-2-pyrrolidones of general Formula I can be produced according to U.S. Pat. No. 4,193,926 (incorporated herein by reference).
Certain preferred 4-(3-ethoxy-4-metoxyphenyl)-2-pyrrolidone include:
4-(3-propoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-butoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-hexyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-isopropoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(l-methylpropoxy)-4-methoxyphenyl)-2-pyrrolidone;
4-(3-isobutoxy-4-methoxyphenyl)-2-pyrrolidione;
4-(3-allyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(3-methyl-2-butenyloxy)-4-methoxyphenyl)-2-pyrrolidone;
4-(3-methoxymethoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(2-hydroxyethoxy)-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(2,2,2-trifluoroethoxy)-4-methoxyphenyl)-2-pyrrolidone;
4-(3-benzyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-phenoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-methoxy-4-ethoxyphenyl)-2-pyrrolidone;
4-(3-methoxy-4-butoxyphenyl)-2-pyrroli done;
1-acetyl-4-(3,4-dimethoxyphenyl)-2-pyrrolidone;
4-(3-decyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-octadecyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(2-methylbutyl)-oxy-4-methoxyphenyl)-2-pyrrolidone; 4-(3-neopentyloxy-4-methoxyphenyl)-2-py τrolidone;
4-(3-isopentyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(2-propinyl)-oxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-cyanomethyloxy-4-methoxyphenyl)-2-pyi τolidone;
4-(3-cyclobutoxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-cyclopentyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-cyclohexyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(3-methylcyclopentyl)-oxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(2-methylcyclopentyl)-oxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-(3-tetrahydrothienyl)-oxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3 -(3 -tetrahydrofuryl)-oxy-4-methoxyphenyl)-2-pyrrolidone;
4-(3-cyclopropylmethyloxy-4-methoxyphenyl)-2-pyr τolidone;
4-(3-cyclopentylmethyloxy-4-methoxyphenyl)-2 -pyrrolidone;
4-(3-methallyloxy-4-methoxyphenyl)-2-pyrrolidone;
4-(4-propinyloxy-3-methoxyphenyl)-2-pyrrolidone;
4-(4-cyclopentyloxy-3-methoxyphenyl)-2 -pyrrolidone;
4-(3,4-diethoxyphenyl)-2-pyrrolidone;
4-(3,4-diisobutoxyphenyl)-2-pyrrolidone;
4-(3-isobutoxy-4-methoxyphenyl)-pyrrolidine-2-thione;
4-(3-cyclopentyloxy-4-methoxyphenyl)-pyrrolidine-2-thione; and
4-(3-(2-tetrahydrofuryloxy)-4-methoxyphenyl)-2-pyrrolidone.
One preferred 4-(polyalkoxyphenyl)-2-pyrrolidones of general Formula I is rolipram: Preferably, the rolipram is (R)-(-)-Rolipram, or (4R)-4-[3-(Cyclopentyloxy)- 4-methoxyphenyl]pyrrolidin-2-one, which is a more active enantiomer (about 2- to 10-fold more potent) than the S-(+) enantiomer ((4S)-4-[3-(Cyclopentyloxy)-4- methoxyphenyl]pyrrolidin-2-one). See Schneider et al., Stereospecific binding of the antidepressant rolipram to brain protein structures. Eur J Pharmacol 127: 105 (1986).
However, the present invention should not be construed as being limited to any particular one of the cAMP-specific PDE inhibitors described herein. It should also be understood that the present invention encompasses any cAMP-specific PDE inhibitor that can be shown to act as a cAMP-specific PDE inhibitor, whether such a compound is now known, later developed, or even later recognized as having in vivo and/or in vitro inhibitory activity against any subtype of a PDE enzyme and that such inhibitory activity leads to an alteration of cAMP levels.
In one embodiment of the present invention, the cAMP-specific PDE inhibitor comprises at least one compound chosen from a PDE 3 inhibitor, a PDE 4 inhibitor, and combinations of two or more thereof. In another embodiment, the cAMP-specific PDE inhibitor comprises a PDE 3 inhibitor, whether such a compound is now known, later developed, or even later recognized as having PDE 3 inhibitory activity. In a further embodiment, the cAMP-specific PDE inhibitor comprises at least one of the PDE 3 inhibitors listed in Table 2.
In some embodiments, the cAMP-specific PDE 3 inhibitor comprises at least one compound chosen from cilostazol, milrinone, enoximone, imazodan, trequinsin, olprinone, amrinone, indolidan, siguazodan, zardaverine, benzafentrine, lixazinone, NSP-513, pimobendan, ORG 9935, 4-methylamino-7-(2,3,4,5-tetrahydro-5-methyl- 3-oxo-6-pyridazinyl) quinazoline, ORG 20241, saterinone, cilostamide, salts thereof, isomers thereof, prodrugs thereof, and combinations of two or more thereof. In preferred embodiments, the cAMP-specific PDE inhibitor comprises the PDE 3 inhibitor, cilostazol.
In other embodiments of the present invention, the cAMP-specific PDE inhibitor comprises a PDE 4 inhibitor, whether such a compound is now known, later developed, or even later recognized as having PDE 4 inhibitory activity. In a further embodiment, the cAMP-specific PDE inhibitor comprises at least one of the PDE 4 inhibitors listed in Table 3.
All references cited in Tables 2 and 3 are incorporated herein by reference. Attorney Docket No. 104244-0001-WOl Express Mail Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
TABLE 2 PDE 3 Inhibitors
No. Name Drug Class Manufacturer Reference
Al Cilostazol (PLETAL) PDE 3 Pfizer, Inc. Liu, Y., et al. Cilostazol (pletal): a dual inhibitor of inhibitor cyclic nucleotide phosphodiesterase type 3 and 6-[4-( 1-Cyclohexyl- lH-tetrazol-5- adenosine uptake. Cardiovasc Drug Rev, 19: 369-86 yl)butoxy]-3,4-dihydroxycarbostyril (2001).
A2 Milrinone PDE 3 Cone, J., et al Comparison of the effects of inhibitor cilostazol and milrinone on intracellular cAMP l,6-dihydro-2-methyl-6-oxo-(3,4'- levels and cellular function in platelets and cardiac 4- bipyridine)-5-carbonitrile cells. J Cardiovasc Pharmacol, 34: 497-504 (1999).
A3 Enoximone PDE 3 Abdel-aleem, S., etal. Effects of phosphodiesterase inhibitor inhibitors on glucose utilization in isolated cardiac l,3-dihydro-4-methyl-5-[4- myocytes MoI Cell Biochem, 180: 129-35 (1998). methylthiobenzoyl]-2H-imidazol-2- one
A4 Imazodan (Cl-914) PDE 3 Mochizuke, N., et al. Cardiovascular effects of inhibitor NSP-804 and NSP-805, novel cardiotonic agents with vasodilator properties. J Cardiovasc yl)phenyl] -3(2H)-pyridazinone Pharmacol, 21: 983-95 (1993). Attorney Docket No. 104244-0001-WOl Express Mail Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
A5 Trequinsin cAMP- O'Donnell, et al Behavioral effects of family- specific selective inhibitors of cyclic nucleotide CAS Number: 78416-81-6 PDE phosphodiesterases. Pharmacol Biochem Behav, 63: 2-(arylimino)-3-alkyl-9-, 10- inhibitor 185-192 (1999). dimethoxy-3 ,4,6,7-tetrahydro-2H- pyrimido[6, 1-a]isoquinolin-4-one
A6 Olprinone PDE 3 Myou, S. etal. Bronchodilator effect of inhaled inhibitor olprinone, a phosphodiesterase 3 inhibitor, in 1,2 dihydro-6-methyl-2-oxo-5- asthmatic patients. Am J Respir Crit Care Med, 160: [imidazo(l,2-a)pyridine carbonitrile 817-20 (1999). U l hydrochloride monohydrate
A7 Amrinone PDE 3 Kerttula, T., et al. Amrinone, a phosphodiesterase inhibitor III inhibitor, and arachidonic acid metabolism in 5-amino-3 ,4'-bipyridine-6(l H)-one humans. J Cardiovasc Pharmacol. 33: 140-3 (1999).
A8 Indolidan (LY195115) cAMP- Kauffman, R. F., et al. LΫ 1951 15: a potent, specific selective inhibitor of cyclic nucleotide 3,3-dimethyl-5 -(1,4,5,6-tetrahydro-6- PDE phosphodiesterase located in the sarcoplasmic oxo-3-pyridazinyl)-2-indolinone inhibitor reticulum. MoI Pharmacol, 30: 609-16 (1986). i
A9 Siguazodan PDE 3 Christensen and Torphy. Isoenzyme-selective inhibitor phosphodiesterase inhibitors as antiasthmatic N-cyano-N'-methyl-N"-[4-(l,4,5,6- Attorney Docket No. 104244-0001-WOl Express MaU Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
tetrahydro-4-methyl-6- oxo-3- agents. Ann Rep Med Chem, 29: 185 (1994). pyridazinyl)phenyl-] guanidine
AlO Zardaverine PDE 3 and Galvan and Schudt. Actions of the PDE 4 phosphodiesterase inhibitor zardaverine on guinea 6-[4-(Difluoromethoxy)-3- inhibitor pig ventricular muscle. Naunyn-Schmied Arch methoxyphenyl]-3(2H)-pyridazinone Pharmacol, 342: 221 (1990).
Al l Benzafentrine PDE 3 and Banner, K. H., et al. The effect of selective PDE 4 phosphodiesterase 3 and 4 isoenzyme inhibitors and inhibitor established anti-asthma drugs on inflammatory cell
activation. Br J Pharmacol. 119: 1255-61 (1996).
A12 4-methylamino-7-(2,3,4,5- tetrahydro- PDE 3 and Nomoto, Y., et al. Studies on cardiotonic agents. 5-methyl-3-oxo-6- PDE 4 VI. Synthesis of novel 4,5-dihydro-3(2H)- pyridazinyl)quinazoline inhibitor pyridazinone derivatives carrying some
benzoheterocycles at the 6-position. Chem Pharm Bull (Tokyo). 39: 352-7 (1991).
A13 Lixazinone (RS-82856) PDE 3 and Strosberg, A. M., et al. RS-82856, a selective i PDE 4 phosphodiesterase inhibitor with inotropic, afterload N-cyclohexyl-N-methyl-4(7-oxy inhibitor reduction and antithrombotic properties. Proc West 1,2,3 ,5-tetrahydroimidazol[2, 1-b] Pharmacol Soc. 30: 5- 10 (1987). ' Attorney Docket No. 104244-0001-WOl Express MaU Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
quinazolin-2-one butyramide
A14 NSP-513 PDE 3 Hirose, H., et al. Antiplatelet and antithrombotic inhibitor effects of a novel selective phosphodiesterase 3 (R)-4,5-dihydro-5-methyl-6-[4-(2- inhibitor, NSP-513, in mice and rats. Jpn J propyl-3 -oxo- 1-cyclohexenyl) amino] Pharmacol. 82: 188-98 (2000). phenyl-3(2H)-pyridazinone
A 15 Pimobendan (VETMEDIN) PDE-3 Shiga, T., et al, beta-Blocker Therapy Combined inhibitor with Low-Dose Pimobendan in Patients with (±)-4,5-dihydro-6-[2-(p- and calcium Idiopathic Dilated Cardiomyopathy and Chronic methoxyphenyl)-5-benzimidazolyl]-5- sensitizer Obstructive Pulmonary Disease: Report on Two methyl-3(2H)-pyridazinone Cases. Cardiovasc Drugs Ther. 16: 259-63 (2002).
A16 ORG 9935 PDE 3 Santing, R. E., et al, Bronchodilatory and anti- inhibitor inflammatory properties of inhaled selective 4,5-dihydro-6-(5,6- phosphodiesterase inhibitors in a guinea pig model dimethoxybenzo[b]thien-2-yl-5- of allergic asthma. Eur J Pharmacol. 429: 335-44 methyl-3 (2H)pyridazinone (2001).
Al 7 ORG 20241 PDE 3 and Santing, R. E., et al. Bronchodilatory and anti¬ i PDE 4 inflammatory properties of inhaled selective N-hydroxy-4-(3,4-dimethoxyphenyl)- inhibitor phosphodiesterase inhibitors in a guinea pig model thiazole-2-carboximidamide HCl ( of allergic asthma. Eur J Pharmacol. 429: 335-44 ' Attorney Docket No. 104244-0001-WOl Express MaU Air BiU: EV 970403955 US Date of Deposit: 29 March 2007
(2001).
Al 8 Saterinone PDE 3 Intravenous Kieback, A. G., et al. Pharmacokinetics and inhibitor infusion hemodynamic effects of the phosphodiesterase III over24 hours inhibitor saterinone in patients with chronic heart
at a rate of 1.5 failure. Int J Cardiol. 91(2-3): 201-8 (2003). microgram/kg per min.
Al 9 Cilostamide PDE 3 Tarpey, S. B., et al, Phosphodiesterase 3 activity is inhibitor reduced in dog lung following pacing-induced heart failure. Am J Physiol Lung Cell MoI Physiol. 284(5): L766-73 (2003).
TABLE 3 PDE 4 Inhibitors
No. Name Drug Class Manufacturer Reference
Cl Roflumilast PDE 4 Altana Hatzelmann, A. and Schudt, C. Anti-inflammatory inhibitor Pharma and immunomodulatory potential of the novel i 3-cyclo-propylmethoxy-4- PDE4 inhibitor roflumilast in vitro. J Pharmacol difluoromethoxy-N-[3,5-di- Exp Ther. 297: 267-79 (2001). chloropyrid-4-yl] -benzamide Attorney Docket No. 104244-0001-WOl Express MaU Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
C2 Cilomilast (ARIFLO®) PDE 4 GlaxoSmith Giembycz, M. A. Cilomilast: a second generation inhibitor Kline phosphodiesterase 4 inhibitor for asthma and 4-cyano-4-(3-cyclopentyloxy-4- chronic obstructive pulmonary disease. Expert Opin methoxy-phenyl)cyclohexane Investig Drugs. 10: 1361-79 (2001). carboxylic acid
C3 Etazolate hydrochloride selective for Chesin, et al. l-Ethyl-4-(isopropylidenehydrazinol- PDE4 H-ρyrazolo-(3,4- b)-pyridin-5-carboxylic acid, ethyl ( 1-Ethyl-4-[(l -methylethylidene) ester, hydrochloride (SQ 20009) - potent new hydrazino]- lH-pyrazolo-[3,4-b]- inhibitor of cyclic 3'5-nucleotide phosphodiesterase. pyridine-5-carboxylic acid, ethyl ester Biochem Pharmacol, 21: 2443 (1972).
C4 Ro 20-1724 selective for Nicholson et al. Differential modulation of tissue PDE4 function and therapeutic potential of selective 4-(3 -Butoxy-4-methoxyphenyl) inhibitors of cyclic nucleotide phosphodiesterase methyl-2-imidazolidone isoenzymes. TiPS 21: 19 (1991).
C5 Rolipram Selective Kato et al. Rolipram, a cyclic AMP-selective inhibitor of phosphodiesterase inhibitor, reduces neuronal 4-(3-(Cyclopentyloxy)-4- PDE4 damage following cerebral ischemia in the gerbil. methoxyphenyl)pyrrolidin-2-one i Eur J Pharmacol, 272: 107 (1995).
Teixeira et al Phosphodiesterase (PDE)4 inhibitors: Attorney Docket No. 104244-0001-WOl Express MaU Air BiU: EV 970403955 US Date of Deposit: 29 March 2007
anti-inflammatory drugs of the future? TiPS 18: 164 (1997).
C6 (R)-(-)-Rolipram More active Schneider et al. Stereospecific binding of the enantiomer antidepressant rolipram to brain protein structures. (4R)-4-[3-(Cyclopentyloxy)-4- ofthe PDE4 Eur J Pharmacol, 127: 105 (1986). methoxyphenyl]pyrrolidin-2-one inhibitor rolipram; 2-
10- fold more potent
than the S-
(+) enantiomer.
C7 (S)-(+)-Rolipram Less active Schneider et al Stereospecific binding of the enantiomer antidepressant rolipram to brain protein structures. (4S)-4-[3-(Cycloρentyloxy)-4- ofthe PDE4 Eur J Pharmacol, 127: 105 (1986). methoxyphenyl]pyrrolidin-2-one inhibitor
rolipram i
C8 Zardaverine Selective Galvan and Schudt. Actions of the
for PDE3 phosphodiesterase inhibitor zardaverine on guinea ( 6-[4-(Difluoromethoxy)-3- ' Attorney Docket No. 104244-0001-WOl Express Mail Air BiU: EV 970403955 US Date of Deposit: 29 March 2007
methoxyphenyl]-3(2H)-pyridazinone and 4 (IC50 pig ventricular muscle. Naunyn-Schmied Arch values are Pharmacol, 342: 221 (1990).).
0.5 and 0.8 µM respectively
C9 V11294A PDE 4 Gale, D. D., et al Pharmacokinetic and inhibitor pharmacodynamic profile following oral 3-(3-cyclopentyloxy-4- administration of the phosphodiesterase (PDE)4 methoxybenzyl)-6-ethylamino-8- inhibitor Vl 1294A in healthy volunteers. Br J Clin isopropyl-3H purine hydrochloride Pharmacol. 54: 478-84 (2002).
ClO CDP840 PDE 4 Celltech Perry, M. J., etal. CDP840: a novel
inhibitor inhibitor of PDE-4.-Cell Biochem Biophys. 29: 113- R-[+]-4-[2-(3-cyclopentyloxy-4- 32 (1998). methoxyphenyl)-2- phenylethyl]pyridine
Cl 1 Denbufylline PDE 4 Hadley, A. J., et al. Stimulation of the inhibitor hypothalamo-pituitary-adrenal axis in the rat by the l,3-dibutyl-7-(2-oxopropyl)-3,7- i type 4 phosphodiesterase (PDE-4) inhibitor, dihydro- 1H-purine-2,6-dione denbufylline. Br J Pharmacol. 119: 463-70 (1996). Attorney Docket No. 104244-0001-WOl Express Mail Air BiU: EV 970403955 US Date of Deposit: 29 March 2007
Cl 2 Mesopram PDE 4 Griffiths, C. E., et al Randomized comparison of inhibitor the type 4 phosphodiesterase inhibitor cipamfylline 5-(4-methoxy-3-propoxyphenyl)-5- cream, cream vehicle and hydrocortisone 17- methyl-1 ,3-oxazolidin-2-one butyrate cream for the treatment of atopic
dermatitis. Br J Dermatol. 147: 299- 307 (2002).
Cl 3 Cipamfylline PDE 4 Loher, F., et al. The specific type 4 inhibitor phosphodiesterase inhibitor mesopram alleviates 8-amino- 1,3-bis-cyclopropylmethyl- experimental colitis in mice. J Pharmacol Exp Ther. 3,7- dihydro-purine-2,6-dione 305: 549-56 (2003).
C14 SCH 351591 PDE 4 Billah, M. M., et al. Pharmacology of N-(3,5- inhibitor dichloro-l-oxido-4-pyridinyl)-8-methoxy-2- N-(3,5-dichloro-l-oxido-4-pyridinyl)- (trifluoromethyl)-5-quinoline carboxamide(SCH 8-methoxy-2- (trifluoromethyl)-5- 351591), a novel, orally active phosphodiesterase 4 quinoline carboxamide inhibitor. J Pharmacol Exp Ther. 302: 127-37 (2002).
C15 SCH 365351 PDE 4 Billah, M. M., et al. Pharmacology of N-(3,5- i inhibitor dichloro- 1-oxido-4-pyridinyl)-8-methoxy-2- N-(3,5-Dichloro-4-pyridinyl)-8- (trifluoromethyl)-5-quinoline carboxamide (SCH methoxy-2-(trifluoromethyl)-5- 351591), a novel, orally active phosphodiesterase 4 ( quinoline carboxamide ' Attorney Docket No. 104244-0001-WOl Express MaU Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
inhibitor. J Pharmacol Exp Then 302: 127-37 (2002).
Cl 6 L-791,943 PDE 4 Guay, D., et al. Discovery of L-79 1,943 : a potent, inhibitor selective, non emetic and orally active phosphodiesterase-4 inhibitor. Bioorg Med Chem
Lett. 12: 1457-61 (2002).
Cl 7 7-Benzylamino-6-chloro-2- cAMP- Wagner, B. et al. 7-Benzylamino-6-chloro-2- piperazino-4-pyrrolidino-pteridine specific piperazino-4-pyrrolidino-pteridine, a potent PDE inhibitor of cAMP-specific phosphodiesterase, inhibitor enhancing nuclear protein binding to the CRE consensus sequence in human tumor cells. Biochem
Pharmacol. 63: 659-68 (2002).
Cl 8 Piclamilast (RP 73401) PDE 4 Rhone- Corbel, M. et al. The selective phosphodiesterase 4 inhibitor Poulenc Rorer inhibitor RP 73-401 reduced matrix N-(3,5-dichloropyrid-4-yl)-3- metalloproteinase 9 activity and transforming cyclopentyloxy-4-methoxybenzamide growth factor-beta release during acute lung injury in mice: the role of the balance between Tumor i necrosis factor- alpha and interleukin-10. J Pharmacol Exp Ther,301: 258-65 (2002). ' Attorney Docket No. 104244-0001-WOl Express MaU Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
C19 NVP-ABE171 PDE 4 Trifilieff, A., et al. Pharmacological profile of a inhibitor novel phosphodiesterase 4 inhibitor, 4-(8- 4-(8-benzo[l,2,5]oxadiazol-5-yl- benzo[l,2,5]oxadiazol-5-yl-[l,7]naphthyridin-6-yl)- [ 1,7]naphthyridin-6-yl)-berizoic acid benzoic acid (NVP-ABE171), a 1,7-naphthyridine derivative, with anti-inflammatory activities. J Pharmacol Exp Ther. 301: 241-8 (2002).
C20 4-(8-benzo[l,2,5]oxadiazol-5-yl- PDE 4D Hersperger, R., et al. Synthesis of 4-(8- [l,7]naphthyridine-6-yl)-benzoic acid inhibitor benzo[l,2,5]oxadiazol-5-yl-[l,7]naphthyridine-6- yl)-benzoic acid: a potent and selective phosphodiesterase type 4D inhibitor. Bioorg Med
Chem Lett. 12: 233-5 (2002).
C21 YM976 PDE 4 Aoki, M, et al. A novel phosphodiesterase type 4 inhibitor inhibitor, YM976 (4-(3-chlorophenyl)-l,7- 4-(3-chlorophenyl)- 1,7- diethylpyrido[2,3-d]pyrimidin-2(lH)-, with little diethylpyrido[2,3-d]pyrimidin-2(lH)- emetogenic activity. J Pharmacol Exp Ther. 295: one one) 255-60 (2000).
C22 KF 195 14 PDE 4 Manabe, H., et al. Anti-inflammatory and inhibitor 5-phenyl-3-(3-pyridyl)methyl-3H- bronchodilator properties of KF19514, a phosphodiesterase 4 and 1 inhibitor. Eur J imidazo[4,5-c][1,8]naphthyridin-4 Attorney Docket No. 104244-0001-WOl Express MaU Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
(5H)-one Pharmacol. 332: 97-107 (1997).
C23 Arofylline PDE 4 Almirall Ferrer, L, et al. Clinical anti-inflammatory inhibitor efficacy of arofylline, a new selective 3-(4-Chlorophenyl)-3,7-dihydro-l- phosphodiesterase-4 inhibitor, in dogs with atopic propyl- 1H-purine-2,6-dione; (2)3-(p- dermatitis. Vet Pec. 745: 191-4 (1999). Chlorophenyl)- 1-propylxanthine
C24 XT-44 PDE 4 Waki, Y., et al Effects of XT-44, a inhibitor phosphodiesterase 4 inhibitor, in osteoblastgenesis 1-n-butyl-3-n-propylxanthine and osteoclastgenesis in culture and its therapeutic effects in rat osteopenia models. Jpn J Pharmacol. 79: 477-83 (1999).
C25 T-440 cAMP- Sugahara M., et al. An efficient synthesis of the specific anti-asthmatic agent T-440: a selective N-alkylation 6,7-Diethoxy- 1-[1-(2-methoxyethyl)- PDE of 2-pyridone. Chem Pharm Bull (Tokyo). 48: 589- 2-oxo-l,2- dihydropyridin-4- inhibitor 9 1 (2000). yl]naphthalene-2,3-dimethanol
C26 Atizoram (CP-80633) PDE 4 Pfizer Cohan, V. L., et al In vitro pharmacology of the
i (2'S)5-[3-(2'-exobicyclo[2.2.1]- inhibitor novel phosphodiesterase type 4 inhibitor, CP-80633. J Pharmacol Exp Ther. 278: 1356-61 heptyloxy)4-methoxyphenyl] (1996). tetrahydro-2 (1H)-primidone ( ' Attorney Docket No. 104244-0001-WOl Express MaU Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
C27 Tibenelast (LY 186655) PDE 4 Ely Lilly Ho, P. P., et al. Cardiovascular effect and stimulus- inhibitor dependent inhibition of superoxide generation from 5,6,-diethoxybenzo(b)thiophene-2- human neutrophils by tibenelast, 5,6- carboxylic acid diethoxybenzo(b)thiophene- 2-carboxylic acid,
sodium salt (LYl 86655). Biochem Pharmacol. 40: 2085-92 (1990).
C28 D-4418 PDE 4 Chiroscience/ inhibitor Schering- Plough
C29 ICI 63,197 PDE4 Zhao, Y., et al., Inhibitor binding to type 4 inhibitor phosphodiesterase (PDE4) assessed using [3H]piclamilast and [3H]rolipram. J. Pharmacol.
Exp. Ther. 305, 565-572, (2003)
C30 Cl 1018 PDE 4 Jouveinal/ inhibitor Park-Davis
C31 D-22888 PDE 4 Asta Medica i inhibitor
C32 N-(3,5-dichloropyridin-4-yl)-2-[l-(4- PDE 4 Arzneimittel- U.S. Pat. No. 6,545,1 58 ( ' Attorney Docket No. 104244-0001-WOl Express MaU Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
fluorobenzyl)-5-hydroxyindol-3-yl]-2- inhibitor werk Dresden oxoacetamide GmbH
C33 l,2,4-triazolo(4,3-b)pyrido(3,2- PDE 4 Almirall U.S. Pat. No. 6,407, 108 d)pyridazine derivatives inhibitors Prodesfarma, SA
C34 Diazepinoindoles PDE 4 Pfizer, Inc.; U.S. Pat. No. 6,544,983; 6,239,130; 5,972,927 inhibitors Jouveinal ('927)
C35 Heterosubstituted pyridine derivatives PDE 4 Merck Frosst U.S. Pat. Nos. 6,316,472; 6,200,993; 6,180,650 inhibitors Canada & Co.
C36 Hydroxyindoles PDE 4 Arzneimittel- U.S. Pat. No. 6,251,923 inhibitors werk Dresden GmbH
C37 N-(3,5-Dichloro-l-oxido-pyridin-4- PDE 4 Merck Frosst U.S. Pat. No. 6,448,274 yl)-4-difluoromethoxy-3- inhibitor Canada & Co.
cyclopropylmeth-oxybenzamide i
C38 Thiazolyl-acid amide derivatives PDE 4 Pfizer, Inc. U.S. Pat. No. 6,559,168 inhibitors ( ' Attorney Docket No. 104244-0001-WOl Express MaU Air BLU: EV 970403955 US Date of Deposit: 29 March 2007
C39 Novel compounds PDE 4 SmithKline U.S. Pat. No. 5,552,438 inhibitors Beecham Corporation
C40 Cyclohexene-ylidene derivatives inhibitors of SmithKline U.S. Pat. No. 5,605,923 TNF Beecham production Corporation and PDE 4
C41 2,3-disubstituted pyridine derivatives PDE 4 Dainippon U.S. Pat. No. 6,555,557 inhibitors Pharmaceu¬
OO tical Co., Ltd.
C42 Phenanthπdine-N-oxides PDE 4 Altana U.S. Pat. Nos. 6,538,005; 6,534,519 inhibitors Pharma AG
C43 Polysubstituted 6- PDE 4 Altana U.S. Pat. No. 5,534,518 phenylphenanthridines inhibitors Pharma AG
C44 PDE IV inhibiting amides PDE 4 Merck Frosst U.S. Pat. No. 6,436,965
inhibitors Canada & Co. i
C45 Aryl thiophene derivatives PDE 4 Merck & Co., U.S. Pat. No. 6,034,089 inhibitors Inc. ' Attorney Docket No. 104244-0001-WOl Express Mail Air BUl: EV 970403955 US Date of Deposit: 29 March 2007
C46 Aryl fUran derivatives PDE 4 Merck & Co, U.S. Pat. No. 6,020,339 inhibitors Inc.
C47 Amides and Imides PDE 3 and Celgene Corp. U.S. Pat. Nos. 6,518,281; 6,180,644; 5,968,945; PDE 4 5,728,845; 5,703,098 inhibitors
C48 Substituted 1,3,4-oxadiazoles PDE 3 and Celgene Corp. U.S. Pat. No. 6,326,388 PDE 4 inhibitors
C49 Cyano and carboxy derivatives of PDE 3 and Celgene Corp. U.S. Pat. Nos. 6,479,554; 6,262,101; 6,130,226;
substituted styrenes inhibitors PDE 4 5,929,1 17
C50 Substituted phenethylsulfones PDE 4 Celgene Corp. U.S. Pat. Nos. 6,020,358; 6,01 1,050 inhibitors
C51 Nitriles PDE 3 and Celgene Corp. U.S. Pat. No. 5,728,844 PDE 4
inhibitors
C52 Succinimide and maleimide cytokine PDE 3 and Celgene Corp. U.S. Pat. No. 5,658,940 i inhibitors PDE 4 inhibitors ' Attorney Docket No. 104244-0001-WOl Express Mail Air Bill: EV 970403955 US Date of Deposit: 29 March 2007
C53 Nicotinamide benzofused-heterocyclyl PDE4 Pfizer, Inc. U.S. Published Application No. 20030186989 derivatives inhibitors
C54 Ether derivatives PDE4 Pfizer, Inc U.S. Published application No. 20030027845 inhibitors
U l O
i
( ' In some embodiments, the cAMP-specific PDE 4 inhibitor comprises at least one compound chosen from roflumilast, cilomilast, etazolate hydrochloride, Ro 20- 1724, rolipram, (R)-(-)-rolipram, (S)-(+)-rolipram, zardaverine, V 11294A, CDP840, denbufylline, mesopram, cipamfylline, SCH 351591, SCH 365351, L-791,943, 7- benzylamino-6-chloro-2-piperazino-4-pyrrolidino-pteridine, piclamilast, NVP- ABE171, YM976, KF19514, arofylline, XT-44, T-440, atizoram, tibenelast, D- 4418, ICI 63,197, Cl 1018, D-22888, N-(3,5-dichloropyridin-4-yl)-2-[l-(4- fluorobenzyl)-5-hydroxyindol-3-yl]-2-oxoacetamide, l,2,4-triazolo(4,3- b)pyrido(3,2-d)pyridazine derivatives, diazepinoindoles, heterosubstituted pyridine derivatives, hydroxyindoles, N-(3,5-Dichloro-l-oxido-pyridin-4-yl)-4- difluoromethoxy-3-cyclopropylmeth-oxybenzamide, thiazolyl-acid amide derivatives, novel compound, cyclohexene-ylidene derivatives, 2,3-disubstituted pyridine derivatives, phenanthridine-N-oxides, polysubstituted 6- phenylphenanthridines, PDE 4 inhibiting amides, aryl thiophene derivatives, aryl furan derivatives, amides and imides, substituted 1,3,4-oxadiazoles, cyano and carboxy derivatives of substituted styrenes, substituted phenethylsulfones, nitriles, succinimide and maleimide cytokine inhibitors, nicotinamide benzofused- heterocyclyl derivatives, ether derivatives, salts thereof, isomers thereof, prodrugs thereof, and combinations of two or more thereof. In some embodiments, the cAMP- specific PDE 4 inhibitor comprises the PDE 4 inhibitor, roflumilast, rolipram, ICI 63,197, Ro 20-1724 or combinations of two or more thereof.
Other cAMP-specific phosphodiesterase inhibitors are known in the art, see, for example, U.S. Pat. Nos. 5,665,754; 5,891,904; 6,348,602, and US 2005-0187278 Al (incorporated herein by reference).
Similarly, variants or derivatives of any of the above-listed compounds may be effective as cAMP agonists in the subject method. Those skilled in the art will readily be able to synthesize and test such derivatives for suitable activity.
In certain embodiments, the subject cAMP agonists can be chosen on the basis of their selectivity for cAMP activation.
In certain embodiments, it may be advantageous to administer two or more of the above cAMP agonists, preferably of different types. For example, use of an adenylate cyclase agonist (such as the adenylate cyclase agonist forskolin or derivatives thereof) in conjunction with a cAMP phosphodiesterase antagonist (such as rolipram, an inhibitor for the Type 4 cAMP-specific phosphodiesterase or PDE4, or rolipram derivatives) have an advantageous or synergistic effect, which is more prominent than the additive effect of using either agonist alone.
h certain preferred embodiments, the subject agents induce melanogenesis µ with an ED50 of 1 mM or less, more preferably of 1 M or less, and even more preferably of 10 nM or less.
In still other embodiments, the McIr agonist is a ligand for a G protein coupled receptors (GPCR) that is expressed by melanocytes, and which induces a cAMP-dependent intracellular signal upon binding the ligand. To illustrate, the McIr agonist can be a β-Adrenergic receptor agonists (sometimes referred to herein as "β-adrenergic agonists"), such as albuterol, bambuterol, bitolterol, carbuterol, clenbuterol, clorprenaline, denopamine, dioxethedrine, dopexamine, ephedrine, epinephrine, etafedrine, ethylnorepinephrine, fenoterol, formoterol, hexoprenaline, ibopamine, isoetharine, isoproterenol, mabuterol, metaproterenol, methoxyphenamine, norepinephrine, orciprenlaine, oxyfedrine, pirbuterol, prenalterol, procaterol, propranolol, protokylol, quinterenol, reproterol, rimiterol, ritodrine, salmefamol, soterenol, salmeterol, terbutaline, tretoquinol, tulobuterol, and xamoterol.
B. Examples of McIr antagonist In the case of McIr antagonists, McIr pathway can be antagonized by inhibiting the cAMP pathway, e.g., by using an agonist of cAMP phosphodiesterase, or by using an antagonist of adenylate cyclase, cAMP or protein kinase A (PKA). Compounds which may reduce the levels or activity of cAMP include cholera toxin, prostaglandylinositol cyclic phosphate (cyclic PIP), endothelins (ET)-I and -3, norepinepurine, K252a, dideoxyadenosine, dynorphins, melatonin, pertussis toxin, staurosporine, Gi agonists, MDL 12330A, SQ 22536, GDPssS and clonidine, beta- blockers, and ligands of G-protein coupled receptors. Additional compounds are disclosed in U.S. Patent Nos. 5,891,875, 5,260,210, and 5,795,756 (incorporated herein by reference). As above, the subject cAMP antagonists can be chosen on the basis of their selectivity for cAMP-mediated pathways, such as selectivity in antagonism of cAMP-mediated pathways relative to pathways regulated by other cyclic nucleotides and/or selectivity for particular cAMP-dependent enzymes or even isoforms of those enzymes.
A variety of PKA inhibitors are known in the art, including both peptidyl and organic compounds. For instance, the McIr agonist can be a 5- isoquinolinesulfonamide, such as represented in the general formula:
wherein,
R4 and R5 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH2)m-R8, -(CH2)m-OH, -(CH2)m-O- lower alkyl, -(CH2)m-O-lower alkenyl, -(CH2)o-O-(CH2)m-R8, -(CH2)m-SH, -(CH2)m-
S-lower alkyl, -(CH2)m-S-lower alkenyl, -(CH2)n-S-(CH2)m-R8, or
R4 and R5 taken together with N to which they are attached form a heterocycle (substituted or unsubstituted);
R 3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamide, -(CH2)m-R8 -(CH2)m-OH, -(CH2)m-O- lower alkyl, -(CH2)m-O-lower alkenyl, -(CH2)n-O-(CH2)m-R8, -(CH2)m-SH, -(CH2)m-
S-lower alkyl, -(CH2)m-S-lower alkenyl, -(CH2)n-S-(CH2)m-Rg; R represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and
o and m are independently for each occurrence zero or an integer in the range of 1 - 6.
To further illustrate, the PKA inhibitor can be N-[2-((p- bromocinnamyl)amino)ethyl]-5-isoquinolinesulfonamide (H-89; Calbiochem Cat. No. 371963), e.g., having the formula:
In another embodiment, the PKA inhibitor is l-(5-isoquinolinesulfonyl)-2- methylpiperazine (H-7; Calbiochem Cat. No. 371955), e.g., having the formula:
In still other embodiments, the PKA inhibitor is KT5720 (Calbiochem Cat. No. 4203 15), having the structure In certain embodiments, a compound which is an agonist or antagonist of PKA is chosen to be selective for PKA over other protein kinases, such as PKC, e.g., the compound modulates the activity of PKA at least an order of magnitude more strongly than it modulates the activity of another protein kinase, preferably at least two orders of magnitude more strongly, even more preferably at least three orders of magnitude more strongly. Thus, for example, a preferred inhibitor of PKA may inhibit PKA activity with a K at least an order of magnitude lower than its K for inhibition of PKC, preferably at least two orders of magnitude lower, even more preferably at least three orders of magnitude lower. In certain embodiments, the McIr antagonist inhibits PKC with a K greater than 1 µM, greater than 100 nM, preferably greater than 10 nM.
C. Delivery Systems It is well known that the skin is an effective barrier to penetration to many chemical agents. The epidermis of the skin has an exterior layer of dead cells called the stratum comeum which is tightly compacted and oily and which provides an effective barrier against gaseous, solid or liquid chemical agents, whether used alone or in water or oil solutions. If an agent penetrates the stratum corneum, it can readily pass through the basal layer of the epidermis and into the dermis. If the agent is harmful, e.g., a toxic chemical, penetration of the stratum corneum is an event to be prevented.
Although the effectiveness of the stratum corneum as a barrier provides great protection, it can also frustrates efforts to apply beneficial agents directly to local areas of the body. The inability of physiologically active agents to penetrate the stratum corneum has resulted in a great deal of research on penetration-enhancing agents for the skin. See for example U.S. Pat. Nos. 3,989,815; 3,989,816; 3,991,203; 4,122,170; 4,316,893; 4,405,616; 4,415,563; 4,423,040; 4,424,210; and 4,444,762.
That being said, various delivery systems suitable for use in the present invention are known to those of skill in the art and can be used to deliver effective amounts of McIr agents, to increase or decrease pigmentation in melanocytes. In general, any formulation that can penetrate the skin barrier (stratum corneum) so that the McJr agent can contact melanocytes in the skin is preferred. For example, encapsulation in liposomes, or microcapsules are examples of delivery systems that can be used. In addition, the compositions of the invention may be formulated in various solvents, gels, creams, lotions or solutions to facilitate simple application to the skin and/or hair follicles. Aerosolized compositions, comprising a suspension of very fine particles of a solid or droplets of a liquid in a gaseous medium, may also be utilized to deliver effective amounts of the McIr agent. The suspension is stored under high pressure and released in the form of a fine spray or foam and can be applied directly to the skin or hair.
Liposomes In a certain embodiments, a liposome preparation can be used. The liposome preparation can be comprised of any liposome which penetrates the stratum corneum and fuses with the cell membrane of melanocytes, resulting in delivery of the contents of the liposome into the cell. Liposomes can be prepared by methods well- known to those of skill in the art. For example, liposomes such as those described in U.S. Pat. No. 5,077,21 1; U.S. Pat. No. 4,621,103; U.S. Pat. No. 4,880,635 or U.S. Pat. No. 5,147,652 can be used. See also Yarosh, D., et al., J. Invest. Dermatol., 103(4): 461-468 (1994) or Caplen, N. J., et al., Nature Med., 1(1): 39-46 (1995).
The liposomes can. specifically target the appropriate cells e.g. epidermal melanocytes). In a preferred embodiment of the invention, the liposomal composition is applied directly to the skin or hair of a mammal, in the area where decreased pigmentation is desired.
Lotions and creams according to the present invention generally comprise a solution carrier system and one or more emollients. Lotions typically comprise from about 1% to about 20%, preferably from about 5% to about 20%, of emollient; from about 50% to about 90%, preferably from about 60% to about 80%, water; and a pharmaceutically effective amount of an agent described herein.
Liposomes (lipid vesicles) may also prove useful as a solvent for the McIr agent, or as a means of encapsulating the McIr agent, or as a means of complexing with the McIr agents. Liposomes are aqueous compartments enclosed by a lipid bilayer. They are produced by techniques well known to those skilled in the art. For example, liposomes can be produced by suspending a suitable lipid, such as phosphatidyl choline, in an aqueous medium. This mixture is then sonicated to give a dispersion of closed vesicles that are quite uniform in size. Among the useful liposomes are stratum corneum lipid liposomes formed from epidermal ceramides, cholesterol, palmitic acid and cholesterol sulfate, such as described in Abraham et al, 1999. Journal Invest Derma, 259-262.
Many lipids are believed suitable for use in making the liposomes, many of which are commercially available, e.g. Liposome Kit is available from Sigma Chemical Company, St. Louis, Missouri under catalog number L-4262. Liposome Kit L-4262 contains Lalpha-phosphatidylcholine (egg yolk), dicetyl phosphate and cholesterol. It is a negatively charged lipsome mixture, another suitable negatively charged liposome mixture available from Sigma Chemcial Company is L-4012 which contains L- alphaphosphatidylcho line, dicetyl phosphate and cholesterol. Suitable positively charged liposome mixtures available from Sigma Chemical Company contains L-alpha-phosphatidyl choline, stearylamine and cholesterol (catalog numbers L-4137 and L-3887).
Categories of lipids in suitable liposomes are phospholipids, glycosphingolipids, ceramides, cholesterol sulfate and neutral lipids. Various combinations of these lipids are found in neonatal mouse, pig and human stratum granulosurn and stratum corneum. Other categories of lipids which can be used to make the liposomes are straight chain fatty acids, glycerol esters, glycerides, phosphoglycerides, sphingolipids, waxes, terpenes and steroids. Specific preferred lipids suitable for use are phosphatidyl choline, dicetyl phosphate and cholesterol.
The liposomes may simply be used as the solvent for the McIr agents —i.e., after the liposomes are produced and isolated the McIr agents is added to the liposomes. The McIr agents may also be encapsulated in (or trapped in) the compartment portion of the liposome. This can be done by adding an aqueous solution of McIr Agents to a suitable lipid and mixing {e.g., sonicating) to produce the liposomes containing the McIr agents. To make the aqueous solution of the McIr agents it may be desirable, as discussed above, to add additional water soluble components (e.g. alcohols, acetone, and the like) to increase the solubility of the McIr agents in the aqueous solution or to help maintain the McIr agents in the aqueous solution. The McIr agents may also be added directly to a suitable lipid and mixed therewith so that there is a blend of McIr agents and lipid. Then when an aqueous solution is added to this blend and sonicated to produce the liposomes, the McIr agents will be in the lipid layer of the liposome and not the compartment of the liposome.
The liposome (as solvent) and McIr agent composition or the liposomes (MC Activator in compartment or lipid layer) can then be combined with a suitable topical vehicle, e.g. a lotion, -gel or cream vehicle.
The lipid mixture which forms the liposome can be any of the conventional mixtures available or discussed in the literature which are pharmaceutically and cosmetically acceptable.
Preferred lipid mixtures contain a phosphatidyl choline, dicetyl phosphate and cholesterol. The lipid mixtures which form the liposomes are commercially available in a solvent such as ethanol -or chloroform. A typical mixture contains on a weight basis, seven parts phosphatidylcholine, 2 parts dicetyl phosphate and one part cholesterol.
Although topical or oral delivery would seem the most practical, for some human subjects who are extremely light sensitive due to treatment with various prescription medicines (e.g. tetracycline) or who are afflicted with certain medical conditions (e.g. burn patients) or genetic disorders (e.g. xeroderma pigmentosum), it is conceivably advantageous to deliver the composition systemically by means of intravenous, subcutaneous or intramuscular routes.
Organogels In one embodiment, the McIr agent is a composition for diffusional transdermal delivery of medication to a patient, which comprises the McIr agent that it may be applied topically and conform to and adhere to the patient's skin for a period of time sufficient for a significant portion of the medication to be delivered transdermally to the patient. The basic composition of this embodiment is a mixture of an organogel, a solubilized McIr agent and a carrier combined with a drug release agent. Penetration enhancement is provided by the organogel and by the release agent.
In the exemplary process, an organogel can be formed from lecithin and isopropyl palmitate. These two materials are thoroughly blended and mixed until a substantially uniform gel structure forms. The organogel, which is the base for the cream composition, can be formed at the time that the composition is to be formulated. The drug or medication is solubilized with a solvent, such as water, alcohol or other appropriate solvent, again by mixing in a known manner. When it is desired to start formation of the actual composition, the solubilized McIr agent is mixed thoroughly into the organogel matrix, again by conventional mixing techniques. The technique used will of course be such that the organogels structure is not broken down. Finally, a carrier, such as water or alcohol, and a drug release agent, such as a polyoxymer, are blended. The carrier/release agent mixture can be made up in large lots and stored under refrigerator until needed, at which time an appropriate quantity can be taken for and the remainder retained in refrigerated storage. The carrier/release agent mixture is then mixed with the drug/organogel mixture to produce the final "cream" composition.
Considering first the organogel, the blend of the two components will typically be in the range of from about 25% to 75% (by weight) of the lecithin component, the remainder being the fatty acid ester component. The "lecithin component" may be lecithin, any comparable fatty acid phospholipid emulsifying agent, such as fatty acids and their esters, cholesterol, tri-glycerides, gelatin, acacia, soybean oil, rapeseed oil, cottonseed oil, waxes or egg yolk, or any other material which acts in the same manner as lecithin.
The other component is an organic solvent/emollient, particularly including fatty acid esters, of which the esters of the saturated alkyl acids are preferred. The preferred solvent/emollient is isopropyl palmitate or isopropyl myristate. However, there are numerous compounds available which exist in liquid form at ambient temperatures and will function in a manner equivalent to the fatty acid esters. These are all quite well known and include, but are not limited to the following: Ethanol, Propylene glycol, Water, Sodium oleate, Leucinic acid, Oleic acid, Capric acid, Sodium caprate, Laurie acid, Sodium laurate, Neodecanoic acid, Dodecylamine, Cetyl lactate, Myristyl lactate, Lauryl lactate, Methyl laurate, Phenyl ethanol, Hexamthhylene lauramide, Urea and derivatives, Dodecyl n,n-dimethylamino acetate, Hydroxyethyl lactamide, Phyophatidylcholine, Sefsol-318 (a medium chain glyceride), Isopropyl myristate, Isopropyl palmitate, Surfactants (including): polyoxyethylene (10) lauryl ether, diethyleneglycol lauryl ether, Laurocapram (azone), Acetonitrile, 1-decanol, 2-pyrrolidone, N-methylpyrrolidone, N-ethyl-1- pyrrolidone, 1-methyl-2-pyrrolidone, 1-lauryl-2-pyττolidone, Sucrose monooleate, Dimethylsulfoxide, Decylmethylsulfoxide, Acetone, Polyethylene glycol (100-400 mw), Dimethylacetamide, Dimethylformamide, Dimethylisosorbide, Sodium bicarbonate, Various C to C 6 alkanes, Mentane, Menthone, Menthol, Terpinene, D- teφ inene, Dipentene, N-nonalol, Limonene, Ethoxy diglycol.
This combination of the phospholipid emulsifying agent and the fatty acid or fatty acid ester or equivalent thereof forms an organogel. For the example, the organogel can be a lecithin organogel, which is both isotropic and thermally reversible. At temperatures greater than about 400C the organogel will become a liquid and its viscosity will be greatly reduced. Water can be also be added to control the viscosity of the organogel. The organogel serves as one of the penetration enhancers in the cream, and acts on the stratum corneum of the skin to promote interaction between the phospholipids of the cream and the phospholipids of the skin. This causes a disruption in the normal regular arrangement of layers in lipids in the stratum corneum so that openings are created which then allow the drug to pass more easily through the skin. The organogel will be compatible with a wide variety of lipophilic, hydrophilic and amphoteric drugs and medications.
Using the above-described lecithin organogel and its components as an example, the properties needed for inclusion of an McIr agent will be evident to those skilled in the art. The various compounds, polymers, etc. comprising the organogel, the solubilized drug and the carrier/polyoxymer components must all be compatible with each other, so that chemical reactions do not occur which would adversely affect the efficacy or safety of the cream composition; they must be mutually soluble so that they can be mixed and blended to a uniform consistency; they must be such that the resulting cream composition has a viscosity under ambient conditions which is low enough to allow it to be applied easily and smoothly to the skin, but not so low that the cream acts as at least in part like a liquid and cannot be retained on the skin where it is applied; they must not be toxic, irritating or otherwise harmful to the patient; they must be sufficiently stable that the overall composition will have a reasonable shelf life and service life; and, as a practical matter, they must be available at reasonable cost.
The McIr agent to be administered may need to be solubilized in a solvent to enable it be blended properly with the organogel and the carrier/release agent. Typical solvents for such use include water, the low molecular weight alcohols and other low molecular weight organic solvents. Solvents such as water, methanol, ethanol and the like are preferred. The purpose of solubilizing is to enable the McIr agent to become properly dispersed in the final cream. It is possible that a few drugs or medications might themselves be sufficiently soluble in the cream that a solvent, and therefore a separate solubilizing step, would not be needed. For the purpose of this description, therefore, the term "solubilized" drug or medication shall be considered to include those drugs or medications which can be dispersed or dissolved into the cream with or without the presence of a separate solvent. Usually the amount each of medication and solvent which will be present, based on the entire composition, will be in the range of up to Humectants The compositions of this invention may also be formed by combining the McIr agent with effective- amounts of water and a humectant. These compositions are predominantly water with enough humectant added to form a cosolvent mixture that will dissolve the McIr agent. These compositions the humectant will generally be present in amounts of about 1 to about 7% by weight of the total composition with about 4 to about 5% being preferred. The balance of the composition is water such that the total amount of ingredients (water, humectant, and McIr agent equals 100% by weight. Thus, such compositions may contain water in amounts of about 9 1 to about 98. 95% by weight of the total compositions- with about 9 1 to about 98.9% being suitable. Humectants well known in the art may be used. Examples of hurnectants include propylene glycol, sorbitol, and glycerin. Other suitable hurnectants may include fructose, glucose, glutamic acid, honey, maltitol, methyl gluceth-10, methyl gluceth-20, sodium lactate, sucrose, and the like. Non-ionic surfactants Moreover, the inclusion of the non-ionic surfactant in the composition of this invention produces a more uniform skin tan rather than spotty tans produced by using tanning compositions which do not contain such non-ionic surfactants. The non-ionic surfactant which is particularly well suited in the practice of this invention is polyoxyethylene 4 lauryl ether which is available from ICI Americas, Inc., Wilmington, Delaware, and is sold under the trade name BRIJ 30. This surfactant is also referred to as laureth-4, which is its CTFA (Cosmetic Toiletry and Frangrance Association) adopted name. Other non-ionic surfactants of this type which can be used in this invention include polyoxyethylene 4 lauryl ether containing 0.01% butylated hydroxy anisole (BHA) and 0.005% citric acid as preservatives. This surfactant is also available from ICI Americas, Inc. and is also known by its CTFA adopted name of Laureth-4 and sold under the trade name BRIJ 30 SP. Still other non-ionic surfactants which are suitable in the compositions of this invention are: polyoxyethylene 23 lauryl ether, known by its CTFA adopted name of Laureth-23 (trade name BRIJ 35); polyoxyethylene 23 lauryl ether containing 0.01% BHA and 0.005% citric acid, known by its CTFA adopted name of Laureth-23 (trade name BRIJ 35 SP); polyoxyethylene 2 cetyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA adopted name of Ceteth-2 (trade name BRIJ 52); polyoxyethylene 10 cetyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA and adopted name of Ceteth-10 (trade name BRIJ 56); polyoxyethylene 20 cetyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA adopted name of Ceteth-20 (trade name BRIJ 58); polyoxyethylene 2 stearyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA name of Steareth-2 (trade name BRIJ 72); polyoxyethylene 10 stearyl ether with 0.001% BHA and 0.005% citric acid, known by its CTFA name of Steareth-10 (trade name BRIJ 76); polyoxyethylene-2 oleyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA name of Oleth-2 (trade name BRIJ 92); polyoxyethylene-2 oleyl ether (low color and odor) with 0.01% BHA and 0.005% citric acid, known by its CTFA name of Oleth-2 (trade name BRIJ 93); polyoxyethylene 10 oleyl ether with 0.01% BHA and 0.005% citric acid, known by its CTFA name of Oleth-10 (trade name BRIJ 96) and polyoxyethylene 10 Oleth ether (low color and odor) with 0.01% BHA and 0.005% citric acid, known by its CTFA name of Oleth-10 (trade name BRIJ 97). The aforementioned non-ionic surfactants may be generally referred to as polyoxyethylene alkyl ethers and may be used alone or in admixture with one another. Another type of non-ionic surfactants which may be used in the present invention is polyoxyethylene 20 sorbitan monolaurate, known by its CTFA name of Polysorbate-20 (trade name TWEEN 20) and polyoxyethylene 4 sorbitan monolaurate, known by its CTFA name of Polysorbitan-21 (trade name TWEEN 21), and other such polyoxyethylene derivatives of sorbitan fatty acid esters. Other types of non-ionic surfactants which may be used in the composition of this invention are sorbitan fatty acid esters which include sorbitan monolaurate, known by its CTFA adopted name of Sorbitan Laurate (trade name ARLACEL 20); sorbitan monopalmitate, known by its CTFA adopted name of Sorbitan Palmitate (trade name ARLACEL 40); sorbitan monostearate, known by its CTFA adopted name of Sorbitan Stearate (trade name ARLACEL 60); sorbitan monooleate, known by its CTFA adopted name of Sorbitan Oleate (trade name ARLACEL 80); sorbitan sesquioleate, known by its CTFA adopted name of Sorbitan Sesquioleate (available under the trade names ARLACEL 83 and ARLACEL C); sorbitan trioleate, known by its CTFA adopted name of Sorbitan Trioleate (trade name ARLACEL 85); glycerol monstearate and polyoxyethylene stearate, known by its CTFA adopted name of Glycerl Stearate and PEG-100 Stearate (trade name ARLACEL 165); and glycerol monoleate diluted with propylene glycol and containing 0.02% BHA and 0.01% citric acid added as preservatives, known by its CTFA adopted name of Glycerl Oleate and Propylene Glycol (trade name ARLACEL 186). Bioadhesives Absorption of McIr agents and contact with melanocytes may be further improved by the use of bioadhesive polymers. In some embodiments, bioadhesive polymers may be included in the formulations of the invention to improve transport and retention of drug microparticles and nanoparticles. In general terms, adhesion of polymers to epithelial tissues may be achieved by (i) physical or mechanical bonds, (ii) primary or covalent chemical bonds, and/or (iii) secondary chemical bonds (e.g., ionic). Secondary chemical bonds, contributing to bioadhesive properties, include dispersive interactions (e.g., Van der Waals interactions) and stronger specific interactions, which include hydrogen bonds. The hydrophilic functional groups responsible for forming hydrogen bonds are the hydroxyl (-OH) and the carboxylic acid groups (-COOH). As used herein "bioadhesion" generally refers to the ability of a material to adhere to a biological surface, such as skin or hair, for an extended period of time. Bioadhesion requires contact between a bioadhesive material and a surface (e.g., tissue and/or cells). Thus the amount of bioadhesive force is affected by both the nature of the bioadhesive material, such as a polymer, and the nature of the surrounding medium. Suitable polymers include polylactic acid (2 kDa MW, types SE and HM), polystyrene, poly(bis carboxy phenoxy propane-co-sebacic anhydride) (20:80) (poly (CCP:SA)), alginate (freshly prepared); and poly(fumaric anhydride- co-sebacic anhydride (20:80) (p(FA:SA)), types A (containing sudan red dye) and B (undyed). Other high-adhesion polymers include p(FA:SA) (50:50) and non-water- soluble polyacrylates and polyacrylamides. Suitable polymers that are bioadhesive include soluble and insoluble, nonbiodegradable and biodegradable polymers. These can be hydrogels or thermoplastics, homopolymers, copolymers or blends, natural or synthetic. Two classes of polymers that may be useful bioadhesive properties are hydrophilic polymers and hydrogels. In the large class of hydrophilic polymers, those containing carboxylic groups (e.g., poly(acrylic acid)) exhibit the best bioadhesive properties, and therefore polymers with the highest concentrations of carboxylic groups should be the materials of choice for bioadhesion on soft tissues. Among polymers known to provide good results are sodium alginate, carboxymethylcellulose, hydroxymethylcellulose and methylcellulose. Some of these materials are water-soluble, while others are hydrogels. Rapidly bioerodible polymers such as poly(lactide-co-glycolide), polyanhydrides, and polyorthoesters, having carboxylic groups exposed on the external surface as their smooth surface as they erode, are also excellent bioadhesive polymers. Representative natural polymers include proteins, such as zein, modified zein, casein, gelatin, gluten, serum albumin, or collagen, and polysaccharides, such as cellulose, dextrans, polyhyaluronic acid, polymers of acrylic and methacrylic esters and alginic acid. Representative synthetic polymers include polyphosphazines, poly(vinyl alcohols), polyamides, polycarbonates, polyalkylenes, polyacrylamides, polyalkylene glycols (e.g., polyethylene glycol (PEG)), polyalkylene oxides, polyalkylene terephthalates, polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyvinylpyrrolidone (PVP), polyglycolides, polysiloxanes, polyurethanes and copolymers thereof. Representative synthetically modified natural polymers include alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, and nitrocelluloses. Specific polymers include, but are not limited to, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose (HPMC), hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxymethyl cellulose, cellulose triacetate, cellulose sulfate sodium salt, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) polyethylene, polypropylene, poly(ethylene glycol), poly(ethylene oxide), poly (ethylene terephthalate), poly(vinyl acetate), polyvinyl chloride, polystyrene, polyvinyl pyrrolidone, polyvinylphenol, poly(butic acid), poly(valeric acid), poly(lactide-co-caprolactone), poly(lactide-co-glycolide), polyanhydrides, polyorthoesters, blends and copolymers thereof. These polymers can be obtained from sources such as Sigma Chemical Co., St. Louis, MO., Polysciences, Warrenton, PA, Aldrich, Milwaukee, WI, Fluka, Ronkonkoma, NY, and BioRad, Richmond, CA or synthesized from monomers obtained from these suppliers using standard techniques. Polyanhydrides are an example of a mucoadhesive polymer. Suitable polyanhydrides include polyadipic anhydride, polyfumaric anhydride, polysebacic anhydride, polymaleic anhydride, polymalic anhydride, polyphthalic anhydride, polyisophthalic anhydride, polyaspartic anhydride, polyterephthalic anhydride, polyisophthalic anhydride, poly carboxyphenoxypropane anhydride and copolymers with other polyanhydrides at different mole ratios. Chitosan Microencapsulation can be particularly useful to deliver McIr agents that might otherwise cause local irritation. Various commercial microcapsules and nanocapsules are available which differ in the type of polymers used to make the capsule wall such as Hallcrest Microcapsules (gelatin, gum arabic), Coletica Thalaspheres (collagen), Lipotec Millicapsules (alginic acid, agar), Induchem Unispheres (lactose, microcrystalline cellulose, hydroxypropyl-methylcellulose), Kobo Glycospheres (modified starch, fatty acid esters, phospholipids) and Softspheres (modified agar). Chitosan is a natural, biodegradable cationic polysaccharide that can be used for topical formulation of McIr agents. It is derived by deacetylating chitin, a natural material extracted from fungi, the exoskeletons of shellfish and from algae and has previously been described as a promoter of wound healing [Balassa, U.S. Pat. No. 3,632,754 (1972); Balassa, U.S. Pat. No. 3,911,1 16 (1975)]. Chitosan comprises a family of polymers with a high percentage of glucosamine (normally 70-99%) and N-acetylated glucosamine (1-30%) forming a linear saccharide chain of molecular weight from 10,000 up to about 1000,000 Dalton. Chitosan, through its cationic glucosamine groups, interacts with anionic proteins such as keratin in the skin conferring some bioadhesive characteristics. In addition, when not deacetylated, the acetamino groups of chitosan are an interesting target for hydrophobic interactions and contribute to some degree to its bioadhesive characteristics [(Muzzarelli et al., In: Chitin and Chitinases Jolles P and Muzzarelli RAA (eds), Birkhauser Verlag Publ., Basel, Switzerland, pp.251-264 (1999)]. In certain embodiments, a high viscosity chitosan is first mixed in the presence of the McIr agents dispersed in a suitable solvent to form a matrix, this matrix can then be precipitated under vigorous stirring conditions in the presence of anionic polymers and at higher pH values to form nano and micron size particles that can penetrate the stratum corneum or outer skin layer. This preparation of chitosan-based particles avoids the use of surfactants or emulsifiers which can cause skin irritation or other adverse reactions. These chitosan formulations can provide such advantages as preferable tissue distribution of the drug, prolonged half life, controlled drug release and reduction of drug toxicity. In certain preferred embodiments, chitosan particles can be used for the topical delivery of water insoluble McIr agents, where the sustained release of the drug is obtained by precipitating the chitosan/active agent matrix in the presence of anionic polymers at pH conditions greater than 6.0 under vigorous stirring conditions. In addition, the chitosan microparticles disclosed in the present invention are able to act as delivery vehicles without leaving polymeric residues on the skin. The absence of residues may be due to the bioadhesiveness of chitosan to the skin surface as mentioned earlier which allows for greater penetration into the stratum corneum or the outer layer of the skin. The term "high viscosity" chitosan refers to a chitosan biopolymer having an apparent viscosity of at least about 100 cps for 1% solutions in 1% acetic acid as measured using a Brookfield LVT viscometer at 25C with appropriate spindle at 30 rpm. The viscosity of the chitosan solution can readily be determined by one of ordinary skill in the art, e.g., by the methods described in Li et al., Rheological Properties of aqueous suspensions of chitin crystallites. J Colloid Interface Sc 183:365-373, 1996. In addition, viscosity can be estimated according to Philipofs equation: V=(I +KC)8, where V is the viscosity in cps, K is a constant, C is the concentration expressed as a fraction (Form No. 198-1029-997GW, Dow Chemical Company). In certain embodiments, the high viscosity chitosan preferably has a viscosity greater than at least 100 cps, and more preferably greater than at least 500 cps. The term "dispersing agent" as used herein comprises any suitable solvent that will sohibilize or suspend the water insoluble or slightly water soluble active agent but does not chemically react with either chitosan or the active substance. Examples include soybean oil, dibutyl hexanedioate, cocoglycerides, aliphatic or aromatic esters having 2-30 carbon atoms (e.g. cococaprylate/caprate), coconut oil, olive oil, safflower oil, cotton seed oil, alkyl, aryl, or cyclic ethers having 2-30 carbon atoms, cycloaliphatic or aromatic hydrocarbons having 4-30 carbon atoms, alkyl or aryl halides having 1-30 carbon atoms. The term "anionic polymer" refers to negatively charged polymers which can form a complex with chitosan such as poly(acrylic acid) and derivatives, xanthan gum, sodium alginate, gum arabic, carboxy methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, carrageenan, polyvinyl alcohol, sulfated glycosaminoglycans such as chondroitin sulfate and dermatan sulfate. D. Other Ingredients The subject McIr agents can be formulated with sunscrccning agents, such as UVA type, UVB type, or a combination of both. Generally, the sunscreening agents are used in amounts effective to provide the desired level of protection against UVA and/or UVB radiation. The sunscreening agents are used in amounts of, for example, about 2% to about 20% by weight of the total composition. Typical UVB type sunscreening agents include substituted para-aminobenzoates, alkyl esters of paramethoxycinnamate and certain esters of salicylic acid. Typical UVA type sunscreening agents include certain benzophenones and dibenzoyl methanes. Representative UVB type sunscreening agents include but are not limited to: (A) IDEA Methoxyinnamate (diethanolamine salt of p-methoxy hydro cinnamate), e.g., tradename BERNEL HYDRO from Bemel Chemical Co., Inc.; (B) Ethyl Dihydroxypropyl PABA (ethyl dihydroxypropyl p-aminobenzoate), e. g., tradename AMERSCREEN P from Amerchol Corp.; (C) Glyceryl PABA (glyceryi-p- aminobenzoate), e.g., tradename NIPA G.M.P.A. from NIPA Laboratories, Inc.; (D) Homosalate (Homomenthyl salicylate), e.g., tradename KEMESTER HMS from Humko Chemical; (E) Octocrylene, (2-ethylhexyl- 2-cyano-3,3diphenylacrylate), e.g., tradename UVINUL N-539 from BASF Chemical Co.; (F) Octyl Dimethyl PABA (Octyl dimethyl paminobenzoate, 2-ethylhexyl pdimethylaminobenzoate, Padimate 0), e.g., tradenames AMERSCOL, ARLATONE UVB, and ESCALOL 507 from Amerchol Corp., ICI Americas, Inc., and Van Dyk, respectively; (G) Octyl Methoxycinnamate (2-ethylhexyl- pmethoxycinnamate), e.g., tradename PARSOL MCX from Bernel Chemical Co. Inc., or Givaudan Corp.; (H) Octyl Salicylate (2- ethylhexy salicylate), e. g., tradename SUNAROME WMO from Felton Worldwide, Inc.; (1) PABA (P-amino benzoic acid), e.g., tradename PABA from EM Industries, Inc. and National Starch & Chemical Corp., or tradename NIPA PABA from NIPA Laboratories Inc.; (J) 2-Phenyl-benzimidazole-5-Sulphonic acid (Novantisol), e.g., tradename EUSOLEX 232 and -NEO-HELIOPAN HYDRO from EM Industries, Inc. and Haarmann & Reimer Corp., respectively; (K) TEA Salicylate (triethanolamine salicylate), e.g., tradenames SUNAROME W and SUNAROME G from Felton Worldwide, Inc.; (L) 3-(4-methylbenzlidene)camphor or 3- (4methylbenzylidene)boran-2-one, e.g., tradename EUSOLEX 6300 from EM Industries, Inc.; and (M) Etocrylene (2-ethyl-2-cyano-3,3'di phenylacry late), e.g., tradename UVINUL N-35 from BASF Chemical Co. Representative UVA type sunscreening agents include but are not limited to: (A) Benzophenone-3 (2-hydroxy- 4-methoxybenzophenone), e.g., tradename SPECTRA-SORB UV-9 and UVINUL M-40 from American Cyanamid Co. and BASF Chemical Co., respectively; (B) Benzophenone-4 (sulisobenzone), e.g., tradename UVINUL MS-40 from BASF Chemical Co.; (C) Benzophenone-8 (dioxybenzone), e.g., tradename SPECTRA- SORB UV-24 from American Cyanamid Co.; (D) Menthyl Anthranilate (Menthyl- Oaminobenzoate), e.g., tradename SUNAROME UVA from Felton Worldwide, Inc.; (E) Benzophenone-1 (2,4- dihydroxybenzophenone), e.g., tradename UVINUL 400 and UVASORB 2 OH from BASF Chemical Co. and TRI-K Industries, Inc., respectively; (F) Benzophenone-2 (2,2',4,4'-tetrahydroxy-benzohpenone), e.g., tradename UVINUL D-50 from BASF Chemical Co.; (G) Benzophenone-6 (2,2'- dihydroxy-4,4'dimethoxy-benz.ophenone), e.g., tradename UVINUL D-49 from BASF Chemical Co.; (H) Benzophenone-12 (octabenzone), e.g., tradename UVINOL 408 from BASF Chemical Co.; (I) 4-isopropyl dibenzoyl methane (1-p- cumenyl3-phen.yipropane-l,3-dione), e.g. tradename EUSOLEX 8020 from EM Industries, Inc.; and (J) Butyl methyl dibenzoyl methane (4-t-butyl- 4'methoxydibenzoyl methane), e.g. tradename PARSOL 1789 from Givaudan Corporation; Physical sunscreening agents may also be used. For example, red petrolatum in amounts of about 30 to about 99% by weight of the total co mposition, or titanium dioxide in amounts of about 2 to about 25% by weight of the total composition may be used. Talc, kaolin, chalk, and precipitated silica may also be used in effective amounts, e.g., about 1% to about 10% by weight of the total composition. Additional sunscreening agents include lawsone (hydroxynaphthoquinone, Cl 0 1-1603, the coloring matter of henna leaves) with dihydroxy acetone. Usually, when used, at least one UVB type and at least one UVA type sunscreening agent is used. For example, at least one of the following UVB type sunscreening agents can be used: from about 1.5 to about 8.0% by weight of the total composition of octyl dimethyl PABA; octyl para-methoxycinnamate in amounts of about 1.5 to about 7.5% by weight of the total composition; homomenthyl salicylate in amounts of about 4.0 to about 15% by weight of the total composition; and octyl salicylate in amounts of about 3 to about 5% by weight of the total composition. Also, for example, at least one of the following UVA type sunscreening agents can be used: benzophenone-3 in amounts of about 0.5 to about 6% by weight of the total composition; benzophenone-8 in amounts of about 0.5 to about 3% by weight of the total composition; and menthyl anthranilate in amounts of about 3.5 to about 5.0% by weight of the total composition. Using the ingredients disclosed above (e.g., emollients, emulsifiers, film formers, and the like), the riboflavin, riboflavin phosphate or combinations of two or more thereof can be incorporated into formulations such as lotions, creams, gels mousses, waxed based sticks, aerosols, alcohol sticks and the like. These formulations are well known in the art, for example see Balsam, M.S., and Sagrin, E. (Editors) Cosmetic Science and Technology, Second Edition, Volumes 1 and 2, Wileylnterscience, a division of John Wiley & Sons, Inc., New York, copyright 1972; and Flick E.W., Cosmetic and Toiletry Formulations, Noyes Publications, 1984. Emollients may be used in amounts which are effective to prevent or relieve dryness. Useful emollients may include: hydrocarbon oils and waxes; silicone oils; triglyceride esters; acetoglyceride esters; ethoxylated glyceride; alkyl esters; alkenyl esters; fatty acids; fatty alcohols; fatty alcohol ethers; ether-esters; lanolin and derivatives; polyhydric alcohols (polyols) and poly-ether derivatives; polyhydric alcohol (polyol) esters; wax esters; beeswax derivatives; vegetable waxes; phospholipids; sterols; and amides. Thus, for example, typical emollients include mineral oil, especially mineral oils having a viscosity in the range of 50 to 500 SUS, lanolin oil, mink oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloe extract, jojoba oil, safflower oil, corn oil, liquid lanolin, cottonseed oil, peanut oil, purcellin oil, perhydrosqualene (squalene), caster oil, polybutene, odorless mineral spirits, sweet almond oil, avocado oil, calophyllum oil, ricin oil, vitamin E acetate, olive oil, mineral spirits, cetearyl alcohol (mixture of fatty alcohols consisting predominantly of cetyl and stearyl alcohols), linolenic alcohol, oleyl alcohol, octyl dodecanol, the oil of cereal germs such as the oil of wheat germ cetearyl octanoate (ester of cetearyl alcohol and 2-ethylhexanoic acid), cetyl palmitate, diisopropyl adipate, isopropyl palmitate, octyl palmitate, isopropyl myristate, butyl myristate, glyceryl stearate, hexadecyl stearate, isocetyl stearate, octyl stearate, octylhydroxy stearate, propylene glycol stearate, butyl stearate, decyl oleate, glyceryl oleate, acetyl glycerides, the octanoates and benzoates Of (C12-Cl 5) alcohols, the octanoates and decanoates of alcohols and polyalcohols such as those of glycol and glycerol, and ricin-oleates of alcohols and poly alcohols such as those of isopropyl adipate, hexyl laurate, octyl dodecanoate, dimethicone copolyol, dimethiconol, lanolin, lanolin alcohol, lanolin wax, hydrogenated lanolin, hydroxylated lanolin, acetylated lanolin, petrolatum, isopropyl lanolate, cetyl myristate, glyceryl myristate-, myristyl myristate, myristyl lactate, cetyl alcohol, isostearyl alcohol stearyl alcohol, and isocetyl lanolate, and the like. Emulsifiers (emulsifying agents) may be used in amounts effective to provide uniform blending of ingredients of the composition. Useful emulsifiers may include anionics such as: fatty acid soaps, e.g., potassium stearate, sodium stearate, ammonium stearate, and triethanolamine stearate; polyol fatty acid monoesters containing fatty acid soaps, e. g., glycerol monostearate containing either potassium or sodium salt; sulfuric esters (sodium salts), e.g., sodium lauryl sulfate, and sodium cetyl sulfate; and polyol fatty acid monoesters containing sulfuric esters, e.g., glyceryl monostearate containing sodium lauryl- sulfate; Cationics such as : N(stearoyl colamino formylmethyl) pyridium chloride; N- soya-N-ethyl morpholinium ethosulfate; Alkyl dimethyl benzyl ammonium chloride; diisobutylphenoxytheoxyethyl dimethyl berzyl ammonium -c hloride; and 5. cetyl pyridium chloride; Nonionics such as: polyoxyethylene fatty alcohol ethers, e.g., polyoxyethylene lauryl alcohol; polyoxypropylene fatty alcohol ethers, e.g., propoxylated oleyl alcohol; polyoxyethylene fatty acid esters, e.g., polyoxyethylene stearate; polyoxyethylene sorbitan fatty acid esters, e.g., polyoxyethylene sorbitan monostearate; sorbitan fatty acid esters, e.g., sorbitan monostearate; polyoxyethylene glycol fatty acid esters, e.g., polyoxyethylene glycol monostearate; polyol fatty acid esters, e.g., glyceryl monostearate and propylene glycol monostearate; and ethoxylated lanolin derivatives, e.g., ethoxylated lanolins, ethoxylated lanolin alcohols and ethoxylated cholesterol. Surfactants may also be used in the compositions of this invention. Suitable surfactants may include those generally grouped as cleansing agents, emulsifying agents, foam boosters, hydrotropes, solubilizing agents, suspending agents and nonsurfactants (facilitates the dispersion of solids in liquids). The surfactants are usually classified as amphoteric, anionic, cationic and nonionic surfactants. Amphoteric surfactants include acylamino acids and derivatives and N- alkylamino acids. Anionic surfactants include: acylamino acids and salts, such as, acylglutamates, acylpeptides, acylsarcosinates, and acyltaurates; carboxylic acids and salts, such as, alkanoic acids, ester carboxylic acids, and ether carboxylic acids; sulfonic acids and salts, such as, acyl isethionates, alkylaryl sulfonates, alkyl sulfonates, and sulfosuccinates; sulfuric acid esters, such as, alkyl ether sulfates and alkyl sulfates. Cationic surfactants include: alkylamines, alkyl imidazolines, ethoxylated amines, and quaternaries (such as, alkylbenzyldimethylammonium salts, alkyl betaines, heterocyclic ammonium salts, and tetra alkylammonium salts). Nonionic surfactants include: alcohols, such as primary alcohols containing 8 to 18 carbon atoms; alkanolamides such as alkanolamine derived amides and ethoxylated amides; amine oxides; esters such as ethoxylated carboxylic acids, ethoxylated glycerides, glycol esters and derivatives, monoglycerides, polyglyceryl esters, polyhydric alcohol esters and ethers, sorbitan/sorbitol esters, and triesters of phosphoric acid; and ethers such as ethoxylated alcohols, ethoxylated lanolin, ethoxylated polysiloxanes, and propoxylated polyoxyethylene ethers. Suitable waxes which may prove useful include: animal waxes, such as beeswax, spermaceti, or wool wax (lanolin); plant waxes, such as carnauba or candelilla; mineral waxes, such as montan wax or ozokerite; and petroleum waxes, such as paraffin wax and miorocrystalline wax (a high molecular weight petroleum wax). Animal, plant, and some mineral waxes are primarily esters of a high molecular weight fatty alcohol with a high molecular weight fatty acid. For example, the hexadecanoic acid ester of tricontanol is commonly reported to be a major component of beeswax. Suitable waxes which may be useful also include the synthetic waxes 'including polyethylene polyoxyethylene and hydrocarbon waxes derived from carbon monoxide and hydrogen. Representative waxes also include: Peresin; cetyl esters; hydrogenated jojoba oil; hydrogenated jojoba wax; hydrogenated rice bran wax; Japan wax; jojoba butter; jojoba oil; jojoba wax; munk wax; montan acid wax; ouricury wax; rice bran wax; shellac wax; sufurized jojoba oil; synthetic beeswax; synthetic jojoba oils; trihydroxystearin; cetyl alcohol; stearyl alcohol; cocoa butter; fatty acids of lanolin; mono-, di- and triglycerides which are solid at 250C, e.g., glyceyl tribehenate (a triester of behenic acid and glycerine) and C18-C36 acid triglyceride (a mixture of triesters Of C18-C36 carboxylic acids and glycerine) available from Croda, Inc., New York, NY under the tradenames-Syncrowax'HRC and Syncrowax HGL-C, respectively; fatty esters which are solid at 250C; silicone waxes such as methyloctadecaneoxypolysiloxane and poly (dimethylsiloxy) stearoxysiloxane; stearyl mono- and diethanolamide; rosin and its derivatives such as the abietates of glycol and glycerol; hydrogenated oils solid at 2500C; and sucroglycerides. Thickeners (viscosity control agents) which may be used in effective amounts in aqueous systems include: algin; carbomers such as carbomer 934, 934P, 940 and 941; cellulose gum; cetearyl alcohol, cocamide DEA, dextrin; gelatin; hydroxyethylcellulose; hydroxyp ropylcellulose; hydroxypropyl methylcellulose; magnesium aluminum silicate; myristyl alcohol; oat flour; oleamide DEA; oleyl alcohol; PEG-7M; PEG14M; PEG-90M; stearamide DEA; Stearamide MEA; stearyl alcohol; tragacanth gum; wheat starch; xanthan gum; and the like. Suitable film formers which may be used include: acrylamide/sodium acrylate copolymer; ammonium acrylates copolymer; Balsam Peru; cellulose gum; ethylene/maleic anhydride copolymer; hydroxyethylcellu lose; hydroxypropylcellulose; polyacrylamide; polyethylene; polyvinyl alcohol; pvm/MA copolymer (polyvinyl methylether/ maleic anhydride); PVP (polyvinylpyrrolidone); maleic anhydride copolymer such as PA- 18 available from Gulf Science and Techno logy; PVP/hexadecene copolymer such as Ganex V-216 available from GAF Corporation; acrylic/acrylate copolymer; and the like. Generally, film formers can be used in amounts of about 0.1% to about 10% by weight of the total composition with about 1% to about 8% being preferred and about 0.1% to about 5% being most preferred. Preservatives which may be used in effective amounts include: butylparaben; ethylparaben; imidazolidinyl urea; methylparaben; o-phenylphenol; propylparaben; quatemium-14; quaternium-15; sodium dehydroacetate; zinc pyrithione; and the like. The preservatives are used in amounts effective to prevent or retard microbial growth. Generally, the preservatives are used in amounts of about 0.1% to about 1% by weight of the total composition with about 0.1% to about 0.8% being preferred and about 0.1% to about 0.5% being most preferred. Perfumes (fragrance components) and colorants (coloring agents) well known to those skilled in the art may be used in effective amounts to impart the desired fragrance and color to the compositions of this invention. The subject McIr agents can be formulated with at least one compound selected from the group consisting of: an anti-inflammatory agent, an anti-acne agent, an anti-wrinkle agent, an anti-scarring agent, an anti-psoriatic agent, an anti¬ proliferative agent, an anti-fungal agent, an anti-viral agent, an anti-septic agent, a local anaesthetic, a keratolytic agent, a hair growth stimulant, a hair growth inhibitor and combinations of two or more thereof. Suitable anti-inflammatory agents include, but are not limited to: corticosteroids including, but not limited to, betamethasone, clobetasol, diflorasone, halobetasol, amcinonide, desoximetasone, diflorasone, fluocinolone, halcinonide, clocortolone, desoximetasone, flurandrenolide, fluticasone, hydrocortisone, mometasone, triamcinolone, aclometasone, desonide, dexamethasone, fluocinolone, and the like; non-steroidal anti-inflammatory agents including, but are not limited to, flurbiprofen, diclofenac, metronidazole, ketorolac, and the like. Suitable anti-acne agents include, but are not limited to, benzoyl peroxide, tretinoin, retinoic acid, tazarotene, azelaic acid, exfoliating agents, such as, for example, salicylic acid, glycolic acid, and the like; antiobiotics, such as for example, tetracyclines, erythromycin, clindamycin, doxycycline, stiemycin, and the like. Suitable anti-wrinkle agents include, but are not limited to, vitamin E, vitamin A, linoleic acid, oleic acid, sapogens, terpines, mineral oil, lanolin, vegetable oils, isostearyl isostearate, glyceryl laurate, methyl gluceth 10, methyl gluceth 20 chitosan, calcium channel inhibtors including, but not limited to, verapamil, anipamil, gallopamil, devapamil, falipamil, tiapamil, nifedipine, amlodipine, dazodipine, felodipine, isradipine, lanicardipine, nimodipine, nisoldipine, nitrendipine, ryosidie, diltiazem, cinnarizine, and flunarizine, and the like. Suitable anti-scarring agents include, but are not limited to, skin peeling agents, including, but not limited to, glycolic acid, salicylic acid, trichloroacetic acid face peels, and the like. Suitable anti-psoriatic agents include, but are not limited to, topical corticosteroids, retinoids, vitamin D analogues, vitamin D receptor modulators, anthralin, psoralen, biologies, coal tar, cyclosporine, methotexate, and the like. Suitable anti-proliferating agents include, but are not limited to, paclitaxel, docetaxel, taxanes, tamoxafϊn, rapamycin, and the like. Suitable anti-fungal agents include, but are not limited to, allylamines and other non-azole ergosterol biosynthesis inhibitors, such as terbinafine, and the like; flucytosine; azoles, such as, fluoconazole, and the like; glucan synthesis inhibitors, polyenes, griseofulvin, amphotericin B, butefanine, butoconazole, carbol-fuchsin, ciclopirox, clioquinol, clotrimazole, econazole, gentian violet, ketoconazole, miconazole, naftifϊ ne, nystatin, oxiconazole, sodium thiosulfate, terbinafine, terconazole, tolnaftate, undecylenic acid, and the like. Suitable anti-viral agents include, but are not limited to, amantadine, rimantadine, interferon, acyclovir, abacavir, adefovir, cidofovir, delavirdine, and the like. Suitable anti-septic agents include, but are not limited to, anti-bacterial agents, alcohols, chlorhexidine, chlorine, hexachlorophene, iodophors, chloroxylenol (PCMX), quaternary ammonium compounds, triclosan, antibiotics, and the like. Suitable local anaestheic agents include, but are not limited to, amethocaine, benzocaine, bupivicaine, butacaine, butacaine sulfate, cocaine, dibucaine, ethicaine, ethylaminobenzoate, ethyl chloride, levobupivacaine, lidocaineprilocaine, procaine, ropivacaine, tetracaine, xylocaine, and the like. Suitable kerotolytic agents include but are not limited to, salicyclic acid, retin A, benzoyl peroxide, topical fluorouracil, alpha hydroxy acids, urea, sulfur, podophyllum resins, and the like. Suitable hair growth stimulants include, but are not limited to, aconitum root extracts, minoxidil, cyclosporin-A, finesteride, antisense nucleic acids, cyanocarboxylic acid compounds, and the like. Suitable hair growth inhibitors include, but are not limited to, neutral endopeptidase inhibitors, protein-tyrosine kinase inhibitors, ornithine aminotransferase inhibitors, L-asparagine synthetase inhibitors, and the like. IV. Illustrative Experimental Results Examples described herein are for illustrative purpose only, and are by no means limiting. Other similar experimental designs can be readily envisioned with minor modification. A. Roles of McIr and MSH in the UVresponse To examine the pathway of UV-induced pigmentation, we compared UV- induced tanning between C57BL/6 animals with an intact MSH pathway (Λ/c7r E/E, wild type) and those which are genetically matched, but contain an inactivating mutation of the MSH receptor (Mclr c, "extension"). Whereas UV-induced hyperpigmentation was clearly observed grossly (white triangles) and microscopically (black triangles) in a dose-dependent manner (Figure IA), McI r (red-haired/pheomelanotic) mice did not exhibit detectable UV-induced pigmentation changes (Figure IB). Pigmentation responses to UV in murine pinnae (external ears) more closely mimic human pigmentation than murine truncal skin because of the presence of epidermal melanocytes in the pinnae (similar to human epidermis) and through which UV-photoadaptation (tanning) may occur. Although the skin of McI r mice appears devoid of eumelanin, it is not lacking melanocytes, as evidenced by incorporation of the melanocyte marker transgene Dct-LacZ (9) (data not shown). If McIr receptor were functionally essential for UV-induced melanization, it is possible that UV may stimulate pigmentation in a non-cell- autonomous fashion, via paracrine or autocrine (or both) mechanisms. To examine this question, keratinocytes were subjected to UV irradiation in vitro, and supernatants of the irradiated cells (conditioned media) were incubated with Bl 6 melanoma cells to test for induction of the melanogenic transcription factor MITF (10). Media from UV-irradiated (vs. unirradiated) keratinocytes produced significant MITF induction at both RNA and protein levels (Figure 2A). In addition, absorption of the conditioned media using anti-α-MSH (but not control anti-HA) affinity chromatography removed most of the stimulatory activity (Figure 2A). Comparable conditioned media derived from UV irradiated Bl 6 pigment cells did not exhibit this activity (Figure 7A), suggesting that this UV mediated effect is weaker or absent. Whereas primary cultured melanocytes showed relatively weak UV-induction of POMC expression, they nonetheless did express POMC without UV exposure as previously described (8, 11), suggesting that autocrine signaling could still contribute to McIr activity. These results are consistent with the possibility that induction of MSH expression and/or secretion by keratinocytes may represent an important means through which UV triggers the pigmentation response. To directly measure MSH production following UV irradiation, quantitative PCR was employed to examine levels of its precursor transcript pre-promelanocortin (POMC) in either keratinocytes or melanocytes. As shown in Figures 2B & 2C, UV treatment stimulated POMC expression.by more than thirty-fold in PAM212 mouse keratinocytes and primary human keratinocytes. UV irradiation of Melan-C mouse melanocytes failed to induce POMC expression (Figure 7B). The UV induction of MSH expression in keratinocytes seen here corroborates previous findings that UV radiation activates expression of MSH in keratinocytes (8). Moreover an essential role for McIr in the UV-pigment response is consistent with common experience in man that fair-skinned individuals (more likely harboring non-signaling McIr variants) exhibit minimal tanning capacity (5, 12), albeit shown here in a genetically controlled system. B. Small molecule rescue ofeumelanin production The above data suggest that UV-induced POMC-MSH-Mcir signaling is essential for UV-induced tanning via a non-cell-autonomous pathway in which keratinocytes instruct melanocytes via secreted MSH, though autocrine melanocyte MSH expression may contribute as well. An alternative theoretical possibility is that Mclr (non-signaling) melanocytes might undergo an irreversible block to eumelanin synthesis at some developmental stage, such that UV-induced tanning cannot occur in adults due to a permanent defect in the pigmentation machinery. To examine this question, we reasoned that if a cAMP agonist could restore pigmentation in this setting, then the inability of UV to induce pigmentation becomes more rigorously linked to inactivity of the cAMP pathway within the McJr e genetic background. In order to examine the cutaneous UV-pigmentation pathway in mouse skin, we employed C57BL/6 mice harboring a transgene in which the keratin 14 promoter drives constitutive expression of stem cell factor in the epidermis (K14-Scf) (13). This transgene mimics the human pattern of Scf expression by epidermal keratinocytes and is correspondingly associated with epidermal melanocyte homing. K14-Scftransgenic ("humanized") mice homozygous for McIr c exhibited fair/pink skin with a high pheomelanin and low eumelanin content (Figure 8) Similar to non-transgenic Mclr mice, we observed no measurable UV-induced melanization in - c/ transgenic McIr mice (Figure 3A). Skin color changes were measured using reflective colorimetry (14) (Figure 3B) and direct melanin quantification (Figure 3C). Forskolin is a cell-permeable diterpenoid that activates adenyl cyclase (15). When forskolin was applied topically to Mclr K14-Scf (pheomelanotic) mice, significant melanization was observed, either applied throughout (Fig 3A), or locally to the rump area (Figure 9A). Compared to vehicle control, topical forskolin caused progressive and robust darkening (Figures 3B & 3D) as well as eumelanin production (Figure 3C). Forskolin-induced eumelanization required epidermal melanocytes, as it was not observed in mice lacking the Kl 4-Scf transgene (Figure 3E). Skin darkening by forskolin was associated with dose-dependent accumulation of melanin in the epidermis (Figure 3F), was obvious after only a few daily topical treatments, and was progressive over several weeks (Figure 9B). Direct measurements (16) revealed a >20-fold increase in skin eumelanin (Figure 3C) together with a shift in eumelanin:pheomelanin ratio from 0.09 ± 0.1 to 0.9 ± 0.5 (data not shown), the latter being reminiscent of the very darkest human skin phototypes (16). Of note, hair/fur color was not altered significantly during the time courses examined here. Forskolin-induced skin darkening was reversed upon cessation of treatment, with a half-life of approximately two weeks (Figure 9B). Both crude preparations of forskolin (Coleusforskohlii root extract) (17) as well as chemically pure forskolin produced significant melanization (Figure 9C). Importantly, forskolin-induced pigmentation appeared to mimic normal melanization, not only regarding pigment chemical species produced, but even to the degree of exhibiting "nuclear capping" in which melanosomes imported by keratinocytes align in discrete structures putatively providing solar shielding to keratinocyte nuclei (Figure 4A, see asterisks) (18). While it is likely that the forskolin rescues pigmentation via targeting of adenylate cyclase downstream of McIr in melanocytes, it is formally possible that it is acting on epidermal keratinocytes to induce production of a (Mc/ r-independent) factor capable of stimulating melanocytic pigmentation. A preliminary test of this was made by treating keratinocytes or Bl 6 melanoma cells in vitro with forskolin for 2 hr, followed by washing and subsequent transfer of 24 hr conditioned medium to recipient Bl 6 melanoma cells. As shown in Figure 7, no MITF activation was observed using such conditioned media, however robust MITF induction was noted with direct forskolin exposure. Collectively, these data demonstrate strong rescue of eumelanin production in McIr deficient melanocytes by a direct effect of forskolin on melanocytes, thus suggesting that the inability of UV to trigger eumelanization is not caused by irreversible inactivation of pigmentation machinery. C. Protective effects of topical melanization Induction of dark melanization in a genetic strain essentially devoid of eumelanin prompted us to examine whether the topically-induced pigmentation would be protective against UV-mediated genomic and cellular damage. A test of UV-induced skin damage was obtained by quantification of "sunburn cells" which represent apoptotic keratinocytes in the epidermis after radiation (19). Sunburn cells (arrows, Figure 4A) were quantified 24 hours after a single 200 mJ/cm2 dose of UVB (equivalent to ~ 1 hour of ambient sun exposure at sea-level in Florida in July (http://www.srrb.noaa dot gov/UV/)). Controls for this experiment included albino mice (tyrosinase mutant, lacking pigmentation) and wild type McJrε/ε mice which are genetically black, all on the C57BL/6 background. Figure 4 shows representative histologic analyses as well as quantitative results which indicate profound protection against sunburn cell formation. Whereas vehicle control-treated McJr e mice were highly sensitive to UV-induced sunburn cell formation (virtually identical to forskolin-pretreated albinos), forskolin pre-treatment of Mclr c mice produced nearly the same degree of UV protection as in genetically black McIr ) mice (Figure 4). As an additional measure of forskolin's influence on UV-induced DNA damage, skin was harvested ten minutes after UV irradiation and stained for thymine cyclobutane dimers, the mutagenic and most abundant DNA lesion caused by UVB (20). As shown in Figure 5A, doses of 20 or 50 mJ/cm2 UVB produced significant nuclear staining throughout the epidermis in Mclr d or albino (Tyrc2 k2i) skin. Importantly, forskolin-induced melanization was associated with nearly complete protection, similar to McI r E (genetically black) epidermis. Since it was formally possible that melanin pigment may quench the fluorescent signal in these experiments, immunohistochemical staining for thymine dimers was also employed and demonstrated that forskolin-treated epidermis was indeed protected from the nuclear staining pattern of UV-induced pyrimidine dimer formation (Figure 5B, see arrows). We next tested the UV-protective effect of forskolin-induced pigmentation against UV-induced skin cancer. This experiment was carried out using a mouse model of the human UV-hypersensitivity syndrome Xeroderma Pigmentosum Group C (Xpc). Utilizing Xpc null mice originally generated by Sands et al. (21), we produced K14-Scf; McJr e; Xpc 1 (C57BL/6) which were pre-treated daily with either forskolin-containing topical treatment or vehicle control for four weeks before daily exposure to 250 mJ/cm2 UVB (along with continued topical treatments) for twenty weeks. This UV dose approximates 1-2 hrs of ambient mid-day sun exposure at sea level in Florida during July (http://www.srrb.noaa dot gov/UV/) and was anticipated to be extremely carcinogenic for the Xpc deficient genetic background (21). Indeed, vehicle control (non-darkened) mice exhibited gross and histologic evidence of sun damage, including failure to thrive (diminished weight gain relative to forskolin-treated mice; Fig 6A,B), epidermal thickening, inflammation, and scarring (Figure 10). Epidermal and dermal thickening were profound in the fair- skinned Xpc null vehicle control UV-treated mice (see red and yellow bars in Figures 1OA & 4B in graphic form), as compared to either non-UV-exposed ventral (belly) skin from the same UV irradiated mice or forskolin-pretreated UV-exposed Xpc null littermate controls (Figure 10). Following chronic UV exposure, 11 cutaneous neoplasms were seen to develop in 9 of 9 vehicle control irradiated mice, within 65 weeks of cessation of UV radiation (Figures 6C & 6D) Two of the 9 mice developed multiple tumors. The tumors represented 8 squamous cell carcinomas and 3 papillomas or spindle cell neoplasm not otherwise specified. Forskolin-treated (darkened) mice developed 5 neoplasms which were all squamous carcinomas. However they were significantly protected relative to vehicle control-treated mice, both in terms of median time to tumor formation (24 weeks in control-treated UV- irradiated animals vs. 46 weeks in forskolin-treated UV-irradiated animals) and number of animals that developed skin cancer (9/9 of control-treated UV-irradiated animals vs. 5/9 of forskolin-treated UV-irradiated animals; p < 0.05), and median follow-up (31 weeks in control-treated UV-irradiated animals vs. 50.3 weeks in forskolin-treated UV-irradiated animals; p value Logrank Test, p<0.0001). Given the extreme UV sensitivity of homozygous Xpc deficiency, coupled to the high chronic UV doses employed, these data suggest a significant protection afforded by topical rescue of McJr functional deficiency. D. Synergistic effects of rolipram and forskolin on melanocyte MITF expression In order to determine whether the same stimulatory effect by forskolin in the mouse model can be repeated in human cells / tissues, human skin (foreskin) treated either by forskolin, rolipram, both forskolin and rolipram, or negative vehicle control were stained for MITF expression. Figures H A - H E show that after stimulation by one of these reagents, MITF expression was only observed in melanocytes, which are relatively rare cells at the base of the epidermis. The data show strong induction of MITF in melanocytes using the combination of rolipram and forskolin, whereas under the chosen condition of this set of experiments, forskolin alone does not strongly stimulate MITF expression. Note that in the experiments using both forskolin and rolipram, both reagents are present in half the concentrations used in the forskolin alone or roliparm alone experiments. This demonstrates a pronounced synergistic effect when two different types of the subject McIr agonists (e.g., PDE inhibitors and cAMP agonists) are used together. Although both types of the subject McIr agonists may be formulated in the same pharmaceutical composition, it would be understood that this needs not be the case. The subject PDE inhibitors and the subject cAMP agonists may be formulated as individual pharmaceutical compositions, to be used either simultaneously, consequentially, repeatedly, and/or alternatively, with or without appreciable intervals. For example, one type may be applied to skin first, followed by applying the other type. Or, one may be used repeatedly over a treatment period, followed by another over a second treatment period. Alternatively, one may be used in alternative with the other (e.g., one used on the even days, the other used on odd days, etc.). For comparison, in one of the rolipram + forskolin images (Figure HE), arrows were included to point out the melanocytes. In others (Figure 11D), the arrows were left out in order not to obscure the dark melanocyte / MITF staining. Applicants also observed that, in some patients, rolipram may work well even without forskolin. While not wishing to be bound by any particular theory, it is likely that different people (e.g., human skin specimens) may respond to treatments by the subject McIr agonists to different degrees / extents, due to, for example, the genetic background of the individuals (e.g., ethnicity, race, etc.). This is consistent with the significant variations in pigmentation types, ability to suntan, sunburn, etc. observed in different human sub-populations. These experiments verify that McIr agonists causing skin-darkening in the mouse model also cause the same effects in human tissues, thus demonstrating the general applicability of the invention, especially its applicability to human skin. E. Synergistic effects of PDE .4 inhibitors and forskolin in human melanocytes To further explore the effects of the PDE 4 inhibitor Rolipram and forskolin in inducing pigmentation in human melanocytes, a human melanoma cell line (MeWo line) was treated with either DMSO, Rolipram, C. forskohlii root extract or the combination of Rolipram and C. forskohlii root extract in DMSO. Phospho- CREB (pCREB) was measured as a surrogate biomarker for activation of the pigmentation pathway based on reports that activated CREB induces the transcription of MITF (42). Neither C. forskohlii root extract nor Rolipram alone were able to cause detectable phosphorylation of CREB. However, the combination of Rolipram and C. forskohlii root extract was a strong activator of CREB, showing that a cAMP agonist and a phosphodiesterase inhibitor can have synergistic effects in activating signaling pathways related to pigmentation. The peak of CREB activation occurred 1 h after treatment of the cells (Figure 12). In order to determine whether other PDE4 inhibitors could also synergize with forskolin, MeWo cells were treated with a range of doses of pure forskolin (0.5 to 40 µM in DMSO), 3 different PDE 4 inhibitors in DMSO or DMSO alone and harvested at 1 h (Figure 13). The PDE 4 inhibitors Rolipram (40 x IC50), Ro 20- 1724 (40 x IC50) or ICI 63,197 (160 x, IC50 value) showed a synergistic effect with forskolin. While these inhibitors had a minimal effect on the levels of pCREB alone (extreme right hand lane of gels in Figure 13), levels of pCREB increased with increasing amounts of forskolin indicating that the synergistic effects of Rolipram are not limited to this compound, but was a more general phenomena for PDE4 inhibitors. F. Synergistic effects of PDE 4 inhibitors andforskolin in intact human skin In order to determine the effects of PDE4 inhibitors on intact human skin, skin tissue discarded from cosmetic surgery was treated with DMSO alone (first, black bar), or rolipram (10 mM second bar; 20 mM, third bar; or 40 mM, fourth bar). As shown in Figure 14, Rolipram caused a dose-dependent increase in pigmentation in skin 6 hours after treatment. Increases in melanin that occur in this time frame are likely due to oxidation of pre-existing melanin (43) and redistribution of melanosomes (44). This phenomenon is known as the "immediate tanning response." The immediate increase in melanization is temporary, and is followed by the more permanent and photo-protective "delayed tanning response" involving increased tyrosinase activity and de novo melanin production in the skin (44, 45). Immediate tanning response precedes the delayed tanning response even after a single dose of UV (44) indicating that this effect is a predictive surrogate biomarker of visible tanning of the skin. To test whether the induction of pigment caused by Rolipram could be duplicated by other PDE4 inhibitors, human abdominal skin was treated daily for 4 days with vehicle alone (first, black bar) Rolipram (20 mM, second bar), ICI 63, 197 (40 mM, third bar) or Ro 20-174 (40 mM, fourth bar) dissolved in vehicle. As is shown in Figure 15, all of the PDE4 inhibitors increased the amount of pigment in the skin. A normal aspect of physiologic tanning is the movement of melanin from the melanocytes to the keratinocytes where the pigment creates a shield to protect the keratinocyte nuclei from damaging UV irradiation (46). The skin treated with Ro 21-174 demonstrated clear migration of pigment into the suprabasal layers of the skin indicating that this model is physiologically relevant for monitoring the induction of a tanning response. The differences in the dynamic range of the tanning response shown in Figures 14 and 15 are due to inherent variability between individual skin samples. In general, light skin demonstrates a larger response to PDE4 inhibitors than medium and darkly pigmented skin (data not shown). In order to explore the synergistic effects of forskolin and Rolipram in intact skin, the same human abdominal skin used in the experiment described in Figure 15 was either not treated (eighth bar) or treated topically with vehicle (first, black bar), Rolipram (20 mM, second bar), forskolin (20 mM, third bar), C. forskohlii root extract (20 mM forskolin, fourth bar), combination of Rolipram and forskolin (20 mM each, fifth bar), combination of Rolipram and C. forskohlii root extract (20 mM each, sixth bar) and ICI 63,197 (40 mM, seventh bar). The resulting pigmentation was compared with skin treated with vehicle (black bar). As shown in Figure 16, neither Rolipram, forskolin nor C. forskohlii root extract alone were able to induce pigment under these conditions. However, the combinations of Rolipram and forskolin (20 mM each) or Rolipram and C. forskohlii root extract (20 mM each) increased pigmentation. Melanin was present in the suprabasal layers in the skin treated with the combination of Rolipram and C. forskohlii root extract and with the PDE4 inhibitor ICI 63,197 alone indicating physiologic induction of the tanning response. The lack of an increase in pigmentation with Rolipram seen in Figure 16 (which uses the same skin as in Figure 15) is likely due to reduced drug delivery from the topical route of exposure. G. Materials and Methods Certain materials, reagents, animals used in the exemplary experiments described herein are provided below, which are not limiting in any respect. (i) Animals C57BL/6J mice of varying pigment phenotype were crossed with K14-Scf transgenic animals also on the C57BL/6J background contributed by Dr. Takahiro Kunisada, Gifu University, Gifu City, Japan. The pigmentation phenotypes used were C57BL/6J Mclr , Tyr (wild type, black pigmentation), C57BL/6J-Mc/re/e (extension mutant, blonde pigmentation, abbreviated Mclr d <), and C57BL/6J Mclr ; Tyrc 2ils (albino, non-pigmented, abbreviated Tyrc 2i ) animals each purchased from the Jackson Laboratory (Bar Harbor, ME). Presence of the K14-Scf transgene was assessed either by phenotype (in the case of wild type or extension animals because of obvious skin color characteristics) or by per amplification of DNA obtained by tail snip of a fragment specific to the K14-Scf transgene as described (13) in albino animals. Xeroderma pigmentosum knockout mice originally generated in 129-derived embryonic stem cells but back-crossed onto the C57BL/6 background were purchased from Taconic (Germantown, NY). All experiments were carried out in accordance with institutionally-approved animal protocols. (U) Cell Lines The Pam212 mouse keratinocyte cell line was graciously provided by Dr. Paolo Dotto (Massachusetts General Hospital and Harvard Medical School, Boston, MA) and the Melan-C mouse melanocyte cell line was generously provided by Dr. Dorothy Bennett (St. George's Hospital Medical School, London, U.K). Pam212 cells were grown in DMEM media supplemented with 10% fetal bovine serum, penicillin, streptomycin and L-glutamine, and Melan-C cells were grown in Ham's FlO media supplemented with 10% fetal bovine serum, penicillin, streptomycin and l-glutamine. Cells were grown to 40-60% confluence prior to use in irradiation experiments in humidified incubators supplemented with 5% CO2. MeWo melanoma cells were purchased from ATCC (Manassas, VA) and maintained in RPMI medium supplemented with 10% fetal bovine serum, penicillin and streptomycin. (Ui) Human Skin Discarded human skin was obtained from a cosmetic surgeon with IRB approval. The skin was transported in FlO medium supplemented with penicillin and streptomycin. Underlying fat was removed with scissors. (iv) Chemicals Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ). Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). AU topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma- Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract was prepared by mixing the dry root powder with vehicle for 1 hr at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer as well as independent analysis confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form. Pure forskolin and Rolipram were obtained from BioMol (Plymouth Meeting, PA). ICI 62,197 and Ro-20-1724 were purchased from Sigma-Aldrich Chemical Corporation, St. Louis, MO. ' (v) Sunless tanning Experiments C57BL/6J animals between 5 and 10 weeks of age were used for these experiments unless otherwise noted. Dorsal hairs were trimmed using animal shears with a 0.25 mm head (Fisher, Pittsburgh, PA). Preparations of forskolin were applied to the sheared skin as described. Solvent (vehicle) control consisted of the same volume of ethanol/propylene glycol (without forskolin) applied to the skin of age-matched genotype-matched cohorts. Unless otherwise indicated, animals were treated once daily on their dorsal surface with 300 —400 µl of topical agent for 5 days a week. Skin reflective colorimetry measurements were assessed with a CR- 400 Colorimeter (Minolta Corporation, Japan). In all cases, the instrument was calibrated against the white standard background provided by the manufacturer before use. Degree of melanization (darkness) is described as the colorimetric measurement on the *L axis (white-black axis) of the CIE standard color axis. (vi) UV exposure Animals were briefly anesthetized with inhaled isoflurane, hairs were sheared with an electric animal clippers outfitted with a surgical preparatory clipper head (to cut hairs to 0.25 mm). Next, animals were exposed to ultraviolet irradiation in a custom-made lucite chamber (Plastic Design Corporation, Massachusetts) designed to allow freedom of movement while being irradiated. UV was delivered by a double bank of UVB lamps and UV emittance was measured with the use of a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. Skin samples were biopsied at indicated time points after UV exposure. In the case of in vitro UV experiments, cells were exposed to ultraviolet radiation in a Stratalinker UV chamber (Stratagene, Cedar Creek, TX) equipped with 15W 254 nM UVB bulbs (Stratagene, Cedar Creek, TX). (vii) RNA extraction and Quantitative Polymerase Chain Reaction After exposure to UVB radiation as described above, melanocyte or keratinocyte cells (as indicated) were incubated at 37°C in humidified incubators supplemented with 5% CO . At indicated times, media was removed and collected. This conditioned medium was used directly or incubated with anti-alpha-MSH (20ug, Sigma, M-0939) for 24 h at 4 degree, then incubated with anti-rabbit IgG for 1 hour at room temperature, and then incubate for Protein A/G beads for two hours at room temperature. Conditioned media was added to either mouse Bl 6 melanoma cells or primary human Melanocytes for 6 hr in culture. Cells were washed once with PBS, pH 7.4, and RNA was extracted using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative TaqMan PCR using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an iCycler machine (BioRad, Hercules, CA). Murine POMC mRNA expression relied on the following reagents: forward primer: AGCAACCCGCCCAAGG (SEQ ID NO: 1), reverse primer: GCGTCTGGCTCTTCTCGG (SEQ ID NO: 2), probe: [6-FAM]-CAAGCGTTACGGTGGCTTCATGACC-[TAMRA-O-FAM] (SEQ ID NO: 3). Murine GAPDH mRNA expression relied on the following reagents: forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 4), reverse primer: AGATGGTGATGGGCTTCCC (SEQ ID NO: 5), probe: [6-FAM]- AGGCCGAGAATGGGAAGCTTGTCATC-[TAMRA-O-FAM] (SEQ ID NO: 6). Human POMC mRNA expression relied on the following reagents: . Human GAPDH expression relied on the following reagents: Human MITF reverse 5'- CGAGCTCATGGACTTTCCCTT A-3' (SEQ ID NO: 7), Human MITF forward: CTTGATGATCCGATTCACCAAA (SEQ ID NO: 8), Human MlTF probe 6FAM- CCATCCACGGGTCTCTGCTCTCCAG-TAMRA6FAM (SEQ ID NO: 9), Mouse MITF forward GGAGCAGAGCAGGGCAGA (SEQ ID NO: 10), Mouse MITF reverse CATGCACGACGCTCGAGA (SEQ ID NO: 11), Mouse MITF Probe: [6- FAM]-AGTGAGTGCCCAGGTATGAACACGCA-[TAMRA-O-FAM] (SEQ ID NO: 12), Human GAPDH forward GAAGGTGAAGGTCGGAGT (SEQ ID NO: 13), Human GAPDH reverse GAAGATGGTGATGGGATTTC (SEQ ID NO: 14), Human GAPDH probe : [6-FAM]-CAAGCTTCCCGTTCTCAGCC-[TAMRA-O- FAM] (SEQ ID NO: 15), Mouse GAPDH forward GTGGATCTGACGTGCCGC (SEQ ID NO: 16), Mouse GAPDH reverse TGCCTGCTTCACCACCTTC (SEQ ID NO: 17), Mouse GAPDH probe: [6-FAM] GGAGAAACCTGCCAAAGTATGATGACATCA-tTAMRA- ό-FAM] (SEQ ID NO: 18), Human POMC forward: CTTGCAGGCCCGGATG (SEQ ID NO: 19), Human POMC reverse: AGCAGCCAGTGTCAGGACCT (SEQ ID NO: 20), Human POMC Probe: [6-FAM]-ACCACGGAAAGCAACCTGCTGGAG- [TAMRA-6-FAM] (SEQ ID NO: 21). (viii) MITF Quantification Pam212 mouse keratinocytes or primary human keratinocytes were irradiated with 10 mJ/cm 2 and incubated for 24 hrs (37°C, 5% CO ). Supernatants were collected at 24 hrs and these keratinocyte-conditioned medias were used to replace the media of either Bl 6 mouse melanoma cells or primary human melanocytes (respectively) growing in log-phase. After 12 hrs, cells were harvested for protein or RNA analysis. For protein isolation, cells were lysed in Protein Lysis Buffer: Tris hydrochloride (pH 8.0) 50 mM, NaCl 15OmM, EDTA 5 mM, Sodium deoxycholate 0.5%. SDS-PAGE analysis and western blotting were performed by conventional techniques using the C5 monoclonal anti-MITF antibody. For qt-PCR analysis, RNA was harvested using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260 nm / 280 nm). mRNA expression was quantified by quantitative Taqman per using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an ICycler machine (BioRad, Hercules, CA). MITF induction was normalized to GAPDH controls in all cases. In experiments determining direct effects of forskolin on MITF induction, Pam212 keratinocytes or Bl 6 pigmented melanoma cells were incubated (6 hrs) with forskolin (80 µM), were washed with PBS twice, and then were incubated for 24h (37°C, 5% CO2). Conditioned supematants were then collected and added to B 16- cells. Negative controls consisted of vehicle-treated conditioned media and positive controls consisted of media containing 80 µM forskolin. Cells were then lysed and evaluated as described above. (be) Histology Animals were either killed by CO2 narcosis or anesthetized with isoflurane anesthesia prior to skin sampling. Approximately 1 cm2 skin biopsies were obtained from sheared skin treated as described. Skin sections were immediately placed in 10% buffered formalin until paraffin embedding and sectioning (done by either the rodent histopathology core service at Harvard Medical School or the histopathology core facility at the University of Kentucky). Hematoxylin/Eosin staining and Fontana-Masson staining were performed either by the histopathology core or in the laboratory using conventional techniques and reagents. (x) Sunburn cell analysis and thymine dimer detection C57BL/6 Kl 4-Scftransgenic McIr 1 animals were treated with either vehicle control or with C. forskohlii root extract (200 mM forskolin) daily (5 days per week) for three weeks starting at 4 weeks of age. Mclr E/E (wild type) Kl 4-Scf transgenic animals (used as a positive control for maximal pigmentation) and Tyrc J c J (albino) Kl 4-Scftransgenic animals (used as an amelanotic control to compare UV effects in skin devoid of pigment) were each treated with vehicle control between the ages of four and seven weeks. At seven weeks of age, animals were shaved and irradiated with 200 mJ/cm2 UVB. After 24 hours, dorsal (exposed) skin was biopsied as described, stained with hematoxylin/eosin and examined for pyknotic nuclei in the epidermis which defines "sunburn cells" (41). The number of sunburn cells in the epidermis was counted in three different animals of each treatment cohort. For thymine dimer analysis, the same pigmentation cohorts of Kl 4-Scf transgenic animals were used, except these experiments were done in the Xeroderma pigmentosum C null (Xpc~'~) genetic background. Animals were treated with either vehicle control or C. forskohlii root extract (200 mM forskolin) as indicated between the ages of four and seven weeks, shaved and irradiated with either 0 mJ/cm2, 20 mJ/cm2 or 50 mJ/cm2 UVB. Animals were euthanized and treated dorsal skin samples were harvested 10 minutes after UVB exposure. Samples were immediately snap-frozen in cryomedium (SAKURA, Tissue-Tek) and 8 µm sections were prepared (LEICA cryostat, CM3050) on Plus slides (Fisherbrand). Antigen retrieval was performed by heating in Tris-EDTA buffer solution (pH 8.0) in a microwave ("20 minutes at boiling, then 60 minutes at low temperature followed by slow cooling to room temperature on the lab bench"). Skin sections were incubated with a 1: 50 dilution of anti-thymine dimer monoclonal antibody (Kamiya Biomedical, Seattle, Washington) and the M.O.M. mouse IgG blocking reagent (Vector laboratories) for Ih at room temperature. For immunofluorescence, samples were incubated with 1:1000 dilution of Alexa Fluor 488-conjugated anti-mouse IgG donkey antibody (Molecular Probes, Eugene, OR) for 40 minutes at room temperature. Nuclear counterstaining was performed using a 3 minute exposure to DAPI (lOug/ml; Molecular Probes). Secondary antibody staining controls consistently revealed little non-specific binding. For immunohistochemical analysis, endogenous peroxidase activity was blocked with DAKO Peroxidase Block (5 min, room temperature), and sections were incubated Ih at room temperature with a 1:50 dilution of anti-thymine dimer mouse monoclonal antibody (Kamiya Biomedical, Seattle, Washington). The DAKO EnVision™+ System (DakoCytomation, Carpinteria, CA) was used as directed. Secondary antibody staining controls consistently revealed little non-specific binding. (xi) Tumorformation and chronic UVprotection experiments C57BL/6 K14-Scf transgenic McI r Xpc 1 animals were treated with either vehicle or with C. forskohlii root extract (200 mM forskolin; once daily, 5 days per week) between the ages of four and seven weeks. Topical treatments were continued throughout the next 20 weeks (along with UV exposure). Beginning at 7 weeks of age, animals were irradiated (250 mJ/cm2/day, 5 days a week) over the course of 16- 20 weeks. During this period, all mice were shaved once a week, irradiated in the morning and treated with vehicle or forskolin in the afternoon. Animals were monitored for growth and skin pathology throughout the course of irradiation and once weekly subsequently for the next year. For growth analysis, same sex littermates of vehicle-treated or forskolin-treated animals were weighed at 16 weeks of irradiation Skin samples were harvested from the dorsal (treated and exposed surface) or ventral (negative control) surface of animals after 16 weeks of irradiation. Biopsies were formalin-fixed, paraffin-embedded and stained with hematoxylin/eosin or Fontana-Masson as described. Thickness of skin layers was determined on a ZEISS Axioplan 2 imaging microscope and data were averaged from at least three separate animals. For tumor surveillance, animals were shaved weekly after their course of irradiation and were regularly observed for pathological changes in the skin. Lesions that were grossly identified as tumors were biopsied and examined. (xii) Activation of pCREB Western blotting to detect the activation of CREB by phosphorylation was performed using a phospho-CREB (pCREB)-specific antibody (Millipore, Billerica, MA), an anti-rabbit secondary antibody conjugated to horseradish peroxidase (Pierce, Rockford, IL), and Chemiluminescence detection reagents (Alpha Innotech, San Leandro, CA). (xiii) Experiments with Human skin Human skin was cut into 0.5 cm2 squares prior to submerging into solutions of the test compound (Figures 14 and 15) or was left intact for topical treatments (Figure 16). For the submerged protocol, the tissue was incubated in 100 µl of the indicated test compound in DMSO or proprietary vehicle for 30 minutes, then rinsed in Medium 154 (Cascade Biologies) supplemented with penicillin and streptomycin. Each skin piece was maintained in 0.2 ml of this medium in a 37°C CO2 incubator for 6 hr (Figure 14) or for 4 days with daily exposure to solutions of the test compound and a daily medium change (Figure 15). For the topical treatment protocol (Figure 16), a large piece of skin was placed in a 10 cm dish containing 5 ml of Medium 154 supplemented as described above. For application of the test compound, 0.5 cm sterile cloning cylinders were attached to the surface of the skin by first applying a layer of Vaseline to the bottom of the cylinder. Twenty microliters of the test compound dissolved in a proprietary vehicle was added to the cylinders and allowed to absorb into the skin. The skin was treated daily for 4 days. Between treatments, the skin was kept in a 37°C CO2 incubator with a daily medium change. At the time of harvest, skin sections were removed using a punch biopsy tool (for the topical treatment studies). The skin was fixed for 48 hours in 10% buffered formalin at 4°C. The fixed tissue was sectioned (according to standard procedures) and stained using the Fontana-Masson stain. Melanin content in the tissue sections was determined using IP Software (Scanalytics Inc). Differences in the dynamic range of this assay were found to be dependent on the degree of pigmentation of the skin samples that were used (data not shown). (xiv) Statistical analysis Statistical comparisons of the sunburn cell analysis and the thickness of epidermis were evaluated by students' t-test. Cumulative tumor free survival was calculated using the Kaplan-Meier method. Statistical comparisons of the melanin content of skin tissue was determined using a paired students' t test. H. Literature cited 1. B. A. Gilchrest, H. Y. Park, M. S. Eller, M. Yaar, Photochem Photobiol 63, 1 (Jan, 1996). 2. R. A. Sturm, Mutat Res 422, 69 (Nov 9, 1998). 3. K. G. Mountjoy, L. S. Robbins, M. T. Mortrud, R. D. Cone, Science 257, 1248 (Aug 28, 1992). 4. C. D. Van Raamsdonk, K. R. Fitch, H. Fuchs, M. H. de Angelis, G. S. Barsh, Nat Genet 36, 961 (Sep, 2004). 5. P. Valverde, E. Healy, I. Jackson, J. L. Rees, A. J. Thody, Nat Genet 11, 328 (Nov, 1995). 6. M. Tsatmali, J. Ancans, J. Yukitake, A. J. Thody, Pigment Cell Res 13 Suppl 8, 125 (2000). 7. M. S. Eller, M. Yaar, B. A. Gilchrest, Nature 372, 413 (Dec 1, 1994). 8. S. Corre et al, J Biol Chem 279, 51226 (Dec 3, 2004). 9. M. A. Mackenzie, S. A. Jordan, P. S. Budd, I. J. Jackson, Dev Biol 192, 99 (Dec 1, 1997). 10. E. R. Price et al. , J Biol Chem 273, 33042 (Dec 4, 1998). 11. A. K. Chakraborty et al., Biochim Biophys Acta 1313, 130 (Aug 28, 1996). 12. R. A. Sturm, Melanoma Res 12, 405 (Oct, 2002). 13. T. Kunisada et al., J Exp Med 187, 1565 (May 18, 1998). 14. S. B. Park, D. H. Suh, J. I. Youn, Clin Exp Dermatol 24, 315 (JuI, 1999). 15. K. B. Seamon, J. W. Daly, J Cyclic Nucleotide Res 7, 201 (1981). 16. S. Ito, K. Wakamatsu, H. Ozeki, Pigment Cell Res 13 Suppl 8, 103 (2000). 17. C. B. Lin etal., J Invest Dermatol 119, 1330 (Dec, 2002). 18. H. R. Byers, S. Maheshwary, D. M. Amodeo, S. G. Dykstra, J Invest Dermatol 121, 813 (Oct, 2003). 19. C. Bayerl, S. Taake, I. Moll, E. G. Jung, Photodermatol Photoimmunol Photomed 11, 149 (Aug, 1995). 20. J. Cadet, E. Sage, T. Douki, Mutat Res 571, 3 (Apr 1, 2005). 21. A. T. Sands, A. Abuin, A. Sanchez, C. J. Conti, A. Bradley, Nature 377, 162 (Sep l4, 1995). 22. N. Le Fur, W. K. Silvers, S. R. Kelsall, B. Mintz, Proc Natl Acad Sci U S A 94, 7561 (JuI 8, 1997). 23. L. S. Robbins et al., Cell 72, 827 (Mar 26, 1993). 24. J. Bolognia, M. Murray, J. Pawelek, J Invest Dermatol 92, 651 (May, 1989). 25. S. Im et al., Cancer Res 58, 47 (Jan 1, 1998). 26. I. Suzuki et al., J Investig Dermatol Symp Proc 4, 29 (Sep, 1999). 27. G. Barsh, T. Gunn, L. He, S. Schlossman, J. Duke-Cohan, Pigment Cell Res 13 Suppl 8, 48 (2000). 28. Y. Yada, K. Higuchi, G. Imokawa, J Biol Chem 266, 18352 (Sep 25, 1991). 29. R. Halaban, Pigment Cell Res 13, 4 (Feb, 2000). 30. T. Hirobe, Development 114, 435 (Feb, 1992). 31. A. L. Cook et al. , J Invest Dermatol 121, 1150 (Nov, 2003). 32. M. W. Lassalle et al, Pigment Cell Res 16, 8 1 (Feb, 2003). 33. J. M. Grichnik, J. A. Burch, J. Burchette, C. R. Shea, J Invest Dermatol 111, 233 (Aug, 1998). 34. A. L. Kadekaro et al. , Cancer Res 65, 4292 (May 15, 2005). 35. M. D. Galibert, S. Carreira, C. R. Goding, Embo J 20, 5022 (Sep 3, 2001). 36. J. Nordlund, The Pigmentary System: Physiology and Pathophysiology (Blackwell Publishing, ed. 2, 2005), pp. 37. S. Q. Wanget al., J Am Acad Dermatol 44, 837 (May, 2001). 38. P. Wolf, C. K. Donawho, M. L. Kripke, J Natl Cancer Inst 86, 99 (Jan 19, 1994). 39. I. Freedberg et al., Fitzpatrick's Dermatology in General Medicine (McGraw- Hill, ed. 6th, 2003), pp. 40. T. L. Diepgen, V. Mahler, Br J Dermatol 146 Suppl 61, 1 (Apr, 2002). 4 1. W. Brenner, F. Gschnait, Arch Dermatol Res 266, 11 (Aug, 1979). 42. B. Saha, S. Kumar, S. Chinmoy, R. Bera, J. Ratha, D. Tobin, R. Barda, Pig. Cell Res. 19, 595 (Dec, 2006). 43. M.A. Pathak, K. Stratton, Arch. Biochem. Biophys. 123, 468 (March 11, 1968) 44. T. Tadokoro, Y. Yamaguchi, J. Batzer, S.G. Coelho, B.Z. Zmudzka, S.A. Miller, R. Wolber, J.Z. Beer, V.J. Hearing, J. Invest. Dermatol. 124, 1326 (June, 2005) 45. M.S. Eller and B.A. Gilchrest, Pig Cell. Res. 13(Suppl. 8), 94 (June, 2000). 46. D.M. Carter, B.V. Jegasothy, E.S. Condit, J. Invest. Dermatol., 60, 274 (May, 1973) EQUIVALENTS: Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. All patents, publications, and other references cited above are hereby incorporated by reference in their entirety. CLAIMS 1. A composition for inducing UV-independent pigmentation of human skin and/or for enhancing UV-dependent pigmentation of human skin, comprising an McIr agonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 2. The composition of claim 1, comprising micro- or nanoparticles of an McIr agonist and a bioadhesive coating or matrix, wherein (i) said particles penetrate the human skin and release the McIr agonist to contact melanocytes in the skin in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin, and (ii) said composition leaves no visible residue on the skin one hour after administration. 3. The composition of claim 1, wherein the McIr agonist is formulated as a composition comprising a liposome preparation, an organogel, a humectant, a non-ionic surfactant or chitosan to enhance penetration of the stratum corneum. 4. A dermatological or cosmetological composition for an external topical administration to human skin, comprising together with pharmaceutically and/or cosmetologically acceptable excipients: at least one UVA-stabilizing and/or UVB-stabilizing screening agent, and an McJr agonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 5. A composition for inducing UV-independent pigmentation of human skin, comprising an McIr agonist, formulated for oral administration, which acts systemically on melanocytes in the skin to induce melanogenesis, and provided in an amount sufficient to cause macroscopically observable pigmentation. 6. The compositions of claims 1, 2, 3, 4, or 5, wherein said McIr agonist is an agonist of both a loss-of-function allele of McIr, such as a variant shown in Table 1, as well as Λfc7r E/E or a combination of two or more thereof. 7. The compositions of claim 6, wherein said McIr agonist is a cyclic AMP (cAMP) agonist. 8. The composition of claim 7, wherein said cAMP agonist activates adenylate cyclase. 9. The composition of claim 8, wherein said cAMP agonist is forskolin or a derivative thereof. 10. The composition of claim 7, wherein said cAMP agonist is a cAMP analog. 11. The composition of claim 7, wherein said cAMP agonist is a phosphodiesterase (PDE) inhibitor. 12. The composition of claim 11, wherein said PDE inhibitor is a PDE3 inhibitor, a PDE4 inhibitor, a cAMP-specific PDE inhibitor and/or a combination or two or more thereof. 13. The composition of claim 11, wherein said cAMP agonist is rolipram or a derivative thereof. 14. The composition of claim 11, wherein said cAMP agonist comprises one or more compounds in Table 2 and Table 3. 15. The composition of claim 6, wherein said McIr agonist comprises forskolin or a derivative thereof, and rolipram or a derivative thereof. 16. The compositions of claims 1, 2, 3, 4, or 5, provided in the form of a gel, a cream or a lotion. 17. The composition of claim 2, wherein said particles have a mean diameter of about 100 microns or less. 18. The composition of claim 2, wherein said particles have a mean diameter of about 1 micron or less. 19. The composition of claim 2, wherein said composition is less irritating when applied to skin than the McIr agonist applied to skin alone. 20. The composition of claim 2 or 19, wherein the composition is substantially free of surfactants. 21. The composition of claim 2, wherein the bioadhesive coating or matrix comprises a polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyphosphazines, polyacrylamides, poly(vinyl alcohols), polysiloxanes, polyvinylpyrrolidone, polyglycolides, polyurethanes, polystyrene, polyvinylphenol, polymers of acrylic and methacrylic esters, polylactides, copolymers of polylactides and polyglycolides, poly(butic acid), poly(valeric acid), poly(lactide-co-caprolactone), poly[lactide-co- glycolide], polyanhydrides, polyorthoesters, blends and copolymers thereof. 22. The composition of claim 2, wherein the bioadhesive coating or matrix is a polysaccharide selected from the group consisting of alkyl celluloses, cellulose ethers, cellulose esters, nitrocelluloses, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxymethyl cellulose, cellulose triacetate, and cellulose sulfate sodium salt. 23. The compositions of claims 1, 2, 3, 4, or 5, further including one or more of a lipid soluble vitamin A, D, E, and K and derivatives, alpha lipoic acid, lipid soluble anti-oxidants, aromatic oils, orange oil, seabuckthorn oil, and fragrances. 24. The compositions of claims 1, 2, 3, 4, or 5, further including at least one photo-protective agent. 25. The compositions of claims 24, further including at least one compound selected from the group consisting of: physical sunblocks, sunscreens, and free-radical scavengers. 26. The compositions of claims 1, 2, 3, 4, or 5, further comprising at least one compound selected from the group consisting of: an anti-inflammatory agent, an anti-acne agent, an anti-wrinkle agent, an anti-scarring agent, an anti- psoriatic agent, an antiproliferative agent, an anti-fungal agent, an anti-viral agent, an anti-septic agent, a local anaesthetic, a keratolytic agent, a hair growth stimulant, and a hair growth inhibitor. 27. A method for inducing UV-independent pigmentation of human skin, comprising administering a composition of any of claims 1-26 in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 28. A method for protecting human skin from the ultraviolet radiation, comprising administering a composition of any of claims 1-26 in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 29. A method for reducing the rate formation of solar erythema, solar allergies or solar elastosis, comprising administering a composition of any of claims 1- 26 in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 30. A method for preventing or delaying actinic ageing of human skin, comprising administering a composition of any of claims 1-26 in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 3 1. A method for treating or preventing a disease or disorder in a mammal caused by ultraviolet radiation, comprising administering an effective amount of a composition of any of claims 1-26 in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin. 32. The method of claim 31, wherein the disease or disorder is selected from the group consisting of: acne vulgaris, actinic keratoses, photodermatitis, photo- induced lupus erthematosus, xeroderma pigmentosum, photosensitizing effects of a drug (such as tetracycline) and skin cancer. 33. Use of an McIr agonist for the manufacture of a medicament or cosmetic preparation for inducing UV-independent pigmentation of human skin. 34. A packaged cosmetic preparation for inducing UV-independent pigmentation of human skin, comprising an McIr agonist in an amount sufficient to cause macroscopically observable pigmentation when applied to human skin, and a package label or insert providing directions for applying the McIr agonist. 35. The packaged cosmetic preparation of claim 34, including a package label or insert providing directions for a fair skinned human subject to apply the McIr agonist to an area of skin which is intended to be darkened. 36. A method for conducting a cosmetics business, comprising: (i) providing a cosmetic formulation including the composition of any of claims 1-26, for inducing UV-independent pigmentation of human skin; and (ii) marketing the cosmetic formulation for one or more uses by human subjects selected from sunless tanning, protecting human skin from the ultraviolet radiation, reducing the rate formation of solar erythema, solar allergies or solar elastosis, and/or preventing or delaying actinic ageing. 37. The method of claim 36, wherein the marketing is directed to individuals having an McIr loss-of-function genotype. 38. A composition for reducing pigmentation of human skin, comprising an McIr antagonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to reduce pigmentation when applied to human skin. 39. The composition of claim 38, comprising micro- or nanoparticles of the McIr antagonist and a bioadhesive coating or matrix, wherein (i) said particles penetrate the human skin and release the McIr antagonist to contact melanocytes in the skin and reduce pigmentation when applied to human skin, and (ii) said composition leaves no visible residue on the skin one hour after administration. 40. The composition of claim 38, wherein the McIr antagonist is formulated as a composition comprising a liposome preparation, an organogel, a humectant, a non-ionic surfactant or chitosan to enhance penetration of the stratum corneum. 41. A dermatological or cosmetological composition for an external topical administration to human skin, comprising, together with pharmaceutically and/or cosmetologically acceptable excipients: at least one UVA-stabilizing and/or UVB-stabilizing screening agent, and an McIr antagonist, formulated to penetrate the human skin to the stratum basale, and provided in an amount sufficient to reduce UV-dependent pigmentation of treated human skin. 42. A composition for reducing UV-independent pigmentation of human skin, comprising an McIr antagonist, formulated for oral administration, which acts systemically on melanocytes in the skin to reduce melanogenesis. 43. The compositions of claim 40, 41, or 42, wherein said McIr antagonist is a cyclic AMP (cAMP) antagonist. 44. The compositions of claim 40, 41, or 42, wherein said McIr antagonist is a PKA inhibitor. A . CLASSIFICATION OF SUBJECT MATTER INV . A61K45/06 According to International Patent Classification (IPC) or to both national classification and IPC B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) A61K Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Electronic data base consulted during the international search (name of data base and, where practical, search terms used) EPO-Internal , EMBASE, BIOSIS, WPI Data C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No FR 2 831 439 A (OREAL [FR]) 1-44 2 May 2003 (2003-05-02) page 1 , paragraph 1 page 4 , line 19 - page 5 , line 21; claims 1-44 1-4 page 5 , line 23 - page 6 , line 9 page 14, line 8 - line 10 EP 0 302 147 A (PROCTER & GAMBLE [US]) 1-44 8 February 1989 (1989-02-08) page 2 , line 4 - line 5 page 4 , line 14 - line 17 1-44 page 4 , line 35 - line 41; examples I— III Further documents are listed In the continuation of Box C See patent family annex * Special categories of cited documents "T" later document published after the international filing date or pnority date and not in conflict with the application but "A" document defining the general state of the art which is not cited to understand the principle or theory underlying the considered to be of particular relevance invention 1 "E earlier document but published on or after the international "X" document of particular relevance, the claimed invention filing date cannot be considered novel or cannot be considered to "L" document which may throw doubts on prionty claιm(s) or involve an inventive step when the document is taken alone which is cited to establish the publication date of another "Y" document of particular relevance, the claimed invention citation or other special reason (as specified) cannot be considered to involve an inventive step when the "O" document referring to an oral disclosure, use, exhibition or document is combined with one or more other such docu¬ other means ments, such combination being obvious to a person skilled "P" document published prior to the international filing date but in the art later than the priority date claimed ■&' document member of the same patent family Date of the actual completion of the international search Date of mailing of the international search report 13 August 2007 04/10/2007 Name and mailing address of the ISA/ Authorized officer European Patent Office, P B 5818 Patentlaan 2 NL - 2280 HV Rijswijk TeI (+31-70) 340-2040, Tx 3 1 651 epo nl, Fax (+31-70) 340-3016 Bend! , Ernst Form PCT/ISA/210 (second sheet) (April 2005) C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No FR 2 872 041 A l (MAURICE MESSEGUE SOC PAR 1-44 ACTIO [FR]) 30 December 2005 (2005-12-30) page 3 , paragraph 1 page 3 , line 37 - page 4 , line 9 examples 2,4,5 TSATMALI M ET AL: "Melanocyte function 1-44 and its control by melanocortin peptides" THE JOURNAL OF HISTOCHEMISTRY & CYTOCHEMISTRY, vol. 50, no. 2 , 2002, pages 125-133, XP002446604 abstract page 125 page 127, right-hand column, paragraph 1 WO 2005/032506 A (BEIERSDORF AG [DE]; 1-44 WOLBER RAINER [DE]; SCHERNER CATHRIN [DE]; TOM DIE) 14 April 2005 (2005-04-14) page 1 1-44 page 2 , line 31 - page 3 , line 2 page 2 , line 19 - line 35 page 10, line 28 - page 12, line 2 1 page 20, line 1 - line 18 page 22, line 24 - page 23, line 31 page 29, line 7 - line 8 DATABASE MEDLINE [Online] 1-44 US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; January 1997 (1997-01), SIEGRIST W ET AL: "Interactions of alpha-melanotropin and agouti on B16 melanoma cells: evidence for inverse agon ism of agouti . " XP002446606 Database accession no. NLM9029482 abstract & JOURNAL OF RECEPTOR AND SIGNAL TRANSDUCTION RESEARCH 1997 JAN-MAY, vol. 17, no. 1-3, January 1997 (1997-01), pages 75-98, ISSN: 1079-9893 Form PCT/ISA/210 (continuation of second sheet) (April 2005) . PCT/US2007/007935 INTERNATIONAL SEARCH REPORT Box Il Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet) This International Search Report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons: 1. X j Claims Nos.: 36-37 because they relate to subject matter not required to be searched by this Authority, namely: Rule 39 .1(111 ) PCT - Scheme, rules and method for doing business Remark: Although claims 27-32 are directed to a method of treatment of the human/animal body, the search has been carried out and based on the alleged effects of the compound/composition. 2. Claims Nos.: because they relate to parts of the International Application that do not comply with the prescribed requirements to such an extent that no meaningful International Search can be carried out, specifically: 3. Claims Nos.: because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). Box III Observations where unity of invention is lacking (Continuation of item 3 of first sheet) This International Searching Authority found multiple inventions in this international application, as follows: As all required additional search fees were timely paid by the applicant, this International Search Report covers all searchable claims. 2. As all searchable claims could be searched without effort justifying an additional fee, this Authority did not invite payment of any additional fee. 3. As only some of the required additional search fees were timely paid by the applicant, this International Search Report covers only those claims for which fees were paid, specifically claims Nos.: 4. ) No required additional search fees were timely paid by the applicant. Consequently, this International Search Report is restricted to the invention first mentioned in the claims; it is covered by claims Nos.: Remark on Protest The additional search fees were accompanied by the applicant's protest. No protest accompanied the payment of additional search fees. Form PCT/ISA/210 (continuation of first sheet (2)) (January 2004) Patent document Publication Patent family Publication cited in search report date member(s) date R 2831439 A 02-05-2003 NONE EP 0302147 A 08-02-1989 NONE FR 2872041 Al 30-12-2005 NONE WO 2005032506 A 14-04-2005 DE 10341663 A l 07-04-2005 EP 1677752 A l 12-07-2006 US 2007028400 A l 08-02-2007 Form PCT/ISA/210 (patent family annex) (April 2005)