Molecular and Biomechanical Analysis of Rainbow Trout LCK Suggests A

Molecular Immunology 44 (2007) 2737–2748 Molecular and biochemical analysis of rainbow trout LCK suggests a conserved mechanism for T-cell signaling in gnathostomes Kerry J. Laing a,1, Stacey Dutton b, John D. Hansen a,c,∗ a Department of Pathobiology, University of Washington, Seattle, WA 98195, USA b Department of Neuroscience, Emory University, Atlanta, GA 30322, USA c USGS-Western Fisheries Research Center, Seattle, WA 98115, USA Received 28 September 2006; received in revised form 16 November 2006; accepted 18 November 2006 Available online 18 December 2006 Abstract Two genes were identified in rainbow trout that display high sequence identity to vertebrate Lck. Both of the trout Lck transcripts are associated with lymphoid tissues and were found to be highly expressed in IgM-negative lymphocytes. In vitro analysis of trout lymphocytes indicates that trout Lck mRNA is up-regulated by T-cell mitogens, supporting an evolutionarily conserved function for Lck in the signaling pathways of T-lymphocytes. Here, we describe the generation and characterization of a specific monoclonal antibody raised against the N-terminal domains of recombinant trout Lck that can recognize Lck protein(s) from trout thymocyte lysates that are similar in size (∼57 kDa) to mammalian Lck. This antibody also reacted with permeabilized lymphocytes during FACS analysis, indicating its potential usage for cellular analyses of trout lymphocytes, thus representing an important tool for investigations of salmonid T-cell function. Published by Elsevier Ltd. Keywords: Lck; T lymphocyte; Rainbow trout; Salmonid 1. Introduction lates immunoreceptor tyrosine-based activation motifs (ITAMs) in the tails of the CD3 and TCR-␨ chains of the TCR complex. Cell mediated immunity is initiated when foreign peptides These phosphorylated ITAMsbecome high affinity docking sites (antigens) are presented to specific T cell receptors (TCRs) for another kinase, ZAP-70, that is also phosphorylated and acti- on T-lymphocytes by major histocompatibility complex (MHC) vated by Lck (Chan et al., 1995; Wange et al., 1995). Activated molecules on antigen presenting cells (APCs). This process is ZAP-70 molecules autophosphorylate and provide docking sites well defined for mammalian lymphocytes. The TCR interacts for other signaling molecules such as the membrane adaptor pro- also with other molecules, such as CD3 and TCR-␨ and the tein LAT (linker for activation of T-cells), which in turn, recruits co-receptors CD4 and CD8, to co-ordinate the recruitment and and activates additional proteins to initiate protein kinase C and activation of various kinases involved in the signaling pathways the MAP-kinase pathways that are fundamental to T-cell differ- of T-cells. Among these kinases is the lymphocyte cell kinase entiation, proliferation and effector functions (Sommers et al., (Lck) that belongs to the Src family of protein tyrosine kinases 2004). (Williams et al., 1998; Robinson et al., 2000). Lck phosphory- Lck is composed of four major subunits; an N-terminal unique domain, two Src homology domains SH3 and SH2, and a kinase domain (SH1); followed by a short regulatory tail. ∗ Corresponding author at: USGS-Western Fisheries Research Center, 6505 Activation and regulation of Lck occurs as a result of differen- NE, 65th Street, Seattle, WA 98115, USA. Tel.: +1 206 526 6588; tial phosphorylation of two important tyrosines. One (Tyr505 in fax: +1 206 526 6654. human Lck) is located in the short C-terminal tail that in its phos- E-mail addresses: [email protected], [email protected] phorylated form, binds to the SH2 domain of Lck to maintain (J.D. Hansen). 505 1 Present address: Fred Hutchinson Cancer Research Center, 1100 Fairview Lck in an inactive state. Tyr is phosphorylated and dephos- Avenue North, D3-100, PO Box 19024, Seattle, WA 98109, USA. phorylated by the activities of the C-terminal Src kinase (Csk) 0161-5890/$ – see front matter. Published by Elsevier Ltd. doi:10.1016/j.molimm.2006.11.021 2738 K.J. Laing et al. / Molecular Immunology 44 (2007) 2737–2748 and CD45, respectively (Hermiston et al., 2002). Dephosphory- Lck, suggesting they will have similar protein:protein interac- lation of Tyr505 results in dissociation of the SH2 domain and tions. To support this, chicken Lck associates with both avian activation of Lck. The other essential tyrosine (Tyr394 in human CD4 and CD8 (Veillette and Ratcliffe, 1991; Chow et al., Lck) resides in an activation loop between the two lobes of the 1992). kinase domain. Autophosphorylation of Tyr394 causes a confor- T-cell populations of teleost fish are relatively undefined mational change in Lck that is essential for its kinase activity compared to mammals. Although increasing evidence shows (Holdorf et al., 2002; Giannini and Bijlmakers, 2004). In addi- the conservation of molecules associated with T-lymphocytes, tion, the SH3 domain interacts with the linker region between such as the T cell receptor (TCR), CD3, CD8 and CD4, in the SH2 and kinase domains to maintain the inactive state of the these lower vertebrates, cellular reagents capable of defining Lck (Hofmann et al., 2005). these critical molecules have yet to be developed. One of the The N-terminal unique sequence of Lck distinguishes it from major teleost models of immunity is rainbow trout, a commer- other Src family members and is responsible for its functional cially important species of the Salmonidae family. In order to specificity (Marth et al., 1985; Turner et al., 1990). This unique improve the availability of molecular reagents for lymphocyte region allows Lck to associate with the cytoplasmic tails of CD4 analyses in salmonids, it is important to identify and function- or CD8 via non-disulphide related protein-protein interactions ally characterize relevant lymphocyte specific markers for trout. between four cysteine residues (CXXC in Lck; CXC in CD4 and Our previous studies described CD8␣ and CD4-like molecules CK8␣)inaZn2+-dependent manner (Huse et al., 1998; Lin et al., from rainbow trout (Hansen and Strassburger, 2000; Laing et 1998). This in turn results in recruitment of Lck to the TCR com- al., 2006) that appear to contain important amino acids for plex, and the initiation of T cell signaling. Localization of Lck interacting with Lck. Prior to this study, however, no sequence to the cell membrane occurs via myristylation (Gly2, Ser6) and information was available for salmonid Lck, thus, we describe palmytilation sites (Cys3) within the N-terminal unique domain here the identification and analysis of two Lck genes from (Yasuda et al., 2000). rainbow trout. Lck-GST fusion proteins were also expressed Lck is well conserved throughout jawed vertebrates, with for the generation of monoclonal antibodies against trout Lck highly conserved gene sequences reported for chicken Gallus that were used in biochemical and cellular analyses of trout gallus (Chow et al., 1992), pufferfish Fugu rubripes (Brenner et lymphocytes. al., 2002) and zebrafish Danio rerio (Langenau et al., 2004) that are abundantly expressed in T-cell rich tissues such as thymus 2. Materials and methods and spleen. Important cysteine and tyrosine residues identified for Lck function in mammals are retained in non-mammalian 2.1. Identification of Lck transcripts in a rainbow trout cDNA library Table 1 A cDNA probe containing nucleotides 30–980 of human Lck Primers and probes transcript (Perlmutter et al., 1988) was used to screen a rainbow Primer name Primer sequence 5–3 trout thymus cDNA library as previously described (Hansen LCK-F1 GARCCIGARCCITGGTTYTT et al., 1997) using moderate stringency. From 57 hybridizing ◦ LCK-R4 TTDATIGTRAAIGTNCCRTA clones, 18 were randomly selected for further 2 screening by LCK-23387 GAAATACAACAGGCTCCTTCA PCR using primers LCK-23387 and LCK-23388. These primers LCK-23388 AGGACGACTTGAGAAAATCTAC had been designed against sequences from a trout Lck cDNA LCK2-F1 GGCTCCTTCTCCTTATCTGTC fragment that was amplified by degenerate PCR using LCKF1 LCK2-R1 TCAGGGCAGTTCTCAGGTC Lck1-115F CTTAGTTGCTGTTTTTGATAGGATTACTAAA and LCKR4 (Table 1) with thymic cDNA resulting in a 928 bp Lck1-231R CTTCAACAGGGTGTCAGCGA amplicon. The fragment was cloned and sequence verified. Lck2-67F TTGCTGTTTTTGATAAGATTTATATTTGATGA PCR parameters were as described for RT-PCR below. Three Lck2-188R AAGCCTAATATAATGCTCTTCAACAGGG clones were identified from the cDNA library that contained LCK-23489 AGAGAGAATTCATGGGATGCAACTATAGT- Lck. One clone containing the full-length cDNA for trout Lck1 TCAGATTATGAT LCK-23491 AGAGACTCGAGTTAGCAAGGCTGTTCTTG- was sequenced to completion using universal (T3/T7) vector GTACTGCCCCTCTGT primers and one gene specific primer, LCK-F1. Subsequently, ARP-For GAAAATCATCCAATTGCTGGATG routine random sequencing of a thymus cDNA library identi- ARP-Rev CTTCCCACGCAAGGACAGA fied a second distinct Lck clone designated as Lck2, which was IgM-MEM-F1 AAAGCCTACAAGAGGGAGACCGAT sequenced to completion using universal primers with LCK2-F1 IgM-MEM-R1 AGAGTTATGAGGAAGAGTATGATGAAGGTG TCR-23743 CAGCTTGAAGTCAAGAAATAC and LCK2-R1 (Table 1). TCR-23744 TATCAGCACGTTGAAAACGAT 2.2. Animals and RNA extraction Taqman probes Probe sequence 5–3 LCK1-177T ATGGATAAAGTTGCTGCTCTGGCTGTAGACCAGTGAA Outbred rainbow trout (Clear Springs Foods Inc., Buhl, LCK2-104T AGGTCTCTTAGTCATGGATAAAGCTGCTCTGGCTG Idaho) were used unless otherwise stated and maintained at a ARP-T CTATCCCAAATGTTTCATTGTCGGCGC constant temperature of 15 ◦C in sand-filtered and UV-treated Note:R=AorG,N=G,A,CorT,Y=CorT,D=A,GorT. freshwater at the WesternFisheries Research Center,

Load more