Circulation of Dengue Serotypes in Five Provinces of Northern Thailand During 2002-2006

Circulation of dengue serotypes in five provinces of northern Thailand during 2002-2006 Punnarai Veeraseatakul , Boonrat Wongchompoo, Somkhid Thichak, Yuddhakarn Yananto, Jarurin Waneesorn and Salakchit Chutipongvivate Clinical Pathology Section, Regional Medical Sciences Centre Chiangmai, Department of Medical Sciences, Ministry of Public Health, 191 M.8 T. Donkaew, Maerim District, Chiangmai 50180, Thailand Abstract Dengue haemorrhagic fever is an epidemic infectious diseases caused by dengue virus. It is a major disease prevalent in all provinces of Thailand. This study was to determine the circulating dengue serotypes by reverse transcription polymerase chain reaction (RT-PCR). A total of 1116 seropositive acute samples were analysed from DF/DHF patients in five provinces of northern Thailand (Chiangmai, Lampang, Lamphun, Mae Hong Son and Phrae) during the period January 2002 to December 2006. Five hundred and fifty-nine samples were found positive, of which 47.2%, 30.6%, 18.4% and 3.8% were affected with DENV-2, DENV-1, DENV-4 and DENV-3 respectively. From 2002 to 2005, the predominant dengue serotype was DENV-2, whereas DENV-1 was predominant in 2006. There was an apparent increase in the percentage of DENV-4 from 2005 to 2006. Our results indicated that all four dengue serotypes were circulating in this region and the annual change of predominant serotypes was the cause of the severity of the disease. Keywords: Dengue haemorrhagic fever; Dengue serotype; Northern Thailand. Introduction increasingly larger dengue outbreaks have occurred. There were 99 410, 127 189 and Dengue is a mosquito-borne viral infection 114 800 cases of dengue reported to the caused by four distinct dengue virus serotypes Bureau of Epidemiology in 1997, 1998 and [3] DENV-1–4. It is the most prevalent arbovirus 2002 respectively. In 1999, the Ministry of in tropical and subtropical regions of Africa, the Public Health initiated a dengue control Americas, the Eastern Mediterranean, the programme to reduce the incidence rate to [4] Western Pacific and South-East Asia.[1,2] In less than 50 cases/100 000 population. In Thailand, the first dengue outbreak occurred northern Thailand, many provinces are located in Bangkok in 1958, initially in a pattern with a approximately 250–300 metres above the sea 2-year cycle, and subsequently in irregular level, with some urban areas and large rural cycles, as the disease spread throughout the areas. There were 13 915, 11 092, 6147, 6992 country. The largest outbreak was reported in and 6914 dengue cases reported during the 1987, with an incidence rate of 325 cases/ five-year period 2002–2006, with incidence 100 000 population. In recent years, rates of 119.4, 91.5, 51.3, 58.9 and 58.1 cases/ E-mail: [email protected], [email protected]; Fax: 66-53-112192 Dengue Bulletin – Volume 31, 2007 19 Circulation of dengue serotypes in Thailand 100 000 population respectively,[5-8] with 120 Figure 1: Map of five provinces of northern deaths. Thailand Gubler et al.[9] and Lam et al.[10] reported that virological surveillance, which involves monitoring of dengue virus infection in humans, Mac Hong Son has been used as an early warning system to Chiang Mai predict outbreaks. Such surveillance, based on Lampang Laos the isolation and identification of dengue Lamphun Phrae viruses infecting the human population, North provides an important means of early detection of any change in the prevalence of dengue Northeast Central virus serotypes. Each dengue serotype has East characteristics that affect the nature of dengue Myanmar epidemic and disease severity. Nisalak et al.[11] reported that the predominant dengue serotype South in the outbreaks in Bangkok during 1997–1998 [12] was DENV-3. Anantapreecha et al. detected Malaysia the predominant serotypes DENV-1 and DENV- 2 in six provinces across Thailand during 2001– 2002. However, dengue serotypes in five RNA extraction provinces of northern Thailand have not yet been well elucidated, thus the present study, Viral RNA was isolated by using QIAamp viral which is aimed at clarifying the pattern of RNA Mini Kit (QIAGEN, Cat. no. 52904). circulating dengue serotypes in this region with Briefly, the serum (100 μl) was added and a view to better understand the mixed with 400 μl of AVL/RNA carrier solution epidemiological complexities of the epidemics (lysis buffer). After incubation at room of dengue infection. temperature for 10 min, 400 μl of absolute ehtanol was added to the solution. All the solutions were then transferred to a spin Materials and methods column and were spun at 8000 rpm for 1 min. The RNA was then washed by adding 500 μl of AW1 (washing buffer 1) and spun at 8000 Patients rpm for 1 min and following the same procedure with AW2 (washing buffer 2). Finally, A total of 1116 seropositive acute samples with the RNA was eluted by adding 60 μl of elution positive anti-dengue IgM antibody were buffer and spun at 8000 rpm for 1 min. The analysed for dengue serotype by RT-PCR at eluted RNA was kept in –70 °C until use. the Regional Medical Sciences Centre, Chiangmai (RMSc_CM), Thailand. These samples were collected from DF/DHF patients RT-PCR in five northern provinces that included Chiangmai, Lamphun, Lampang, Mae Hong RT-PCR method was performed as previously Son and Phrae during 2002–2006 (Figure 1). described by Yenchitsomanus et al.[13] Briefly, 20 Dengue Bulletin – Volume 31, 2007 Circulation of dengue serotypes in Thailand Table 1: Primer sequences of dengue virus 2 was the predominant serotype (47.2% cases), and serotyping by RT-PCR followed by DENV-1 (30.6% cases), DENV-4 Primer Sequence 5’- 3’ (18.4% cases) and DENV-3 (3.8% cases). DUL GCTGTGTCACCCAGAGTGGCCAT The circulation of dengue serotypes in northern DUR TGGCTGGTGCACAGACAATGGTT Thailand by year during 2002-2006 is shown in D1L GGGGCTTCAACATCCCAAGAG Figure 2. From 2002 to 2005, the predominant D1R GCTTAGTTTCAAAGCTTTTTCAC serotype was DENV-2 as 46.0%, 59.7%, 70.3% D2L ATCCAGATGTCATCAGGAAAC and 44.8% of cases were of this serotype, D2R CCGGCTCTACTCCTATGATG respectively, followed by DENV-1 (42.0%, D3L CAATGTGCTTGAATACCTTTGT 32.3% and 25.0% cases) from 2002 to 2004 D3R GGACAGGCTCCTCCTTCTTG respectively and DENV-4 (26.6% cases) in 2005. D4L GGACAACAGTGGTGAAAGTCA In 2006, the predominant serotype had D4R GGTTACACTGTTGGTATTCTCA changed to DENV-1 (42.8% cases), followed by DENV-4 (33.1% cases). DENV-3 was found 5 μl of RNA solution was mixed with reagents to be the least circulating serotype during 2003 of one step RT-PCR kit (QIAGEN, Cat. no. to 2006 and not found at all in 2002. 210212) and specific oligonucleotide primers of dengue-envelope (E) gene; DUL and DUR. The distribution of the predominant dengue The cDNA synthesis was performed at 50 °C serotypes by provinces were analysed when for 30 min in a thermal cycler (MJ research more than five positive dengue virus samples PTC-100, USA) followed by 40 cycles of PCR were detected. In Chiangmai province, the step including 94 °C for 5 min, 94 °C for 1 min, predominant serotypes were DENV-1 (48.7% 45 °C for 1 min and 72 °C (5 min for the last and 56.9% cases) in 2002 and 2006, and DENV- cycle). 1 μl of the primary PCR product was 2 (54.8%, 71.4% and 52.0% cases) in 2003, used as the template for the second PCR with 2004 and 2005 respectively. In Lampang four serotype-specific primer pairs; D1L, D1R, province, the predominant serotypes were D2L, D2R, D3L, D3R, D4L and D4R (Table DENV-2 (100.0%, 62.5%, 79.3% and 40.0% 1). The PCR step was the same as above with cases) from 2002 to 2005 respectively and the annealing temperature set at 62 °C. DENV-1 (72.0% cases) in 2006. In Lamphun Negative and positive dengue controls were province, the predominant serotypes were used. The secondary PCR products were DENV-2 (66.7% and 50.0% cases) in 2002 and analysed in 2% agarose gel electrophoresis and 2004, and DENV-4 (61.8% and 77.8% cases) then visualized by ethidium bromide staining. in 2005 and 2006. In Mae Hong Son province, the predominant serotypes were DENV-2 (75.1% cases) in 2005 and DENV-1 (80.0% Results and discussion cases) in 2006. In Phrae province, the predominant serotype was DENV-2 (50.0% and The number of seropositive acute cases and 38.4% cases) in 2005 and 2006. dengue serotypes in the five provinces during 2002-2006 are shown in Table 2. Five hundred The comparison of the predominant dengue and fifty-nine dengue viral cases were detected serotypes among the five provinces by year with an average positivity rate of 50.0% by RT- was analysed. In 2002, DENV-1 was PCR. All the four dengue serotypes were predominant in one province (Chiangmai) and detected during this study. The total numbers DENV-2 was predominant in two provinces of positive dengue cases were analysed. DENV- (Lamphun and Lampang). In 2003, DENV-2 was Dengue Bulletin – Volume 31, 2007 21 Circulation of dengue serotypes in Thailand Table 2: Summary of seropositive dengue cases and dengue serotypes in five provinces of northern Thailand, 2002–2006 predominant in two provinces (Chiangmai and (Phrae) and DENV-4 was predominant in one Lampang). In 2004, DENV-2 was predominant province (Lamphun). This result has shown that in three provinces (Chiangmai, Lamphun and the spread of predominate DENV-2 was Lampang). In 2005, DENV-2 was predominant increasing from two provinces to four provinces in four provinces (Chiangmai, Lampang, Mae during 2002–2005; after that it rapidly Hong Son and Phrae) and DENV-4 was decreased in all provinces.

Load more