Special Issue on Computational Science, Mathematics and Biology IJCSME-SCSMB-16-March-2016 ISSN-2349-8439

______Molecular characterization of June , species (Coleoptera: : ) from India Kolla Sreedevi1, Asha Thomas2 ______ABSTRACT: White grubs are the serious pests of agricultural and horticultural crops that belong to family Scarabaeidae of Order Coleoptera. Scarabaeidae that comprises of dung rollers and pestiferous species include numerous genera and Holotrichia Hope, 1837 is the largest genus covering several species. Studies have been carried out to analyse and present the mitochondrial COI gene sequences for five predominant species of Holotrichia viz., H. serrata (Fabricius, 1787), H. nagpurensis Khan and Ghai, 1982, H. consanguinea (Blanchard, 1851), H. longipennis (Blanchard, 1851) and H. sikkimensi sBrenske, 1893. The cluster analysis revealed two clades corroborating the morphological similarity. KEY WORDS: DNA barcoding, White and root grubs, Melolonthinae, Scarabaeidae ______1. INTRODUCTION The light traps were installed at the time of dusk during White grubs are the universal pests of several agricultural, May to July. Three light traps were set in white grub horticultural, forest crops and turf grasses that belong to endemic areas of three states Himachal Pradesh, Uttar family Scarabaeidae and superfamily Scarabaeoidea of Pradesh and Rajasthan of North India. Holotrichia serrata Coleoptera. Scarabaeidae comprises of two groups, and H. nagpurensis were obtained from Ghaziabad Laprosticti that includes dung rollers and Pleurosticti that (28o40’N; 77o28’E) and Amroha (28o54’N; 78o31’E) includes phytophagous species. Further, the districts, western Uttar Pradesh, India, respectively whereas PleurostictiScarabeidae consists of Melolonthinae, H. longipennis and H. sikkimensis were collected from Rutelinae, Dynastinae and Cetoniinae, of which the white Palampur (32o11’N; 76o53’E), Khangradt., Himachal grubs belong to the former two subfamilies. Melolonthinae Pradesh, India. was collected is one of the largest and most diverse subfamilies, with from Dausa (26o52’N; 76o20’E), Rajasthan, India. approximately 750 genera and nearly 11,000 species The adults trapped into the bucket fitted beneath the light worldwide (Houston and Weir, 1992). Of these, genus source were collected and brought to the Division of Holotrichia Hope, 1837 covers numerous species. The Entomology, IARI, New Delhi, India. The collected adults species identification is more pertinent for any further were sorted out, cleaned, dried, relaxed, mounted and studies and is dependent more on conventional taxonomy. labeled properly for identification. The species were Besides, DNA-based methods have become quite popular identified using keys (Brenske, 1899; Khan and Ghai, 1975, in recent times in the species delineation and identification 1982). The male were identified by the shape of (Floyd et al., 2002; Hebert et al., 2003, Hebert et al. 2004), hind tibial spurs and were placed in 70% alcohol. Genomic in particular identification of immature stages to species DNA samples were prepared from the male beetles level (Garcia-Robledo et al., 2013). DNA based approaches preserved in 70% ethanol. Total genomic DNA was not only give the species identification but also explain the extracted from body parts of specimens using Quiagen genetic diversity among the species. So, the present study Blood and Tissue Kit following the manufactures protocol. has been taken up to analyze mitochondrial cytochrome c The voucher numbers (HsA004, HnA004, HcA004, oxidase subunit I (COI) and generate the DNA barcode HlA004, HsiA004) were deposited in National Pusa library for selected five Holotrichia species that are Collection, Indian Agricultural Research Institute (IARI), predominant in India New Delhi, India. All the reactions were carried out in a 2. MATERIALS AND METHODS thermal cycler C1000 PCR system (Biorad) in 25 µl The adults of five species, Holotrichia serrata, H. volume containing 2.5 µl of Taq buffer, 2 µl of MgCl2, 0.5 consanguinea, H. nagpurensis, H. longipennis, and H. µl of dNTPs, 0.5 µl of each primer, 1 µl of DNA template sikkimensis were collected from different parts of North with an amount between 10-30 ng/µl, 0.5 µl Taq DNA India during 2013 - 2014 using light traps with black light polymerase and made up to 25 µl with molecular gradient source. water. The PCR temperature profile for the mitochondrial COI fragment (approx. 650 base pairs (bp) using the primer 1Senior Scientist; 2Research Associate pair GGTCAACAAATCATAAAGATATTGG (F) and Division of Entomology, Indian Agricultural Research TAAACTTCAGGGTGACCAAAAAATCA (R) (Folmer, Institute, New Delhi – 110 012, India 1994) consisted of an initial denaturation at 94 ºC (5 min.) E-mail:[email protected],Phone: +91-9911606683 followed by 35 cycles of denaturation at 94 ºC (5 min.),

Copyright@IJCSME 72 | P a g e Special Issue on Computational Science, Mathematics and Biology IJCSME-SCSMB-16-March-2016 ISSN-2349-8439

______annealing at 48 ºC (1 min.), extension at 72 ºC (1 min.), and (C), and 18.93% (G). There were 23% nucleotide sites a final extension at 72 ºC (8 min.). Negative and positive variable and 9.5% were parsimony informative, controls were included with each reaction. Two µl of respectively. The reliability of the clustering pattern in the amplified product were verified for size uniformity by trees was determined by the bootstrap test, with 1000 electrophoresis in a 0.8% agarose gel stained with ethidium replications. The transition/transversion rate ratios are k1 = bromide using commercial DNA size standards, whereas 2.414 (purines) and k2 = 4.813 (pyrimidines). The overall the remaining PCR product were sequenced at sequencing transition/transversion bias is R = 1.794, where R = facility, Scigenomics, Cochin, Kerala on an automatic DNA [A*G*k1 + T*C*k2]/[(A+G)*(T+C)] (Table 2) provides sequencer using the same primers as used in PCR. Trace the evolutionary divergence between the species calculated files revealed no potential ambiguities indicated by multiple using K2P model.. peaks in the sequences. BLAST searches were performed to COI sequences for these five species of Holotrichia were confirm the identity of all new sequences. generated and have been submitted to NCBI for public All the sequences generated in the present study reference for the first time. These benefits combined with corresponding to mt CO1 was aligned with Bioedit 4 the observed applicability of molecular identification for program (Hall, 1999) using Muscle (Edgar, 2004). The species assignment in Holotrichia justify efforts to Maximum Likelihood method (ML) using the GTR+G+I strengthen the database and representative of the domestic model with 1000 replicates bootstrapping was performed and exotic species. This study revealed that CO1 sequence using MEGA 5.0 (Tamura et al., 2011). All the provides sufficient information to resolve relationships corresponding sequences of Holotrichia species were among a number of closely related taxa while many others deposited in NCBI GenBank for the first time. Genetic could not be robustly discriminated. The present study distances and nucleotide diagnosticsAs K2P-distance is the recommends the use of 3’ end region of mtCO1 to find a most commonly used distance metric in DNA barcoding useful molecular identification tool for white grub species. (Hebert et al., 2003), which was employed for comparison Hence, a simultaneous evaluation of the morphology and in the present study. It allows comparing the behavior of molecular is imminent to elucidate the genetic relationships the DNA fragment 3’ region to the standard barcode region between the species. which is situated in the same gene. 4. CONCLUSION 3. RESULTS AND DISCUSSION DNA barcodes were generated for the first time that serves The five Holotrichia species were sequenced and mtCOI as referral collection and aids in quicker identification of yielded 653 bp nucleotide sequences. A comparison of the the species with any available stage of the species. triplicate sequence showed no evidence of mismatch thus REFERENCES confirming no sequencing errors. Evidence of nuclear 1. Brenske, E. (1899). Diagnoses copies was not found, which was supported by the absence Melolonthidarumnovarum ex India Orientali. of stop codon within the sequence and base composition Indian Museum Notes, 4, 176-179. was similar with no indels. Blast search for the sequences 2. Edgar, R. C. (2004). MUSCLE: multiple sequence showed the highest hits for the respective family. Multiple alignment with high accuracy and high throughput. sequences of COI were aligned and the sequences have Nucleic Acids Research, 32, 1792-1797. been deposited in NCBI Genbank under the accession 3. Floyd, R., Abebe, E., Papert, A. and Blaxter, M. numbers (Table 1). The Maximum likelihood tree (ML tree (2002). Molecular barcodes for soil nematode based on Kimura 3 parameter distance at 1000 iterations) identification. Mol. Ecol. 11, 839–850. constructed based on the sequences of five species and one (doi:10.1046/j.1365-294X.2002. 01485.x.) out group, Lepidiotastradbrokensis obtained from NCBI 4. Folmer, O., Black, M., Hoeh, W., Lutz, R., and database (Fig. 1) revealed that two major clades were Vrijenhoek, R. (1994). DNA primers for recognized and those clades differentiate five Holotrichia amplification of mitochondrial cytochrome C species. The subclades of clade clearly differentiated the oxidase subunit I from diverse metazoan species based on its taxonomic conclusions, where H. invertebrates. Molecular Marine Biology and nagpuriensis was branched with H. serrata and H. Biotechnology, 3, 294-299. sikkimensis with H. longipennis. 5. Foottit, R.G., Maw, H.E.L., von Dohlen, C.D. & Genetic distance: The nucleotide composition of all the Hebert, P.D.N. (2008). Species identification of sequences was AT-rich, 29.39% (A), 37.21% (T), 14.47% aphids (Insecta:Hemiptera: Aphididae) through

Copyright@IJCSME 73 | P a g e Special Issue on Computational Science, Mathematics and Biology IJCSME-SCSMB-16-March-2016 ISSN-2349-8439

______DNA barcodes. Molecular Ecology Resources, 8, 1189–1201. 6. Garcia-Robledo, C., Kuprewicz, E., Staines, C. L., John Kress, W. and Erwin, T. L. (2013). Using a comprehensive DNA barcode library to detect novel egg and larval host plant associations in a Cephaloleia rolled-leaf beetle (Coleoptera: Chrysomelidae), Biological Journal of the Linnean Society,1-10 7. Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. 8. Hebert P. D. N., Cywinska A, Ball S. L., deWaard J. R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B: Biological Sciences 270: 313- 321.

9. Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H. and Hallwachs, W. (2004). Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptesfulgerator. Proceedings of the National academy of Sciences of USA, 101, 14812-14817. 10. Houston, W. W. K. and Weir, T. A. (1992). Melolonthinae, pp. 174-358. In Houston, W. W. K. (ed.) Zoological catalogue of Australia. Vol. 9. Coleoptera: Scarabaeoidea. Australian Government Publishing Service, Canberra. 11. Tamura K, Peterson D, Peterson N, Stecher G, Nei M and Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony meth Molecular Biology and Evolution 28, 2731–2739. doi: 10.1093/molbev/msr121 12. Khan, K. M. (1975). Studies on Indian Melolonthinae. Doctoral Thesis submitted to Indian Agricultural Research Institute. Pusa, New Delhi, India. 13. Khan, K. M. and Ghai, S. (1982). Taxonomic status of the genus Holotrichia Hope (: Melolonthinae: Scarabaeidae) with descriptions of five new species from India along with redescriptions of two poorly described species and a key to species. Bulletin of Entomology, 23(1/2), 28-45.

Copyright@IJCSME 74 | P a g e