DOCSLIB.ORG

Molecular Characterization of June Beetle, Holotrichia Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Characterization of June Beetle, Holotrichia Species Special Issue on Computational Science, Mathematics and Biology IJCSME-SCSMB-16-March-2016 ISSN-2349-8439 ___________________________________________________________________________________ Molecular characterization of June beetle, Holotrichia species (Coleoptera: Scarabaeidae: Melolonthinae) from India Kolla Sreedevi1, Asha Thomas2 _______________________________________________________________________________________________ ABSTRACT: White grubs are the serious pests of agricultural and horticultural crops that belong to family Scarabaeidae of Order Coleoptera. Scarabaeidae that comprises of dung rollers and pestiferous species include numerous genera and Holotrichia Hope, 1837 is the largest genus covering several species. Studies have been carried out to analyse and present the mitochondrial COI gene sequences for five predominant species of Holotrichia viz., H. serrata (Fabricius, 1787), H. nagpurensis Khan and Ghai, 1982, H. consanguinea (Blanchard, 1851), H. longipennis (Blanchard, 1851) and H. sikkimensi sBrenske, 1893. The cluster analysis revealed two clades corroborating the morphological similarity. KEY WORDS: DNA barcoding, White and root grubs, Melolonthinae, Scarabaeidae ___________________________________________________________________________________ 1. INTRODUCTION The light traps were installed at the time of dusk during White grubs are the universal pests of several agricultural, May to July. Three light traps were set in white grub horticultural, forest crops and turf grasses that belong to endemic areas of three states Himachal Pradesh, Uttar family Scarabaeidae and superfamily Scarabaeoidea of Pradesh and Rajasthan of North India. Holotrichia serrata Coleoptera. Scarabaeidae comprises of two groups, and H. nagpurensis were obtained from Ghaziabad Laprosticti that includes dung rollers and Pleurosticti that (28o40’N; 77o28’E) and Amroha (28o54’N; 78o31’E) includes phytophagous insect species. Further, the districts, western Uttar Pradesh, India, respectively whereas PleurostictiScarabeidae consists of Melolonthinae, H. longipennis and H. sikkimensis were collected from Rutelinae, Dynastinae and Cetoniinae, of which the white Palampur (32o11’N; 76o53’E), Khangradt., Himachal grubs belong to the former two subfamilies. Melolonthinae Pradesh, India. Holotrichia consanguinea was collected is one of the largest and most diverse subfamilies, with from Dausa (26o52’N; 76o20’E), Rajasthan, India. approximately 750 genera and nearly 11,000 species The adults trapped into the bucket fitted beneath the light worldwide (Houston and Weir, 1992). Of these, genus source were collected and brought to the Division of Holotrichia Hope, 1837 covers numerous species. The Entomology, IARI, New Delhi, India. The collected adults species identification is more pertinent for any further were sorted out, cleaned, dried, relaxed, mounted and studies and is dependent more on conventional taxonomy. labeled properly for identification. The species were Besides, DNA-based methods have become quite popular identified using keys (Brenske, 1899; Khan and Ghai, 1975, in recent times in the species delineation and identification 1982). The male beetles were identified by the shape of (Floyd et al., 2002; Hebert et al., 2003, Hebert et al. 2004), hind tibial spurs and were placed in 70% alcohol. Genomic in particular identification of immature stages to species DNA samples were prepared from the male beetles level (Garcia-Robledo et al., 2013). DNA based approaches preserved in 70% ethanol. Total genomic DNA was not only give the species identification but also explain the extracted from body parts of specimens using Quiagen genetic diversity among the species. So, the present study Blood and Tissue Kit following the manufactures protocol. has been taken up to analyze mitochondrial cytochrome c The voucher numbers (HsA004, HnA004, HcA004, oxidase subunit I (COI) and generate the DNA barcode HlA004, HsiA004) were deposited in National Pusa library for selected five Holotrichia species that are Collection, Indian Agricultural Research Institute (IARI), predominant in India New Delhi, India. All the reactions were carried out in a 2. MATERIALS AND METHODS thermal cycler C1000 PCR system (Biorad) in 25 µl The adults of five species, Holotrichia serrata, H. volume containing 2.5 µl of Taq buffer, 2 µl of MgCl2, 0.5 consanguinea, H. nagpurensis, H. longipennis, and H. µl of dNTPs, 0.5 µl of each primer, 1 µl of DNA template sikkimensis were collected from different parts of North with an amount between 10-30 ng/µl, 0.5 µl Taq DNA India during 2013 - 2014 using light traps with black light polymerase and made up to 25 µl with molecular gradient source. water. The PCR temperature profile for the mitochondrial COI fragment (approx. 650 base pairs (bp) using the primer 1Senior Scientist; 2Research Associate pair GGTCAACAAATCATAAAGATATTGG (F) and Division of Entomology, Indian Agricultural Research TAAACTTCAGGGTGACCAAAAAATCA (R) (Folmer, Institute, New Delhi – 110 012, India 1994) consisted of an initial denaturation at 94 ºC (5 min.) E-mail:[email protected],Phone: +91-9911606683 followed by 35 cycles of denaturation at 94 ºC (5 min.), Copyright@IJCSME 72 | P a g e Special Issue on Computational Science, Mathematics and Biology IJCSME-SCSMB-16-March-2016 ISSN-2349-8439 ___________________________________________________________________________________ annealing at 48 ºC (1 min.), extension at 72 ºC (1 min.), and (C), and 18.93% (G). There were 23% nucleotide sites a final extension at 72 ºC (8 min.). Negative and positive variable and 9.5% were parsimony informative, controls were included with each reaction. Two µl of respectively. The reliability of the clustering pattern in the amplified product were verified for size uniformity by trees was determined by the bootstrap test, with 1000 electrophoresis in a 0.8% agarose gel stained with ethidium replications. The transition/transversion rate ratios are k1 = bromide using commercial DNA size standards, whereas 2.414 (purines) and k2 = 4.813 (pyrimidines). The overall the remaining PCR product were sequenced at sequencing transition/transversion bias is R = 1.794, where R = facility, Scigenomics, Cochin, Kerala on an automatic DNA [A*G*k1 + T*C*k2]/[(A+G)*(T+C)] (Table 2) provides sequencer using the same primers as used in PCR. Trace the evolutionary divergence between the species calculated files revealed no potential ambiguities indicated by multiple using K2P model.. peaks in the sequences. BLAST searches were performed to COI sequences for these five species of Holotrichia were confirm the identity of all new sequences. generated and have been submitted to NCBI for public All the sequences generated in the present study reference for the first time. These benefits combined with corresponding to mt CO1 was aligned with Bioedit 4 the observed applicability of molecular identification for program (Hall, 1999) using Muscle (Edgar, 2004). The species assignment in Holotrichia justify efforts to Maximum Likelihood method (ML) using the GTR+G+I strengthen the database and representative of the domestic model with 1000 replicates bootstrapping was performed and exotic species. This study revealed that CO1 sequence using MEGA 5.0 (Tamura et al., 2011). All the provides sufficient information to resolve relationships corresponding sequences of Holotrichia species were among a number of closely related taxa while many others deposited in NCBI GenBank for the first time. Genetic could not be robustly discriminated. The present study distances and nucleotide diagnosticsAs K2P-distance is the recommends the use of 3’ end region of mtCO1 to find a most commonly used distance metric in DNA barcoding useful molecular identification tool for white grub species. (Hebert et al., 2003), which was employed for comparison Hence, a simultaneous evaluation of the morphology and in the present study. It allows comparing the behavior of molecular is imminent to elucidate the genetic relationships the DNA fragment 3’ region to the standard barcode region between the species. which is situated in the same gene. 4. CONCLUSION 3. RESULTS AND DISCUSSION DNA barcodes were generated for the first time that serves The five Holotrichia species were sequenced and mtCOI as referral collection and aids in quicker identification of yielded 653 bp nucleotide sequences. A comparison of the the species with any available stage of the species. triplicate sequence showed no evidence of mismatch thus REFERENCES confirming no sequencing errors. Evidence of nuclear 1. Brenske, E. (1899). Diagnoses copies was not found, which was supported by the absence Melolonthidarumnovarum ex India Orientali. of stop codon within the sequence and base composition Indian Museum Notes, 4, 176-179. was similar with no indels. Blast search for the sequences 2. Edgar, R. C. (2004). MUSCLE: multiple sequence showed the highest hits for the respective family. Multiple alignment with high accuracy and high throughput. sequences of COI were aligned and the sequences have Nucleic Acids Research, 32, 1792-1797. been deposited in NCBI Genbank under the accession 3. Floyd, R., Abebe, E., Papert, A. and Blaxter, M. numbers (Table 1). The Maximum likelihood tree (ML tree (2002). Molecular barcodes for soil nematode based on Kimura 3 parameter distance at 1000 iterations) identification. Mol. Ecol. 11, 839–850. constructed based on the sequences of five species and one (doi:10.1046/j.1365-294X.2002. 01485.x.) out group, Lepidiotastradbrokensis obtained
Load more

Recommended publications
  • Stridulatory Organs in Asian Holotrichia Species © 2016 JEZS (Coleoptera: Melolonthidae: Melolonthinae) Received: 29-09-2016 Accepted: 30-10-2016
    Journal of Entomology and Zoology Studies 2016; 4(6): 207-210 E-ISSN: 2320-7078 P-ISSN: 2349-6800 JEZS 2016; 4(6): 207-210 Stridulatory organs in Asian Holotrichia species © 2016 JEZS (Coleoptera: Melolonthidae: Melolonthinae) Received: 29-09-2016 Accepted: 30-10-2016 Sara Lariza Rivera-Gasperín Sara Lariza Rivera-Gasperín and Miguel Ángel Morón Red de Biodiversidad y Sistemática, Instituto de Ecología, A.C., Carretera antigua Abstract a Coatepec 351, El Haya, Xalapa Elytral stridulatory organs in the Asiatic genus Holotrichia Hope are described. Structure and position of 91070, Veracruz, Mexico. such organs suggest that sound is produced by males and females by rubbing the internal edge of the hind femur (plectrum) on the ridge elytral epipleura (pars stridens). Similar stridulatory structures were also Miguel Ángel Morón found in some species of the closely related genera Sebakwe Péringuey, Microtrichia Brenske, Red de Biodiversidad y Octoplasia Brenske, Heptelia Brenske, Amphitrichia Brenske, Heptophylla Motschulsky, Latipalpus Sistemática, Instituto de Moser and Eotrichia Medvedev. Ecología, A.C., Carretera antigua a Coatepec 351, El Haya, Xalapa Keywords: Scarab, stridulation, pars stridens, plectrum, morphology 91070, Veracruz, Mexico. 1. Introduction All stridulatory organs produce sound or vibration by friction and share the same basic [1] structure, consisting of two body parts moving against each other . The mechanism of stridulation involves a system that consists of two primary organs: a usually elevated fine parallel ribs (pars stridens) and a scraper (plectrum), which is essentially a mobile sharply [2] confined ridge that rubs against the pars stridens . Stridulation has been documented in many insect orders including Orthoptera, Odonata, Lepidoptera, Hymenoptera and Coleoptera.
    [Show full text]
  • Ag. Ento. 3.1 Fundamentals of Entomology Credit Ours: (2+1=3) THEORY Part – I 1
    Ag. Ento. 3.1 Fundamentals of Entomology Ag. Ento. 3.1 Fundamentals of Entomology Credit ours: (2+1=3) THEORY Part – I 1. History of Entomology in India. 2. Factors for insect‘s abundance. Major points related to dominance of Insecta in Animal kingdom. 3. Classification of phylum Arthropoda up to classes. Relationship of class Insecta with other classes of Arthropoda. Harmful and useful insects. Part – II 4. Morphology: Structure and functions of insect cuticle, moulting and body segmentation. 5. Structure of Head, thorax and abdomen. 6. Structure and modifications of insect antennae 7. Structure and modifications of insect mouth parts 8. Structure and modifications of insect legs, wing venation, modifications and wing coupling apparatus. 9. Metamorphosis and diapause in insects. Types of larvae and pupae. Part – III 10. Structure of male and female genital organs 11. Structure and functions of digestive system 12. Excretory system 13. Circulatory system 14. Respiratory system 15. Nervous system, secretary (Endocrine) and Major sensory organs 16. Reproductive systems in insects. Types of reproduction in insects. MID TERM EXAMINATION Part – IV 17. Systematics: Taxonomy –importance, history and development and binomial nomenclature. 18. Definitions of Biotype, Sub-species, Species, Genus, Family and Order. Classification of class Insecta up to Orders. Major characteristics of orders. Basic groups of present day insects with special emphasis to orders and families of Agricultural importance like 19. Orthoptera: Acrididae, Tettigonidae, Gryllidae, Gryllotalpidae; 20. Dictyoptera: Mantidae, Blattidae; Odonata; Neuroptera: Chrysopidae; 21. Isoptera: Termitidae; Thysanoptera: Thripidae; 22. Hemiptera: Pentatomidae, Coreidae, Cimicidae, Pyrrhocoridae, Lygaeidae, Cicadellidae, Delphacidae, Aphididae, Coccidae, Lophophidae, Aleurodidae, Pseudococcidae; 23. Lepidoptera: Pieridae, Papiloinidae, Noctuidae, Sphingidae, Pyralidae, Gelechiidae, Arctiidae, Saturnidae, Bombycidae; 24.
    [Show full text]
  • Entomology) Onwards Google Meet) on 15Th May, 2021 at 10 Am Participants: I
    Board of Studies Meeting (Department of Organised virtually (on Entomology) onwards google meet) on 15th May, 2021 at 10 am Participants: I. Prof. Nand Lal, Deppt. of life 2. Prof. C. P. science, CSJM Srivastav, Professor of University, Kanpur 3. Prof.Y. P. Entomology, B.H.U. Malik, Professor Varanasi of Entomology, CSA Kanpur Univ. of Agri. and Tech. 4. Dr. Dev Narayan Singh, Associate Professor, of College, Bakewar (Etawah) Deptt. Entomology, Janta 5. Dr. B. B. Singh, Assistant Professor, Mahavidyalay, Ajitmal (Auraiya) Deptt. of Entomology, Janta 6. Dr. Mahesh Prasad Yadav, Convenor and Associate Horticulture, Janta professor, Deptt. of College, Bakewar (Etawah) Minutes Of Meeting: BOS mecting of of deptt. Entomology was held to New Education adapt syllabus as under Policy (NEP 2020) with the suggested the presence of various renowed subjects. The outcomes of experts of meetings are as under. 1. Syllabus under suggested NEP 2020 is and implementation. accepted recommended for 2. Prof. Suggestions given by C. P. Srivastav and Prof. Y. minor P. Malik regarding ammendments and corrections have been 3. incorporated. Website names as well as books names have also been syllabus adapted by board. suggested in the 4. Board also that as the suggested per norms of ICAR the name of should be "Entomology". Department 5. Board also that master suggested degree in subject will be "M. Sc. Entomology" (Ag.) Enclosures: Corrected final of syllabus Entomology for B. Sc. (Ag.) programme. Prepared by: Dr. Dev Narayan Singh Convenor Dr. M. P. Yadav Department of Entomology Sr. Course semester No. code Name of papers AG-203 II Credit hrs.
    [Show full text]
  • IDENTIFICATION of the SEX PHEROMONE of Holotrichia Reynaudi
    P1: GDX/GDP Journal of Chemical Ecology [joec] pp414-joec-368127 February 19, 2002 16:44 Style file version Nov. 19th, 1999 Journal of Chemical Ecology, Vol. 28, No. 3, March 2002 (C 2002) CORE Metadata, citation and similar papers at core.ac.uk Provided by ICRISAT Open Access Repository IDENTIFICATION OF THE SEX PHEROMONE OF Holotrichia reynaudi ANDREW WARD,1,6 CHRIS MOORE,2,* V. ANITHA,3 JOHN WIGHTMAN,4 and D. JOHN ROGERS5 1Farming Systems Institute Department of Primary Industries PO Box 23, Kingaroy, Qld 4610, Australia 2Farming Systems Institute Department of Primary Industries 665 Fairfield Road, Yeerongpilly, Qld 4105, Australia 3International Crops Research Institute for the Semi-Arid Tropics Patancheru, Andhra Pradesh 502 324, India 4International Pest Management Conondale Cottage, Lot 7 Stanley River Road Maleny Qld 4552, Australia 5Farming Systems Institute Department of Primary Industries Meiers Road, Indooroopilly, Qld 4068, Australia 6Current address: Department of Primary Industries and Fisheries PO Box 1346, Katherine, NT 0851, Australia (Received December 20, 2000; accepted October 27, 2001) Abstract—The male attractant pheromone of the scarab beetle Holotrichia reynaudi, an agricultural pest native to southern India, was extracted from ab- dominal glands of females with hexane and analyzed by gas chromatography– mass spectrometry. Field testing of the candidate chemicals, indole, phenol, and anisole, both alone and as binary mixtures, led us to conclude that anisole was the major component of the sex pheromone. Neither male nor female beetles were attracted to indole or phenol on their own. Similarly, when indole and anisole were combined, the attractiveness of the solution did not increase over that obtained with anisole alone.
    [Show full text]
  • Microbial Pesticides
    Facilitating Microbial Pesticide Use in Agriculture in South Asia Editors W.A.R.T. Wickramaarachchi SAARC Agriculture Centre (SAC) Dhaka, Bangladesh Malvika Chaudhary Plantwise Asia, CABI-South Asia New Delhi, India Jagadeesh Patil ICAR-National Bureau of Agricultural Insect Resources (NBAIR), Bengaluru, India SAARC Agriculture Centre (SAC) South Asian Association for Regional Cooperation (SAARC) i Facilitating Microbial Pesticide Use in Agriculture in South Asia SAARC Regional Expert Consultation on Facilitating Microbial Pesticide Use in Agriculture in South Asia, 21-23 August 2017, ICAR-National Bureau of Agricultural Insect Resources (NBAIR), Bengaluru, India Editors W.A.R.T. Wickramaarachchi SAARC Agriculture Centre (SAC), Dhaka, Bangladesh Malvika Chaudhary Plantwise Asia, CABI-South Asia, New Delhi, India Jagadeesh Patil ICAR-National Bureau of Agricultural Insect Resources (NBAIR) Bengaluru, India December 2017 @ 2017 SAARC Agriculture Centre Published by the SAARC Agriculture Centre (SAC), South Asian Association for Regional Cooperation, BARC Complex, Farmgate, New Airport Road, Dhaka -1215, Bangladesh (www.sac.org.bd) All rights reserved No part of this publication may be reproduced, stored in retrieval system or transmitted in any form or by any means electronic, mechanical, recording or otherwise without prior permission of the publisher Citation Wickramaarachchi, W.A.R.T., Chaudhary, M. and Patil, J. (Eds). 2017. Facilitating Microbial Pesticide Use in Agriculture in South Asia. SAARC Agriculture Centre, Dhaka, Bangladesh, 226 pp Available online through www.sac.org.bd This book contains the papers and proceedings of the SAARC Regional Expert Consultation on Facilitating microbial pesticides use in agriculture in South Asia jointly organized by SAARC Agriculture Centre (SAC), ICAR-National Bureau of Agricultural Insect Resources (NBAIR) and The Centre for Agriculture and Bioscience International (CABI) at National Bureau of Agricultural Insect Resources (NBAIR), Bengaluru, India from 21-23 August 2017.
    [Show full text]
  • Diversity and Population Dynamics of Phytophagous Scarabaeid Beetles (Coleoptera: Scarabaeidae) in Different Landscapes of Himachal Pradesh, India
    Arthropods, 2015, 4(2): 46-68 Article Diversity and population dynamics of phytophagous scarabaeid beetles (Coleoptera: Scarabaeidae) in different landscapes of Himachal Pradesh, India Mandeep Pathania1,2, RS Chandel1, KS Verma1, PK Mehta1 1Department of Entomology, College of Agriculture, Chaudhary Sarwan Kumar Himachal Pradesh Krishi Vishvavidyalaya, Palampur, Himachal Pradesh, India 176062 2Punjab Agricultural University, Regional Research Station, Abohar, Punjab, India 152116 E-mail: [email protected] Received 9 December 2014; Accepted 15 January 2015; Published online 1 June 2015 Abstract Scarabaeid beetles constitute a major group of defoliators of cultivated and wild plants. Therefore, it is important to understand their diversity, abundance and distribution for planning effective pest management programmes. We surveyed scarabaeid beetles from 8 landscapes from different zones in Himachal Pradesh (N 32o 29' and E 75o 10'), India. In 2011 and 2012, surveys were conducted during 4 months period (May-August) by using UV light traps. A total of 13,569 scarabaeid adults of 20 genera and 56 species belonging to subfamilies Melolonthinae, Rutelinae, Cetoniinae and Dynastinae were recorded. The five most common species were Brahmina coriacea, Adoretus lasiopygus, Anomala lineatopennis, Maladera insanabilis and Holotrichia longipennis. They comprised 9.88-10.05, 7.18-7.76, 7.13-7.27, 6.80-7.62 and 5.22-5.30% during 2011-12, respectively. Anomala (10 species) was the most dominant genus in the present study, whereas Melolonthinae was the most dominant subfamily accounting 53.23% of total scarabs collected from the study sites. Among different landscapes, Palampur had maximum diversity and abundance, while Shillaroo had least diversity but more abundance of single species B.
    [Show full text]
  • The Entomologist's Record and Journal of Variation
    . JVASV^iX ^ N^ {/) lSNrNVIN0SHilWS*^S3ldVaan^LIBRARIES SMITHSONIAN INSTITUTION Ni <n - M ^^ <n 5 CO Z ^ ^ 2 ^—^ _j 2 -I RIES SMITHSONIAN INSTITUTION NOIinillSNI NVINOSHilWS S3iyVdan U r- ^ ^ 2 CD 4 A'^iitfwN r: > — w ? _ ISNI NVINOSHilWS SBiyVdan LIBRARIES'SMITHSONIAN INSTITUTION f^ <rt .... CO 2 2 2 s;- W to 2 C/J • 2 CO *^ 2 RIES SMITHSONIAN_INSTITUTlON NOIiniliSNI_NVINOSHilWS S3liiVyan_L; iiSNi"^NViNOSHiiNS S3iyvaan libraries smithsonian'^institution i^ 33 . z I/' ^ ^ (^ RIES SMITHSONIAN INSTITUTION NOIiniliSNI NVINOSHilWS S3lbVHan Li CO — -- — "> — IISNI NVINOSHimS S3IMVHan LIBRARIES SMITHSONIAN INSTITUTION N' 2 -J 2 _j 2 RIES SMITHSONIAN INSTITUTION NOIifllliSNI NVINOSHIIWS SSIMVyail L! MOTITI IT I f\t _NviN0SHiiws'^S3iMvaan libraries'^smithsonian^institution NOlin z \ '^ ^—s^ 5 <^ ^ ^ ^ '^ - /^w\ ^ /^^\ - ^^ ^ /^rf^\ - /^ o ^^^ — x.ii:i2Ji^ o ??'^ — \ii Z ^^^^^""-^ o ^^^^^ -» 2 _J Z -J , ; SMITHSONIAN INSTITUTION NOIXniliSNI NVINOSHillMS $3 I M VH 8 !!_ LI BR = C/> ± O) ^. ? CO I NVINOSHimS S3iaVHan libraries SMITHSONIAN INSTITUTION NOIlf CO ..-. CO 2 Z z . o .3 :/.^ C/)o Z u. ^^^ i to Z CO • z to * z > SMITHS0NIAN_1NSTITUTI0N NOIiniliSNI_NVINOSHimS S3 I d ViJ 8 n_LI B R UJ i"'NViNOSHiiws S3ibvyan libraries smithsonian"^institution Noiir r~ > z r- Z r- 2: . CO . ^ ^ ^ ^ ; SMITHSONIAN INSTITUTION NOIiniliSNI NVINOSHillNS SSiyVMail LI BR CO . •» Z r, <^ 2 z 5 ^^4ii?^^ ^' X^W o ^"^- x life ^<ji; o ^'f;0: i >^ _NVIN0SHiIlMs'^S3iyVdan^LIBRARIEs'^SMITHS0NlAN INSTITUTION NOlif Z \ ^'^ ^-rr-^ 5 CO n CO CO o z > SMITHSONIAN INSTITUTION NOIiniliSNI NVINOSHimS S3 I ^Vd 8 11 LI BR >" _ . z 3 ENTOMOLOGIST'S RECORD AND Journal of Variation Edited by P.A. SOKOLOFF fre s Assistant Editors J.A.
    [Show full text]
  • Diagnostics of Major White Grub Species Associated with Potato Crop Ecosystem in Himachal Pradesh, India
    Int.J.Curr.Microbiol.App.Sci (2017) 6(9): 2545-2555 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 9 (2017) pp. 2545-2555 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.609.313 Diagnostics of Major White Grub Species Associated with Potato Crop Ecosystem in Himachal Pradesh, India Padala Vinod Kumar, K. Sreedevi* and Sukhwinder Singh Division of Entomology, ICAR-Indian Agricultural Research Institute, New Delhi, 110012, India *Corresponding author ABSTRACT The major white grub species associated with potato crop were surveyed in Himachal Pradesh, India during April to August, 2015. Adults were collected in the vicinity of potato K e yw or ds ecosystem by using light traps with black, mercury light sources and manual collection Melolonthinae, from trees on which they settled for feeding and mating. The survey revealed nine major Rutelinae, species of Scarabaeidae of which, four species are melolonthines viz., Brahmina coriacea Dynastinae, Potato, (Hope, 1837), Holotrichia longipennis (Blanchard, 1850), Holotrichia sikkimensis Himachal Pradesh. (Brenske, 1892), Holotrichia seticollis Moser, 1912, four species are rutelines viz., Article Info Anomala polita (Blanchard, 1851), Anomala lineatopennis Blanchard, 1851, Anomala dimidiata (Hope, 1831), Anomala propinqua Arrow, 1912 and one species of Dynastinae Accepted: i.e Phyllognathus dionysius (Fabricius, 1792). Of these, Anomala propinqua Arrow, 1912 26 August 2017 is reported for the first time in potato ecosystem. Present studies have brought out Available Online: illustrative diagnostic keys of white grub species associated with potato crop ecosystem 10 September 2017 that can be used at field level, where the identification of the species is very important from management point of view.
    [Show full text]
  • EU Project Number 613678
    EU project number 613678 Strategies to develop effective, innovative and practical approaches to protect major European fruit crops from pests and pathogens Work package 1. Pathways of introduction of fruit pests and pathogens Deliverable 1.3. PART 7 - REPORT on Oranges and Mandarins – Fruit pathway and Alert List Partners involved: EPPO (Grousset F, Petter F, Suffert M) and JKI (Steffen K, Wilstermann A, Schrader G). This document should be cited as ‘Grousset F, Wistermann A, Steffen K, Petter F, Schrader G, Suffert M (2016) DROPSA Deliverable 1.3 Report for Oranges and Mandarins – Fruit pathway and Alert List’. An Excel file containing supporting information is available at https://upload.eppo.int/download/112o3f5b0c014 DROPSA is funded by the European Union’s Seventh Framework Programme for research, technological development and demonstration (grant agreement no. 613678). www.dropsaproject.eu [email protected] DROPSA DELIVERABLE REPORT on ORANGES AND MANDARINS – Fruit pathway and Alert List 1. Introduction ............................................................................................................................................... 2 1.1 Background on oranges and mandarins ..................................................................................................... 2 1.2 Data on production and trade of orange and mandarin fruit ........................................................................ 5 1.3 Characteristics of the pathway ‘orange and mandarin fruit’ .......................................................................
    [Show full text]
  • APPENDIX G. Bibliography of ECOTOX Open Literature
    APPENDIX G. Bibliography of ECOTOX Open Literature Explanation of OPP Acceptability Criteria and Rejection Codes for ECOTOX Data Studies located and coded into ECOTOX must meet acceptability criteria, as established in the Interim Guidance of the Evaluation Criteria for Ecological Toxicity Data in the Open Literature, Phase I and II, Office of Pesticide Programs, U.S. Environmental Protection Agency, July 16, 2004. Studies that do not meet these criteria are designated in the bibliography as “Accepted for ECOTOX but not OPP.” The intent of the acceptability criteria is to ensure data quality and verifiability. The criteria parallel criteria used in evaluating registrant-submitted studies. Specific criteria are listed below, along with the corresponding rejection code. · The paper does not report toxicology information for a chemical of concern to OPP; (Rejection Code: NO COC) • The article is not published in English language; (Rejection Code: NO FOREIGN) • The study is not presented as a full article. Abstracts will not be considered; (Rejection Code: NO ABSTRACT) • The paper is not publicly available document; (Rejection Code: NO NOT PUBLIC (typically not used, as any paper acquired from the ECOTOX holding or through the literature search is considered public) • The paper is not the primary source of the data; (Rejection Code: NO REVIEW) • The paper does not report that treatment(s) were compared to an acceptable control; (Rejection Code: NO CONTROL) • The paper does not report an explicit duration of exposure; (Rejection Code: NO DURATION) • The paper does not report a concurrent environmental chemical concentration/dose or application rate; (Rejection Code: NO CONC) • The paper does not report the location of the study (e.g., laboratory vs.
    [Show full text]
  • Ethology of Coconut Root Grub Chafer Leucopholis Coneophora Burmeister
    International Journal of Agriculture and Food Science Technology (IJAFST) ISSN No. 2249-3050, Volume 4 No. 2 (2013) Ethology of coconut root grub chafer Leucopholis coneophora Burmeister (Melolonthinae: Scarabaeidae) P S Prathibha1, A R V Kumar2, K Subaharan1 1 Entomology, Central Plantation Crops Research Institute, Kasaragod, Kerala, INDIA. 671124 2Dept. of Agri.Entomology, Gandhi Krishi Vigyan Kendra, University of Agricultural Sciences - Bangalore, INDIA 560065 ABSTRACT Root grub, Leucopholis coneophora Burm. is a polyphagous pest of coconut and intercrops grown in sandy loam soils in south India. It damages seedlings and adult palms by feeding on roots, boring the bole and collar regions. Understanding the ethology of the pest would aid to develop an ecofriendly pest management strategy. Though control measures have been developed, imperative need is there to search for newer method. On this line it was attempted to study the adult emergence pattern during 2011-2013 in root grub infe, Kerala. Adult emergence initiated on receipt of summer shower in third week of April in 2011, 2012 and 2013. The peak emergence attained during June, after the receipt of >200 mm rainfall. The emergence commenced when illuminance fell down to 124.37±75sted coconut gardens (N12º31.550’ E074 º58.081’) at CPCRI experimental farm, Kasaragod.5lx in the evening and prolonged up to 1.2±04lx. However, heavy rainfall during this part of the day delayed/stopped the emergence. Maximum swarming occurred at 32.6±15.1lx. Female emergence and mating started at 12.04±8.1 lx. The operational sex ratio was wider during initial days of emergence, which narrowed down in subsequent days.
    [Show full text]
  • Four New Species of the Genus Miridiba Reitter (Coleoptera: Scarabaeidae: Melolonthinae) from China
    Zootaxa 4527 (1): 001–020 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2018 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4527.1.1 http://zoobank.org/urn:lsid:zoobank.org:pub:71CB1CF8-CC28-4D9B-BF30-7FE197E432A1 Four new species of the genus Miridiba Reitter (Coleoptera: Scarabaeidae: Melolonthinae) from China CHUAN-BU GAO1, MING BAI2, HONG FANG1 & ZHI-GUO YU1,3 1College of Plant Protection, Shenyang Agriculture University, Shenyang, 110866 China. E-mail: [email protected], [email protected], [email protected] 2Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, 100101 China. E-mail: [email protected] 3Corresponding author Abstract Four new species of the genus Miridiba Reitter, 1902 from South China are described and illustrated: Miridiba (Miridiba) bannaensis Gao & Fang, new species, M. (M.) kuatunensis Gao & Fang, new species, M. (M.) xingkei Gao & Fang new species and M. (M.) youweii Gao & Fang, new species. Miridiba (M.) tuberculipennis obscura Itoh, 1995 is raised to species level. Miridiba (M.) obscura Itoh, 1995 and M. (M.) tuberculipennis (Moser, 1913) are newly recorded for China. A catalogue of Miridiba species from China is provided. [Zoobank registrations: Miridiba bannaensis Gao & Fang, new species: LSID: urn:lsid:zoobank.org:act:0AEA5EFC-0914-437A-AEF6-C2685247E427 Miridiba kuatunensis Gao & Fang, new species: LSID: urn:lsid:zoobank.org:act:148F9BA8-5666-40DC-A209-25C4B68D5CD5 Miridiba xingkei Gao & Fang, new species: LSID: urn:lsid:zoobank.org:act:65A3141D-C7AC-4E89-BB20-5F5CFFA4D58E Miridiba youweii Gao & Fang, new species: LSID: urn:lsid:zoobank.org:act:DDA98D6C-5753-4F82-A49A-D9C7913DCFC2] Key words: morphology, catalogue, Miridiba, new species, new records, China Introduction The chafer genus Miridiba Reitter, 1902 (Scarabaeidae: Melolonthinae: Rhizotrogini) encompasses 44 species widely distributed in the Oriental and Palaearctic regions (Schoolmeesters 2018).
    [Show full text]