Novel Hemotropic Mycoplasma Species in White-Tailed Deer (Odocoileus Virginianus)

Home , Ovis

Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611

Contents lists available at ScienceDirect

Comparative Immunology, Microbiology

and Infectious Diseases

jour nal homepage: www.elsevier.com/locate/cimid

Novel hemotropic Mycoplasma species in white-tailed deer

(Odocoileus virginianus)

a,∗ b a

Ricardo G. Maggi , M. Colter Chitwood , Suzanne Kennedy-Stoskopf ,

Christopher S. DePerno

College of Veterinary Medicine, North Carolina State University, 1060 William Moore Drive, Raleigh, NC 27607, USA

Fisheries, Wildlife, and Conservation Biology Program, Department of Forestry and Environmental Resources, North Carolina State

University, 110 Brooks Avenue, Raleigh, NC 27607, USA

a r t a b

i c l e i n f o s t r a c t

Article history:

Globally, hemotropic Mycoplasma spp. are emerging or re-emerging zoonotic pathogens

Received 29 January 2013

that affect livestock, wildlife, companion animals, and humans, potentially causing seri-

Received in revised form 8 August 2013

ous and economically important disease problems. Little is known about hemotropic

Accepted 13 August 2013

Mycoplasma spp. prevalence, host-speciﬁcity, or route of transmission in most species,

including wildlife. DNA ampliﬁcation by PCR targeting the 16SrRNA and the RNaseP genes

Keywords:

was used to establish the presence and prevalence of hemotropic Mycoplasma spp. in a

Hemoplasma

white-tailed deer (O. virginianus) population in eastern North Carolina. Sixty-ﬁve deer (89%)

Hemotropic Mycoplasma

tested positive for hemotropic Mycoplasma spp. where sequence analysis of the 16SsRNA

Odocoileus virginianus

White-tailed deer and the RNaseP genes indicated the presence of at least three distinct species. This study rep-

Zoonotic diseases resents the ﬁrst detection of three distinct hemotropic Mycoplasma species in white-tailed

deer and the ﬁrst report of two novel hemotropic Mycoplasma species.

1. Introduction [12–17], companion animals [1,4,18–22], and humans

[23–28], causing potentially serious and economically

Hemotropic Mycoplasma spp. (hemoplasmas) are cell- important diseases problems.

wall deﬁcient, obligate epierythrocytic bacteria that infect Mycoplasma ovis, a hemoplasma parasite of sheep and

numerous animal species, including humans. Infections goats [7–10], has been associated with lethargy and anemia

are often chronic and sub-clinical; however, animals can of varying severities in captive reindeer (Rangifer tarandus)

develop hemolytic anemia, particularly when: immuno- and in farm-raised white-tailed deer (Odocoileus virgini-

suppressed; stressed from poor nutrition, pregnancy or anus) [13,16]. A high rate of infection with Mycoplasma ovis

lactation; or concurrently infected with other, more viru- – like organisms has been also reported in several other

lent pathogens or more than one Mycoplasma species [1–4]. cervids species (Blastocerus dichotomus, Mazama nana, and

Globally, Mycoplasma spp. are emerging or re-emerging Mazama americana) raised in captivity [15] as well as in free

zoonotic pathogens that affect livestock [5–11], wildlife ranging species (B. dichotomus, Ozotocerus bezoarticus, and

O. bezoarticus) [14]. More recently, M. ovis or infection with

a Mycoplasma ovis – like organisms has been also described

∗

Corresponding author at: Intracellular Pathogens Research Labora- infecting dogs [22] and humans [23,25] highlighting the

tory, College of Veterinary Medicine, North Carolina State University, 1060 potential zoonotic potential of this species.

William Moore Drive, Raleigh, NC 27607, USA. Tel.: +1 919 513 8273;

The objective of this study was to determine the molec-

fax: +1 919 515 3440.

ular prevalence of hemotropic Mycoplasma species in 73

E-mail address: [email protected] (R.G. Maggi).

608 R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611

Table 1

Sequence homologies on the 16SrRNA gene (partial sequence) (Genbank accession numbers in parenthesis).

Sample ID Mycoplasma spp. deer Mycoplasma spp. deer Mycoplasma spp. deer Mycoplasma wenyonii

USA (FJ824847) Brazil (HQ634379) Japan (AB558899) (EU367964)

10 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%)

28 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%)

61 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%) Group A

65 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%)

66 1056/1060 (99.6%) 1037/1060 (97.8%) 1045/1060 (98.6%) 1017/1060 (95.9%)

7 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%)

46 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%)

47 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%) Group B

63 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%)

70 1225/1268 (96.6%) 1243/1268 (98.0%) 1221/1268 (96.8%) 1212/1268 (95.6%)

6 1091/1134 (96.2%) 1111/1134 (97.8%) 1088/1134 (95.9%) 1076/1134 (94.9%)

Group C

74 1091/1134 (96.2%) 1111/1134 (97.8%) 1088/1134 (95.9%) 1076/1134 (94.9%)

free-ranging white-tailed deer (O. virginianus) from a hunt- 2.4. DNA testing

ing preserve in eastern North Carolina.

All blood samples were analyzed for the presence of

hemotropic Mycoplasma DNA by PCR targeting a 1380 bp

2. Materials and methods region of the 16S rRNA, and a 165 bp region of the RNAse

P gene as previously described [23,31]. DNA from 200

2.1. Sample selection micro-liter of blood–EDTA from each white-tailed deer

was extracted using a Qiamp DNA Mini Kit (QIAGEN Inc.,

During a population health assessment in July 2008 Valencia, CA). After extraction following the manufacture

and March 2009, 73 white-tailed deer (13 males and 60 protocol, DNA concentration and quality was measured

female) from eastern North Carolina were surveyed for the using absorbance ratio between 260/280 nm (Nanodrop,

◦

∼

presence of Mycoplasma spp. Hofmann Forest ( 34 53 N, Thermo Scientiﬁc, USA). Ampliﬁcation of hemotropic

∼ ◦

77 23 W), owned and managed by the North Carolina Mycoplasma 16S rRNA was performed using two sets of

State Natural Resources Foundation, is a 31,565-acre tract oligonucleotides HemMycop16S-41s: 5 GYATGCMTAAY-

managed for loblolly pine production. Hofmann Forest has ACATGCAAGTCGARCG 3 and HemMyco16S-938as: 5

nine hunt clubs (>400 members) that use hounds to hunt CTCCACCACTTGTTCAGGTCCCCGTC 3 and HemMycop16S-

white-tailed deer (estimated population of 2000–5000 322s: 5 GCCCATATTCCTACGGGAAGCAGCAGT 3 and

deer) [29,30]. HemMycop16S-1420as: 5 GTTTGACGGGCGGTGTGTA-

CAAGACC 3 . Sequence derived from amplicons obtained

from each primer set (with an overlap of 600 bp to assure

2.2. Blood sampling consistency in species identiﬁcation from each sample)

was aligned and edited using AlignX (Vector NTI suite

Deer blood was obtained via cardiac puncture imme- 11.5.1). Similarly, ampliﬁcation of Mycoplasma RNaseP

diately after animals were killed by head-shot with a gene was performed using oligonucleotides HemoMyco

high-powered riﬂe. Blood samples were collected using RNaseP30s: 5 GAT KGT GYG AGY ATA TAA AAA ATA AAR

an evacuated tube system (Vacutainer, Beckon, Dickson CTC RAC 3 and HemoMyco RNaseP200as: 5 GMG GRG

and Company, Franklin Lakes, NJ, USA) and analyzed for TTT ACC GCG TTT CAC 3 as forward and reverse primers,

◦

−

packed cell volume (PCV) in situ and stored at 20 C until respectively. Ampliﬁcation was performed in a 25-␮l ﬁnal

processed. volume reaction containing 12.5 ␮l of Tak-Ex Premix

(Fisher Scientiﬁc), 0.25 ␮l of 30 ␮M of each forward and

reverse primer (IDT DNA Technology), 8 ␮l of molecular

2.3. Body gross examination and health condition grade water, and 5 ␮l of DNA from each sample tested.

analysis PCR negative controls were prepared using 5 ␮l of DNA

from blood of a healthy dog and positive controls were

Gross body condition of each animal, assessed in the prepared using 5 ␮l of DNA from dog blood infected with

ﬁeld by wildlife biologists and veterinarians, was evalu- Mycoplasma hematoparvum. Conventional PCR was per-

ated on the basis of body-condition indicators (e.g., kidney formed in an Eppendorf Mastercycler EPgradient under

◦

fat, femur marrow fat) and later by blood analysis (glu- the following conditions: a single hot-start cycle at 95 C

◦

cose, urea nitrogen, creatinine, total protein, albumin, total for 2 min followed by 55 cycles of: denaturing at 94 C

◦ ◦

bilirubin, alkaline phosphatase, alanine aminotransferase, for 15 s, annealing at 68 C (16SrRNA) or 59 C (RNaseP)

◦

aspartate aminotransferase, cholesterol, calcium, phos- for 15 s, and extension at 72 C for 18 s. Ampliﬁcation was

◦

phorus, sodium, potassium, chloride, albumin/globulin completed by an additional cycle at 72 C for 30 s, and prod-

ratio, BUN/creatinine ratio, globulin, and creatine kinase, ucts were analyzed by 2% agarose gel electrophoresis with

as previously described [30]. detection using ethidium bromide under ultraviolet light.

R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611 609

96 Group A (KC512404) 97 Mycoplasma Deer USA (FJ824847)

98 Mycoplasma Deer Japan (AB558899) Mycoplasma Deer Brazil (HQ634379)

98 Group B (KC512403) 47 Group C (KC512403) Mycoplasma wenyonii (EU367964) Mycoplasma pneumoniae (NR 041751)

0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00

Fig. 1. Neighbor-joining phylogeny reconstruction of the three hemotropic Mycoplasma species identiﬁed using nucleotide sequences derived from 1300 bp

of the 16SrRNA gene. Program: Mega 4.0 Maximum Composite Likelihood.

Table 2

Sequence homologies in a 102 bp partial region of the RNaseP gene (Genbank accession numbers in parenthesis).

Sample ID Candidatus M. haemocervae’ Mycoplasma wenyonii Mycoplasma ovis

(AB561882) (EU078610) (EU078612)

10 94/102 (92.1%) 90/102 (88.2%) 92/102 (90.2%)

28 94/102 (92.1%) 90/102 (88.2%) 92/102 (90.2%)

61 94/102 (92.1%) 90/102 (88.2%) 92/102 (90.2%) Group A

65 94/102 (92.1%) 90/102 (88.2%) 92/102 (90.2%)

66 94/102 (92.1%) 90/102 (88.2%) 92/102 (90.2%)

7 97/102 (95.0%) 90/102 (88.2%) 93/102 (91.2%)

46 97/102 (95.0%) 90/102 (88.2%) 93/102 (91.2%)

47 97/102 (95.0%) 90/102 (88.2%) 93/102 (91.2%) Group B

63 97/102 (95.0%) 90/102 (88.2%) 93/102 (91.2%)

70 97/102 (95.0%) 90/102 (88.2%) 93/102 (91.2%)

6 90/102 (88.2%) 91/102 (89.2%) 90/102 (88.2%)

Group C

74 90/102 (88.2%) 91/102 (89.2%) 90/102 (88.2%)

Amplicon products were sequenced by Eton Bio, Inc (RTP, Sequence homology analysis of 12 randomly selected pos-

North Carolina) to establish species strain identiﬁcation. itive samples (Table 1) suggested the presence of three

distinct hemotropic Mycoplasma groups (Fig. 1): Group

3. Results A with a 99.6% match with a Mycoplasma sp. recently

described in a sick, farm-reared fawn [13] from rural Indi-

3.1. Gross examination of animal condition ana, USA (Genbank FJ824847); Group B, matching 96.6%

with Genbank FJ824847 sequence, 98% with a Mycoplasma

Gross examination of animal condition post-mortem sp. described in marsh deer (Blastoceros dichotomus) from

did not show any signs indicative of clinical abnormalities. Brazil (HQ634379), 96.8% with a Mycoplasma sp. described

Packed cell volumes did not indicate anemia in either col- in sika deer (Cervus nippon) from Japan (AB558899), and

lection period. PCV samples averaged 45% (SD = 5.6, n = 28) 95.3% with M. wenyomii (EU367964) detected in cattle; and

in July, and PCV average was 53% (SD = 6.6, n = 30) in March Group C matched only 96.2% with Genbank FJ824847 and

[29]. 97.8% with a Mycoplasma sp. described in marsh deer (Blas-

toceros dichotomus) from Brazil (HQ634379).

3.2. Blood DNA analysis The same 12 blood DNA samples were ampliﬁed using

PCR targeting a 165 bp region of the RNaseP gene. Sequence

A total of 65/73 DNA samples (89%) tested posi- analysis of the RNasesP gene (Table 2) also identiﬁed

tive for Mycoplasma spp. ampliﬁcation using primers three clusters that matched the three groups described

targeting a region expanding 1300 bp of the 16S rRNA gene. above (Fig. 2): Group A with 92.1% homology with

67 Candidatus M. haemocervae AB561882

80 Mycoplasma ovis (EU078612) Group A (JQ610624) 48 Group B (JQ610626) Group C (JQ610628) Mycoplasma wenyonii (EU078610)

0.05 0.04 0.03 0.02 0.01 0.00

Fig. 2. Neighbor-joining phylogeny reconstruction of the three hemotropic Mycoplasma species identiﬁed using nucleotide sequences derived from 121 bp

of the RNaseP gene. Program: Mega 4.0 Maximum Composite Likelihood.

610 R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611

‘Candidatus Mycoplasma haemocervae’ (AB561882), 90.2% Acknowledgements

with M. ovis (EU078612) and 88.2% with M. wenyonii

(EU078610); Group B matching 95.0% with ‘Candidatus This project was funded by the North Carolina State

Mycoplasma haemocervae’ (AB561882), 91.2% with M. ovis Natural Resources Foundation, Inc., the NCSU Department

(EU078612), and 88.2% with M. wenyonii (EU078610); and of Forestry and Environmental Resources, and the NCSU

Group C matching 88.2% with ‘Candidatus Mycoplasma Fisheries, Wildlife, and Conservation Biology Program. The

haemocervae’ (AB561882) and M. ovis (EU078612), and research protocol outlined here was approved by the North

89.2% with M. wenyonii (EU078610). Carolina Wildlife Resources Commission and the North

Carolina State University (NCSU) Institutional Animal Care

4. Discussion

and Use Committee (08-082-O). We thank the numerous

undergraduate, graduate, and veterinary students for vol-

Hemotropic Mycoplasma spp. (‘hemoplasmas’, formerly

unteering during the ﬁeld collection of samples.

classiﬁed as Haemobartonella and Eperythrozoon spp.)

appear to have co-evolved with many animals species. The References

development of molecular assays, primarily targeting the

16S rRNA gene of these microbes, has resulted in the recent [1] Willi B, Novacco M, Meli M, Wolf-Jackel G, Boretti F, Wengi N, et al.

Haemotropic mycoplasmas of cats and dogs: transmission, diagno-

recognition of several novel human [23–25,27,32] and ani-

sis, prevalence and importance in Europe. Schweiz Arch Tierheilkd

mal hemoplasmas [13,21,31,33–43]. DNA screening of 73

2010;152:237–44.

white-tailed deer blood samples resulted in the detection [2] de Morais HA, Guimaraes AM, Vidotto O, Baumann A, Biondo AW,

of a high prevalence Mycoplasma infection similar to pre- Messick JB. Co-infection with Mycoplasma haemofelis and ‘Candida-

tus Mycoplasma haemominutum’ in three cats from Brazil. J Feline

viously reported prevalence in sheep [7] and other deer

Med Surg 2007;9:518–20.

species [13,14,16] supporting the possibility that ticks or

[3] Bobade PA, Nash AS, Rogerson P. Feline haemobartonellosis: clin-

other vectors, injuries related to animal-to-animal con- ical, haematological and pathological studies in natural infections

and the relationship to infection with feline leukaemia virus. Vet Rec

tact, and perhaps vertical transmission might play a role

1988;122:32–6.

in widespread infection of these species [15].

[4] Messick JB. Hemotrophic mycoplasmas (hemoplasmas): a review

Sequence analysis of randomly selected samples iden- and new insights into pathogenic potential. Vet Clin Pathol

2004;33:2–13.

tiﬁed three hemotropic Mycoplasma sp. groups: one

[5] Fujihara Y, Sasaoka F, Suzuki J, Watanabe Y, Fujihara M, Ooshita K,

closely related to a previously reported species (Genbank

et al. Prevalence of hemoplasma infection among cattle in the west-

FJ824847) described in a sick fawn [13], and two poten- ern part of Japan. J Vet Med Sci 2011;73:1653–5.

[6] Tagawa M, Matsumoto K, Yokoyama N, Inokuma H. Comparison of

tially new hemotropic Mycoplasma species not described

the effect of two hemoplasma species on hematological parameters

or reported to date. The lack of clinical abnormalities cou-

in cattle. J Vet Med Sci 2011;72:113–5.

pled with the high prevalence of infection suggests that [7] Aguirre DH, Thompson C, Neumann RD, Salatin AO, Gaido AB, de

Echaide ST. Clinical mycoplasmosis outbreak due to Mycoplasma ovis

white-tailed deer may serve as a reservoir for at least three

in sheep from Shalta, Argentina. Clinical, microbiological and molec-

Mycoplasma spp. Additional research on the distribution of

ular diagnosis. Rev Argent Microbiol 2009;41:212–4.

these hemotropic Mycoplasma spp. is needed to determine [8] Neimark H, Hoff B, Ganter M. Mycoplasma ovis comb. nov. (formerly

if they are locally conﬁned or have a wider distribution in Eperythrozoon ovis), an epierythrocytic agent of haemolytic anaemia

in sheep and goats. Int J Syst Evol Microbiol 2004;54:365–71.

white-tailed deer populations.

[9] Suzuki J, Sasaoka F, Fujihara M, Watanabe Y, Tasaki T, Oda S, et al.

Previous studies have shown that hemotropic

Molecular identiﬁcation of ‘Candidatus Mycoplasma haemovis’ in

Mycoplasma infection in humans are more prevalent sheep with hemolytic anemia. J Vet Med Sci 2011;73:1113–5.

[10] Tagawa M, Takeuchi T, Fujisawa T, Konno Y, Yamamoto S, Mat-

in farmers, veterinarians and other individuals who have

sumoto K, et al. A clinical case of severe anemia in a sheep coinfected

frequent and close contact with animals and or vectors

with Mycoplasma ovis and ‘Candidatus Mycoplasma haemovis’ in

[23,24,28,44]. In fact, M. ovis has been recently described Hokkaido, Japan. J Vet Med Sci 2012;74:99–102.

[11] Dieckmann SM, Winkler M, Groebel K, Dieckmann MP, Hofmann-

as the most prevalent species infecting humans that has

Lehmann R, Hoelzle K, et al. Haemotrophic Mycoplasma infection in

extensive animal and/or vector contact [23,25] than from

horses. Vet Microbiol 2010;145:351–3.

people with less exposure. While ticks (i.e. Rhipicephalus [12] Biondo AW, Dos Santos AP, Guimaraes AM, Vieira RF, Vidotto O,

Macieira Dde B, et al. A review of the occurrence of hemoplas-

sanguineus) have been suggested as vectors for the trans-

mas (hemotrophic mycoplasmas) in Brazil. Rev Bras Parasitol Vet

mission of hemotropic Mycoplasmas, no experimental 2009;18:1–7.

vector competence data is available [12,45–48]. [13] Boes KM, Goncarovs KO, Thompson CA, Halik LA, Santos AP,

Guimaraes AM, et al. Identiﬁcation of a Mycoplasma ovis-like organ-

The pathogenic potential of many hemotropic

ism in a herd of farmed white-tailed deer (Odocoileus virginianus) in

Mycoplasmas as a cause of human and animal dis-

rural Indiana. Vet Clin Pathol 2012;41:77–83.

ease remains to be elucidated as do the mechanisms of [14] Grazziotin AL, Duarte JM, Szabo MP, Santos AP, Guimaraes AM,

intra- and inter- species transmission. The sympatric rela- Mohamed A, et al. Prevalence and molecular characterization of

Mycoplasma ovis in selected free-ranging Brazilian deer populations.

tionships between deer, hunters, their dogs and arthropod

J Wildl Dis 2011;47:1005–11.

vectors in the shared environment present an oppor-

[15] Grazziotin AL, Santos AP, Guimaraes AM, Mohamed A, Cubas ZS,

tunity to explore the zoonotic potential of hemotropic de Oliveira MJ, et al. Mycoplasma ovis in captive cervids: preva-

lence, molecular characterization and phylogeny. Vet Microbiol

Mycoplasma spp. present in white-tailed deer.

2011;152:415–9.

Sequence data for the 16S rRNA and the RNaseP gene

[16] Stoffregen WC, Alt DP, Palmer MV, Olsen SC, Waters WR, Stasko JA.

for the three hemotropic Mycoplasma sp. described in this Identiﬁcation of a haemomycoplasma species in anemic reindeer

(Rangifer tarandus). J Wildl Dis 2006;42:249–58.

study are deposited in Genbank database with accession

[17] Watanabe Y, Fujihara M, Obara H, Matsubara K, Yamauchi K, Hara-

numbers: KC512404; KC512403; KC512402; JQ610626;

sawa R. Novel hemoplasma species detected in free-ranging sika deer

JQ610627; and JQ610628. (Cervus nippon). J Vet Med Sci 2010;72:1527–30.

R.G. Maggi et al. / Comparative Immunology, Microbiology and Infectious Diseases 36 (2013) 607–611 611

[18] Morgenthal D, Hamel D, Arndt G, Silaghi C, Pﬁster K, Kempf VA, [34] Ohtake Y, Nishizawa I, Sato M, Watanabe Y, Nishimura T, Matsub-

et al. Prevalence of haemotropic Mycoplasma spp., Bartonella spp. ara K, et al. Mycoplasma ovis detected in free-living Japanese serows,

and Anaplasma phagocytophilum in cats in Berlin/Brandenburg Capricornis crispus. J Vet Med Sci 2011;73:371–3.

(Northeast Germany). Berl Munch Tierarztl Wochenschr 2012;125: [35] Andre MR, Adania CH, Machado RZ, Allegretti SM, Felippe PA, Silva

418–27. KF, et al. Molecular and serologic detection of Ehrlichia spp. in endan-

[19] Willi B, Boretti FS, Baumgartner C, Cattori V, Meli ML, Doherr MG, gered Brazilian wild captive felids. J Wildl Dis 2010;46:1017–23.

et al. Feline hemoplasmas in Switzerland: identiﬁcation of a novel [36] Birkenheuer AJ, Breitschwerdt EB, Alleman AR, Pitulle C. Differen-

species, diagnosis, prevalence, and clinical importance. Schweiz Arch tiation of Haemobartonella canis and Mycoplasma haemofelis on

Tierheilkd 2006;148:139–40. the basis of comparative analysis of gene sequences. Am J Vet Res

[20] Sykes JE. Feline hemotropic mycoplasmas. J Vet Emerg Crit Care (San 2002;63:1385–8.

Antonio) 2010;20:62–9. [37] Crosse P, Ayling R, Whitehead C, Szladovits B, English K, Bradley D,

[21] Sykes JE, Ball LM, Bailiff NL, Fry MM. ‘Candidatus Mycoplasma et al. First detection of ‘Candidatus Mycoplasma haemolamae’ infec-

haematoparvum’, a novel small haemotropic mycoplasma from a tion in alpacas in England. Vet Rec 2012;171:71.

dog. Int J Syst Evol Microbiol 2005;55:27–30. [38] Hornok S, Meli ML, Gonczi E, Ignits E, Willi B, Lutz H, et al. First

[22] Varanat M, Maggi RG, Linder KE, Breitschwerdt EB. Molecular preva- molecular identiﬁcation of ‘Candidatus mycoplasma haemominu-

lence of Bartonella, Babesia, and hemotropic Mycoplasma sp. in dogs tum’ from a cat with fatal haemolytic anaemia in Hungary. Acta Vet

with splenic disease. J Vet Intern Med 2011;25:1284–91. Hung 2008;56:441–50.

[23] Maggi RG, Compton SM, Trull CL, Mascarelli PE, Mozayeni BR, Bre- [39] Messick JB, Walker PG, Raphael W, Berent L, Shi X. ‘Candidatus

itschwerdt EB. Infection with hemotropic Mycoplasma sp. in people mycoplasma haemodidelphidis’ sp. nov., ‘Candidatus mycoplasma

with and without extensive arthropod and animal contact. J Clin haemolamae’ sp. nov. and Mycoplasma haemocanis comb. nov.,

Microbiol 2013 (in press). haemotrophic parasites from a naturally infected opossum (Didel-

[24] Maggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt EB. phis virginiana), alpaca (Lama pacos) and dog (Canis familiaris):

Co-infection with Anaplasma platys, Bartonella henselae and Candi- phylogenetic and secondary structural relatedness of their 16S

datus Mycoplasma haematoparvum in a veterinarian. Parasit Vectors rRNA genes to other mycoplasmas. Int J Syst Evol Microbiol

2013;6:103. 2002;52:693–8.

[25] Sykes JE, Lindsay LL, Maggi RG, Breitschwerdt EB. Human coin- [40] Nibblett BM, Waldner C, Taylor SM, Jackson ML, Knorr LM, Snead

fection with Bartonella henselae and two hemotropic mycoplasma EC. Hemotropic mycoplasma prevalence in shelter and client-owned

variants resembling Mycoplasma ovis. J Clin Microbiol 2010;48: cats in Saskatchewan and a comparison of polymerase chain reaction

3782–5. (PCR) - Results from two independent laboratories. Can J Vet Res

[26] Yuan CL, Liang AB, Yao CB, Yang ZB, Zhu JG, Cui L, et al. Prevalence of 2010;74:91–6.

Mycoplasma suis (Eperythrozoon suis) infection in swine and swine- [41] Vieira RF, Molento MB, Guimaraes AM, Santos AP, Bonat M,

farm workers in Shanghai, China. Am J Vet Res 2009;70:890–4. Javorouski ML, et al. Use of a Mycoplasma suis-PCR protocol for

[27] Steer JA, Tasker S, Barker EN, Jensen J, Mitchell J, Stocki T, et al. A novel screening a population of captive peccaries (Tayassu tajacu and

hemotropic Mycoplasma (hemoplasma) in a patient with hemolytic Tayassu pecari). Rev Bras Parasitol Vet 2011;20:75–7.

anemia and pyrexia. Clin Infect Dis 2011;53:e147–51. [42] Willi B, Filoni C, Catao-Dias JL, Cattori V, Meli ML, Vargas A, et al.

[28] Yang D, Tai X, Qiu Y, Yun S. Prevalence of Eperythrozoon spp. infec- Worldwide occurrence of feline hemoplasma infections in wild felid

tion and congenital eperythrozoonosis in humans in Inner Mongolia, species. J Clin Microbiol 2007;45:1159–66.

China. Epidemiol Infect 2000;125:421–6. [43] Willi B, Meli ML, Luthy R, Honegger H, Wengi N, Hoelzle LE, et al.

[29] Chitwood MC. Assessment of hunters and white-tailed deer of Hof- Development and application of a universal Hemoplasma screening

mann Forest. North Carolina: North Carolina State University; 2010. assay based on the SYBR green PCR principle. J Clin Microbiol

p. 66. 2009;47:4049–54.

[30] Chitwood MC, DePerno CS, Flowers JR, Kennedy-Stoskopf S. Physio- [44] Hu Z, Yin J, Shen K, Kang W, Chen Q. Outbreaks of hemotrophic

logical condition of female white-tailed deer in a nutrient-deﬁcient mycoplasma infections in China. Emerg Infect Dis 2009;15:1139–40.

habitat type. Southeastern Naturalist 2013;12:307–16. [45] Barker EN, Langton DA, Helps CR, Brown G, Malik R, Shaw SE,

[31] Compton SM, Maggi RG, Breitschwerdt EB. Candidatus Mycoplasma et al. Haemoparasites of free-roaming dogs associated with several

haematoparvum and Mycoplasma haemocanis infections in dogs remote Aboriginal communities in Australia. BMC Vet Res 2012;8:55.

from the United States. Comp Immunol Microbiol Infect Dis [46] Novacco M, Boretti FS, Wolf-Jackel GA, Riond B, Meli ML, Willi B,

2012;35:557–62. et al. Chronic “Candidatus Mycoplasma turicensis” infection. Vet Res

[32] dos Santos AP, dos Santos RP, Biondo AW, Dora JM, Goldani LZ, 2010;42:59.

de Oliveira ST, et al. Hemoplasma infection in HIV-positive patient, [47] Hii SF, Kopp SR, Thompson MF, O’Leary CA, Rees RL, Traub RJ. Canine

Brazil. Emerg Infect Dis 2008;14:1922–4. vector-borne disease pathogens in dogs from south-east Queensland

[33] Sykes JE, Terry JC, Lindsay LL, Owens SD. Prevalences of various and north-east Northern Territory. Aust Vet J 2012;90:130–5.

hemoplasma species among cats in the United States with possible [48] Andre MR, Adania CH, Allegretti SM, Machado RZ. Hemoplasmas in

hemoplasmosis. J Am Vet Med Assoc 2008;232:372–9. wild canids and felids in Brazil. J Zoo Wildl Med 2011;42:342–7.