DOCSLIB.ORG

<I>PASSERINA</I> BUNTING RELATIONSHIPS

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
<I>PASSERINA</I> BUNTING RELATIONSHIPS The Auk 118(3):611-623, 2001 A CYTOCHROME-b PERSPECTIVE ON PASSERINA BUNTING RELATIONSHIPS JOHN KLICKA,L3 ADAM J. FRY,TM ROBERT M. ZINK, • AND CHRISTOPHERW. THOMPSON2,5 •J.E BellMuseum of NaturalHistory, University of Minnesota, 1987 UpperBuford Circle, St. Paul,Minnesota 55108, USA; and 2BurkeMuseum and Department of ZoologyDB-10, University of Washington,Seattle, Washington98195, USA ABSTRACT.--Wesequenced the completemitochondrial cytochrome-b gene (1,143 nucle- otides)for representativesof eachspecies in thecardinalid genera Passerina (6 species),Guir- aca(1 species),and Cyanocompsa(3 species), and useda variety of phylogeneticmethods to addressrelationships within and amonggenera. We determinedthat Passerina,as presently recognized,is paraphyletic.Lazuli Bunting(P. amoena) is sisterto the muchlarger Blue Gros- beak (Guiracacaerulea). Indigo Bunting(P. cyanea) and Lazuli Buntingare not sistertaxa as generallythought. In all weightedparsimony trees and for the gamma-correctedHKY tree, Indigo Buntingis the sisterof two sistergroups, a "blue" (Lazuli Buntingand Blue Gros- beak)and a "painted" (Rosita'sBunting [P. rositae], Orange-breasted Bunting [P. leclancherii], VariedBunting [P. versicolor], and Painted Bunting [P. ciris]) clade. The latter two speciesform a highly supportedsister pair of relativelymore recent origin. Uncorrected (p) distancesfor ingroup (Passerinaand Guiraca)taxa range from 3.0% (P.versicolor-P. ciris) to 7.6%(P. cyanea- P.leclancherii) and average6.5% overall. Assuming a molecularclock, a bunting"radiation" between4.1 and 7.3 Mya yielded four lineages.This timing is consistentwith fossilevidence and coincideswith a late-Miocenecooling during which a varietyof westerngrassland hab- itatsevolved. A reductionin sizeat that time may haveallowed buntings to exploitthat new foodresource (grass seeds). We speculate that the BlueGrosbeak subsequently gained large size and widespreaddistribution as a result of ecologicalcharacter displacement. Received 25 October1999, accepted 16 September2000. THE BUNTINGSof the avian genusPasserina ently recognized (Sibley and Monroe 1990, (family Cardinalidae) include six species AOU 1998),form a natural group.Nevertheless, whose compositerange includesMexico, the some authors (Phillips et al. 1964, Blake 1969, United States,and parts of southernCanada. Mayr and Short1970) place the monotypicBlue They are small, heavy-billed finches,most of Grosbeak(Guiraca caerulea) within this genus, which (see Thompson and Leu 1995) exhibit and others(Paynter 1970) further expandPas- pronouncedsexual dichromatism with brightly serinato include additional genera.Thus, de- coloredmales and mostlybrownish or olive fe- spite the phenotypic similarities of the six rec- males. Traditional museum studies relying ognized species, monophyly of Passerina upon comparisonsof studyskins (e.g. Ridgway remains unresolved. 1901),as well asa morerecent study employing Relationshipswithin Passerinaalso remain numericalphenetic analyses of both skinsand unclear. Phillips et al. (1964) consider the In- skeletons(Hellack and Schnell 1977), have con- digo Bunting(E cyanea)and the Lazuli Bunting cludedthat the membersof Passerina,as pres- (P. amoena)conspecific. Hybridization on the GreatPlains between P. cyanea and P.amoena has 3 Present address: Barrick Museum, Box 454012, been well documented(Sibley and Short 1959, University of Nevada Las Vegas, 4505 Maryland Emlen et al. 1975, Kroodsma et al. 1975). Sim- Parkway, Las Vegas, Nevada 89154-4012, USA. ilarly, the Painted Bunting (P.ciris) and Varied E-mail: [email protected] Bunting (P. versicolor)are known to have hy- 4Present address: Department of Ecology and bridized (Storer 1961). Whereas such hybrid- EvolutionaryBiology, Box G-W, Brown University, Providence, Rhode Island 02912, USA. izationmight be takenas evidence of sister-spe- sPresent address: Washington Department of Fish ciesrelationships, a known pairing betweenP. and Wildlife, 16018 Mill Creek Boulevard, Mill cyaneaand P. ciris (Taylor 1974) muddles the Creek, Washington98012, USA. picture.The ability to hybridizemight be a mis- 611 612 KLICKAET AL. [Auk, Vol. 118 leading indicator of relationship (Zink and (outgroup). Those three generawere thus targeted McKitrick 1995), therefore the construction of for completecyt-b genesequencing. Because adding an independentphylogeny is warranted. more taxa to the sistergroup increasesthe chanceof Our understandingof the speciesin Passerina obtaining the correcttree (Smith 1994), single rep- resentatives of all three members of Cyanocompsa is uneven.Passerina cyanea is among our best were subsequentlyused. To obtaina measureof in- known songbirdswith song,display behaviors, traspecificgenetic variation and to provide a check mating strategies,molt, and migration having for potentialsequencing errors, each of sixspecies of been studied extensively(see Payne's[1992] Passerinaand the monotypic G. caerulea(ingroup comprehensivereview for references).At the taxa) were representedby two differenttissue spec- other extreme are the endemic forms of south- imens (Table 1). ern Mexico, Leclancher's(Orange-breasted) Laboratoryprotocols.--Total DNA was extracted Bunting (P.leclancherii) and Rosita's(Rose-bel- from fragments(-100 mg) of muscleor liver tissues lied) Bunting(P. rositae), about which very little followingeither a standardphenol/chloroform pro- tocol (Hillis et al. 1996) or via incubationin Chelex/ is known. A few comparativestudies have in- Proteinase K, a modification of Ellegren's (1992) volved most or all members of Passerina, ex- method. Overlapping sequencefragments were am- amining molts and plumages(summarized in plified via the polymerasechain reaction(PCR) us- Thompsonand Leu 1994), songs (Thompson ing variouscombinations of the followingpublished 1968), and morphology (Hellack and Schnell primers:L14851 (Kornegayet al. 1993),L14841 (Ko- 1977). However,interpretation of thosestudies cher et al. 1989), H15299 (Hackett 1996), H4A is compromisedby the lack of an explicitphy- (Harshman 1996), LCBA, LCBB, LCBC, HCBC logenetic hypothesis (Brooks and McLennan (Klicka et al. 1999);and two designed(J. Klicka) for 1991). general use on New World nine-primariedoscines: In this study,we usedDNA sequencesfrom HCBRB (GGAGAATGACTCCGAYGTTTCA), and the completemitochondrial (mtDNA) protein HCBJT (GGCTGGGGTGAAATTTTCTGGGTCT). A map of primer locationsis availableby request.PCR coding cytochrome-b(cyt-b) gene to assessthe reactionswere performedin 50 bL total volumesus- monophyly of Passerinaas presently recog- ing a 1.5 mM concentrationof MgC12,1 •M concen- nized and to constructa phylogenetichypoth- trations of eachprimer, 0.2 mM final concentration esis for the constituentsof this group. Cyt-b of dNTPs, 0.5 •L of Tfi polymerase(Thermusfiavus, and its flanking regionsare well characterized Epicentre), 2.2 •L of 20x Tfi buffer (400 mM in birds and its rate of evolutionis particularly [NH412SO4and 1 M Tris-HC1 [pH 9.0], Epicentre)and well suited for avian studiesat the specieslevel 10-1,000 ng (2 •L) of DNA template.A typical dou- (Moore and DeFilippis 1997). The resulting ble-strandedamplification began with a 2 min de- phylogenetictree providesa historicalframe- naturationat 94øCfollowed by 38 cyclesof denatur- work for a better understandingof the evolu- ing (94øC,45 s), annealing(54øC, 1 min, 30 s), and primer extension(72øC, 1 min, 30 s) with a final ex- tion of variouslife-history traits and for inves- tensionof 72øCfor 10 min. The presenceof the de- tigating historicalbiogeography. siredproduct was verified by electrophoresisof 5 bL in a 1% agarosegel (SeakemLE, FMC) followedby METHODS Ethidium Bromide staining. Excess primers and dNTPs were then removed by enzymatic treatment Taxon sampling.--Outgroupchoice is a critical of the PCR product with Exonuclease1 and Shrimp component of molecular phylogenetic analysis Alkaline Phosphatase(U.S. BiochemicalCorp.). To (Smith 1994).Outgroups that are too distantly relat- ensuresequencing accuracy, large fragment overlaps ed to the group of interest lead to spuriousrooting were used and wherever possible both light and of the ingroup topology (Wheeler 1990). Relation- heavy strandsof the treatedproduct were sequenced ships among Cardinalid genera are poorly under- using either the original or nestedprimers. Sequenc- stood, thereforean initial genericlevel phylogenetic ing reactions(Hillis et al. 1996)were donemanually surveyof the groupwas performed.A cyt-b (430bp) (productno. 70130,U.S.B.), run out on 6% acrylam- segmentfrom at leastone representativeof eachpu- ide (Gene-Page,Amresco) gels, and visualizedby au- tative Cardinalid genus (exceptingCyanoloxia) was toradiography (3sS). Sequences (GenBank nos. sequenced,as were representativesof severalThrau- AF301446-AF301462) were aligned visually using pid genera,which were used as outgroups.The de- published chicken (Gallus;Desjardins and Morals tailed resultsof that initial study are to be published 1990) and Snow Goose (Chen [Anser] caerulescens; elsewhere;however, in all phylogeneticanalyses the Quinn and Wilson 1993) sequencesfor comparison. Passerinabuntings and G. caeruleawere determined Data analysis.--Parsimony(uniform and differen- to constitutea clade (ingroup), sisterto Cyanocompsa tial weighting schemes)and maximum-likelihood April 2001] PasserinaBunting Paraphyly 613 z methodswere used to estimatephylogenetic trees For comparison,and to allow quick visual assess- ment of relative geneticdistances, we alsoconstruct- ed neighbor-joiningtrees. All analyseswere
Load more

Recommended publications
  • Terrestrial Ecology Enhancement
    PROTECTING NESTING BIRDS BEST MANAGEMENT PRACTICES FOR VEGETATION AND CONSTRUCTION PROJECTS Version 3.0 May 2017 1 CONTENTS Page 1.0 INTRODUCTION 3 2.0 BIRDS IN PORTLAND 4 3.0 NESTING BEHAVIOR OF PORTLAND BIRDS 4 3.1 Timing 4 3.2 Nesting Habitats 5 4.0 GENERAL GUIDELINES 9 4.1 What if Work Must Occur During Avoidance Periods? 10 4.2 Who Conducts a Nesting Bird Survey? 10 5.0 SPECIFIC GUIDELINES 10 5.1 Stream Enhancement Construction Projects 10 5.2 Invasive Species Management 10 - Blackberry - Clematis - Garlic Mustard - Hawthorne - Holly and Laurel - Ivy: Ground Ivy - Ivy: Tree Ivy - Knapweed, Tansy and Thistle - Knotweed - Purple Loosestrife - Reed Canarygrass - Yellow Flag Iris 5.3 Other Vegetation Management 14 - Live Tree Removal (Native and Non-Native) - Snag Removal - Shrub Removal (Native and Non-Native) - Grassland Mowing and Ground Cover Removal (Native and Non-Native) - Controlled Burn 5.4 Other Management Activities 16 - Removing Structures - Manipulating Water Levels 6.0 SENSITIVE AREAS 17 7.0 SPECIAL CONSIDERATIONS 17 7.1 Species 17 7.2 Other Things to Keep in Mind 19 Best Management Practices: Avoiding Impacts on Nesting Birds Version 3.0 –May 2017 2 8.0 WHAT IF YOU FIND AN ACTIVE NEST ON A PROJECT SITE 19 DURING PROJECT IMPLEMENTATION? 9.0 WHAT IF YOU FIND A BABY BIRD OUT OF ITS NEST? 19 10.0 SUMMARY OF RECOMMENDATIONS FOR AVOIDING 20 IMPACTS ON NESTING BIRDS DURING CONSTRUCTION AND REVEGETATION PROJECTS APPENDICES A—Average Arrival Dates for Birds in the Portland Metro Area 21 B—Nesting Birds by Habitat in Portland 22 C—Bird Nesting Season and Work Windows 25 D—Nest Buffer Best Management Practices: 26 Protocol for Bird Nest Surveys, Buffers and Monitoring E—Vegetation and Other Management Recommendations 38 F—Special Status Bird Species Most Closely Associated with Special 45 Status Habitats G— If You Find a Baby Bird Out of its Nest on a Project Site 48 H—Additional Things You Can Do To Help Native Birds 49 FIGURES AND TABLES Figure 1.
    [Show full text]
  • Rare Birds of California Now Available! Price $54.00 for WFO Members, $59.99 for Nonmembers
    Volume 40, Number 3, 2009 The 33rd Report of the California Bird Records Committee: 2007 Records Daniel S. Singer and Scott B. Terrill .........................158 Distribution, Abundance, and Survival of Nesting American Dippers Near Juneau, Alaska Mary F. Willson, Grey W. Pendleton, and Katherine M. Hocker ........................................................191 Changes in the Winter Distribution of the Rough-legged Hawk in North America Edward R. Pandolfino and Kimberly Suedkamp Wells .....................................................210 Nesting Success of California Least Terns at the Guerrero Negro Saltworks, Baja California Sur, Mexico, 2005 Antonio Gutiérrez-Aguilar, Roberto Carmona, and Andrea Cuellar ..................................... 225 NOTES Sandwich Terns on Isla Rasa, Gulf of California, Mexico Enriqueta Velarde and Marisol Tordesillas ...............................230 Curve-billed Thrasher Reproductive Success after a Wet Winter in the Sonoran Desert of Arizona Carroll D. Littlefield ............234 First North American Records of the Rufous-tailed Robin (Luscinia sibilans) Lucas H. DeCicco, Steven C. Heinl, and David W. Sonneborn ........................................................237 Book Reviews Rich Hoyer and Alan Contreras ...........................242 Featured Photo: Juvenal Plumage of the Aztec Thrush Kurt A. Radamaker .................................................................247 Front cover photo by © Bob Lewis of Berkeley, California: Dusky Warbler (Phylloscopus fuscatus), Richmond, Contra Costa County, California, 9 October 2008, discovered by Emilie Strauss. Known in North America including Alaska from over 30 records, the Dusky is the Old World Warbler most frequent in western North America south of Alaska, with 13 records from California and 2 from Baja California. Back cover “Featured Photos” by © Kurt A. Radamaker of Fountain Hills, Arizona: Aztec Thrush (Ridgwayia pinicola), re- cently fledged juvenile, Mesa del Campanero, about 20 km west of Yecora, Sonora, Mexico, 1 September 2007.
    [Show full text]
  • Wildlife of the North Hills: Birds, Animals, Butterflies
    Wildlife of the North Hills: Birds, Animals, Butterflies Oakland, California 2005 About this Booklet The idea for this booklet grew out of a suggestion from Anne Seasons, President of the North Hills Phoenix Association, that I compile pictures of local birds in a form that could be made available to residents of the north hills. I expanded on that idea to include other local wildlife. For purposes of this booklet, the “North Hills” is defined as that area on the Berkeley/Oakland border bounded by Claremont Avenue on the north, Tunnel Road on the south, Grizzly Peak Blvd. on the east, and Domingo Avenue on the west. The species shown here are observed, heard or tracked with some regularity in this area. The lists are not a complete record of species found: more than 50 additional bird species have been observed here, smaller rodents were included without visual verification, and the compiler lacks the training to identify reptiles, bats or additional butterflies. We would like to include additional species: advice from local experts is welcome and will speed the process. A few of the species listed fall into the category of pests; but most - whether resident or visitor - are desirable additions to the neighborhood. We hope you will enjoy using this booklet to identify the wildlife you see around you. Kay Loughman November 2005 2 Contents Birds Turkey Vulture Bewick’s Wren Red-tailed Hawk Wrentit American Kestrel Ruby-crowned Kinglet California Quail American Robin Mourning Dove Hermit thrush Rock Pigeon Northern Mockingbird Band-tailed
    [Show full text]
  • The Quarterly Journal of Oregon Field Ornithology
    $4.95 The quarterly journal of Oregon field ornithology Volume 20, Number 4, Winter 1994 Oregon's First Verified Rustic Bunting 111 Paul Sherrell The Records of the Oregon Bird Records Committee, 1993-1994 113 Harry Nehls Oregon's Next First State Record Bird 115 Bill Tice What will be Oregon's next state record bird?.. 118 Bill Tice Third Specimen of Nuttall's Woodpecker {Picoides nuttallit) in Oregon from Jackson County and Comments on Earlier Records ..119 M. Ralph Browning Stephen P. Cross Identifying Long-billed Curlews Along the Oregon Coast: A Caution 121 Range D. Bayer Birders Add Dollars to Local Economy 122 Douglas Staller Where do chickadees get fur for their nests? 122 Dennis P. Vroman North American Migration Count 123 Pat French Some Thoughts on Acorn Woodpeckers in Oregon 124 George A. Jobanek NEWS AND NOTES OB 20(4) 128 FIELDNOTES. .131 Eastern Oregon, Spring 1994 131 Steve Summers Western Oregon, Spring 1994 137 Gerard Lillie Western Oregon, Winter 1993-94 143 Supplement to OB 20(3): 104, Fall 1994 Jim Johnson COVER PHOTO Clark's Nutcracker at Crater Lake, 17 April 1994. Photo/Skip Russell. CENTER OFO membership form OFO Bookcase Complete checklist of Oregon birds Oregon s Christmas Bird Counts Oregon Birds is looking for material in these categories: Oregon Birds News Briefs on things of temporal importance, such as meetings, birding trips, The quarterly journal of Oregon field ornithology announcements, news items, etc. Articles are longer contributions dealing with identification, distribution, ecology, is a quarterly publication of Oregon Field OREGON BIRDS management, conservation, taxonomy, Ornithologists, an Oregon not-for-profit corporation.
    [Show full text]
  • Birds of the East Texas Baptist University Campus with Birds Observed Off-Campus During BIOL3400 Field Course
    Birds of the East Texas Baptist University Campus with birds observed off-campus during BIOL3400 Field course Photo Credit: Talton Cooper Species Descriptions and Photos by students of BIOL3400 Edited by Troy A. Ladine Photo Credit: Kenneth Anding Links to Tables, Figures, and Species accounts for birds observed during May-term course or winter bird counts. Figure 1. Location of Environmental Studies Area Table. 1. Number of species and number of days observing birds during the field course from 2005 to 2016 and annual statistics. Table 2. Compilation of species observed during May 2005 - 2016 on campus and off-campus. Table 3. Number of days, by year, species have been observed on the campus of ETBU. Table 4. Number of days, by year, species have been observed during the off-campus trips. Table 5. Number of days, by year, species have been observed during a winter count of birds on the Environmental Studies Area of ETBU. Table 6. Species observed from 1 September to 1 October 2009 on the Environmental Studies Area of ETBU. Alphabetical Listing of Birds with authors of accounts and photographers . A Acadian Flycatcher B Anhinga B Belted Kingfisher Alder Flycatcher Bald Eagle Travis W. Sammons American Bittern Shane Kelehan Bewick's Wren Lynlea Hansen Rusty Collier Black Phoebe American Coot Leslie Fletcher Black-throated Blue Warbler Jordan Bartlett Jovana Nieto Jacob Stone American Crow Baltimore Oriole Black Vulture Zane Gruznina Pete Fitzsimmons Jeremy Alexander Darius Roberts George Plumlee Blair Brown Rachel Hastie Janae Wineland Brent Lewis American Goldfinch Barn Swallow Keely Schlabs Kathleen Santanello Katy Gifford Black-and-white Warbler Matthew Armendarez Jordan Brewer Sheridan A.
    [Show full text]
  • L O U I S I a N A
    L O U I S I A N A SPARROWS L O U I S I A N A SPARROWS Written by Bill Fontenot and Richard DeMay Photography by Greg Lavaty and Richard DeMay Designed and Illustrated by Diane K. Baker What is a Sparrow? Generally, sparrows are characterized as New World sparrows belong to the bird small, gray or brown-streaked, conical-billed family Emberizidae. Here in North America, birds that live on or near the ground. The sparrows are divided into 13 genera, which also cryptic blend of gray, white, black, and brown includes the towhees (genus Pipilo), longspurs hues which comprise a typical sparrow’s color (genus Calcarius), juncos (genus Junco), and pattern is the result of tens of thousands of Lark Bunting (genus Calamospiza) – all of sparrow generations living in grassland and which are technically sparrows. Emberizidae is brushland habitats. The triangular or cone- a large family, containing well over 300 species shaped bills inherent to most all sparrow species are perfectly adapted for a life of granivory – of crushing and husking seeds. “Of Louisiana’s 33 recorded sparrows, Sparrows possess well-developed claws on their toes, the evolutionary result of so much time spent on the ground, scratching for seeds only seven species breed here...” through leaf litter and other duff. Additionally, worldwide, 50 of which occur in the United most species incorporate a substantial amount States on a regular basis, and 33 of which have of insect, spider, snail, and other invertebrate been recorded for Louisiana. food items into their diets, especially during Of Louisiana’s 33 recorded sparrows, Opposite page: Bachman Sparrow the spring and summer months.
    [Show full text]
  • Life History Account for Lazuli Bunting
    California Wildlife Habitat Relationships System California Department of Fish and Wildlife California Interagency Wildlife Task Group LAZULI BUNTING Passerina amoena Family: CARDINALIDAE Order: PASSERIFORMES Class: AVES B477 Written by: S. Granholm Reviewed by: L. Mewaldt Edited by: R. Duke DISTRIBUTION, ABUNDANCE, AND SEASONALITY A common summer visitor from April into September throughout most of California, except in higher mountains and southern deserts. Breeds in open chaparral habitats and brushy understories of open wooded habitats, especially valley foothill riparian. Also frequents thickets of willows, tangles of vines, patches of tall forbs. Often breeds on hillsides near streams or springs. In arid areas, mostly breeds in riparian habitats. May breed in tall forbs in mountain meadows (Gaines 1977b). An uncommon breeder in Central Valley, and rare and local above lower montane habitats. Small numbers move upslope after nesting, occasionally as high as 3050 m (10,000 ft). More widespread in lowlands in migration, occurring commonly in Central Valley (especially in fall) and desert oases (Grinnell and Miller 1944, McCaskie et al. 1979, 1988, Verner and Boss 1980, Garrett and Dunn 1981). SPECIFIC HABITAT REQUIREMENTS Feeding: Feeds mostly on insects and small seeds. Both are important foods through spring and summer (Martin et al. 1961, Bent 1968). Mostly forages in or beneath tall, dense herbaceous vegetation, shrubs, low tree foliage, and vine tangles. Takes insects and seeds from plants or from ground. Sometimes hawks insects in air and gleans foliage well up into tree canopy. Cover: Trees and shrubs and herbage provide cover. Male often sings from high perch in a tree, if present; otherwise uses a taller shrub (Grinnell and Miller 1944).
    [Show full text]
  • Landbird Monitoring in the Sonoran Desert Network 2012 Annual Report
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Landbird Monitoring in the Sonoran Desert Network 2012 Annual Report Natural Resource Technical Report NPS/SODN/NRTR—2013/744 ON THE COVER Hooded Oriole (Icterus cucullatus). Photo by Moez Ali. Landbird Monitoring in the Sonoran Desert Network 2012 Annual Report Natural Resource Technical Report NPS/SODN/NRTR—2013/744 Authors Moez Ali Rocky Mountain Bird Observatory 230 Cherry Street, Suite 150 Fort Collins, Colorado 80521 Kristen Beaupré National Park Service Sonoran Desert Network 7660 E. Broadway Blvd, Suite 303 Tucson, Arizona 85710 Patricia Valentine-Darby University of West Florida Department of Biology 11000 University Parkway Pensacola, Florida 32514 Chris White Rocky Mountain Bird Observatory 230 Cherry Street, Suite 150 Fort Collins, Colorado 80521 Project Contact Robert E. Bennetts National Park Service Southern Plains Network Capulin Volcano National Monument PO Box 40 Des Moines, New Mexico 88418 May 2013 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colora- do, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource manage- ment, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Technical Report Series is used to disseminate results of scientific studies in the physical, biological, and social sciences for both the advancement of science and the achievement of the National Park Service mission.
    [Show full text]
  • Cop13 Prop. 14
    CoP13 Prop. 14 CONSIDERATION OF PROPOSALS FOR AMENDMENT OF APPENDICES I AND II A. Proposal Inclusion of Passerina ciris in Appendix II, in accordance with Article II, paragraph 2 (a), of the Convention and Resolution Conf. 9.24 (Rev. CoP12), Annex 2 a, paragraph B. i). B. Proponent Mexico and the United States of America. C. Supporting statement 1. Taxonomy 1.1 Class: Aves 1.2 Order: Passeriformes 1.3 Family: Cardinalidae 1.4 Genus and species: Passerina ciris 1.5 Scientific synonyms: None 1.6 Common names: English: Painted Bunting French: Nonpareil, Pape de Louisiane, Passerin nonpareil Spanish: Mosaico, Sietecolores, Mariposa, Colorín Sietecolores Danish: Papstfink Dutch: Mexicaanse Nonpareil German: Papst-Finkenammer Italian: Papa della Luisiana, Settecolori 1.7 Code numbers: None 2. Biological parameters 2.1 Distribution Passerina ciris ranges throughout the southeastern and southwestern United States to the West Indies, Mexico and Central America, ranging from sea level up to 2,200 m (Sprunt 1954, Monroe 1968, Rappole and Warner 1980, Binford 1989, Stiles and Skutch 1989, Howell and Web 1995, AOU 1998, Raffaele et al. 1998, Lowther et al. 1999, Garrido and Kirkconell 2000). Its breeding, migratory and wintering ranges fall within the jurisdiction of 11 nations, all CITES Parties, including the proponents. The global breeding population of Passerina ciris is divided between two of the range countries, 80% in the United States and 20% in Mexico (Rich et al. 2004). During the breeding season this species is distributed in two disjunctive populations: the eastern breeding population ranges from the Atlantic Coast of the United States, including the barrier islands, from North Carolina south to central Florida.
    [Show full text]
  • 21 Sep 2018 Lists of Victims and Hosts of the Parasitic
    version: 21 Sep 2018 Lists of victims and hosts of the parasitic cowbirds (Molothrus). Peter E. Lowther, Field Museum Brood parasitism is an awkward term to describe an interaction between two species in which, as in predator-prey relationships, one species gains at the expense of the other. Brood parasites "prey" upon parental care. Victimized species usually have reduced breeding success, partly because of the additional cost of caring for alien eggs and young, and partly because of the behavior of brood parasites (both adults and young) which may directly and adversely affect the survival of the victim's own eggs or young. About 1% of all bird species, among 7 families, are brood parasites. The 5 species of brood parasitic “cowbirds” are currently all treated as members of the genus Molothrus. Host selection is an active process. Not all species co-occurring with brood parasites are equally likely to be selected nor are they of equal quality as hosts. Rather, to varying degrees, brood parasites are specialized for certain categories of hosts. Brood parasites may rely on a single host species to rear their young or may distribute their eggs among many species, seemingly without regard to any characteristics of potential hosts. Lists of species are not the best means to describe interactions between a brood parasitic species and its hosts. Such lists do not necessarily reflect the taxonomy used by the brood parasites themselves nor do they accurately reflect the complex interactions within bird communities (see Ortega 1998: 183-184). Host lists do, however, offer some insight into the process of host selection and do emphasize the wide variety of features than can impact on host selection.
    [Show full text]
  • Early- to Mid-Succession Birds Guild
    Supplemental Volume: Species of Conservation Concern SC SWAP 2015 Early- to Mid-Succession Birds Guild Bewick's Wren Thryomanes bewickii Blue Grosbeak Guiraca caerulea Blue-winged Warbler Vermivora pinus Brown Thrasher Toxostoma rufum Chestnut-sided Warbler Dendroica pensylvanic Dickcissel Spiza americana Eastern Kingbird Tyrannus tyrannus Eastern Towhee Pipilo erythrophthalmus Golden-winged Warbler Vermivora chrysoptera Gray Kingbird Tyrannus dominicensis Indigo Bunting Passerina cyanea Orchard Oriole Icterus spurius Prairie Warbler Dendroica discolor White-eyed Vireo Vireo griseus Yellow-billed Cuckoo Coccyzus americanus Yellow-breasted Chat Icteria virens NOTE: The Yellow-billed Cuckoo is also discussed in the Deciduous Forest Interior Birds Guild. Contributors (2005): Elizabeth Ciuzio (KYDNR), Anna Huckabee Smith (NCWRC), and Dennis Forsythe (The Citadel) Reviewed and Edited: (2012) John Kilgo (USFS), Nick Wallover (SCDNR); (2013) Lisa Smith (SCDNR) and Anna Huckabee Smith (SCDNR) DESCRIPTION Taxonomy and Basic Description All bird species in this guild belong to the taxonomic order Passeriformes (perching birds) and they are grouped in 9 different families. The Blue-winged, Chestnut-sided, Golden-winged, and Prairie Warblers are in the family Parulidae (the wood warblers). The Eastern and Gray Kingbirds are in the flycatcher family, Tyrannidae. The Blue Grosbeak, Dickcissel, and Indigo Bunting are in the family Cardinalidae. The Bewick’s Wren is in the wren family, Troglodytidae. The orchard oriole belongs to the family Icteridae. The Brown Thrasher is in the family Mimidae, the Yellow-billed Cuckoo belongs to the family Cuculidae, the Eastern Towhee is in the family Emberizidae, and the White-eyed Vireo is in the family Vireonidae. All are small Blue-winged Warbler birds and can be distinguished by song, appearance, and habitat preference.
    [Show full text]
  • Wildland Fire in Ecosystems: Effects of Fire on Fauna
    United States Department of Agriculture Wildland Fire in Forest Service Rocky Mountain Ecosystems Research Station General Technical Report RMRS-GTR-42- volume 1 Effects of Fire on Fauna January 2000 Abstract _____________________________________ Smith, Jane Kapler, ed. 2000. Wildland fire in ecosystems: effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 83 p. Fires affect animals mainly through effects on their habitat. Fires often cause short-term increases in wildlife foods that contribute to increases in populations of some animals. These increases are moderated by the animals’ ability to thrive in the altered, often simplified, structure of the postfire environment. The extent of fire effects on animal communities generally depends on the extent of change in habitat structure and species composition caused by fire. Stand-replacement fires usually cause greater changes in the faunal communities of forests than in those of grasslands. Within forests, stand- replacement fires usually alter the animal community more dramatically than understory fires. Animal species are adapted to survive the pattern of fire frequency, season, size, severity, and uniformity that characterized their habitat in presettlement times. When fire frequency increases or decreases substantially or fire severity changes from presettlement patterns, habitat for many animal species declines. Keywords: fire effects, fire management, fire regime, habitat, succession, wildlife The volumes in “The Rainbow Series” will be published during the year 2000. To order, check the box or boxes below, fill in the address form, and send to the mailing address listed below.
    [Show full text]