DOCSLIB.ORG

Novel Hemotropic Mycoplasma Species in White-Tailed Deer (Odocoileus Virginianus)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Novel Hemotropic Mycoplasma Species in White-Tailed Deer (Odocoileus Virginianus) Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611 Contents lists available at ScienceDirect Comparative Immunology, Microbiology and Infectious Diseases jour nal homepage: www.elsevier.com/locate/cimid Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus) a,∗ b a Ricardo G. Maggi , M. Colter Chitwood , Suzanne Kennedy-Stoskopf , b Christopher S. DePerno a College of Veterinary Medicine, North Carolina State University, 1060 William Moore Drive, Raleigh, NC 27607, USA b Fisheries, Wildlife, and Conservation Biology Program, Department of Forestry and Environmental Resources, North Carolina State University, 110 Brooks Avenue, Raleigh, NC 27607, USA a r t a b i c l e i n f o s t r a c t Article history: Globally, hemotropic Mycoplasma spp. are emerging or re-emerging zoonotic pathogens Received 29 January 2013 that affect livestock, wildlife, companion animals, and humans, potentially causing seri- Received in revised form 8 August 2013 ous and economically important disease problems. Little is known about hemotropic Accepted 13 August 2013 Mycoplasma spp. prevalence, host-specificity, or route of transmission in most species, including wildlife. DNA amplification by PCR targeting the 16SrRNA and the RNaseP genes Keywords: was used to establish the presence and prevalence of hemotropic Mycoplasma spp. in a Hemoplasma white-tailed deer (O. virginianus) population in eastern North Carolina. Sixty-five deer (89%) Hemotropic Mycoplasma tested positive for hemotropic Mycoplasma spp. where sequence analysis of the 16SsRNA Odocoileus virginianus White-tailed deer and the RNaseP genes indicated the presence of at least three distinct species. This study rep- Zoonotic diseases resents the first detection of three distinct hemotropic Mycoplasma species in white-tailed deer and the first report of two novel hemotropic Mycoplasma species. © 2013 Elsevier Ltd. All rights reserved. 1. Introduction [12–17], companion animals [1,4,18–22], and humans [23–28], causing potentially serious and economically Hemotropic Mycoplasma spp. (hemoplasmas) are cell- important diseases problems. wall deficient, obligate epierythrocytic bacteria that infect Mycoplasma ovis, a hemoplasma parasite of sheep and numerous animal species, including humans. Infections goats [7–10], has been associated with lethargy and anemia are often chronic and sub-clinical; however, animals can of varying severities in captive reindeer (Rangifer tarandus) develop hemolytic anemia, particularly when: immuno- and in farm-raised white-tailed deer (Odocoileus virgini- suppressed; stressed from poor nutrition, pregnancy or anus) [13,16]. A high rate of infection with Mycoplasma ovis lactation; or concurrently infected with other, more viru- – like organisms has been also reported in several other lent pathogens or more than one Mycoplasma species [1–4]. cervids species (Blastocerus dichotomus, Mazama nana, and Globally, Mycoplasma spp. are emerging or re-emerging Mazama americana) raised in captivity [15] as well as in free zoonotic pathogens that affect livestock [5–11], wildlife ranging species (B. dichotomus, Ozotocerus bezoarticus, and O. bezoarticus) [14]. More recently, M. ovis or infection with a Mycoplasma ovis – like organisms has been also described ∗ Corresponding author at: Intracellular Pathogens Research Labora- infecting dogs [22] and humans [23,25] highlighting the tory, College of Veterinary Medicine, North Carolina State University, 1060 potential zoonotic potential of this species. William Moore Drive, Raleigh, NC 27607, USA. Tel.: +1 919 513 8273; The objective of this study was to determine the molec- fax: +1 919 515 3440. ular prevalence of hemotropic Mycoplasma species in 73 E-mail address: [email protected] (R.G. Maggi). 0147-9571/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.cimid.2013.08.001 608 R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611 Table 1 Sequence homologies on the 16SrRNA gene (partial sequence) (Genbank accession numbers in parenthesis). Sample ID Mycoplasma spp. deer Mycoplasma spp. deer Mycoplasma spp. deer Mycoplasma wenyonii USA (FJ824847) Brazil (HQ634379) Japan (AB558899) (EU367964) 10 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) 28 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) 61 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) Group A 65 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) 66 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) 7 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) 46 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) 47 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) Group B 63 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) 70 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) 6 1091/1134 (96.2%) 1111/1134 (97.8%) 1088/1134 (95.9%) 1076/1134 (94.9%) Group C 74 1091/1134 (96.2%) 1111/1134 (97.8%) 1088/1134 (95.9%) 1076/1134 (94.9%) free-ranging white-tailed deer (O. virginianus) from a hunt- 2.4. DNA testing ing preserve in eastern North Carolina. All blood samples were analyzed for the presence of hemotropic Mycoplasma DNA by PCR targeting a 1380 bp 2. Materials and methods region of the 16S rRNA, and a 165 bp region of the RNAse P gene as previously described [23,31]. DNA from 200 2.1. Sample selection micro-liter of blood–EDTA from each white-tailed deer was extracted using a Qiamp DNA Mini Kit (QIAGEN Inc., During a population health assessment in July 2008 Valencia, CA). After extraction following the manufacture and March 2009, 73 white-tailed deer (13 males and 60 protocol, DNA concentration and quality was measured female) from eastern North Carolina were surveyed for the using absorbance ratio between 260/280 nm (Nanodrop, ◦ ∼ presence of Mycoplasma spp. Hofmann Forest ( 34 53 N, Thermo Scientific, USA). Amplification of hemotropic ∼ ◦ 77 23 W), owned and managed by the North Carolina Mycoplasma 16S rRNA was performed using two sets of State Natural Resources Foundation, is a 31,565-acre tract oligonucleotides HemMycop16S-41s: 5 GYATGCMTAAY- managed for loblolly pine production. Hofmann Forest has ACATGCAAGTCGARCG 3 and HemMyco16S-938as: 5 nine hunt clubs (>400 members) that use hounds to hunt CTCCACCACTTGTTCAGGTCCCCGTC 3 and HemMycop16S- white-tailed deer (estimated population of 2000–5000 322s: 5 GCCCATATTCCTACGGGAAGCAGCAGT 3 and deer) [29,30]. HemMycop16S-1420as: 5 GTTTGACGGGCGGTGTGTA- CAAGACC 3 . Sequence derived from amplicons obtained from each primer set (with an overlap of 600 bp to assure 2.2. Blood sampling consistency in species identification from each sample) was aligned and edited using AlignX (Vector NTI suite Deer blood was obtained via cardiac puncture imme- 11.5.1). Similarly, amplification of Mycoplasma RNaseP diately after animals were killed by head-shot with a gene was performed using oligonucleotides HemoMyco high-powered rifle. Blood samples were collected using RNaseP30s: 5 GAT KGT GYG AGY ATA TAA AAA ATA AAR an evacuated tube system (Vacutainer, Beckon, Dickson CTC RAC 3 and HemoMyco RNaseP200as: 5 GMG GRG and Company, Franklin Lakes, NJ, USA) and analyzed for TTT ACC GCG TTT CAC 3 as forward and reverse primers, ◦ − packed cell volume (PCV) in situ and stored at 20 C until respectively. Amplification was performed in a 25-␮l final ® processed. volume reaction containing 12.5 ␮l of Tak-Ex Premix (Fisher Scientific), 0.25 ␮l of 30 ␮M of each forward and ® reverse primer (IDT DNA Technology), 8 ␮l of molecular 2.3. Body gross examination and health condition grade water, and 5 ␮l of DNA from each sample tested. analysis PCR negative controls were prepared using 5 ␮l of DNA from blood of a healthy dog and positive controls were Gross body condition of each animal, assessed in the prepared using 5 ␮l of DNA from dog blood infected with field by wildlife biologists and veterinarians, was evalu- Mycoplasma hematoparvum. Conventional PCR was per- ® ated on the basis of body-condition indicators (e.g., kidney formed in an Eppendorf Mastercycler EPgradient under ◦ fat, femur marrow fat) and later by blood analysis (glu- the following conditions: a single hot-start cycle at 95 C ◦ cose, urea nitrogen, creatinine, total protein, albumin, total for 2 min followed by 55 cycles of: denaturing at 94 C ◦ ◦ bilirubin, alkaline phosphatase, alanine aminotransferase, for 15 s, annealing at 68 C (16SrRNA) or 59 C (RNaseP) ◦ aspartate aminotransferase, cholesterol, calcium, phos- for 15 s, and extension at 72 C for 18 s. Amplification was ◦ phorus, sodium, potassium, chloride, albumin/globulin completed by an additional cycle at 72 C for 30 s, and prod- ratio, BUN/creatinine ratio, globulin, and creatine kinase, ucts were analyzed by 2% agarose gel electrophoresis with as previously described [30]. detection using ethidium bromide under ultraviolet light. R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611 609 96 Group A (KC512404) 97 Mycoplasma Deer USA (FJ824847) 98 Mycoplasma Deer Japan (AB558899) Mycoplasma Deer Brazil (HQ634379) 98 Group B (KC512403) 47 Group C (KC512403) Mycoplasma wenyonii (EU367964) Mycoplasma pneumoniae (NR 041751) 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00 Fig. 1. Neighbor-joining phylogeny reconstruction of the three hemotropic Mycoplasma species
Load more

Recommended publications
  • BIGHORN SHEEP Ovis Canadensis Original1 Prepared by R.A
    BIGHORN SHEEP Ovis canadensis Original1 prepared by R.A. Demarchi Species Information Distribution Global Taxonomy The genus Ovis is present in west-central Asia, Until recently, three species of Bighorn Sheep were Siberia, and North America (and widely introduced recognized in North America: California Bighorn in Europe). Approximately 38 000 Rocky Mountain Sheep (Ovis canadensis californiana), Rocky Bighorn Sheep (Wishart 1999) are distributed in Mountain Bighorn Sheep (O. canadensis canadensis), scattered patches along the Rocky Mountains of and Desert Bighorn Sheep (O. canadensis nelsoni). As North America from west of Grand Cache, Alberta, a result of morphometric measurements, and to northern New Mexico. They are more abundant protein and mtDNA analysis, Ramey (1995, 1999) and continuously distributed in the rainshadow of recommended that only Desert Bighorn Sheep and the eastern slopes of the Continental Divide the Sierra Nevada population of California Bighorn throughout their range. Sheep be recognized as separate subspecies. California Bighorn Sheep were extirpated from most Currently, California and Rocky Mountain Bighorn of the United States by epizootic disease contracted sheep are managed as separate ecotypes in British from domestic sheep in the 1800s with a small Columbia. number living in California until 1954 (Buechner Description 1960). Since 1954, Bighorn Sheep have been reintroduced from British Columbia to California, California Bighorn Sheep are slightly smaller than Idaho, Nevada, North Dakota, Oregon, Utah, and mature Rocky Mountain Bighorn Sheep Washington, resulting in their re-establishment in (McTaggart-Cowan and Guiguet 1965). Like their much of their historic range. By 1998, California Rocky Mountain counterpart, California Bighorn Bighorn Sheep were estimated to number 10 000 Sheep have a dark to medium rich brown head, neck, (Toweill 1999).
    [Show full text]
  • Antelope, Deer, Bighorn Sheep and Mountain Goats: a Guide to the Carpals
    J. Ethnobiol. 10(2):169-181 Winter 1990 ANTELOPE, DEER, BIGHORN SHEEP AND MOUNTAIN GOATS: A GUIDE TO THE CARPALS PAMELA J. FORD Mount San Antonio College 1100 North Grand Avenue Walnut, CA 91739 ABSTRACT.-Remains of antelope, deer, mountain goat, and bighorn sheep appear in archaeological sites in the North American west. Carpal bones of these animals are generally recovered in excellent condition but are rarely identified beyond the classification 1/small-sized artiodactyl." This guide, based on the analysis of over thirty modem specimens, is intended as an aid in the identifi­ cation of these remains for archaeological and biogeographical studies. RESUMEN.-Se han encontrado restos de antilopes, ciervos, cabras de las montanas rocosas, y de carneros cimarrones en sitios arqueol6gicos del oeste de Norte America. Huesos carpianos de estos animales se recuperan, por 10 general, en excelentes condiciones pero raramente son identificados mas alIa de la clasifi­ cacion "artiodactilos pequeno." Esta glia, basada en un anaIisis de mas de treinta especlmenes modemos, tiene el proposito de servir como ayuda en la identifica­ cion de estos restos para estudios arqueologicos y biogeogrMicos. RESUME.-On peut trouver des ossements d'antilopes, de cerfs, de chevres de montagne et de mouflons des Rocheuses, dans des sites archeologiques de la . region ouest de I'Amerique du Nord. Les os carpeins de ces animaux, generale­ ment en excellente condition, sont rarement identifies au dela du classement d' ,I artiodactyles de petite taille." Le but de ce guide base sur 30 specimens recents est d'aider aidentifier ces ossements pour des etudes archeologiques et biogeo­ graphiques.
    [Show full text]
  • Genital Brucella Suis Biovar 2 Infection of Wild Boar (Sus Scrofa) Hunted in Tuscany (Italy)
    microorganisms Article Genital Brucella suis Biovar 2 Infection of Wild Boar (Sus scrofa) Hunted in Tuscany (Italy) Giovanni Cilia * , Filippo Fratini , Barbara Turchi, Marta Angelini, Domenico Cerri and Fabrizio Bertelloni Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy; fi[email protected] (F.F.); [email protected] (B.T.); [email protected] (M.A.); [email protected] (D.C.); [email protected] (F.B.) * Correspondence: [email protected] Abstract: Brucellosis is a zoonosis caused by different Brucella species. Wild boar (Sus scrofa) could be infected by some species and represents an important reservoir, especially for B. suis biovar 2. This study aimed to investigate the prevalence of Brucella spp. by serological and molecular assays in wild boar hunted in Tuscany (Italy) during two hunting seasons. From 287 animals, sera, lymph nodes, livers, spleens, and reproductive system organs were collected. Within sera, 16 (5.74%) were positive to both rose bengal test (RBT) and complement fixation test (CFT), with titres ranging from 1:4 to 1:16 (corresponding to 20 and 80 ICFTU/mL, respectively). Brucella spp. DNA was detected in four lymph nodes (1.40%), five epididymides (1.74%), and one fetus pool (2.22%). All positive PCR samples belonged to Brucella suis biovar 2. The results of this investigation confirmed that wild boar represents a host for B. suis biovar. 2 and plays an important role in the epidemiology of brucellosis in central Italy. Additionally, epididymis localization confirms the possible venereal transmission. Citation: Cilia, G.; Fratini, F.; Turchi, B.; Angelini, M.; Cerri, D.; Bertelloni, Keywords: Brucella suis biovar 2; wild boar; surveillance; epidemiology; reproductive system F.
    [Show full text]
  • Anaplasma Phagocytophilum and Babesia Species Of
    pathogens Article Anaplasma phagocytophilum and Babesia Species of Sympatric Roe Deer (Capreolus capreolus), Fallow Deer (Dama dama), Sika Deer (Cervus nippon) and Red Deer (Cervus elaphus) in Germany Cornelia Silaghi 1,2,*, Julia Fröhlich 1, Hubert Reindl 3, Dietmar Hamel 4 and Steffen Rehbein 4 1 Institute of Comparative Tropical Medicine and Parasitology, Ludwig-Maximilians-Universität München, Leopoldstr. 5, 80802 Munich, Germany; [email protected] 2 Institute of Infectology, Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald Insel Riems, Germany 3 Tierärztliche Fachpraxis für Kleintiere, Schießtrath 12, 92709 Moosbach, Germany; [email protected] 4 Boehringer Ingelheim Vetmedica GmbH, Kathrinenhof Research Center, Walchenseestr. 8-12, 83101 Rohrdorf, Germany; [email protected] (D.H.); steff[email protected] (S.R.) * Correspondence: cornelia.silaghi@fli.de; Tel.: +49-0-383-5171-172 Received: 15 October 2020; Accepted: 18 November 2020; Published: 20 November 2020 Abstract: (1) Background: Wild cervids play an important role in transmission cycles of tick-borne pathogens; however, investigations of tick-borne pathogens in sika deer in Germany are lacking. (2) Methods: Spleen tissue of 74 sympatric wild cervids (30 roe deer, 7 fallow deer, 22 sika deer, 15 red deer) and of 27 red deer from a farm from southeastern Germany were analyzed by molecular methods for the presence of Anaplasma phagocytophilum and Babesia species. (3) Results: Anaplasma phagocytophilum and Babesia DNA was demonstrated in 90.5% and 47.3% of the 74 combined wild cervids and 14.8% and 18.5% of the farmed deer, respectively. Twelve 16S rRNA variants of A. phagocytophilum were delineated.
    [Show full text]
  • SPR-659: Genetic Variation of Pronghorn Across US Route 89 And
    Genetic Variation of Pronghorn across US Route 89 and State Route 64 Final Report 659 March 2012 Arizona Department of Transportation Research Center Genetic Variation of Pronghorn across US Route 89 and State Route 64 Final Report 659 March 2012 Prepared by: Tad Theimer, Scott Sprague, Ellyce Eddy, and Russell Benford Department of Biological Sciences Northern Arizona University Box 5640 Flagstaff, AZ 86011 Prepared for: Arizona Department of Transportation In cooperation with U.S. Department of Transportation Federal Highway Administration The contents of this report reflect the views of the authors who are responsible for the facts and the accuracy of the data presented herein. The contents do not necessarily reflect the official views or policies of the Arizona Department of Transportation or the Federal Highway Administration. This report does not constitute a standard, specification, or regulation. Trade or manufacturers’ names that may appear herein are cited only because they are considered essential to the objectives of the report. The US government and the State of Arizona do not endorse products or manufacturers. Cover photos courtesy of Wikipedia Commons. Technical Report Documentation Page 1. Report No. 2. Government Accession No. 3. Recipient's Catalog No. FHWA-AZ-12-659 4. Title and Subtitle 5. Report Date GENETIC VARIATION OF PRONGHORN ACROSS US ROUTE 89 AND March 2012 STATE ROUTE 64 6. Performing Organization Code 7. Author 8. Performing Organization Report No. Tad Theimer, Scott Sprague, Ellyce Eddy, Russell Benford 9. Performing Organization Name and Address 10. Work Unit No. Northern Arizona University Box 5640, Beaver Street Flagstaff, AZ 86011 11.
    [Show full text]
  • Evaluating How Swedish Hunters Determine Which Species Belong in Nature
    European Journal of Wildlife Research (2020) 66: 77 https://doi.org/10.1007/s10344-020-01418-6 ORIGINAL ARTICLE Evaluating how Swedish hunters determine which species belong in nature M. Nils Peterson1 & Alyssa Chen1 & Erica von Essen1 & Hans Peter Hansen1 Received: 30 January 2020 /Revised: 17 August 2020 /Accepted: 24 August 2020 / Published online: 27 August 2020 # Springer-Verlag GmbH Germany, part of Springer Nature 2020 Abstract Understanding whether people view non-native species as belonging in a place will help guide important conservation efforts ranging from eradications of exotics to re-introduction of extirpated species. In this manuscript we describe the degree to which Swedish hunters perceive key wildlife species as belonging in Swedish nature. We surveyed 2014 Swedish hunters randomly selected from a database of all registered hunters with a 47.5% response rate. We measured hunters’ perceptions of the belonging of 10 key species on the Swedish landscape, compared them with confidence intervals for proportions, and predicted them using regression models. Construct validity was assessed through pretesting and focus groups. Our results suggest Swedish hunters consider species introduced wholly by humans as less likely to belong in Sweden compared with species that evolved in situ, species with negative socio-economic impact as less likely to belong in Sweden compared with species with no impact or positive economic impacts, and species with wide distributions to be seen as more likely to belong in Sweden compared with those with narrow distributions. Perceptions of wolves, fallow deer, and European rabbits differed from these broad trends potentially due to unique cultural constructions of belonging for the species and the duration since anthropogenic introductions for the latter species.
    [Show full text]
  • Preliminary Studies on the Etiology of Keratoconjunctivitis in Reindeer (Rangifer Tarandus Tarandus) Calves in Alaska
    Journal of Wildlife Diseases, 44(4), 2008, pp. 1051–1055 # Wildlife Disease Association 2008 Preliminary Studies on the Etiology of Keratoconjunctivitis in Reindeer (Rangifer tarandus tarandus) Calves in Alaska Alina L. Evans,1,5 Russell F. Bey,1 James V. Schoster,2 James E. Gaarder,3 and Gregory L. Finstad4 1 Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, 1971 Commonwealth Ave., St. Paul, Minnesota 55108, USA; 2 Animal Eye Consultants of Minnesota, Roseville, Minnesota 55113, USA; 3 Veterinary Eye Specialists, 1921 W Diamond Blvd., Suite 108, Anchorage, Alaska, 99515, USA; 4 Reindeer Research Program, University of Alaska, PO Box 757200, Fairbanks, Alaska, 99775; 5 Corresponding author (email: [email protected]) ABSTRACT: Keratoconjunctivitis outbreaks oc- and possibly contagious eye disease that cur each summer in reindeer (Rangifer tar- can leave animals blind or with impaired andus tarandus) herds in western Alaska, USA. vision. Keratoconjunctivitis is seen annu- This condition has not been well characterized nor has a definitive primary etiologic agent ally during the summer reindeer handlings been identified. We evaluated the eyes of 660 on the Seward Peninsula (Reindeer Re- calves near Nome, Alaska, between 29 June and search Program, University of Alaska 14 July 2005. Clinical signs of keratoconjuncti- Fairbanks, unpubl. data). vitis were observed in 26/660 calves (3.9%). Infectious keratoconjunctivitis has been Samples were collected from the conjunctival studied in numerous other species. In sac of both affected (n522) and unaffected (n524) animals for bacterial culture, enzyme- cattle, the primary pathogen has been linked immunosorbent assay testing for Chla- identified to be the piliated form of mydophila psittaci, and for polymerase chain Moraxella bovis (Ruehl et al., 1988).
    [Show full text]
  • Phylogeny of Dictyocaulus (Lungworms) from Eight Species of Ruminants Based on Analyses of Ribosomal RNA Data
    179 Phylogeny of Dictyocaulus (lungworms) from eight species of ruminants based on analyses of ribosomal RNA data J. HO¨ GLUND1*,D.A.MORRISON1, B. P. DIVINA1,2, E. WILHELMSSON1 and J. G. MATTSSON1 1 Department of Parasitology (SWEPAR), National Veterinary Institute and Swedish University of Agriculture Sciences, 751 89 Uppsala, Sweden 2 College of Veterinary Medicine, University of the Philippines Los Ban˜os, College, Laguna, 4031 Philippines (Received 8 November 2002; revised 8 February 2003; accepted 8 February 2003) SUMMARY In this study, we conducted phylogenetic analyses of nematode parasites within the genus Dictyocaulus (superfamily Trichostrongyloidea). Lungworms from cattle (Bos taurus), domestic sheep (Ovis aries), European fallow deer (Dama dama), moose (Alces alces), musk ox (Ovibos moschatus), red deer (Cervus elaphus), reindeer (Rangifer tarandus) and roe deer (Capreolus capreolus) were obtained and their small subunit ribosomal RNA (SSU) and internal transcribed spacer 2 (ITS2) sequences analysed. In the hosts examined we identified D. capreolus, D. eckerti, D. filaria and D. viviparus. However, in fallow deer we detected a taxon with unique SSU and ITS2 sequences. The phylogenetic position of this taxon based on the SSU sequences shows that it is a separate evolutionary lineage from the other recognized species of Dictyocaulus. Furthermore, the analysis of the ITS2 sequence data indicates that it is as genetically distinct as are the named species of Dictyocaulus. Therefore, either this taxon needs to be recognized as a new species, or D. capreolus, D. eckerti and D. viviparus need to be combined into a single species. Traditionally, the genus Dictyocaulus has been placed as a separate family within the superfamily Trichostrongyloidea.
    [Show full text]
  • Mixed-Species Exhibits with Pigs (Suidae)
    Mixed-species exhibits with Pigs (Suidae) Written by KRISZTIÁN SVÁBIK Team Leader, Toni’s Zoo, Rothenburg, Luzern, Switzerland Email: [email protected] 9th May 2021 Cover photo © Krisztián Svábik Mixed-species exhibits with Pigs (Suidae) 1 CONTENTS INTRODUCTION ........................................................................................................... 3 Use of space and enclosure furnishings ................................................................... 3 Feeding ..................................................................................................................... 3 Breeding ................................................................................................................... 4 Choice of species and individuals ............................................................................ 4 List of mixed-species exhibits involving Suids ........................................................ 5 LIST OF SPECIES COMBINATIONS – SUIDAE .......................................................... 6 Sulawesi Babirusa, Babyrousa celebensis ...............................................................7 Common Warthog, Phacochoerus africanus ......................................................... 8 Giant Forest Hog, Hylochoerus meinertzhageni ..................................................10 Bushpig, Potamochoerus larvatus ........................................................................ 11 Red River Hog, Potamochoerus porcus ...............................................................
    [Show full text]
  • List of 28 Orders, 129 Families, 598 Genera and 1121 Species in Mammal Images Library 31 December 2013
    What the American Society of Mammalogists has in the images library LIST OF 28 ORDERS, 129 FAMILIES, 598 GENERA AND 1121 SPECIES IN MAMMAL IMAGES LIBRARY 31 DECEMBER 2013 AFROSORICIDA (5 genera, 5 species) – golden moles and tenrecs CHRYSOCHLORIDAE - golden moles Chrysospalax villosus - Rough-haired Golden Mole TENRECIDAE - tenrecs 1. Echinops telfairi - Lesser Hedgehog Tenrec 2. Hemicentetes semispinosus – Lowland Streaked Tenrec 3. Microgale dobsoni - Dobson’s Shrew Tenrec 4. Tenrec ecaudatus – Tailless Tenrec ARTIODACTYLA (83 genera, 142 species) – paraxonic (mostly even-toed) ungulates ANTILOCAPRIDAE - pronghorns Antilocapra americana - Pronghorn BOVIDAE (46 genera) - cattle, sheep, goats, and antelopes 1. Addax nasomaculatus - Addax 2. Aepyceros melampus - Impala 3. Alcelaphus buselaphus - Hartebeest 4. Alcelaphus caama – Red Hartebeest 5. Ammotragus lervia - Barbary Sheep 6. Antidorcas marsupialis - Springbok 7. Antilope cervicapra – Blackbuck 8. Beatragus hunter – Hunter’s Hartebeest 9. Bison bison - American Bison 10. Bison bonasus - European Bison 11. Bos frontalis - Gaur 12. Bos javanicus - Banteng 13. Bos taurus -Auroch 14. Boselaphus tragocamelus - Nilgai 15. Bubalus bubalis - Water Buffalo 16. Bubalus depressicornis - Anoa 17. Bubalus quarlesi - Mountain Anoa 18. Budorcas taxicolor - Takin 19. Capra caucasica - Tur 20. Capra falconeri - Markhor 21. Capra hircus - Goat 22. Capra nubiana – Nubian Ibex 23. Capra pyrenaica – Spanish Ibex 24. Capricornis crispus – Japanese Serow 25. Cephalophus jentinki - Jentink's Duiker 26. Cephalophus natalensis – Red Duiker 1 What the American Society of Mammalogists has in the images library 27. Cephalophus niger – Black Duiker 28. Cephalophus rufilatus – Red-flanked Duiker 29. Cephalophus silvicultor - Yellow-backed Duiker 30. Cephalophus zebra - Zebra Duiker 31. Connochaetes gnou - Black Wildebeest 32. Connochaetes taurinus - Blue Wildebeest 33. Damaliscus korrigum – Topi 34.
    [Show full text]
  • Allozyme Divergence and Phylogenetic Relationships Among Capra, Ovis and Rupicapra (Artyodactyla, Bovidae)
    Heredity'S? (1991) 281—296 Received 28 November 7990 Genetical Society of Great Britain Allozyme divergence and phylogenetic relationships among Capra, Ovis and Rupicapra (Artyodactyla, Bovidae) E. RANOI,* G. FUSCO,* A. LORENZINI,* S. TOSO & G. TOSIt *g7ftj Nez/c nate di 9/clog/a del/a Selvaggine, Via Ca Fornacetta, 9 Ozzano dell'EmiIia (Bo) Italy, and j-Dipartimento di B/Wag/a, Universitâ diM/lana, Via Ce/ar/a, 3 Mi/epa,Italy Geneticdivergence and phylogenetic relationships between the chamois (Rupicaprini, Rupkapra rupicapra rupicapra) and three species of the Caprini (Capra aegagrus hircus, Capra ibex ibex and Ovis amrnon musUnon) have been studied by multilocus protein electrophoresis. Dendrograms have been constructed both with distance and parsimony methods. Goat, sheep and chamois pair- wise genetic distances had very similar values, All the topologies showed that Capra, Ovis and Rupicapra originate from the same internode, suggesting the hypothesis of a common, and almost contemporaneous, ancestor. The estimated divergence times among the three genera ranged from 5.28 to 7.08 Myr. These findings suggest the need to reconsider the evolutionary relationships in the Caprinae. Keywords:allozymes,Caprinae, electrophoresis phylogenetic trees. caprid lineage since the lower or middle Miocene. Introduction ShaDer (1977) agrees with the outline given by Thenius Theevolutionary relationships of the subfamily & Hofer (1960) supporting the idea of a more recent Caprinae (Artyodactyla, Bovidae; Corbet, 1978) have origin of the Caprini, and in particular of a Pliocenic been discussed by Geist (197!) within the framework splitting of Ovis and Capra. In Geist's (1971) opinion of his dispersal theory of Ice Age mammal evolution.
    [Show full text]
  • Reindeer {Rangifer Tarandus) Response to Feces and Urine from Sheep (Ovis Aries) and Reindeer
    Reindeer {Rangifer tarandus) response to feces and urine from sheep (Ovis aries) and reindeer Stein R. Moe1'4, Øystein Holand2, Jonathan E. Colman3 & Eigil Reimers3 1 Department of Biology and Nature Conservation, Agricultural University of Norway, P.O. Box 5014, N-1432 Ås, Norway ([email protected]). 1 Department of Animal Science, Agricultural University of Norway, P.O. Box 5025, N-1432 Ås, Norway. 5 Department of Biology, Division of General Physiology, University of Oslo, P.O. Box 1051, Blindern, N-0316 Oslo, Norway. 4 corresponding author. Abstract: In many Norwegian alpine and tundra areas sheep and reindeer graze sympatrically. Areas covered with dung or urine may have consequences for reindeer pasture utilization. Experiments were conducted on 5 stall fed male rein• deer calves where animals were individually presenred with two troughs (experimental and control) containing 200 g of concentrate. Fresh and dry sheep and reindeer pellets (50 g wet weight) were mixed with the concentrate in the experi• mental trough and the aversive response was tested against the control. Both fresh sheep (P < 0.0001) and reindeer (P < 0.0001) pellets were associated with aversive response by reindeer. A similar response was found for dry sheep (P = 0.006) and dry reindeer (P = 0.0009) pellets. Similar trials were conducted using sheep and reindeer urine (20 g sprayed evenly on the food) and the aversive response by reindeer was tested against the control (sprayed with 20 g of water). Both sheep and reindeer urine stimulated an aversive response by reindeer {P = 0.03 for both tests). The differ• ences in the aversive response of reindeer ro fresh sheep and reindeer pellets, dry sheep and reindeer pellets and sheep and reindeer urine were also tested.
    [Show full text]