Transactivation of Pdgfrb by Dopamine D4 Receptor Does Not
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Platelet-Derived Growth Factor Receptor Expression and Amplification in Choroid Plexus Carcinomas
Modern Pathology (2008) 21, 265–270 & 2008 USCAP, Inc All rights reserved 0893-3952/08 $30.00 www.modernpathology.org Platelet-derived growth factor receptor expression and amplification in choroid plexus carcinomas Nina N Nupponen1,*, Janna Paulsson2,*, Astrid Jeibmann3, Brigitte Wrede4, Minna Tanner5, Johannes EA Wolff 6, Werner Paulus3, Arne O¨ stman2 and Martin Hasselblatt3 1Molecular Cancer Biology Program, University of Helsinki, Helsinki, Finland; 2Department of Oncology–Pathology, Cancer Centrum Karolinska, Karolinska Institutet, Stockholm, Sweden; 3Institute of Neuropathology, University Hospital Mu¨nster, Mu¨nster, Germany; 4Department of Pediatric Oncology, University of Regensburg, Regensburg, Germany; 5Department of Oncology, Tampere University Hospital, Tampere, Finland and 6Children’s Cancer Hospital, MD Anderson Cancer Center, Houston, TX, USA Platelet-derived growth factor (PDGF) receptor signaling has been implicated in the development of glial tumors, but not yet been examined in choroid plexus carcinomas, pediatric tumors with dismal prognosis for which novel treatment options would be desirable. Therefore, protein expression of PDGF receptors a and b as well as amplification status of the respective genes, PDGFRA and PDGFRB, were examined in a series of 22 patients harboring choroid plexus carcinoma using immunohistochemistry and chromogenic in situ hybridization (CISH). The majority of choroid plexus carcinomas expressed PDGF receptors with 6 cases (27%) displaying high staining scores for PDGF receptor a and 13 cases (59%) showing high staining scores for PDGF receptor b. Correspondingly, copy-number gains of PDGFRA were observed in 8 cases out of 12 cases available for CISH and 1 case displayed amplification (six or more signals per nucleus). The proportion of choroid plexus carcinomas with amplification of PDGFRB was even higher (5/12 cases). -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
The Role of Fc Gamma Receptors in the Activity of Therapeutic Monoclonal Antibodies
UNIVERSITY OF SOUTHAMPTON FACULTY OF MEDICINE Cancer Sciences Unit Volume 1 of 1 The Role of Fc Gamma Receptors in the Activity of Therapeutic Monoclonal Antibodies by Robert James Oldham Thesis for the degree of Doctor of Philosophy September 2016 UNIVERSITY OF SOUTHAMPTON ABSTRACT FACULTY OF MEDICINE Biomedicine Thesis for the degree of Doctor of Philosophy THE ROLE OF FC GAMMA RECEPTORS IN THE ACTIVITY OF THERAPEUTIC MONOCLONAL ANTIBODIES Robert James Oldham Fc gamma receptors (FcγRs) are the major family of receptors responsible for interacting with immunoglobulin G (IgG). They are known to be required for the anti-tumour activity of direct targeting mAbs through expression on NK cells and macrophages. Furthermore, recent work has suggested that cross-linking via FcγRs is required for the activity of agonistic, immune modulatory mAb. This thesis sought to investigate the requirement for these receptors for different aspects of mAb activity; from T cell activation to tumour depletion, using a combination of in vitro and in vivo systems. A panel of CHO-K1 cells were generated and transfected to express the polymorphic variants of human FcγRs. These were characterised for their ability to bind IgG before being used as feeder cells in T cell proliferation assays. The assays found that cross-linking of the anti-CD28 mAb, TGN1412 by FcγRIIb (CD32b) or FcγRIIa (CD32a) but not FcγRIIIa (CD16a) transfected cells induced T cell proliferation. Furthermore, this was accompanied by the release of pro-inflammatory cytokines including TNF-α, IFN-γ and IL-2. With the importance of cross-linking via CD32b demonstrated, experiments probed the mechanism of expression using Ramos and Raji cells. -
Pdgfrβ Regulates Adipose Tissue Expansion and Glucose
1008 Diabetes Volume 66, April 2017 Yasuhiro Onogi,1 Tsutomu Wada,1 Chie Kamiya,1 Kento Inata,1 Takatoshi Matsuzawa,1 Yuka Inaba,2,3 Kumi Kimura,2 Hiroshi Inoue,2,3 Seiji Yamamoto,4 Yoko Ishii,4 Daisuke Koya,5 Hiroshi Tsuneki,1 Masakiyo Sasahara,4 and Toshiyasu Sasaoka1 PDGFRb Regulates Adipose Tissue Expansion and Glucose Metabolism via Vascular Remodeling in Diet-Induced Obesity Diabetes 2017;66:1008–1021 | DOI: 10.2337/db16-0881 Platelet-derived growth factor (PDGF) is a key factor in The physiological roles of the vasculature in adipose tissue angiogenesis; however, its role in adult obesity remains have been attracting interest from the viewpoint of adipose unclear. In order to clarify its pathophysiological role, tissue expansion and chronic inflammation (1,2). White we investigated the significance of PDGF receptor b adipose tissue (WAT) such as visceral fat possesses the (PDGFRb) in adipose tissue expansion and glucose unique characteristic of plasticity; its volume may change metabolism. Mature vessels in the epididymal white several fold even after growth depending on nutritional adipose tissue (eWAT) were tightly wrapped with peri- conditions. Enlarged adipose tissue is chronically exposed cytes in normal mice. Pericyte desorption from vessels to hypoxia (3,4), which stimulates the production of angio- and the subsequent proliferation of endothelial cells genic factors for the supplementation of nutrients and were markedly increased in the eWAT of diet-induced oxygen to the newly enlarged tissue area (5). Selective ab- obese mice. Analyses with flow cytometry and adipose lation of the vasculature in WAT by apoptosis-inducible tissue cultures indicated that PDGF-B caused the de- peptides or the systemic administration of angiogenic in- PATHOPHYSIOLOGY tachment of pericytes from vessels in a concentration- hibitors has been shown to reduce WAT volumes and result dependent manner. -
60+ Genes Tested FDA-Approved Targeted Therapies & Gene Indicators
® 60+ genes tested ABL1, ABL2, ALK, AR, ARAF, ATM, ATR, BRAF, BRCA1*, BRCA2*, BTK, CCND1, CCND2, CCND3, CDK4, Somatic mutation detection CDK6, CDKN1A, CDKN1B, CDKN2A, CDKN2B, DDR1, DDR2, EGFR, ERBB2 (HER2), ESR1, FGFR1, FGFR2, for approved cancer therapies FGFR3, FGFR4, FLCN, FLT1, FLT3, FLT4, GNA11, GNAQ, HDAC1, HDAC2, HRAS, JAK1, JAK2, KDR, KIT, in solid tumors KRAS, MAP2K1, MET, MTOR, NF1, NF2, NRAS, PALB2, PARP1, PDGFRA, PDGFRB, PIK3CA, PIK3CD, PTCH1, PTEN, RAF1, RET, ROS1, SMO, SRC, STK11, TNK2, TSC1, TSC2 FDA-approved Targeted Therapies & Gene Indicators Abiraterone AR Necitumumab EGFR Ado-Trastuzumab ERBB2 (HER2) Nilotinib ABL1, ABL2, DDR1, DDR2, KIT, PDGFRA, PDGFRB Emtansine FGFR1, FGFR2, FGFR3, FLT1, FLT4, KDR, PDGFRA, Afatinib EGFR, ERBB2 (HER2) Nintedanib PDGFRB Alectinib ALK Olaparib ATM, ATR, BRCA1*, BRCA2*, PALB2, PARP1 Anastrozole ESR1 Osimertinib EGFR Axitinib FLT1, FLT4, KDR, KIT, PDGFRA, PDGFRB CDK4, CDK6, CCND1, CCND2, CCND3, CDKN1A, Palbociclib Belinostat HDAC1, HDAC2 CDKN1B, CDKN2A, CDKN2B Panitumumab EGFR Bicalutamide AR Panobinostat HDAC1, HDAC2 Bosutinib ABL1, SRC Pazopanib FLT1, FLT4, KDR, KIT, PDGFRA, PDGFRB Cabozantinib FLT1, FLT3, FLT4, KDR, KIT, MET, RET Pertuzumab ERBB2 (HER2) Ceritinib ALK ABL1, FGFR1, FGFR2, FGFR3, FGFR4, FLT1, FLT3, FLT4, Cetuximab EGFR Ponatinib KDR, KIT, PDGFRA, PDGFRB, RET, SRC Cobimetinib MAP2K1 Ramucirumab KDR Crizotinib ALK, MET, ROS1 Regorafenib ARAF, BRAF, FLT1, FLT4, KDR, KIT, PDGFRB, RAF1, RET Dabrafenib BRAF Ruxolitinib JAK1, JAK2 Dasatinib ABL1, ABL2, DDR1, DDR2, SRC, TNK2 -
PSM, a Mediator of PDGF-BB-, IGF-I-, and Insulin-Stimulated Mitogenesis
Oncogene (2000) 19, 39 ± 50 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc PSM, a mediator of PDGF-BB-, IGF-I-, and insulin-stimulated mitogenesis Heimo Riedel*,1,2, Nasim Yousaf1, Yuyuan Zhao4, Heping Dai1,3, Youping Deng1 and Jian Wang1 1Department of Biological Sciences, Wayne State University, Detroit, Michigan, MI 48202, USA; 2Member, Barbara Ann Karmanos Cancer Institute, Detroit, Michigan, MI 48201, USA PSM/SH2-B has been described as a cellular partner of Introduction the FceRI receptor, insulin receptor (IR), insulin-like growth factor-I (IGF-I) receptor (IGF-IR), and nerve The platelet-derived growth factor (PDGF) family growth factor receptor (TrkA). A function has been represents key mitogenic and chemotactic factors that proposed in neuronal dierentiation and development but have been exploited by the Simian sarcoma virus v-sis its role in other signaling pathways is still unclear. To oncogene which results in altered PDGF expression further elucidate the physiologic role of PSM we have (Water®eld et al., 1983). Normal cellular PDGF identi®ed additional mitogenic receptor tyrosine kinases appears in three distinct isoforms as any combination as putative PSM partners including platelet-derived of the PDGF A and B chains which act in paracrine growth factor (PDGF) receptor (PDGFR) beta, hepato- and autocrine mechanisms (Heldin, 1993). PDGF cyte growth factor receptor (Met), and ®broblast growth receptor (PDGFR) signal transduction appears to be factor receptor. We have mapped Y740 as a site of a largely membrane delineated event (Hughes et al., PDGFR beta that is involved in the association with 1996). -
Cloning and Characterization of Ovine Immunoglobulin G Fc Receptor II (Fcgrii)§ Veterinary Immunology and Immunopathology
Veterinary Immunology and Immunopathology 133 (2010) 243–249 Contents lists available at ScienceDirect Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm Short communication Cloning and characterization of ovine immunoglobulin G Fc receptor II (FcgRII)§ Yunchao Liu a,b, Aiping Wang b, Songlin Qiao a, Gaiping Zhang a,*, Jun Xi a, Leiming You a, Xiaohui Tian a, Qiaomu Li a, Lina Zhang a, Junqing Guo a a Key Laboratory of Animal Immunology of the Ministry of Agriculture, Henan Provincial Key Laboratory of Animal Immunology, Henan Academy of Agricultural Sciences, Zhengzhou 450002, China b College of Bioengineering, Zhengzhou University, Zhengzhou 450001, China ARTICLE INFO ABSTRACT Article history: Immunoglobulin G (IgG) Fc receptors (FcgRs) bind to immune complexes through Received 31 December 2008 interactions with the Fc region of IgG to initiate or inhibit the defense mechanism of the Received in revised form 1 July 2009 leukocytes on which they are expressed. In this study, we describe the cloning, sequencing Accepted 9 July 2009 and characterization of ovine FcgRII. By screening a translated expression sequence tag (EST) database with the protein sequence of bovine IgG Fc receptor II, we identified a Keywords: putative ovine homologue. Using rapid amplification of cDNA ends (RACE), we isolated the Sheep cDNA encoding ovine FcgRII from peripheral blood leucocyte RNA. The ovine FcgRII cDNA FcgRII contains an 894 bp open-reading frame, encoding a 297 amino acid transmembrane Inhibitory receptor Expression glycoprotein composed of two immunoglobulin-like extracellular domains, a transmem- brane region and a cytoplasmic tail with an immunoreceptor tyrosine-based inhibitory motif (ITIM). -
PDGFRB FISH for Gleevec Eligibility in Myelodysplastic Syndrome/Myeloproliferative Disease (MDS/MPD)
PDGFRB FISH PRODUCT DATASHEET Proprietary Name: PDGFRB FISH for Gleevec Eligibility in Myelodysplastic Syndrome/Myeloproliferative Disease (MDS/MPD) Established Name: PDGFRB FISH for Gleevec in MDS/MPD INTENDED USE Humanitarian Device. Authorized by Federal law for use in the qualitative detection of PDGFRB gene rearrangement in patients with MDS/MPD. The effectiveness of this device for this use has not been demonstrated. Caution: Federal Law restricts this device to sale by or on the order of a licensed practitioner. PDGFRB FISH for Gleevec Eligibility in Myelodysplastic Syndrome/Myeloproliferative Disease (MDS/MPD) is an in vitro diagnostic test intended for the qualitative detection of PDGFRB gene rearrangement from fresh bone marrow samples of patients with MDS/MPD with a high index of suspicion based on karyotyping showing a 5q31~33 anomaly. The PDGFRB FISH assay is indicated as an aid in the selection of MDS/MPD patients for whom Gleevec® (imatinib mesylate) treatment is being considered. This assay is for professional use only and is to be performed at a single laboratory site. SUMMARY AND EXPLANATION OF THE TEST The PDGFRB FISH assay detects rearrangement of the PDGFRB locus at chromosome 5q31~33 in adult patients with myelodysplastic syndrome/myeloproliferative disease (MDS/MPD). The PDGFRB gene encodes a cell surface receptor tyrosine kinase that upon activation stimulates mesenchymal cell division. Rearrangement of PDGFRB has been demonstrated by classical cytogenetic analysis in an exceedingly small fraction of MDS/MPD patients (~1%), usually cases with a clinical phenotype of chronic myelomonocytic leukemia (CMML). In particular, these patients harbor a t(5:12)(q31;p12) translocation involving the PDGFRB and ETV6 genes. -
Molecular and Cellular Studies Examining the Biological Significance of Different Isoforms of the Receptor Tyrosine Kinase' C-Kit
Molecular and cellular studies examining the biological significance of different isoforms of the receptor tyrosine kinase' c-Kit Antony Charles Cambareri B. Sc. (Hons) Institute of Medical and Veterinary Science Department of Medicine University of Adelaide South Australia A thesis submitted to the University of Adelaide in candidature for the degree of Doctor of Philosophy October 2004 Declaration This thesis contains no material that has been accepted for the award of any other degree or diploma in any other university. To the best of my knowledge and belief' this thesis contains no material previously published or written by another person' except where due reference has been made in the text. I give consent to this copy of my thesis, when deposited in the University Library, being available for loan and photocopylng. p? Antony C atefl 4 ,(? ll Acknowledgments I would like to sincerely thank my supervisors, Professor Leonie Ashman and professor Bik To. I thank them both for their encouragement, persistence and support over the period of this work' Special thanks to Steve Fitter, who was pivotal in "retraining" me in the art of science upon my return to the lab from "the dark side". He is both a great friend and a legendary molecular biologist (it is true that it will work if you add a microlitre!)' I also thank Andrew Zannettino for spending the time to critique drafts of this thesis, and for valuable input to experimental design. I acknowledge the valuable technical assistance of Ly Nguyen and Peter Konstantopolous from the Leukaemia Haemopoiesis Laboratory. Thanks also to Sue Branford and Rebecca Lawrence for their assistance with Quantitative PCR. -
Platelet-Derived Growth Factor Isoform Expression in Carbon Tetrachloride
Laboratory Investigation (2008) 88, 1090–1100 & 2008 USCAP, Inc All rights reserved 0023-6837/08 $30.00 Platelet-derived growth factor isoform expression in carbon tetrachloride-induced chronic liver injury Erawan Borkham-Kamphorst1, Evgenia Kovalenko1, Claudia RC van Roeyen2, Nikolaus Gassler3, Michael Bomble1, Tammo Ostendorf 2,Ju¨rgen Floege2, Axel M Gressner1 and Ralf Weiskirchen1 Platelet-derived growth factor (PDGF) has an essential role in liver fibrogenesis, as PDGF-B and -D both act as potent mitogens on culture-activated hepatic stellate cells (HSCs). Induction of PDGF receptor type-b (PDGFRb) in HSC is well documented in single-dose carbon tetrachloride (CCl4)-induced acute liver injury. Of the newly discovered isoforms PDGF- C and -D, only PDGF-D shows significant upregulation in bile duct ligation (BDL) models. We have now investigated the expression of PDGF isoforms and receptors in chronic liver injury in vivo after long-term CCl4 treatment and demonstrated that isolated hepatocytes have the requisite PDGF signaling pathways, both in the naive state and when isolated from CCl4-treated rats. In vivo, PDGF gene expression showed upregulation of all PDGF isoforms and receptors, with values peaking at 4 weeks and decreasing to near basal levels by 8 and 12 weeks. Interestingly, PDGF-C increased significantly when compared to BDL-models. PDGF-A, PDGF-C and PDGF receptor type-a (PDGFRa) correlated closely with in- flammation and steatosis. Immunohistochemistry revealed expression of PDGF-B, -C and -D in areas corresponding to centrilobular necrosis, inflammation and fibrosis, whereas PDGF-A localized in regenerative hepatocytes. PDGFRb was identified along the fibrotic septa, whereas PDGFRa showed positive staining in fibrotic septa and regenerative hepa- tocytes. -
Abstract: Dissecting PDGFRB Function in NPM- ALK Driven Lymphoma
University of Veterinary Medicine, Vienna Institute of Pathology and Forensic Veterinary Medicine Abstract: Dissecting PDGFRB function in NPM- ALK driven lymphoma Lukas KENNER, Pathology of Laboratory Animals The study of tumor animal models of proven clinical relevance is essential to advance clinical practice. Anaplastic large cell lymphoma (ALCL) is a malignant T-cell Non-Hodgkin lymphoma and frequently associated with the t(2;5) translocation resulting in expression of the Nucleophosmin-Anaplastic Lymphoma Kinase (NPM-ALK) fusion protein. Recent studies by us identified AP-1 transcription factors (TF) JUNB and cJUN as downstream effectors of NPM-ALK. These TFs directly upregulate platelet derived growth factor receptor B (PDGFRB) expression in lymphoma cells. Based on these findings we established a mouse model for ALCL by expressing NPM-ALK under the CD4 promoter, which is the only animal model reflecting the clinical progression and metastatic potential of the disease. Genetic ablation of cJUN and JUNB in this model did not affect tumor incidence, however lymphomas displayed reduced progression, indicated by reduced vascularization as well as a loss of dissemination. This resulted in extended survival; therapeutic inhibition of PDGFRB with the kinase inhibitor imatinib markedly prolonged the life of NPM-ALK transgenic mice. We therefore conclude that cJUN/JUNB driven expression of PDGFRB in lymphoma cells induces stromal alterations in the microenvironment of the initial ALCL tumor, which are essential for tumor progression and dissemination. This is pointing towards tumor cell autonomous as well as microenvironmental functions of signaling cascades in ALK driven ALCL. Therefore this mouse model is suitable to study tumor stroma interactions, which are currently lacking. -
Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its
Supplementary data ASXL2 regulates hematopoiesis in mice and its deficiency promotes myeloid expansion Supplementary Methods Genomic DNA extraction Genomic DNA was extracted from BM mononuclear cells using a DNA extraction kit (Puregene Gentra System, Minneapolis, MN, USA) according to the manufacturer’s instructions. Genomic DNA was quantified using Qubit Fluorometer (Life Technologies) and DNA integrity was assessed by agarose gel electrophoresis. For samples with low quantity, DNA was amplified using REPLI-g Ultrafast mini kit (Qiagen). Peripheral blood analysis Complete peripheral blood counts were analysed using Abbott Cell-Dyn 3700 hematology analyzer (Abbott Laboratories). Expression analysis of Asxl2 and Asxl1 Transcript levels of Asxl2 and Asxl1 were estimated using quantitative RT-PCR with following primers: Asxl2 primer set 1, ATTCGACAAGAGATTGAGAAGGAG (forward) and TTTCTGTGAATCTTCAAGGCTTAG (reverse); Asxl2 primer set 2, GCCCTTAACAATGAGTTCTTCACT (forward) and TCCACAGCTCTACTTTCTTCTCCT (reverse); Asxl1 primers, GGTGGAACAATGGAAGGAAA (forward) and CTGGCCGAGAACGTTTCTTA (reverse). Asxl2 protein was detected in immunoblot using anti-ASXL2 antibody (Bethyl). In vitro differentiation of bone marrow cells Bone marrow (BM) cells were cultured in IMDM containing 20% FBS and 10 ng/ml IL3, 10 ng/ml IL6, 20 ng/ml SCF and 20 ng/ml GMCSF for two weeks. For FACS analysis, cells were washed, stained with fluorochrome-conjugated antibodies and analysed on FACS LSR II flow cytometer (BD Biosciences) using FACSDIVA software (BD Biosciences). Colony re-plating assay Bone marrow cells were plated in methylcellulose medium containing mouse stem cell factor (SCF), mouse interleukin 3 (IL-3), human interleukin 6 (IL-6) and human erythropoietin (MethoCult GF M3434; StemCell Technologies). Colonies were enumerated after 9-12 days and cells were harvested for re-plating.