Journal of Cell Science o:10.1242/jcs.128512 doi: 3982–3989 126, ß Science Cell of Journal 2013 June 1 Accepted USA China 510006, Guangzhou University, xesvl ogtlmrs(ra n edl 97 Dunham and 1997; al., unstable, Reddel, et and heterogeneous, Heaphy (Bryan contain 2010; telomeres often Reddel, long telomerase excessively and cells the Cesare ALT 1997; than 2011). al., on rather et depends (HR) that (Bryan mechanism recombination a alternative (ALT), homologous through neuroepithelial of telomeres telomeres of their or 10–15% the lengthening extend remaining mesenchymal to for appear The predominantly precursors, critical cells. cells, cancer appear cancer of mechanisms growth Such cancer relentless and of (Shay 1997). activity 85–90% and contrast, expression Bacchetti, In telomerase 1994). elevated normal have al., in cells et non-detectable (Kim or cells low very transcriptase somatic are reverse activity telomerase and highly expression human are telomerase instance, of For activity Xin and regulated. 2008; expression al., The et de 2008). Venteicher al., 2002; telomere 2009; et al., al., et et maintaining In Cong Venteicher telomere- 2006; 2005; al., for linear Lange, 2003). of et (Blackburn responsible network integrity with al., and a are length and organisms et proteins telomerase associated Feldser in example, for 2001; stability humans, (Blackburn, genome chromosomes maintain problem replication end the and overcome to evolved have Telomeres Introduction telomerase. the of and independent cells, proliferation ALT and in growth homeostasis telomere sustained words: and achieve Key as bodies, TAH1 may TAH1 nuclear to cells 1. PML point ALT responses, findings protein Importantly, damage Our how telomeres. DNA homeobox-containing activity. into at ALT regulate signals insight telomere-associated altered that response indicating provide pathways damage for C-circles, between DNA telomere we TAH1 link in of Here, increase novel presence associate protein an unclear. the a to and reduced remain this led notably DNA role (APBs). and also renamed double-stranded precise APBs inhibition bodies of telomeric TAH1 and we number bind (PML) formation the Hence, directly their reduced leukemia are significantly but can bodies. promyelocytic knockdown cells pathway, HMBOX1 nuclear ALT ALT ALT-associated as telomeres. the PML known of to maintain protein with presence APBs homeobox-containing to of the a pathway importance that (ALT) and the demonstrate telomeres telomeres shown Telomerase-negative of has proliferation. dynamic lengthening work and and alternative growth Previous rapid the long for employ activity by and often characterized expression contrast, telomerase by elevated on cells, rely cancer cells cancer of majority The Summary ( correspondence for *Authors 5 4 3 2 1 Feng Xuyang cells ALT in telomere maintenance in participates TAH1/HMBOX1 protein homeobox-containing telomere-associated The 3982 ebnMa Wenbin en n ar cenDprmn fBohmsr n oeua ilg,Byo olg fMdcn,OeByo lz,Hutn X77030, TX Houston, China Plaza, 510150, Baylor Guangzhou One Province, Medicine, Guangdong of of USA College Medicine 77030, Baylor Reproductive TX Biology, of Houston, Molecular Laboratory Plaza, Yat-Sen USA and Key Baylor Sun 77030, Biochemistry One Sciences, TX of Medicine, Life Houston, Department of of Plaza, Mclean College School Baylor Marrs Baylor Biocontrol, One and Center, of Medicine, Verna Cancer Laboratory of Duncan Key College L. State Baylor Dan and Core, Education Screening of Assay Ministry Cell-Based the of Engineering Gene of Laboratory Key 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. eoee MO1 A1 oebx N aaersos,Atraielnteigo eoee,ATpathway ALT telomeres, of lengthening Alternative response, damage DNA Homeobox, TAH1, HMBOX1, Telomere, 1 a Liu Dan , 1 hnu Luo Zhenhua , [email protected] 2,3,4 ujuHuang Junjiu , 1 ha Jiang Shuai , ; [email protected] 1,5, n huSongyang Zhou and * 1 egLi Feng , ) 1 i Han Xin , h R ope otlmrstruhteritrcin(Jiang interaction their through telomeres to targets complex likely complex MRN been the RAP1–TRF2 to the pathways have the other example, in complex For ALT participate telomeres. that In telosome/shelterin proteins 2000). recruit the al., to the et shown of Wu in 2007; members roles al., important et cells, (Jiang play APBs NBS1) of PML, and formation (e.g. MRE11, proteins these RAD50, of telomere number HP1, also in A have participate cells. 2007) and ALT al., bodies in et PML maintenance Zhong to localize 2000; Sp100) to al., shown and et been NBS1, Wu 2009) MRE11, 2005; al., al., RAD50, et et (e.g. Zeng (Jiang repair 1999; DNA al., as et well Yeager al., as 2007; et Yu, (Jiang and SMC5/6) (e.g. Potts and HR 2009; MUS81, in HP1, involved RPA, and are RAD52, that activity RAD51, DNA Proteins ALT 2010). telomeric of Reddel, sites both and likely (Cesare contain are APBs which proteins. 1999), telomere-binding al., APBs or et bodies (Yeager leukemia) (promyelocytic PML 2009; ALT-associated 2004). al., al., et et Wang Henson 2009; extra- 2004; Ishikawa, abundant Griffith, and the and and Nabetani as HR (Cesare telomere well in pathway single- implicated as ALT been and has 2001) that double-stranded circles) al., (e.g. stranded et DNA telomeric Scheel chromosomal 2000; al., et nte hrceitco h L el stepeec of presence the is cells ALT the of characteristic Another 1 agHu Yang , 1,4,5, * 1 a Wang Dan , 1 ogZhao Yong , eerhArticle Research 1 , Journal of Cell Science eoeetree rtisi h L aha eanpoorly remain of roles pathway precise ALT the the However, understood. 1999). in (Wu al., proteins formation et APB telomere-targeted Yeager for 2000; which important al., RAP1, are et and telomeres, TRF2, the TRF1, to with telomeres 2009). and localize interact al., bodies to et PML shown (Brouwer bring were may together TRF2 they that and suggesting TRF1 PML, And 2007). al., et otiuet eoeaeidpnetmitnneof and maintenance telomeres extra- to telomerase-independent cells. bodies in that cancer PML ALT reduction in indicate to bridge telomeres a results to to help contribute RNAi These we led may telomeres. DNA. TAH1 line also at telomere cell responses TAH1 chromosomal ALT damage of APBs of DNA the knockdown number the induced In impacted and TAH1 for telomeres. required of is inhibition of to and examined, homeodomain DNA targeting the telomeric better to that TAH1 bind report directly which can We TAH1 (TAH1), telomere-associated function. as its 1 protein represents the protein and to basis refer homeodomain-containing is we molecular al., localization Here, the telomeric et unclear. However, HMBOX1 (Berger for 2006). significance DNA al., functional et double-stranded Chen bind homeodomain 2008; to its and predicted factor transcription was a as function cell also cells can ALT HeLa (De telomerase-positive with the expressed the exogenously in associate as when RAP1 well to as with WI38-VA13 found co-localize line recently could and was telomeres, (HMBOX1) containing 1 homeobox the protein (PICh), segments chromatin isolated hog cenuigtetcnqecle rtoisof proteomics called technique the using screen a Through ´ adnadKnso,20) It 2009). Kingston, and jardin A1HBX euae eoee nATcls3983 cells ALT in telomeres regulates TAH1/HMBOX1 Results lose ihHL el dt o hw) h ifrneof difference cells The telomerase-positive shown). versus cells not were ALT (data results in cells Similar lower targeting HeLa 1A). telomere much (Fig. with a cells seen at ALT also albeit with telomeres, compared the level with TAH1 endogenous cells. ALT in association telomeres the with demonstrating TAH1 1B), endogenous (Fig. of cells U2OS from TRF2) cells telomerase-positive to and ALT shown both (De been in telomeres has to localize TAH1/HMBOX1 expressed in Exogenously than cells cells ALT positive in telomerase frequently more localizes TAH1 oue Bre ta. 08;hwvr h pcfct and specificity the however, DNA-binding 2008); double-stranded al., et known (Berger modules are homeodomain- Homeodomains a in DNA manner telomeric dependent pathway. to ALT directly binds the TAH1 in role a play may TAH1 that suggests CI)asy sn niTH nioisas eeldspecific ( revealed signals DNA immunoprecipitation also telomere of antibodies Chromatin enrichment anti-TAH1 1A). using punctate (Fig. assays (ChIP) signals cells telomere WI38-VA13/2RA telomerase- with of and overlap are to appeared U2OS TAH1 cells of patterns immunostaining HeLa both and In SV40- HTC75 positive. maintain human while (a to pathway telomeres, (a ALT cells use their U2OS line) WI38-VA13/2RA cell lines. lung and human cell immortalized line) multiple cell in osteosarcoma TAH1 localization telomeric endogenous the of examined we maintenance, telomere in nHC5cls ecudas bev olclzto of co-localization observe also could we cells, HTC75 In ´ adnadKnso,20) ofrhrsuyterl fTAH1 of role the study further To 2009). Kingston, and jardin tnaderr *** error. standard odn oto.Aqatfcto ftedt ssono h right. the on shown for is used data TRF2, was the For of probe quantification Alu A an control. and loading control a IP as served IgG antibodies. (TTAGGG) right. the on shown ( are varying co-localization containing TAH1–telomere cells of of degrees percentage cells. the HTC75 of and Quantifications PNA-TelC-FITC WI38-VA13/2RA telomere U2OS, the in using probe TAH1 endogenous ALT for in cells. out frequently telomerase-positive more in telomeres than to cells localizes TAH1 1. Fig. B eoeeCI nlsswt h itnltdtlmr probe telomere biotinylated the with analysis ChIP Telomere ) n 3 5 a efre sn 2Sclsadanti-TAH1 and cells U2OS using performed was .FrTH n IgG, and TAH1 For 3. P , .0 oprdwt control. with compared 0.001 , / fsgasosre for observed signals of 1/3 n 5 ( .Errbr indicate bars Error 6. A FFS a carried was IF-FISH ) , 70% Journal of Cell Science nS4 ula oaiainsqec NS oisCterminus, C attached its (TAH1- to we (NLS) When sequence TAH1- 2D). localization (Fig. mutant nuclear SV40 cytoplasm an only the in homeodomain deletion the contrast, predominantly in the In telomeres. shown and to localize homeodomain As TAH1 could hour) of analysis. full-length (TAH1 mutant mutants immunostaining both deletion for 2D, Fig. two 2C) (Fig. generated the TAH1 we mediates localization, telomere likely homeodomain probe the mutant TAH1. to of the bind targeting and directly telomeric can not TAH1 DNA that but suggest telomeric data probe, These left). TelGGG8 2B, (Fig. unlabeled concentrations increasing the with Moreover, reduced (biotin-TelGCC8). of were probe signals mutant retarded the the but on manner, effect dose-dependent no a in had probe telomeric the the slow of could migration homeodomain TAH1 GST-tagged purified 2B, Fig. ietywt eoei N eune,w are out carried (biotin-TelGGG8) probe DNA we double- bacterially telomeric biotinylated a stranded using and sequences, 2A) (EMSA) (Fig. homeodomain DNA TAH1 assays purified shift telomeric mobility electrophoretic interact with could homeodomain TAH1 directly whether test To never studied. has been DNA telomeric towards homeodomain TAH1 of activity 3984 ots h eedneo A1o t oedmi for homeodomain its on TAH1 of dependence the test To D -L ipae ifs ula itiuinbtfailed but distribution nuclear diffuse displayed h-NLS ora fCl cec 2 (17) 126 Science Cell of Journal D )remained h) . ssonin shown As inl nclsc-xrsigPLwt D1 a PDK1, BiFC nuclear of with pattern the to both TAH1 PML cells, In localize 3B). co-expressing (Fig. PML not such NBs) co-expressing and (PML no does bodies detected nuclear that cells PML-containing we kinase whereas in phosphoinositide-dependent apparent, were When signals 3B). nucleus (Fig. respectively signals the YFP TAH1 2011) punctate examined, in and al., were fragments PML et YFP with co-expressing Ma tagged stably 2002; and cells al., complementation U2OS fluorescence et for (Hu of halves proximity detection two the close tagged bring to are will YFPc) that YFP or proteins (YFPn In fragments two YFP assay. between with interactions (BiFC) the assays, using complementation BiFC PML and fluorescence TAH1 between possibility, bi-molecular this interaction PML explore the further in examined To reside we PML. might with TAH1 interact that and suggesting bodies ( 3A), cells (Fig. with foci WI38-VA13/2RA co-localize PML to and appeared U2OS signals TAH1 of endogenous cells majority ALT the in bodies In PML to localizes TAH1 u idnsdmntaeta h oedmi fTH is sequences. TAH1 telomere with through of interaction telomeres to direct homeodomain TAH1 its targeting the for sufficient that and together, necessary Taken demonstrate 2D). findings (Fig. TRF2 with our co-stained that foci form to rd n niTF gen niois AIwsue to used was nuclei. DAPI the antibodies. stain anti-FLAG (green) with anti-TRF2 co-stained and were (red) TAH1 mutant and length uat.( mutants. ( proteins GST PAGE. native (8 nM) by (25 examined TelGCC8 and or probes nM) 8 (25 and TelGGG8 4 biotinylated 2, 1, fusion (0.5, GST-h proteins expressed different bacterially panel: of Right concentrations nM). (25 TelGGG8 biotinylated 2.5 increasing and at 0.25 added (0.025, were concentrations probes TelGCC8 or TelGGG8 idn ecin otiigGTh(8 GST-h containing reactions binding a 4 as and served 2 BSA (1, protein. control loaded each loading was for amount lanes protein successive in in Blue increase Commassie twofold by A examined staining. was (GST-h) proteins only TAH1-homeodomain- GST-tagged and (GST) proteins GST i.2 A1bnstlmrcDAi homeodomain- a in DNA manner. telomeric dependent binds TAH1 2. Fig. C ceai iga ffl-eghTH n t deletion its and TAH1 full-length of diagram Schematic ) m )wr sda eaiecnrl(Mock). control negative a as used were M) D 2Sclsepesn LGtge full- FLAG-tagged expressing cells U2OS ) ( A h muto atral purified bacterially of amount The ) m m )wr nuae with incubated were M) ) ( g). B etpnl unlabeled panel: Left ) m )t the to M) m )and M) nvitro in . , 0 of 50% 60%), Journal of Cell Science fTH nABfraino persistence. or formation differences importance APB the in any underline TAH1 results of observe material these TAH1 together, (supplementary not Taken cells of S1A,B). control did Fig. result and knockdown we direct the cells however, between a knockdown TAH1 than monitored, of rather progression was cycle cycle cell cell When inhibition. G2/M in because arisen changes at have the might of then enriched numbers APB progression, in are cycle observed cell we APBs differences affects of knockdown 4E). ratio TAH1 (Fig. average If the phase. cell in 28.1%) per and 25.6% APB:PML-NB to 42.7% (from decrease eedo eobnto o eoeemitnnewhere maintenance telomere and for length, telomere recombination in changes on drastic depend undergo can cells ALT influencing without length activity telomere ALT to contributes TAH1 cells control to knockdown compared 4D, TAH1 APBs (Fig. most fewer PML However, significantly of contained 4C). number cells (Fig. found total arrows) the affect We (white (white to NBs Reduced appear 4C). APBs not cells. (Fig. did knockdown of expression TAH1 TRF2 TAH1 number and control and the in both in PML arrowheads), variation both cell-to-cell should for extensive which APBs, positive for examined stain then were cells (shRNAs), knockdown The RNAs in achieved short-hairpin TAH1 which down independent of knocked both two we with hypothesis, cells this of test U2OS number enable the To impact cells. may and in PML telomeres APBs with and bodies telomeres PML both link to cells with TAH1 ALT associate in to APBs ability of The number the regulates TAH1 PML. of vicinity the in PML with be interact or may 3B– TAH1 that (Fig. indicate PML observations and These TRF2 D). co-expressing cells comparable in were observed cells those YFP-positive to of percentage the and signals P , .0) nfc,TH elto eutdin resulted depletion TAH1 fact, In 0.001). . 0 ncdw fiiny(i.4A,B). (Fig. efficiency knockdown 70% , 40% A1HBX euae eoee nATcls3985 cells ALT in telomeres regulates TAH1/HMBOX1 motneo A1i h rcs fCcrl omto and formation C-circle cells. of ALT process in recombination the telomere in possibly a TAH1 to of led importance depletion TAH1 in comparison, SMC5 , In by down S2A–C). signals knocking Fig. SMC5 cells C-circle material expected, ALT for reduced As in cells depleted information 2009). U2OS C-circle al., positive cells in et a role U2OS (Henson critical As its examined cells. of in also because C-circles U2OS of we knockdown amount control, TAH1 the al. compared et versus we Henson control 2009), by developed al., assay) et (CC (Henson assay C-circle and recombination. cells the homologous ALT Using of in by-products prevalent or are templates which possible C-circles, of formation the little 5A,B). had (Fig. depletion length telomere TAH1 average significant however, the on 2007); expected, effect al., (Stagno As knockdown et control TRF2 shown). D’Alcontres with of versus occurred No not telomeres ratios TAH1 of (data shortening or in length. cells apparent ends telomere knockdown signal-free were fluorescence fusions telomere examine chromosomal in quantitative to changes (TRF) significant (Q-FISH) telomere fragment and restriction fluorescencehybridization and ends telomere signal-free telomeric and analysis telomere may the fusions, used detect in end-to-end ends to TAH1 we (FISH) of signal-free hybridization importance pathway, the as probe ALT further such To accumulate. byproducts recombination nce oni 2Scls ohtenme fTF (as TIFs of number the both cells, was U2OS TRF2 in in When role down (TIF). a knocked number foci played the assessing TAH1 telomere-dysfunction-induced by whether telomeres of the examine at responses to damage on DNA went we Next, telomeres the cells at ALT responses in damage DNA regulates TAH1 0 euto nCcrl inl Fg CD,udriigthe underlining 5C,D), (Fig. signals C-circle in reduction 50% ete netgtdwehrTH niiincudimpact could inhibition TAH1 whether investigated then We nlsso loecnecmlmnaini el rmC U2OS C. from cells in complementation fluorescence of analysis Fnpu D1YP eeue sngtv controls. negative as used PML- were and PDK1-YFPc only, plus PML-YFPn YFPn only, TAH1-YFPc expressing cells o rti xrsini h niae ellns ( lines. cell indicated the in expression ( protein respectively. for as controls, used positive were or TFR2-YFPc negative plus PML-YFPn plus or PML-YFPn PDK1-YFPc expressing Cells TAH1-YFPc. plus PML-YFPn nioisaantedgnu A1(e)adPL(green). PML and (red) ( TAH1 with endogenous co-immunostained against were antibodies cells. cells ALT in WI38-VA13/2RA bodies and PML cells to localizes TAH1 3. Fig. B iCasy eecridoti 2Sclssal expressing stably cells U2OS in out carried were assays BiFC ) , 0 (supplementary 20% C etr blotting Western ) D FACS ) ( nsitu in nsitu in A U2OS ) Journal of Cell Science oprdwt control. with compared hw ntegah ro asidct tnaderr ( is errors and standard calculated indicate then bars was Error line graph. The cell the cell. each per in APBs for shown and ratio NBs NB PML of APB:PML number average total the ( on based mean. calculated the was mark lines blue and where are graph, (arrowheads) the APBs and cells. (arrows) ( knockdown NBs indicated. TAH1 PML in for (green) staining PML Representative and (red) TRF2 endogenous Fg C,alvlcmaal oTF knockdown TRF2 telomeres, to of integrity that the comparable suggest compromise results could These the level inhibition S3D). cells TAH1 and Fig. control material case, a to cell (supplementary compared this per cells 6C), In TIF-positive a (Fig. TIFs of by 6A–C). percentage (Fig. observed accompanied of the was cells also number inhibition TIF-positive we TAH1 the of depletion, both percentage TAH1 al., in et with D’Alcontres increases (Stagno TRF2 (supplementary Similarly, cells of these importance 2007). in increased the protection with telomere cells consistent in S3A–D), TIF-positive Fig. the material and of cell per foci) percentage co-localized 53BP1–telomere by indicated ( IF-FISH ( APBs. by of assessed was number shRNAs the TAH1 regulates TAH1 4. Fig. 3986 B .sRAsqecsaantGPwr sda oto.( control. as used were GFP against sequences shRNA ). D ora fCl cec 2 (17) 126 Science Cell of Journal h ubro Psprcl a uniidadi hw in shown is and quantified was cell per APBs of number The ) n niae h ubro el xmndfrec elline, cell each for examined cells of number the indicates E h ai fABPLN o ahcell each for NB APB:PML of ratio The ) A n uniaiera-iePCR real-time quantitative and ) ncdw fiinyof efficiency Knockdown , odices in increase fold 3 n 5 C ) *** 3). Fiae of images IF ) P , 0.001 eoeepoeto nATcls ti lopsil httelomere that possible also is in It primarily cells. function ALT to in appears protection TAH1 al., telomere 1995), et al., (Broccoli et cells Chong telomere ALT 1997; modulate and telomerase-positive can both which in TRF2, length DNA. double-stranded and telomeric TRF1 TRF1 bind unlike proteins also However, telomere can TAH1 core TRF2, the and to detection Similar perhaps easier immunostaining. and 2002), TAH1 by of al., binding frequent general et more (Henson allowing in thus telomeres cells long ALT exceedingly cells, have telomerase-positive with more telomerase- frequency. Compared lower much in telomere was at TAH1 but endogenous than cells, telomerase-positive detect in TAH1 targeting to cells able were ALT endogenous We cells. in positive that targeted telomere or ALT demonstrated in formation frequently protection We the telomere and for activity, cells. important ALT APBs, is of TAH1 stability that evidence provide ta. 09.Tenvlfnto fTH arnsfurther warrants TAH1 DNA between of link essential function an represent (Cesare novel may cells it The ALT as in investigation, previous 2009). length responses of al., telomere damage of et reminiscent DNA independent is of were occurrences that This spontaneous length. of telomere reports gross or in fusions, end-to-end changes ends, by signal-free accompanied not telomere were of increased Elevated however, result telomeres. cells, at a TAH1-depleted signals in as damage TIFs damage (e.g. DNA DNA for APBs increased ability and in reduced repair proteins to decrease lead a repair may and knockdown) damage TAH1 2007), DNA al., et numerous (Jiang foci contain induced damage APBs DNA telomeric (TIFs). in increase an observed also at sensitive associations. more transient or be low-affinity may and detecting favor BiFC TAH1 may whereas that with co-IP interactions, that PML indicate possible high-affinity bridge also data is to These with It needed members. shown). PML shelterin/telosome be not co-precipitate al., may (data factors et to TRF2 additional (Brouwer unable or assays likewise TRF1 BiFC were either in we PML but been with 2009), also associate have TRF2 to and proximity TRF1 FLAG- reported Both with shown). close GST- not (co-IP) (data However, co-immunoprecipitate suggesting PML tagged to proteins. assays, failed fragment-tagged TAH1 BiFC YFP tagged two in between the complementation TAH1 between fluorescence DNA. and detect telomeric PML and readily PML could between these We interaction PML, the assembly with APB modulating facilitate interact to by could function may TAH1 TAH1 Taken that that unaffected. suggest findings APB data remained NBs our disrupted even PML with APBs, U2OS of together of to number in number total the knockdown in led the recombination TAH1 reduction though significant With RAD50 and a found 2007). repair we and al., cells, DNA et MRE11 (Jiang and as formation TRF2, such and proteins Reddel, proteins telomere TRF1 and PML, as (Cesare of activity knockdown such RNAi ALT example, for For important 2010). and cells ALT in TAH1 cells. ALT prolonged in upon telomeres long apparent exceedingly the become given knockdown, only may shortening L esstlmrs-oiiecls efudta the that found repeats telomere We bind vitro specifically in cells. could TAH1 in telomerase-positive TAH1 of of homeodomain localization versus telomere the examined ALT we study, this In telomeres. at Discussion may responses cells damage ALT DNA in of TAH1 of regulation function its major involve one that indicate and ocretwt P euto nTH ncdw el,we cells, knockdown TAH1 in reduction APB with Concurrent formation complex protein of sites specific are APBs Functional n agtistlmr localization telomere its target and nvivo in utemr,we Furthermore, . Journal of Cell Science eervretasetdit el o 8t 2hus h eune r:shGFP: are: sequences The hours. 72 to 48 for cells 5 into transfected reverse were GGATA-3 C- pcl-mU6 the was into cloned were PML fluorescence sequences 1– between shRNA residues whereas RNAi, bi-molecular vector (YFPn, For retroviral YFP 156–239), 2011). Venus For al., of residues et C- fragment (Ma terminus. the 155) N-terminal (YFPc, with the C with YFP C-terminus tagged the terminally of the at tagged fragment at was terminal TAH1 FLAG assay, (BiFC) with complementation tagged was dTdT-3 GCATGGTTCCTAATAAT-3 C- the to appended was TAH1- (TAH1- PKKKRKVG, of (NLS), mutant terminus signal pDEST15 localization deletion nuclear the 40) homeodomain deleted only into virus was the 266–340 cloned homeodomain a.a. generate also encompassing TAH1 region was to The The 236–341 expression. 2009). bacterial a.a. for al., vector encoding vector retroviral hour) et pBabe (TAH1 (Wan the mutant into expression cloned mammalian were cDNAs for TAH1 mutant or antibodies Full-length telomere and lines cell canonical Constructs, Methods bypass and Materials cells proliferation. and cancer growth and sustained how for telomeres, pathways and to maintenance NBs, clues PML offer machineries, response damage 50n/l o as(Fncntut eoeaayi.FrBF sa,cells assay, BiFC For analysis. before construct) (YFPn the days with 7 infected for were ng/ml) (1 cells puromycin (500 in U2OS either production. selected retroviruses, retrovirus appropriate for sequences shRNA 5 9 9 -GTGGTACCAGCATCAGCCTT-3 -GAAGCAAGAUGUUAUAGAAdTdT-3 E23 el eetasetdwt osrcsecdn aiu rtisor proteins various encoding constructs with transfected were cells HEK293T 9 iA12 5 siTAH1-2: ; 9 hA12 5 shTAH1-2: ; D ocet TAH1- create to h 9 -GGACCTAGATGTAGATGATdTdT-3 Bam 9 -GGACCTAGATGTAGATGAT-3 9 Iand HI iA11 5 siTAH1-1: ; Hin 9 hA11 5 shTAH1-1: ; D -L.Frimnfursec,TAH1 immunofluorescence, For h-NLS. IIsts(ue l,20) n siRNAs And 2009). al., et (Xu sites dIII 9 . 9 -CCTGGAGAGTCATGGGATA- 9 m -CCTGGAGAGTCATG- D /l o aso G418 or days 3 for g/ml) ) h V0(Simian SV40 The h). 9 hR2 5 shTRF2: ; 9 n siSMC5: and ; 9 GA- - A1HBX euae eoee nATcls3987 cells ALT in telomeres regulates TAH1/HMBOX1 ecie M,21) rel,clue el i 5 mdse)wr fixed were lysate immunoglobulin dishes) control Sonicated and mm scraping. previously beads 150 (2 A/G-agarose mechanical (IgG) protein (in as by with pre-cleared collected cells then done and was cultured formaldehyde, essentially Briefly, 1% with 2011). was (Ma, (ChIP) described immunoprecipitation Chromatin immunoprecipitation Chromatin was (Panagene) probe 37 PNA-TelC-FITC at with conducted incubation additional in an permeablized IF-FISH, were paraformaldehyde, For 1 4% detection were (in with that X-100 (TIF) fixed cells Triton Briefly, were 0.5% foci 2009). coverslips al., glass dysfunction-induced et on (Wan telomere plated described previously for as IF done essentially and IF Indirect (IF-FISH) IF-fluorescent hybridization and (IF) immunofluorescence Indirect rz,adrbi oylnlat-g Sga nioiswr sdi hsstudy. this in used were by antibodies (Sigma) anti-IgG polyclonal analyzed rabbit and Cruz), (Santa anti-FLAG anti-PML were monoclonal polyclonal mouse (Novus), anti-53BP1 rabbit polyclonal rabbit proteins (Abcam), (Abmart), anti-TRF2 polyclonal tagged rabbit 2011). (Calbiochem), al., YFPc et (Ma and cytometry flow YFPn and microscopy co-expressing stably ueipsbewt R2fc eecutda Ps h vrg ubrof line. number cell average each for also The calculated were APBs. then that as was foci counted cell nuclear scoring, were per PML-positive APB foci APBs line. For TRF2 cell microscope. with each Ti superimposable for Nikon examined a were on cells performed was microscopy a uiiduigQAukPRprfcto i Qae) o-lte onto dot-blotted probe: [Telo (Qiagen), probes kit biotin-labeled purification using analyzed PCR 5 and QIAquik membranes, using Hybond-N+ purified was CGCGGTGGCTCACGCCTGTAATCCCAGCA]. 9 Boi-TGGTGGTGG;adAupoe 5 probe: Alu and -Biotin-TTAGGGTTAGGGTTAGGGT; abtplcoa niTH Gntx,muemncoa anti-TRF2 monoclonal mouse (Genetex), anti-TAH1 polyclonal Rabbit m ) n nuae ihaporaeatbde (3 antibodies appropriate with incubated and g), ˚ o w or fe eodr nioyicbto.Fluorescence incubation. antibody secondary after hours two for C 6 B)bfr rmr n eodr nioyincubation. antibody secondary and primary before PBS) ciiy ro asidct tnaderrors standard ( indicate bars Error formation activity. C-circle relative to line the cell determine each for averaged and then combined were values The DNA concentration. individual for cells to control normalized were TAH1 cells from knockdown values Intensity C. from as ( used control. were negative cells the HTC75 for assay. used CC was cells TAH1 U2OS and knockdown control from DNA genomic ( control. with eoeesgas ro asindicate bars Error signals. telomere mean. lines the blue mark and unit), fluorescence (TFU, telomere intensity fluorescence as length expressed telomere relative of the distribution show Histograms controls. as positive used were cells knockdown TRF2 against TAH1. sequences and shRNA cells expressing U2OS those control of analysis FISH tnaderr.*** errors. standard A1 D ouainduln.( doubling. population PD, against TAH1. sequences and shRNA cells expressing U2OS those control of analysis (TRF) i.5 A1cnrbtst ALT to activity. contributes TAH1 5. Fig. n 5 ) *** 3). ( A P eoeersrcinfragment restriction Telomere ) , C .0 oprdwt control. with compared 0.001 aiu mut of amounts Various ) n D niae h ubrof number the indicates uniiaino data of Quantification ) P nsitu in , m 9 .0 compared 0.001 -Biotin-GGCCGGG- ) h ltdDNA eluted The g). B )Q- . 300 Journal of Cell Science asidct tnaderr ( errors standard indicate bars with Cells B. and ( cd(N)poewsue nti td.Tlmrswr eaue t85 at denatured were Telomeres study. this in nucleic peptide used spread (CCCTAA) was FITC-labeled and described probe the as (3:1), (PNA) and with performed 2011), acid acid were al., quantification treated acetic et and (Huang methanol:glacial FISH hypotonically previously with Telomere slides. fixed then clean solution, onto were KCl mM cells 75 0.5 Metaphase-enriched with metaphases. incubated were cells U2OS fluorescent quantitative Telomere signal biotin-labeled telomere the using in out carried modification was blotting (5 slight probe Southern telomeric 2004). with al., et previously (Liu detection described shTAH1 or as shGFP expressing stably cells sequences U2OS using performed was assay TRF assay The (TRF) fragment restriction Telomere 95 of cycles then 40 Biosystems). and (Applied 2008). are (Bio-Rad), system reverse- conditions PCR Kit al., real-time (QIAGENE), Cycling Synthesis StepOnePlus et Kit cDNA ABI mini the iScript (Liang using RNeasy the amplified previously using the cDNA described with into isolated as transcribed was out RNA total carried Briefly, was qPCR Real-time Nylon (qPCR) PCR to quantitative Real-time transfer electrophoresis, Nucleic Chemiluminescent the by (Thermo). using Module detection Detection followed biotin Acid for blotting minutes and 20 membranes, for temperature room ds(TTAGGGTTAGGGTTAGGG- ds(TTAGCC- at [TelGGG8: TTAGCCTTAGCCTTAGCCTTAGCCTTAGCCTTAGCCTTAGCCT)], TelGCC8: DNA TelGCC8 double-stranded or TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGT); pre-annealed TelGGG8 biotin-labeled GST-homeodomain with purified probes, SDS- incubated of (pH by in concentrations verified Tris were were different mM proteins eluted proteins assay, 50 recombinant EMSA and and the For of (GE) PAGE. beads, purity glutathione and reduced agarose expression mM The 236– 8.0). glutathione-conjugated 10 (a.a. containing using buffer protein elution purified only homeodomain was TAH1 341) (EMSA) GST-tagged assay expressed shift mobility Bacterially electrophoretic and purification Protein bars Error cell. per TIFs of number ( average errors the standard mark indicate lines Blue A. from foci. superimposable indicate (red) Arrows ( anti-53BP1 antibodies. using cells (green) U2OS TRF2 knockdown and TAH1 cells. and ALT control in in analysis responses damage DNA telomere ( regulates TAH1 6. Fig. 3988 eeto ihteCeiuiecn uli cdDtcinMdl (Thermo). Module Detection Acid Nucleic Chemiluminescent the with detection C B A 3P n R2c-tiigfc TF)wr crdfridvda cells individual for scored were (TIFs) foci co-staining TRF2 and 53BP1 ) ecnae fTFpstv el eecluae ae ndt rmA from data on based calculated were cells TIF-positive of Percentages ) ersnaieiae ftetlmr-yfnto-nue oi(TIF) foci telomere-dysfunction-induced the of images Representative ) ora fCl cec 2 (17) 126 Science Cell of Journal 9 boi-TGGTGGTGG) olwdb itnsignal biotin -biotin-TTAGGGTTAGGGTTAGGGT), by followed § olclzto oiwr crda I oiie Error positive. TIF as scored were foci co-localization 3 n 5 ) *** 3). n 5 ) * 3). nsitu in m P /lncdzl o oerc el at cells enrich to h 6 for nocodazole g/ml ˚ , o 5sad60 and s 15 for C P .0 oprdwt control. with compared 0.001 , .5cmae ihcontrol. with compared 0.05 yrdzto (Q-FISH) hybridization ˚ o 0s. 60 for C ˚ for C xoa n xoiinsfwr ..Frqatttv esrmn ftelomere program. of TFL-TELO measurement the using quantitative integrated using was For filters, intensity FITC/DAPI 4.8. fluorescence with telomere software microscope length, AxioVision Zeiss a and on AxioCam (0.5 imaged probe digitally was PNA telomeres telomere 0.5 the with stained with were Chromosomes hybridized and min 4 olwn Vcosikn,temmrn a yrdzda 45 at hybridized was membrane the crosslinking, UV Following ecnae eetasomduigacietasomto.Pretg-rnfre data Percentage-transformed transformation. arcsine using transformed were Percentages analysis Statistical 50 with PBS in 37 incubated ethanol, at 70% in fixed were cells Cultured analysis profile cycle Cell U/ (4 RsaI and Genomic 2009). HinfI al., with et (Henson digested previously was described as DNA performed was assay CC assay (CC) C-circle A1wsrcnl on orglt eoeaeatvt in activity at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.128512/-/DC1 online telomerase available material regulate Supplementary to 2013). al., found et (Kappei recently cells telomerase-positive was TAH1 proof in Health. added Note of Institutes months. National 12 after the release for or PMC in Development Child Deposited of the Human Institute represent National & necessarily Shriver Kennedy Health not Eunice does the of solely and views is authors official content the The of Development. National responsibility Human Shriver the & Health Kennedy Child Eunice of the Institute Intellectual from Medicine 5P30HD024064] of number College [grant IDDRC) Baylor described (BCM by Center Research Disabilities project Developmental part and The in supported P30CA125123]. also Duncan number was L. [grant Dan [grant the Foundation Center at Resource Welch Cancer Shared GRSA Sciences the the and Medical GM095599]; Q-1673]; number General number of number [grant [grant (NCI) Institute (NIGMS) Institute National number [grant Cancer Central CA133249]; National the number the Guangzhou to of like support for grant also the would in We acknowledge Funds 11lgjc08]. 11lgpy22, Research numbers Nova [grant Education Universities Fundamental Technology and of the 2011J2200082]; Higher and Program Zhujiang for Guangdong 201001Y0104687244], Science of number Fund of Team [grant R&D Province Research 31000611, Innovative Introduced Program numbers Specialized 20100171110028]; the [grant 31171397]; Doctoral Foundation 2010CB945401]; and Science 2012CB911201, 91019020 Natural numbers National [grant (973 Program Research Program) Basic National the by supported was study This Funding manuscript. and the J.H., wrote D.L., and data X.F., S.J. the advice. W.M. and interpreted and conceptual Z.L., Y.Z. Z.S. and D.W., X.F., support Y.H., technical experiments. X.H., gave the F.L., experiments; designed the Z.S. performed and J.H. X.F., contributions Author as defined protected Inc. were Institute Fisher’s differences SAS by Significant from compared USA). software means NC, StatView and the (Cary, ANOVA using (PLSD) by difference analyzed least-significant were data other and yoer analysis. cytometry riptDAwsso-lte noa2 a onto slot-blotted was DNA input or Daefe;Fmna) naiuto h ietwsue sipt ihthe with input, as used (10 digest was diluted digest The the digest. 10 of to aliquot diluted remaining An Fementas). (Dnase-free; ufr n U 5 and buffer, (5 r olwdb 65 by followed hrs 4 nu N Tl rb:5 probe: [TelC DNA input for probes TelC iulzduigteCeiuiecn uli cdDtcinMdl (Thermo). Module Detection Acid Nucleic then Chemiluminescent the using visualized and Biotin-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCA], m S,01 we 0 MdT,1m TP MdT,2 dGTP, mM 1 dTTP, mM 1 dATP, mM 1 20, Tween 0.1% BSA, g ˚ o 0mn n tie ih50 with stained and min, 10 for C W W 9DAplmrs mlfe rdc rwt l rbsfor probes Alu with or product amplified polymerase DNA 29 9DAplmrs NB) n hnicbtda 30 at incubated then and (NEB)), polymerase DNA 29 ˚ o 0mn o uniiain 10 quantification, For min. 20 for C m ia oueta otie 5 0 r10n fDNA of ng 100 or 50, 25, contained that volume final l 9 Boi-CTACTACTA l rb:5 probe: Alu -Biotin-CCCTAACCCTAACCCTAA; m )wscmie ih10 with combined was l) m /lDP.Fursec rmcrmsmsand chromosomes from Fluorescence DAPI. g/ml 6 m S-okdHbn-+membrane. Hybond-N+ SSC-soaked /lpoiimidd eoeflow before iodide propidium g/ml m )pu NsAT(5ng/ (25 RNaseA/T plus g) P m , /l Pngn,Korea). (Panagene, g/ml) m .5o lower. or 0.05 m ia ecinproduct reaction final l frato mixture reaction of l ˚ ih5 with C m /lRaeA RNase g/ml 9 -labeled 6 ˚ for C W m 29 g) 9 - Journal of Cell Science in,W . hn,Z . gyn . esn .D,Tol,C . Braithwaite, D., C. Toouli, D., J. Henson, A., Nguyen, H., Z. Zhong, Q., W. Jiang, R. R. Reddel, and D. J. Henson, H., Z. and Zhong, M. Q., C. W. Jiang, A. Chang, A., A. Neumann, D., J. Henson, H., Z. Zhong, Q., W. Jiang, De W. J. Shay, and E. W. J., Wright, Hanish, S., H., Y. Erdjument-Bromage, Cong, D., Broccoli, B., Steensel, van L., Chong, un,J,Wn,F,Oua . i,N,J,G,Y,X,Zo . i . in,P., Liang, M., Li, B., Zuo, X., Ye, G., Ji, N., Liu, M., Okuka, F., Wang, J., Huang, R. R. Reddel, and L. C. Fasching, A., A. Neumann, A., M. Dunham, T. Lange, de L. Yu, and X. Li, X., Liu, J., Xi, X., Zeng, H., Saiyin, S., Chen, and A. A. Neumann, A., H. Pickett, E., C. Napier, B., S. Cohen, Z., Kaul, J., A. Cesare, R. R. Reddel, and J. A. Cesare, D. J. Griffith, and J. A. Cesare, u .D,Cieo,Y n epoa .K. T. Kerppola, and Y. Chinenov, D., C. Hu, R. R. Reddel, and A. M. Dunham, L., Dalla-Pozza, A., Englezou, M., T. Bryan, esn .D,Co . uctca .I,Cag .C,A,A . ikt,H .and A. H. Pickett, Y., A. Au, C., A. Chang, I., L. Huschtscha, Y., Cao, D., J. Henson, R. R. Reddel, and M. T. Bryan, T. Lange, de and L. Chong, W. A., J. Smogorzewska, Szostak, D., and Broccoli, W. C. Greider, H., E. Blackburn, H. E. Blackburn, egr .F,Bds . ere .R,Tlke,S,Piipks .A,Pen A., A. Philippakis, S., Talukder, R., A. Gehrke, G., Badis, F., M. Berger, References esn .D,Nuan .A,Yae,T .adRde,R R. R. Reddel, and R. T. Yeager, A., A. Neumann, D., J. Henson, W. C. Greider, and A. J. Hackett, M., D. Feldser, and J. H. Tanke, C., A. Vertegaal, C., J. Wiegant, J., Schimmel, K., A. Brouwer, epy .M,Sbaog .P,Hn,S . ogn,M . otoey .A., E. Montgomery, G., M. Goggins, M., S. Hong, P., A. Subhawong, M., C. Heaphy, jri,J n igtn .E. R. Kingston, and J. ´jardin, soitdPLbde yp3p1rqie P proteins. HP1 requires p53/p21 by bodies R. PML R. associated Reddel, and W. and A. restriction methionine by genes telomeres interference. of RNA lengthening alternative candidate complex. MRE11/RAD50/NBS1 the 4334. of sequestration mediated R. R. Reddel, T. 1667. Lange, de and P. Tempst, fE/P cells. ES/iPS al. of et W. W. Ge, Loci. genomic specific telomeres. regulation. with protein containing homeobox a HMBOX1, human activity. repressor of transcriptional analysis functional fusions. chromosome of absence the R. R. Reddel, mn ZPadRlfml rtisi iigclsuigbmlclrfluorescence bimolecular using cells living in proteins family complementation. Rel and bZIP among cells. human in recombination by maintenance Telomere implications. and mechanisms t-loops. heterogeneous and circles in telomeric length free by telomere maintaining lines. for cell tumor-derived mechanism and alternative tumors an human for Evidence (1997). lentv-eghnn-ftlmrsactivity. alternative-lengthening-of-telomeres R. R. Reddel, cells. human immortalised vitro in Cell Biol. aging. and cancer human to yeast and Med. Tetrahymena maize, Nat. from path the telomerase: eghnn ftlmrsi amla cells. mammalian in telomeres of lengthening W. R. Dirks, TRF2. and TRF1 proteins, 231-235. Myb-related distinct two contain telomeres al. et T. E. Chan, analysis B., high-resolution by O. preferences. revealed sequence Botvinnik, binding of S., DNA homeodomain Mnaimneh, in M., Variation (2008). T. Alleyne, L., Castillo, aresn . et,G . pti,J . oa,T . eta .H tal. et H. W. Westra, L., maintenance T. telomere subtypes. Lotan, telomeres cancer of I., human lengthening in J. alternative mechanism Epstein, the of J., Prevalence G. (2011). Netto, E., Gabrielson, instability. genome of initiation the 20 12 ee Dev. Genes 20) hlei:tepoencmlxta hpsadsfgad human safeguards and shapes that complex protein the Shelterin: (2005). irbo.Ml il Rev. Biol. Mol. Microbiol. 4804-4815. , 1133-1138. , 20) eoei N eitsd ooPLbd formation. body PML novo de mediates DNA Telomeric (2009). 20) pnaeu curneo eoei N aaersos in response damage DNA telomeric of occurrence Spontaneous (2009). 20) upeso fatraielnteigo eoee ySp100- by telomeres of lengthening alternative of Suppression (2005). 20) wthn n inln ttetelomere. the at signaling and Switching (2001). elRes. Cell 20) N -ice r pcfcadqatfal akr of markers quantifiable and specific are C-circles DNA (2009). 21) soito ftlmr eghwt uhni pluripotency authentic with length telomere of Association (2011). o.Cell Mol. Oncogene 19 Cell Cell 2100-2110. , 21 20) nuto fatraielnteigo telomeres- of lengthening alternative of Induction (2009). 136 9 779-792. , 26 789-798. , 19) ua eoei protein. telomeric human A (1995). 133 a.Rv Genet. Rev. Nat. 19) eoeednmc n eoeaeatvt in activity telomerase and dynamics Telomere (1997). 21) lentv eghnn ftlmrs models, telomeres: of lengthening Alternative (2010). 20) eoei N nATclsi characterized is cells ALT in DNA Telomeric (2004). 175-186. , 4635-4647. , yoee.Gnm Res. Genome Cytogenet. 1266-1276. , 20) uiiaino rtisascae with associated proteins of Purification (2009). u.J Cancer J. Eur. a.Rv Cancer Rev. Nat. a.Src.Ml Biol. Mol. Struct. Nat. 66 m .Pathol. J. Am. 0-2.(al fcontents). of (Table 407-425. , a.Med. Nat. a.Biotechnol. Nat. Oncogene 20) iulzto finteractions of Visualization (2002). 11 20) ua eoeaeadits and telomerase Human (2002). 20) eoeedsucinand dysfunction Telomere (2003). 319-330. , 33 o.Cl.Biol. Cell. Mol. 767-773. , 3 179 3 623-627. , 1271-1274. , 21 a.Genet. Nat. .Cl Biol. Cell J. 1608-1615. , 114 16 598-610. , 20) eoee and Telomeres (2006). 20) dniiainof Identification (2007). 1244-1251. , 131-136. , 27 20) slto and Isolation (2006). o.Cl.Biol. Cell. Mol. 1181-1185. , Cell 20) Alternative (2002). Science 19) Human (1997). 24 a.Genet. Nat. 26 106 185 9948-9957. , 447-450. , 270 661-673. , 797-810. , (2000). 1663- , Mol. ˜a- 25 17 A1HBX euae eoee nATcls3989 cells ALT in telomeres regulates TAH1/HMBOX1 , , a W. Ma, i,D,Sfr,A,OCno,M . hn .W,Leee,A,Qn .and J. Qin, A., Laegeler, W., D. Chan, S., M. J., O’Connor, Wong, A., J., Safari, Qin, Y., D., S. Liu, Jung, H., Xin, P., Gu, Y., Zhang, M., Wan, J., Liang, i,N . itse,M . rwe .R,Hre,C . et .D,H,P L., P. Ho, D., M. West, B., C. Harley, R., K. Prowse, A., M. Piatyszek, W., N. Kim, Dras M., Scheibe, C., Benda, F., Butter, D., Kappei, eg .C,Xag . adt,T . ozlzSae,I,Gnao . Harris, S., Gonzalo, I., Gonzalez-Suarez, K., T. Pandita, T., Xiang, C., S. Zeng, egr .R,Nuan .A,Egeo,A,Hshsh,L . ol,J .and R. J. Noble, I., L. Huschtscha, A., Englezou, A., A. Neumann, Z. R., Songyang, T. and Yeager, D. Liu, J., Xu, J., Qin, L., Liao, J., Z. Xu, Songyang, and D. Liu, H., Xin, L. P. Chen, and H. W. Lee, K., G. Wu, T. Lange, de and A. Smogorzewska, C., R. Wang, hy .W n acet,S. Bacchetti, and W. J. Shay, T. H. Yu, and R. P. Potts, F. Ishikawa, and A. Nabetani, a,M,Qn . ogag .adLu D. Liu, and Z. Songyang, J., Qin, M., Wan, Veenstra, M., R. Terns, E., K. E. McCann, Z., S. Meng, Artandi, B., and E. D. Abreu, S., T. A. Veenstra, Venteicher, J., P. Mason, J., Z. Meng, S., A. Venteicher, hn,Z . in,W . eae .J,Nuan .A,Wdw,R n Reddel, and R. Wadhwa, A., A. Neumann, J., A. Cesare, Q., W. Jiang, H., Z. Zhong, cel . cafr .L,Juh . elr . a,D,Bikcmd,C,van C., Brinkschmidt, D., Wai, M., Keller, A., Jauch, L., K. Schaefer, C., Scheel, Z. Songyang, and H. Kim, W., Ma, tgoDAcnrs . edzBrue,A,Fxn .L,Rye .J and J. N. Royle, L., J. Foxon, A., Mendez-Bermudez, M., D’Alcontres, Stagno (ChIP). telomeres. Z. Songyang, al. et cells. stem 739. D. embryonic in complexes Liu, repression transcriptional J., A. Cooney, 2011-2015. oilo .M,Wih,W . enih .L n hy .W. J. cancer. and Shay, cells and immortal L. with S. activity telomerase Weinrich, human E., of W. association Wright, M., G. Coviello, 1681-1701. eoeerpa-idn rti otiuigt eoeaerecruitment. telomerase al. to et contributing K. protein Araki, repeat-binding M., telomere Araki, C., Basquin, L., C. .C n ag Q. Yang, and endonuclease. C. C. yeo rmeoyi ekma(M)body. (PML) leukemia promyelocytic of type R. R. Reddel, CISK. kinase survival cytokine-independent the of Chem. substrate a as Flightless-I telomeres. of lengthening alternative in telomerase- NBS1 immortalized Chem. of in phases Implication S/G2 cells. late negative during bodies leukemia promyelocytic telomeres. human at deletions T-loop-sized generates eaieimraie cells. immortalized negative functions. in implicated is and TPP1 with associates regulation. Stn1, length yeast telomere of homolog human a (OBFC1), synthesis. E. telomere and S. localization 648. Artandi, body Cajal and components for P. required telomerase protein M. Terns, as D., reptin T. and pontin assembly. holoenzyme ATPases for of essential Identification (2008). A5/B1cmlxi el htueatraielnteigo telomeres. of lengthening alternative use Chem. that cells in complex RAD50/NBS1 R. R. lentv eghnn ftlmrsi soitdwt hoooa ntblt in instability C. chromosomal Poremba, with associated and is B. telomeres osteosarcomas. Dockhorn-Dworniczak, of W., lengthening Alternative Boecker, F., Valen, proteins. telomere-binding of SUMOylation Biol. through Mol. cells cancer ALT peptide and (BiFC) complementation fluorescence assays. Bi-molecular array-based by interactions ciainadls ftlmrcDNA. telomeric of loss and activation P. Salomoni, Cancer J. Eur. 21) nlsso eoeepoen yCrmtnImmunoprecipitation Chromatin by proteins telomere of Analysis (2011). 284 275 282 20) irpino eoeemitnneb elto fteMRE11/ the of depletion by maintenance telomere of Disruption (2007). ehd o.Biol. Mol. Methods eoeBiol. Genome 14377-14385. , 30618-30622. , 29314-29322. , 14 a.Cl Biol. Cell Nat. 581-590. , 19) eoeaengtv motlzdhmnclscnananovel a contain cells human immortalized Telomerase-negative (1999). a.Cl Biol. Cell Nat. 20) TPitrcswt O1adrgltsislclzto to localization its regulates and POT1 with interacts PTOP (2004). 20) ako R2i L el assPLdpnetp53 PML-dependent causes cells ALT in TRF2 of Lack (2007). 33 Oncogene 787-791. , ehd o.Biol. Mol. Methods 9 20) h M56cmlxmitistlmr eghin length telomere maintains complex SMC5/6 The (2007). 20) eoeercmiainrqie h MUS81 the requires recombination Telomere (2009). 232. , 6 20 673-680. , .Bo.Chem. Biol. J. 19) uvyo eoeaeatvt nhmncancer. human in activity telomerase of survey A (1997). 735 3835-3844. , o.Cl.Biol. Cell. Mol. 20) nsa eoei Nsi ua telomerase- human in DNAs telomeric Unusual (2009). 11 151-159. , 616-623. , 20) ao n c4ascaewt unique with associate Oct4 and Nanog (2008). 20) h eooesetrncmlxadits and complex telosome/shelterin The (2008). Cell 21) tdigo eoei protein-protein telomeric of Studying (2011). .Cl Biol. Cell J. 735 132 20) ua eoeaeholoenzyme telomerase human A (2009). 284 161-171. , 20) B1adTF ooaieat colocalize TRF1 and NBS1 (2000). 945-957. , 29 20) Bfl-otiigpoen1 protein fold-containing OB (2009). acrRes. Cancer 26725-26731. , 21) O1i amla direct mammalian a is HOT1 (2013). 703-713. , 20) oooosrecombination Homologous (2004). 179 ˇkovic Cell 855-867. , ˇ . tvne . Novo, M., Stevense, I., , 119 59 20) dniiainof Identification (2009). a.Cl Biol. Cell Nat. 4175-4179. , 355-368. , Science 19) Specific (1994). MOJ. EMBO Science a.Struct. Nat. 323 10 .Biol. J. .Biol. J. (2001). .Biol. J. 731- , 644- , 266 32 , ,