Association Between Two Polymorphisms in the SRD5A2 Gene and Serum Androgen Concentrations in British Men1

578 Vol. 12, 578–581, June 2003 Cancer Epidemiology, Biomarkers & Prevention

Short Communication Association between Two Polymorphisms in the SRD5A2 Gene and Serum Androgen Concentrations in British Men1

Naomi E. Allen,2 Juergen K. V. Reichardt, are needed to additionally clarify the role of the A49T Hannah Nguyen, and Timothy J. Key polymorphism in androgen metabolism. Cancer Research United Kingdom Epidemiology Unit, University of Oxford, Gibson Building, Radcliffe Infirmary, Oxford, OX2 6HE, United Kingdom Introduction [N. E. A., T. J. K.], and Institute for Genetic Medicine, Departments of Biochemistry and Molecular Biology and Preventive Medicine, University of It is well established that the steroid 5 ␣-reductase type II Southern California School of Medicine, University of Southern California, enzyme, which irreversibly converts testosterone to its more Los Angeles, California 90089-9075 [J. K. V. R., H. N.] potent metabolite DHT3 in prostatic cells, is required for the normal growth and development of the prostate gland (1). A meta-analysis of prospective studies suggests that the serum Abstract concentration of A-diol-g, a serum marker of the abundance of Androgens are essential for the growth of the prostate 5 ␣-reductase type II and intraprostatic DHT, is slightly higher gland and have been implicated in the development of in men who subsequently develop prostate cancer compared prostate cancer. Little is known about the determinants with healthy individuals (2). The circulating A-diol-g concen- of androgen levels in men, although observed ethnic tration is believed to be a more accurate serum marker of 5 differences suggest they may have a genetic basis. Several ␣-reductase type II than serum DHT itself, because A-diol-g is polymorphisms have been identified in the steroid 5 ␣- the direct metabolite of DHT formed in the prostate gland. reductase type II gene (SRD5A2), which encodes an However, circulating DHT is largely derived from 5 ␣-reduc- enzyme that catalyzes the conversion of testosterone to its tase type I activity in the skin and is therefore not an accurate more potent metabolite, dihydrotestosterone. Although marker of intraprostatic 5 ␣-reductase type II activity. Other some of these polymorphisms have been associated with than age and body mass, little is known about the determinants increased prostate cancer risk, the association with of A-diol-g levels in men (3). The observation that young circulating androgen levels remains unclear. The purpose Japanese men have lower A-diol-g levels than Caucasian and of this study is to investigate the association between the African-American men (4) in parallel with a lower prostate ؅ (TA)n dinucleotide repeat polymorphism in the 3 cancer risk (5), suggests that differences in 5 ␣-reductase type untranslated region and the A49T polymorphism (which II activity may have a strong genetic basis. replaces the normal alanine with threonine at codon 49) The SRD5A2 gene is located in chromosome band 2p23. in the SRD5A2 gene and serum androgen concentrations One polymorphism identified in the 3Ј untranslated region in 604 British men. In particular, we wanted to test the consists of a variable number of TA dinucleotide repeats (6). hypotheses that the variant alleles are associated with an Three clusters of base-pair repeats have been identified, being increased serum concentration of androstanediol assigned (TA)0 comprising 96% of alleles, and the variants glucuronide, a direct metabolite of dihydrotestosterone (TA)9 and (TA)18 alleles (6). Although this polymorphism does and a serum marker of 5 ␣-reductase activity. Mean not affect the structure of the resulting protein, it may affect hormone concentrations were evaluated in each genotype, mRNA stability and, thus, alter enzymic activity. The observa- and adjusted for age and other relevant factors. We tion that the rare (TA)18 allele is limited to African-American found no evidence that the SRD5A2 (TA)n repeat populations (7), who have a higher rate of prostate cancer than polymorphism was associated with androgen levels. Men Asian-American or Caucasian men (5), suggests that a long who possessed one or two copies of the variant T allele in allele length may be associated with increased enzyme activity. the A49T polymorphism had a significantly 24% lower However, subsequent case-control studies in Caucasian and androstanediol glucuronide concentration than men who Asian men have not found the (TA)9 variant allele to be asso- .(ciated with an increased prostate cancer risk (8–11 .(0.0003 ؍ were homozygous for the wild-type allele (P Because of the rarity of this variant allele, larger studies A second common SRD5A2 germ-line polymorphism is a single missense mutation that substitutes alanine with threonine at codon 49 (A49T; Ref. 12). This polymorphism results in a variant protein of which the in vitro enzymic activity is ϳ5-fold Received 12/4/02; revised 2/25/03; accepted 3/3/03. higher than normal (12). Although the A49T polymorphism is The costs of publication of this article were defrayed in part by the payment of rare in all populations, the variant T allele is more prevalent page charges. This article must therefore be hereby marked advertisement in among Caucasian men (5–6%; Ref. 13) than African-American accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by Cancer Research United Kingdom and by the (1%) or Hispanic men (2%; Ref. 12) and has thus far not been Europe Against Cancer Program of the Commission of the European Communi- ties. This work was also partially supported by a grant from the NIH (to J. K. V. R.; grant CA68581). 2 To whom requests for reprints should be addressed, at Cancer Research United 3 The abbreviations used are: DHT, dihydrotestosterone; A-diol-g, androstanediol Kingdom Epidemiology Unit, Gibson Building, Radcliffe Infirmary, Oxford, glucuronide; SRD5A2, steroid 5 ␣-reductase type II; TA, thymine-adenine; FT, OX2 6HE United Kingdom. Phone: 44-1865-311933; Fax: 44-1865-301545; free-testosterone; SHBG, sex-hormone binding globulin; EPIC, European Pro- E-mail: [email protected]. spective Investigation into Cancer and Nutrition.

identified in Asian men (11, 14). Studies in Caucasian men SRD5A2 A49T Polymorphism. The A49T mutation was have generally not found this polymorphism to be associated screened using PCR amplification of radiolabeled exon 1 of the with an increased prostate cancer risk in Caucasian men (9, 13, SRD5A2 gene (with the primers oNM16 GCAGCGGCCAC- 15), although the T allele has been associated with an increased CGGCG and oNM32 GTGGAAGTAATGTACGCAGAA), prostate cancer risk in African-American and Hispanic men (12). followed by single-stranded conformational polymorphism If these genetic polymorphisms do influence prostate can- analysis to determine genotypes at the A49T locus, as reported cer risk, one might expect their effects to be mediated via previously (12). All of the samples were submitted in coded changes in androgen levels, and in particular, A-diol-g. How- format for genotyping and included 5% of masked repeats. ever, very little is known about the associations between Statistical Methods. Testosterone, FT, and A-diol-g were SRD5A2 genetic variants and circulating androgen concentra- square-root transformed, and SHBG was natural-logarithmi- tions in men. We previously found the SRD5A2 V89L poly- cally transformed to approximate normal distributions, to per- morphism to be associated with a 10% reduction in circulating form multivariate ANOVA; back-transformed means and their concentrations of A-diol-g in a large group of British men (16). corresponding 95% confidence intervals are presented. Multi- The aim of the present study is to examine the association variate ANOVA was used to evaluate the association between between the SRD5A2 (TA)n and A49T polymorphisms in rela- genotype and circulating hormone concentrations after adjust- tion to circulating concentrations of A-diol-g, and its main ing for age (20–29, 30–39, 40–49, 50–59, 60–69, and 70ϩ precursor hormones, testosterone and calculated FT, and its years), time of day at venipuncture (Ͻ10.00, 10.00–13.29, and associated binding protein, SHBG, in this same group of men. 13.30ϩ), and time since last meal at venipuncture (Ͻ1.5, 1.5- Ͻ3, and 3ϩ h). Adjustments for lifestyle factors such as body mass index, smoking, education, dietary group, and physical Materials and Methods exercise were examined but did not affect the point estimates Subjects. This study is part of a larger investigation, designed and were not included in the final model. Differences in ad- to investigate diet and hormonal function in men, described justed mean hormone levels between the genotypes were eval- elsewhere (17). Briefly, 750 white male subjects were selected uated using the (TA)0/(TA)0 genotype as the reference group for from the Oxford United Kingdom component of the EPIC the (TA)n polymorphism and the A/A genotype as the reference study. These men were recruited from the United Kingdom group for the A49T polymorphism. All of the Ps are derived between 1994 and 1997 through vegetarian and health food from parametric tests of heterogeneity derived from ANOVA magazines, the Vegetarian Society and the Vegan Society, and models and are taken from the F statistic that the underlying from friends and relatives of the participants. Men were eligible group means are all equal, unless otherwise stated. A P Ͻ 0.05 for the current study if they had donated a blood sample before was considered statistically significant. A test for linear trend 1998 and had no diagnosis of cancer or any other serious was also performed where appropriate, to assess statistical conditions known to influence hormone concentrations. significance across genotypes by incorporating the categorical Blood Collection and Hormone Assays. Blood samples (30 term in the model as a linear term. All of the statistical analyses ml) were collected for each subject, sent in the mail to the EPIC were performed using Stata 7.0 (19). laboratory in Norfolk, and aliquoted into 0.5-ml straws of plasma, serum, buffy coat, and erythrocytes. Samples were Results stored in liquid nitrogen tanks at Ϫ196°C until needed for The mean age of the subjects was 47 years (range, 20–78 analysis. Immunoassays were used to measure serum testoster- years), and the mean body mass index was 24.0 kg/m2 (range, one (Immuno 1; BayerCorp, New York, NY), A-diol-g (Diag- 17.5–48.0 kg/m2). Genotyping was successful for the (TA) nostic Systems, Webster, TX), and SHBG (Oy Medix Bio- n polymorphism in 584 subjects and for the A49T polymorphism chemica Ab, Kauniainen, Finland) in the Clinical Biochemistry in 604 subjects. The genotype distribution of the (TA) poly- Laboratory at the John Radcliffe Hospital (Oxford, United n morphism is shown in Table 1. The variant allele was either 103 Kingdom) in 1998. Samples were randomly assorted into bp (7%) or 105 bp (93%) in length and was, thus, considered to batches. Coefficients of variation were 6.8% at 10.2 nmol/liter be a part of the (TA) family of alleles; no subject had repeat for testosterone, 2.6% at 9.7 nmol/liter for A-diol-g, and 9.5% 9 lengths Ͼ105 bp. The prevalence of the variant (TA) allele was at 31 nmol/liter for SHBG. An estimate of the concentration of 9 10.8%, and the proportion of homozygotes was 1.2%. The FT was derived from the known concentrations of testosterone genotype distribution of the A49T polymorphism is shown in and SHBG, based on the assumption that the albumin concen- Table 2. The prevalence of the variant T allele was 3.4%, and tration was constant between individuals, using the formula the proportion of homozygotes was 0.33%. Both genotype based on the law of mass action (18). frequencies were in Hardy-Weinberg equilibrium [P ϭ 0.997 Molecular Analyses. DNA was purified from 0.5-ml buffy and 0.797 for the (TA)n and the A49T polymorphism, respectively]. coat samples of peripheral blood using Nucleon BACC2 kits The mean hormone concentrations in each (TA)n genotype according to the manufacturer’s instructions (Nucleon ST; are also presented in Table 1. The (TA)9 allele was not signif- Glasgow, Scotland, United Kingdom). icantly associated with testosterone, FT, A-diol-g, or SHBG

SRD5A2 (TA)n Repeat Polymorphism. The (TA)n marker concentrations. However, men who possessed the (TA)9/(TA)9 was genotyped using PCR reactions containing the reverse genotype had an 11% higher mean A-diol-g concentration than Ј Ј primer (5 -GGCAGAACGCCAGGAGAC-3 ) and the forward men who possessed the (TA)0/(TA)0 genotype, although this primer (5Ј-GAAAACTGTCAAGCTGCTG-3Ј). Cycling condi- was not statistically significant and was based on small num- tions were as follows: 95°C for 2 min; 35 cycles of 94°C for 1 bers (P ϭ 0.813). A test for linear trend of increasing A-diol-g min; 55°C for 1 min; and 72°C for 2 min. Amplification was levels across genotypes was also not statistically significant performed in a PE Applied Biosystems GeneAmp PCR System (P ϭ 0.797). 9700, and the number of (TA) repeats was determined using a The association between the A49T polymorphism and Perkin-Elmer ABI Prism 310 genetic analyzer and running in mean hormone concentrations is shown in Table 2. Individuals parallel with a molecular weight DNA marker. who possessed either one or two copies of the variant T allele

a Table 1 Adjusted mean hormone concentrations by SRD5A2 (TA)n repeat polymorphism

(TA)n n (%) Testosterone (nmol/liter) FT (nmol/liter) A-diol-g (nmol/liter) SHBG (nmol/liter)

(TA)0/(TA)0 465 (79.6) 20.5 (19.9–21.1) 0.43 (0.42–0.44) 8.75 (8.41–9.09) 46.3 (44.5–48.2) (TA)0/(TA)9 112 (19.2) 20.6 (19.3–22.0) 0.44 (0.41–0.46) 8.73 (8.05–9.44) 43.8 (40.4–47.4) (TA)9/(TA)9 7 (1.20) 21.9 (16.9–27.7) 0.41 (0.32–0.51) 9.68 (6.99–12.8) 55.9 (40.5–77.1) Pb 0.860 0.619 0.813 0.226

(TA)0/(TA)9 and (TA)9/(TA)9 119 (20.4) 20.7 (19.4–22.0) 0.44 (0.41–0.46) 8.79 (8.13–9.48) 44.4 (41.1–48.0) Pb 0.776 0.427 0.915 0.343 a Values are adjusted for age (six categories), time of day since venipuncture (four categories), and time since last meal at venipuncture (four categories). b P is test of heterogeneity across the mean hormone concentration in each genotype (see text).

Table 2 Adjusteda mean hormone concentrations by SRD5A2 A49T polymorphism

A49T n (%) Testosterone (nmol/liter) FT (nmol/liter) A-diol-g (nmol/liter) SHBG (nmol/liter) A/A 565 (93.5) 20.4 (19.8–21.0) 0.43 (0.42–044) 8.88 (8.58–9.19) 45.6 (44.0–47.2) A/T 37 (6.21) 22.2 (19.8–24.7) 0.43 (0.39–0.48) 6.88 (5.86–8.00) 49.6 (43.0–57.1) T/T 2 (0.33) 18.9 (10.6–29.6) 0.37 (0.23–0.55) 4.12 (1.34–8.43) 55.1 (30.2–100) Pb 0.359 0.757 0.0005 0.449 A/T and T/T 39 (6.50) 22.0 (19.7–24.4) 0.43 (0.39–0.47) 6.73 (5.73–7.80) 49.8 (43.4–57.2) Pb 0.198 0.917 0.0003 0.222 a Values are adjusted for age (six categories), time of day since venipuncture (four categories), and time since last meal at venipuncture (four categories). b P is test of heterogeneity across the mean hormone concentration in each genotype (see text).

had a 24% lower mean A-diol-g concentration than individuals copies of the variant T allele had a significant 24% lower who were homozygous for the wild-type A allele (test for A-diol-g concentration than men who were homozygous for the heterogeneity; P ϭ 0.0003). Although based on very small wild-type allele. These findings are unexpected because this numbers, there was also some evidence of a dose-response polymorphism has been associated with a 5-fold increase in the ␣ relationship; men who possessed the T/T genotype had a 23% Vmax of the 5 -reductase type II enzyme in vitro (12), suggesting lower A-diol-g concentration than the A/T genotype (P ϭ this polymorphism might increase DHT production in vivo. Some 0.194) and a 54% lower A-diol-g concentration than the A/A epidemiological studies have also found the A49T polymorphism genotype (P ϭ 0.034). The T allele was not significantly to be associated with an increased risk of advanced prostate cancer associated with concentrations of any other hormone, although in African-American and Hispanic men (12), and with poor prog- testosterone and SHBG concentration was 7.8% and 9.2% nostic indicators in prostatic tumors (20). However, other studies higher in men who had either one or two T alleles compared have found no association between this polymorphism and pros- with men who had two A alleles (test for heterogeneity; P ϭ tate cancer risk in Caucasian men (9, 13, 15). 0.198 and 0.222 for testosterone and SHBG, respectively). The association between the T allele and a lower mean A-diol-g concentration was highly statistically significant, and Discussion is therefore unlikely to be because of chance. Furthermore, a This is the largest study to date to investigate the association sub-sample of genotypes was confirmed via direct sequencing, between two common polymorphisms in the SRD5A2 gene and and the mean hormone concentration in each genotype was circulating androgen levels in men. To ensure the groups were adjusted for potential confounders. However, the use of serum as comparable as possible, hormone concentrations were ad- A-diol-g concentration as a marker of the abundance of 5 ␣ ␣ justed for age and variables associated with blood collection -reductase type II has limitations. This is because 5 -reduc- ␣ and analysis. Furthermore, all of the hormone assays were tase exists in two isoenzymes: 5 -reductase type I, encoded by conducted blind and in a randomly assorted order. the SRD5A1 gene and which regulates DHT production in the skin, and 5 ␣-reductase type II, encoded by the SRD5A2 gene Our results suggest that the (TA)n repeat polymorphism is not a strong determinant of circulating androgen levels. How- and which regulates DHT production in prostatic tissue (21). ever, the proportion of men who are homozygous for the variant Therefore, the serum A-diol-g concentration is a marker of both cutaneous and intraprostatic DHT production. Little is known (TA)9 allele in our study and in other Caucasian populations is low, at between 1% and 2% (7, 8, 10), which limits the power about the contribution of 5 ␣-reductase type I activity to the to detect small effects. Nevertheless, our findings are consistent overall circulating level of A-diol-g, although the observation with a previous study in Asian men that also found no associ- that specific inhibition of either 5 ␣-reductase type I (22) or

ation between the (TA)n repeat polymorphism and circulating type II (23) lowers serum A-diol-g concentrations suggests that androgen levels (11) or an increased risk for prostate cancer in both isoenzymes are important. Therefore, individual variations Caucasian men (8–10). in type I activity will introduce error when using A-diol-g as an This is the first study to investigate the association be- index of 5 ␣-reductase type II activity. However, it is unlikely tween the A49T polymorphism and circulating androgen con- that the reduction in A-diol-g concentration associated with the centrations in men. Despite the low prevalence of the T allele T allele is because of a larger reduction in type I activity relative in our population, which is consistent with other Caucasian to type II, as the two isoenzymes are encoded on separate populations (13), this polymorphism was a strong determinant chromosomes and, thus, contribute independent genetic sources of circulating A-diol-g levels. Men who possessed one or two of variation on A-diol-g levels. Of course, one cannot discount

the possibility that the T allele might be in linkage disequilib- 5. Parkin, D. M., Whelan, S. L., Ferlay, J., Raymond, L., and Young, J. Cancer rium with a nearby SRD5A2 locus, that is itself related to 5 Incidence in Five Continents. Vol II. Lyon, France: IARC, 1997. ␣-reductase type II activity and A-diol-g concentration. 6. Davis, D. L., and Russell, D. W. Unusual length polymorphism in human ␣ In addition, interindividual variation in the activity of steroid 5 -reductase type 2 gene (SRD5A2). Hum. Mol. Genet., 2: 820–1993. other enzymes involved in the production of A-diol-g may 7. Reichardt, J. K., Makridakis, N., Henderson, B. E., Yu, M. C., Pike, M. C., and ␣ Ross, R. K. Genetic variability of the human SRD5A2 gene: implications for effect circulating A-diol-g levels, such as 3 -hydroxysteroid prostate cancer risk. Cancer Res., 55: 3973–3975, 1995. ␤ dehydrogenase and 17 -hydroxysteroid dehydrogenase, which 8. Kantoff, P. W., Febbo, P. G., Giovannucci, E., Krithivas, K., Dahl, D. M., convert DHT and dehydroepiandrosterone to A-diol-g, respec- Chang, G., Hennekens, C. H., Brown, M., and Stampfer, M. J. A polymorphism tively. Furthermore, local concentrations of growth factors (24) of the 5 ␣-reductase gene and its association with prostate cancer: a case-control and other androgens (24, 25) are also involved in the regulation analysis. Cancer Epidemiol. Biomark. Prev., 6: 189–192, 1997. of 5 ␣-reductase type II activity in vivo. Finally, circulating 9. Latil, A. G., Azzouzi, R., Cancel, G. S., Guillaume, E. C., Cochan-Priollet, B., androgen levels are likely to be only weakly correlated with Berthon, P. L., and Cussenot, O. Prostate carcinoma risk and allelic variants of genes involved in androgen biosynthesis and metabolism pathways. Cancer androgen levels within the prostate gland and can only provide (Phila.), 92: 1130–1137, 2001. a limited view of the complexity of physiological events that 10. Margiotti, K., Sangiuolo, F., De Luca, A., Froio, F., Pearce, C. L., Ricci- regulate 5 ␣-reductase type II activity. Future studies that Barbini, V., Micali, F., Bonafe, M., Franceschi, C., Dallapiccola, B., Novelli, G., measure DHT concentration within the prostate tissue itself are, and Reichardt, J. K. Evidence for an association between the SRD5A2 (type II therefore, warranted to investigate the effect of SRD5A2 poly- steroid 5 ␣-reductase) locus and prostate cancer in Italian patients. Dis. Markers, 16: 147–150, 2000. morphisms on 5 ␣-reductase type II levels. However, despite 11. Hsing, A. W., Chen, C., Chokkalingam, A. P., Gao, Y. T., Dightman, D. A., such limitations, epidemiological data have shown A-diol-g Nguyen, H. T., Deng, J., Cheng, J., Sesterhenn, I. A., Mostofi, F. K., Stanczyk, levels to parallel ethnic differences in prostate cancer risk (4) F. Z., and Reichardt, J. K. Polymorphic markers in the SRD5A2 gene and prostate and to be the only androgen to be consistently associated with cancer risk: a population-based case-control study. Cancer Epidemiol. Biomark. increased prostate cancer risk (2). These observations Prev., 10: 1077–1082, 2001. strengthen the hypothesis that A-diol-g may reflect intrapros- 12. Makridakis, N. M., Ross, R. K., Pike, M. C., Crocitto, L. E., Kolonel, L. N., tatic androgen activity and that increased 5 ␣-reductase type II Pearce, C. L., Henderson, B. E., and Reichardt, J. K. Association of missense substitution in SRD5A2 gene with prostate cancer in African-American and activity is important in prostate cancer development. Hispanic men in Los Angeles, USA. Lancet, 354: 975–978, 1999. In addition to genetic factors, it has been hypothesized that 13. Mononen, N., Ikonen, T., Syrjakoski, K., Matikainen, M., Schleutker, J., environmental factors such as diet may influence androgen Tammela, T. L., Koivisto, P. A., and Kallioniemi, O. P. A missense substitution levels, which may be partly mediated through changes in en- A49T in the steroid 5 ␣-reductase gene (SRD5A2) is not associated with prostate zyme activity. Although this study population included men with cancer in Finland. Br. J. Cancer, 84: 1344–1347, 2001. different dietary habits, a previous analysis conducted in these men 14. Yamada, Y., Watanabe, M., Murata, M., Yamanaka, M., Kubota, Y., Ito, H., reported that serum concentrations of testosterone, FT, A-diol-g, Katoh, T., Kawamura, J., Yatani, R., and Shiraishi, T. Impact of genetic polymorphisms of 17-hydroxylase cytochrome P-450 (CYP17) and steroid 5 ␣-reduc- SHBG, and luteinising hormone were similar between the meat- tase type II (SRD5A2) genes on prostate-cancer risk among the Japanese popu- eaters, vegetarians, and vegans (17). In this present analysis, ad- lation. Int. J. Cancer, 92: 683–686, 2001. ditional adjustment for diet group made no appreciable difference 15. So¨derstrom, T., Wadelius, M., Andersson, S. O., Johansson, J. E., Johansson, to the findings and is, therefore, unlikely to influence the associ- S., Granath, F., and Rane, A. 5 ␣-reductase 2 polymorphisms as risk factors in ation between genotype and hormone levels. Similarly, although prostate cancer. Pharmacogenetics, 12: 307–312, 2002. the population was, on average, younger than the typical patient 16. Allen, N. E., Forrest, M. S., and Key, T. J. The association between polymorphisms in the CYP17 and 5 ␣-reductase type II genes and serum androgen population with prostate cancer, there was no evidence that the concentrations in men. Cancer Epidemiol. Biomark. Prev., 10: 185–189, 2001. effect of genotype on hormone levels varied with age, despite the 17. Allen, N. E., Appleby, P. N., Davey, G. K., and Key, T. J. Hormones and diet: age-related decline in androgen levels. low insulin-like growth factor-I but normal bioavailable androgens in vegan men. The results from this present study indicate that the Br. J. Cancer, 83: 95–97, 2000.

SRD5A2 (TA)n repeat polymorphism is not significantly asso- 18. So¨dergard, R., Backstrom, T., Shanbhag, V., and Carstensen, H. Calculation ciated with circulating androgen levels in British men. The of free and bound fractions of testosterone and estradiol-17 ␤ to human plasma SRD5A2 A49T polymorphism is associated with a significantly proteins at body temperature. J. Steroid Biochem., 16: 801–810, 1982. lower A-diol-g concentration and, in the light of previous 19. Statacorp. Stata statistical software, Release 7.0. College Station, TX: Stata results from in vitro studies, additional large studies are needed Corporation, 2001. to substantiate this finding. 20. Jaffe, J. M., Malkowicz, S. B., Walker, A. H., MacBride, S., Peschel, R., Tomaszewski, J., Van Arsdalen, K., Wein, A. J., and Rebbeck, T. R. Association of SRD5A2 genotype and pathological characteristics of prostate tumors. Cancer Acknowledgments Res., 60: 1626–1630, 2000. We thank all of the participants of the EPIC study, the EPIC study staff at the 21. Thigpen, A. E., Silver, R. I., Guileyardo, J. M., Casey, M. L., McConnell, Cancer Research United Kingdom Epidemiology Unit, Oxford, and Dr. Dennis J. D., and Russell, D. W. Tissue distribution and ontogeny of steroid 5 ␣-reductase Quantrill and staff at the Clinical Biochemistry laboratory at the John Radcliffe isozyme expression. J. Clin. Investig., 92: 903–910, 1993. Infirmary, Oxford, for conducting the hormone assays. 22. Schwartz, J. I., Tanaka, W. K., Wang, D. Z., Ebel, D. L., Geissler, L. A., Dallob, A., Hafkin, B., and Gertz, B. J. MK-386, an inhibitor of 5 ␣-reductase References type 1, reduces dihydrotestosterone concentrations in serum and sebum without affecting dihydrotestosterone concentrations in semen. J. Clin. Endocrinol. 1. Wilding, G. Endocrine control of prostate cancer. Cancer Surv., 23: 43–62, Metab., 82: 1373–1377, 1997. 1995. 2. Eaton, N. E., Reeves, G. K., Appleby, P. N., and Key, T. J. Endogenous sex 23. Castro-Magana, M., Angulo, M., Fuentes, B., Canas, A., Sarrantonio, M., hormones and prostate cancer: a quantitative review of prospective studies. Br. J. Arguello, R., and Vitollo, P. Effect of finasteride on human testicular steroido- Cancer, 80: 930–934, 1999. genesis. J. Androl., 17: 516–521, 1996. 3. Allen, N. E., Appleby, P. N., Davey, G. K., and Key, T. J. Lifestyle and 24. Horton, R., Pasupuletti, V., and Antonipillai, I. Androgen induction of steroid nutritional determinants of bioavailable androgens and related hormones in Brit- 5 ␣-reductase may be mediated via insulin-like growth factor-I. Endocrinology, ish men. Cancer Causes Control, 13: 353–363, 2002. 133: 447–451, 1993. 4. Ross, R. K., Bernstein, L., Lobo, R. A., Shimizu, H., Stanczyk, F. Z., Pike, 25. Wahe, M., Antonipillai, I., and Horton, R. Effects of transforming growth M. C., and Henderson, B. E. 5 ␣-reductase activity and risk of prostate cancer factor ␤ and epidermal growth factor on steroid 5 ␣-reductase activity in genital among Japanese and US white and black males. Lancet, 339: 887–889, 1992. skin fibroblasts. Mol. Cell. Endocrinol., 98: 55–59, 1993.

Downloaded from cebp.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. Association between Two Polymorphisms in the SRD5A2 Gene and Serum Androgen Concentrations in British Men

Naomi E. Allen, Juergen K. V. Reichardt, Hannah Nguyen, et al.

Cancer Epidemiol Biomarkers Prev 2003;12:578-581.

Updated version Access the most recent version of this article at: http://cebp.aacrjournals.org/content/12/6/578

Cited articles This article cites 22 articles, 5 of which you can access for free at: http://cebp.aacrjournals.org/content/12/6/578.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cebp.aacrjournals.org/content/12/6/578.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cebp.aacrjournals.org/content/12/6/578. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.