Mirnas in Control of Oncogenic Signaling in Breast Cancer Cells

miRNAs in control of oncogenic signaling

in breast cancer cells

Von der Fakultät Energie-, Verfahrens- und Biotechnik der Universität Stuttgart zur Erlangung der Würde eines Doktors der Naturwissen- schaften (Dr. rer. nat.) genehmigte Abhandlung

Vorgelegt von

Annabell Bischoff aus Segnitz

Hauptberichter: Prof. Dr. Monilola Olayioye Mitberichter: Prof. Dr. Klaus Pfizenmaier

Tag der mündlichen Prüfung: 12.11.2014

Institut für Zellbiologie und Immunologie Universität Stuttgart 2014

Eidesstattliche Erklärung

Hiermit erkläre ich, Annabell Bischoff, dass ich die vorliegende Arbeit selbständig angefertigt habe. Es wurden nur die in der Arbeit ausdrücklich benannten Quellen und Hilfsmittel be- nutzt. Wörtlich oder sinngemäß übernommenes Gedankengut habe ich als solches kenntlich gemacht.

I hereby assure that I performed this work independently without further help or other materials than stated.

______

Datum, Ort Unterschrift

Table of content

Eidesstattliche Erklärung ...... 3 Table of content ...... 5 Abbreviations ...... 9 Abstract ...... 13 Zusammenfassung ...... 15 1 Introduction ...... 17 1.1 Breast Cancer ...... 17

1.2 Development of breast cancer ...... 17

1.3 ErbB receptors ...... 18

1.4 ErbB2-ErbB3 receptor dimer ...... 20

1.5 PI3K/Akt signaling ...... 22

1.6 Ras-ERK (Extracellular Signal Regulated Kinase) and PLCγ signaling ...... 25

1.7 Cell motility ...... 26

1.8 miRNAs ...... 27

1.8.1 miRNA biogenesis ...... 27 1.8.2 miRNA targeting ...... 28 1.8.3 Nomenclature of miRNAs ...... 29 1.8.4 miRNA target prediction ...... 30 1.8.5 miRNAs and their biological function ...... 31 1.8.6 miRNAs in cancer ...... 31 1.8.7 Aim of the thesis ...... 33 2 Materials and Methods ...... 35 2.1 Materials ...... 35

2.1.1 Equipment ...... 35 2.1.2 Chemicals and consumables ...... 36 2.1.3 Buffers and solutions ...... 37 2.1.4 Bacterial strain ...... 38 2.1.5 Cell lines, cell culture medium ...... 38 2.1.6 Animals ...... 39 2.1.7 Oligonucleotides ...... 39 2.1.8 Kits and enzymes ...... 42

2.2 Methods ...... 42

2.2.1 Cell culture ...... 42 2.2.2 Cell transfection ...... 43 2.2.3 Screening workflow ...... 43 2.2.4 In-Cell Western analysis (ICW) ...... 43 2.2.5 Plasmid Constructs – QuickChange Site directed PCR Mutagenesis ...... 44 2.2.6 Transformation of E.coli ...... 44 2.2.7 Purification of plasmid DNA (Mini-Prep) ...... 45 2.2.8 Preparation of plasmid DNA (Midi-Prep) ...... 45 2.2.9 Migration/Invasion (Transwell) Assay ...... 45 2.2.10 Impedance measurement ...... 45 2.2.11 Proliferation Assay ...... 46 2.2.12 Life cell imaging ...... 46 2.2.13 Luciferase Reporter Assay ...... 46 2.2.14 Rac activity assay...... 46 2.2.15 Quantitative Real Time PCR ...... 46 2.2.16 Cell lysis, SDS-PAGE and Western Blotting ...... 47 2.2.17 FACS analysis ...... 47 2.2.18 Immunofluorescence microscopy ...... 48 2.2.19 Animal experiment ...... 48 2.2.20 Target prediction analysis for miR-149 using KEGG...... 48 3 Results ...... 49 3.1 miRNA Screen ...... 49

3.1.1 Establishment of a screening procedure to monitor Akt activation upon HRG stimulation ...... 49 3.1.2 miR-149 serves as a positive control for the screen targeting the ErbB3 3’UTR 51 3.1.3 Genome-wide miRNA screening for regulators of HRG-induced Akt activation 54 3.1.4 Identification of a miRNA-ErbB interaction network...... 58 3.1.5 Expression of miR-148b, miR-149, miR-326 and miR-520a-3p reduces ErbB3- expression and affects Erk and Akt signaling ...... 61 3.1.6 Overexpression of miR-148b, miR-149, miR-326 and miR-520a-3p reduces the heregulin-driven proliferation...... 63 3.2 miR-149 in breast cancer ...... 65 6

3.2.1 Clinical data of miR-149 ...... 65 3.2.3 miR-149 expression affects cell adhesion and cell spreading ...... 67 3.2.5 miR-149 expression affects Rac activity ...... 71 3.2.6 miR-149 affects migration and invasion also in the prostate cancer cell line PC3 73 3.2.7 miR-149 expression in vivo model ...... 74 4 Discussion ...... 77 4.1 miRNA Screen ...... 77

4.1.1 Screening for miRNAs altering the ErbB/Akt pathway ...... 77 4.1.2 miRNAs alter heregulin-dependent Akt activation ...... 78 4.1.3 Protein target network of miRNAs negatively affecting ΔpAkt ...... 79 4.1.4 Protein target network of miRNAs enhancing ΔpAkt ...... 82 4.1.5 miRNAs regulate multiple targets within the ErbB/Akt pathway ...... 83 4.1.6 Clinical relevance of miR-148b, miR-149 miR-326, and miR-520a-3p ...... 84 4.2 miR-149 functions as a tumor suppressor by controlling breast epithelial cell migration and invasion ...... 85

4.2.1 miR-149 is a novel tumor suppressor in basal-like breast cancer ...... 85 4.2.2 miR-149 affects the activity of focal adhesion proteins and focal adhesion formation ...... 85 4.2.3 Overexpression of miR-149 reduces Rac activity and has anti-metastatic function in vitro and in vivo ...... 86 4.2.4 miR-149 downregulates the Rac effector proteins Rap1A, Rap1B and Vav2 ...87 4.2.5 Conclusions and outlook ...... 88 List of Figures ...... 89 List of Tables ...... 91 5 List of references ...... 93 6 Supplements ...... 107 6.1 mimic miRNA library ...... 107

6.2 Screen miRNA raw data ...... 112

6.3 Lists of computationally predicted miRNA targets ...... 124

Acknowledgements ...... 133 Curriculum vitae ...... 135

Abbreviations

% percent (per hundred) °C degree Celsius µg microgram µL microliter µm micrometer µM micromolar 2-ME 2-mercaptoethanol A adenosine aa amino acid Ab antibody Ago argonaute protein Akt/PKB protein kinase B AP alkaline phosphatase APS ammonium persulfate ATP adenosine triphosphate BH3 Bcl-2 homology domain 3 bp base pairs BSA bovine serum albumin C cytosine C. elegans caenorhabditis elegans ca catalytically active caspase cysteine-aspartic protease Cdc24 cell division control protein 42 homolog cDNA complementary deoxyribonucleic acid

CO2 carbon dioxide conc. concentration Cq quantification cycle DAG diacylglycerol DMEM Dulbecco's Modified Eagle Medium DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTP deoxynucleotide triphosphate DTT dithiothreitol E. coli escherichia coli e.g. for example (example given) ECL enhanced chemiluminescence EDTA ethylenediaminetetraacetic acid EGF epidermal growth factor eGFP enhanced green fluorescent protein EGFR epidermal growth factor receptor EMT epithelial mesenchymal transition ERK extracellular regulated kinase EtBr ethidium bromide Exp-5 exportin-5 FA focal adhesion FACS fluorescence activated cell sorting FAK focal adhesion kinase FAM 6-FAM (6-carboxyfluorescein)

FCS fetal calf serum FOXO forkhead transcription factors g gravitational acceleration G guanine GAP GTPase activating protein GAPDH glyceraldehyde 3-phosphate dehydrogenase GDI guanosine nucleotide dissociation inhibitors GDP guanosine diphosphate GEF guanine nucleotide exchange factor Grb2 growth factor receptor-bound protein-2 GTP guanosine triphosphate h hour HEK293 human embryonic kidney cells 293 HER2 human epidermal growth factor receptor 2 (ErbB2) HRG heregulin HRP horseradish peroxidase hsa homo sapiens hsa-miR homo sapiens microRNA IF Immunofluorescence kDa kilo Dalton LacZ beta-galactosidase gene in E. coli mA milliampere mAb monoclonal antibody MAPK mitogen-activated protein kinase max maximal MEK mitogen-activated protein kinase kinase (MAPKK) mg milligram min minute miR- mature miRNA miRISC microRNA induced silencing complex miRNA microRNA (ribonucleic acid) ml milliliter mM millimolar mRNA messenger ribonucleic acid mTOR mammalian target of rapamycin MW molecular weight n.s. non significant

Na3VO4 sodium orthovanadate NaDoc sodium deoxycholate NaF sodium fluoride ng nanogram nt nucleotide OD optical density ORF open reading frame PBS phosphate buffered saline PCR polymerase chain reaction PDK1 3-phosphoinositide-dependent protein kinase 1 PFA paraformaldehyde pH potential of hydrogen PI3K phosphoinositide 3-kinase PI4KIIIb phosphatidylinositol 4-kinase IIIb 10

PI4P phosphatidylinositol 4-phosphate

PIP2 phosphatidylinositol 4,5-bisphosphate

PIP3 phosphatidylinositol 3,4,5-trisphosphate PKC protein kinase C PLCγ phosphoinositide phospholipase C γ PMSF phenylmethylsulfonylfluorid pre-miRNA precursor microRNA pri-miRNA primary microRNA PTEN phosphatase and tensin homolog PVDF polyvinylidene difluoride qRT-PCR quantitative real time polymerase chain reaction Rho proteins Rho GTPase proteins (e.g. RhoA, Rac1 and Cdc42) RIPA radio immuno precipitation assay RISC RNA induced silencing complex RNA ribonucleic acid RNA pol II RNA polymerase II RNAi RNA interference RNase ribonuclease rpm rotations per minute RPMI Roswell Park Memorial Institute medium RT room temperature RTK receptor tyrosine kinase s second SDS sodium dodecyl sulfate SDS-PAGE SDS- polyacrylamide gel electrophoresis SEM standard error of the mean Ser serine siRNA small interfering RNA SOS son of Sevenless Src Src proto-oncogene tyrosine-protein kinase Src T thymine TAE tris-acetate-EDTA TEMED N,N,N',N'-Tetramethylethylendiamin Thr threonine TNBC triple-negative breast cancer Tris tris-(hydroxylmethyl)-amino methane Tyr tyrosine U uracil UTR untranslated region v/v volume/volume w/v weight/volume WB western blot

Abstract microRNAs (miRNAs) are 17-nt to 24-nt short non-coding RNAs that have emerged as critical regulators of gene expression in almost all forms of life. miRNAs act by partial complementary binding usually within the 3’-untranslated region (3’UTR) of the mRNA target resulting in translational repression and/or mRNA degradation. Microarray and proteomic experiments have demonstrated the impact of a single miRNA on fine-tuning expression of a hundred of targets affecting a multitude of biological processes such as development, proliferation and apoptosis. Deregulation of miRNA function is also implicated in various diseases including the development of cancer. Furthermore, recent miRNA profiling studies conducted on different tumor types have identified sets of miRNAs that have altered expression in tumor and normal tissue, making them attractive targets for therapeutic intervention or as diagnostic markers. Nevertheless, target identification and detailed knowledge of miRNA functions is the key for the correct selection of miRNAs causally involved in the specific disease process.

This thesis focuses especially on the role of miRNAs in two processes that are of major interest to breast cancer research; the ErbB2/ErbB3/Akt signaling pathway and cancer cell motility. Prolonged ErbB2/ErbB3/Akt signaling is frequently reported in various cancers and enables the cell to bypass targeting therapies as it favors cell survival. In the case of breast cancer, this is particularly achieved by increased ErbB2/ErbB3 receptor activation. In order to investigate the extent by which miRNAs modulate the ErbB receptor signaling pathway, we performed a genome-wide screen in the breast cancer cell line MCF7 based on Akt phosphorylation as a read-out. We identified 43 miRNAs that specifically regulate heregulin (HRG)-induced Akt activation, either positively or negatively, and revealed the complexity of coordinated miRNA-target interactions within the ErbB signaling pathway. We further validated four miRNAs, miR-149, miR-148b, miR-326, and miR-520a-3p, with potential tumor suppressive function as novel regulators of ErbB3 transcript and protein levels. But also the expression levels of other key components within the ErbB/Akt pathway were affected either on the protein or mRNA level, like Erk1/2 and PIK3CA. The selected miRNAs further efficiently blocked ErbB signaling and HRG-dependent proliferation, supporting their tumor-suppressive role. In the second part, we focused on the role of the screen hit miR-149 in regulating cancer cell motility, a process that is of pivotal importance for the formation of metastasis especially in later stages of breast cancer. Clinical data revealed that miR-149 is downregulated in various tumor types, including the basal-like breast cancer subtype. Using the basal-like MDA-MB-231 cell line as a model system and a combination of biochemical and cellular assays, we showed that miR-149 interfered with signaling downstream of integrin receptors at multiple levels, impairing Rac activation and efficiently blocking cell migration and invasion both in vitro and in vivo. Furthermore, Rap1a, Rap1b and Vav2 were identified as potential targets of miR-149. In addition, we confirmed the observed phenotype in other basal-like breast cancer cell lines, therefore providing evidence that miR-149 has broader tumor- suppressive function.

Taken together, this study demonstrates a new role for several miRNAs in regulating cancer- associated pathways and further broadens our knowledge of their functions. 13

Zusammenfassung microRNAs (miRNAs) sind 17 – 24 nt kurze, nicht-kodierende RNAs, welche einen wesentli- chen Beitrag zur Genregulation in nahezu allen Lebewesen ausüben. Durch die Anbindung an die entsprechende Ziel-mRNA können miRNAs entweder die mRNA Degradation imitie- ren oder die mRNA Translation reprimieren. Dabei erfolgt die Bindung über eine möglichst komplementäre Basenpaarung der miRNA mit der untranslatierten 3’-Region der Ziel-mRNA. Protein- und RNA-basierte Analysen haben gezeigt, dass eine miRNA die Expression von hunderten von Genen beeinflussen kann. Dementsprechend sind miRNAs auch in der Regu- lation von nahezu allen biologischen Prozessen involviert, wie zum Beispiel bei der Zellent- wicklung, der Proliferation und der Apoptose. Allerdings ist die Funktion einiger miRNAs auch eng mit verschiedenen Krankheiten wie Krebs verknüpft, und etliche Studien haben bereits deutlich veränderte Expressionsraten einiger miRNAs in den Expressionsprofilen von gesunden und kanzerogenen Geweben gezeigt. Dies veranschaulicht nicht zuletzt die hohe Relevanz von miRNAs für die Anwendung als Biomarker beziehungsweise für den Einsatz als Therapeutikum. Allerdings erfordert eine erfolgreiche klinische Anwendung von miRNAs die Identifikation relevanter Zielgene sowie eine detaillierte Aufklärung der biologischen Funktionen und beteiligten Prozesse.

Diese Arbeit beschäftigt sich mit der Rolle von miRNAs in zwei Prozessen, die wesentlich zur Entstehung von Brustkrebs beitragen. Dabei handelt es sich zum einen um den ErbB2/ErbB3/Akt-Signalweg und zum anderen um die Zellmotilität von Krebszellen. Eine er- höhte Aktivität des Akt-Signalwegs ist eng mit der Entstehung von therapieresistenten Krebszellen verbunden, da Akt das Überleben der Zellen unterstützt. In Brustkrebszellen wird dies häufig durch eine erhöhte Aktivität des ErbB2/ErbB3-Rezeptors hervorgerufen. Ba- sierend auf der heregulininduzierten Akt-Phosphorylierung wurde ein genomweiter miRNA- Screen in der luminalen Brustkrebszelllinie MCF7 durchgeführt. Dabei wurden 43 miRNAs identifiziert, welche signifikant die heregulininduzierte Akt-Phosphorylierung positiv oder negativ regulierten. Die bioinformatische Analyse lieferte einen ersten Hinweis auf das komple- xe Zusammenspiel der miRNA und deren potentieller Zielgene im ErbB-Signalweg, wobei für die vier ausgewählten miRNAs, miR-148b, miR-149, miR-326 und miR-520a-3p, die Negativ- Regulation von ErbB3 auf Transkript und Protein-Ebene experimentell bestätigt wurde. Aber auch andere Komponenten des ErbB-Signalweges, wie Erk1/2 oder PIK3CA, wiesen ein deutlich reduziertes Protein- oder mRNA Level auf. Die tumorsuppresiven Eigenschaften dieser miRNAs wurden ferner gestützt durch die verminderte Aktivität des ErbB-Signalweges und der inhibierten heregulinabhängigen Proliferation der MCF7-Brustkrebszellen.

Im zweiten Teil der Arbeit wurde vor allem die Rolle von miR-149 in der Regulation von Zell- motilität behandelt, welche ein entscheidender Faktor bei der Entstehung von Metastasen ist. Klinische Daten weisen eine deutliche Reduktion von miR-149 in verschiedenen Krebstypen auf, wobei in Brustkrebs die miR-149-Level vorwiegend im basalen Subtyp reduziert sind. Durch verschiedenste biologische und biochemische Experimente konnte gezeigt werden, dass miR-149 in Zelllinien des basalen Subtyps, wie MDA-MB-231, die Ausbildung und Akti- vität fokaler Adhäsionen hemmt, Rac-Aktivierung inhibiert, und Zellmigration und -invasion

deutlich reduziert, in vitro und in vivo. Als potentielle Zielgene konnten Rap1a, Rap1b und Vav2 identifiziert werden. Zudem konnte der beobachtete Phänotyp auch in weiteren Zellli- nien reproduziert werden, was nicht zuletzt auf eine konservierte und zelltypunabhängige Funktion von miR-149 als Tumorsuppressor hindeutet.

Zusammengefasst erweitert diese Arbeit die bisherigen Kenntnisse über die miRNA- vermittelte Regulation von brustkrebsrelevanten Signalwegen und liefert darüber hinaus neue Details über deren Zielgene.

1 Introduction

1.1 Breast Cancer

Cancer is a universal term for a wide group of diseases that can affect almost every part of the human body and is one of the leading causes of deaths worldwide, accounting for 8.2 million deaths in 2012 (World Health Organization). Overall, there are more than 100 different types of cancer, and each is categorized by the type of cell that is initially affected. Also the factors contributing to the development of cancer are very diverse, ranging from environmental influences, genetic alterations up to viral infections.

Among women, breast cancer is the most frequent type of cancer, with an estimated 1.67 million new cancer cases diagnosed in 2012, and accounts for approximately 25% of all cancers in women. But despite the fact that therapy prognoses are relatively good, breast cancer is still the second leading cause of cancer mortality in women (522,000 deaths in 2012) (World Health Organization). Like other cancers, breast cancer is a heterogeneous disease with diverse morphological and molecular features. Among parameters such as tumor size, histological grade, lymph node involvement, hormone receptor status and metastases formation it is currently classified into five main molecular classes: luminal A, luminal B, basal- like, ErbB2-positive and unclassified breast cancer subtypes. The basal-like subtype consti- tutes approximately 20% of all breast cancers and is also referred to as triple-negative breast cancer because it frequently lacks expression of estrogen, progesterone and ErbB2/HER2 receptors. While the presence of estrogen and progesterone receptors allows a better clinical prognosis, as those cancers respond to hormone therapy, the basal-like and ErbB2-positive subtypes are more aggressive and are characterized by a higher risk of early relapse and a higher metastatic potential (Patel et al., 2007; Sørlie, 2007; Nishimura and Arima, 2008). De- pendent on the cancer subtype and the state of disease progression, cancer treatment comprises one or the combination of the following options: surgery, radiation, chemotherapy, im- munotherapy, hormone therapy and gene therapy. Nevertheless the prerequisite for successful treatment is the detection of cancer in early stages and furthermore a profound understanding of the underlying molecular mechanisms to refine therapeutic strategies. In this context, the field of miRNAs is of increasing interest as miRNAs function as key regulators of gene expression and are frequently subject to change during the development of human diseases, including cancer. Consequently, they have led to the discovery of a completely new repertoire of promising tools for diagnostic and therapeutic purposes.

1.2 Development of breast cancer

Breast cancer development is a complex multistep process which is usually initiated by un- controlled cell growth followed by sustained cell survival, extravasation of primary tumor cells, infiltration of new tissue, and finally the formation of secondary tumors (metastases) in distant parts of the body (Figure 1).

Figure 1: Cancer development. The general steps involved in cancer progression are increased cell proliferation, sustained survival, extravasation, invasion, and infiltration of other parts of the human body resulting in the formation of metastases. The figure is reproduced from “What is Cancer?” (What is Cancer?, 2012).

In healthy tissue, cell growth and tissue homeostasis is strictly controlled and furthermore, cells are conditioned to commit suicide (apoptosis) if proper cell function is no longer guaranteed. This protective system is made up of various intracellular and extracellular signaling check-points (Kastan and Bartek, 2004; Collado et al., 2007). To overcome these protective systems, cells have to accumulate various genetic alterations, resulting in the loss of tumor suppressor activity and/or an increase in oncogenic processes. Signaling processes frequently associated with sustained survival and an enhanced proliferation of cancer cells are the PI3K/Akt pathway and the RAS/MEK/ERK pathway (Cantley and Neel, 1999; Vivanco and Sawyers, 2002). Deregulation of these pathways is reported on multiple levels such as the hyperactivation or overexpression of upstream effectors such as growth factor receptors, the loss of negative regulators like PTEN or activating mutations of members within the pathway, as it is reported for Ras (Cantley and Neel, 1999; Downward, 2003). Consequently, cells grow beyond their normal border limits and sooner or later cells acquire the capacity to escape from their usual environment, a process referred to as epithelial-mesenchymal transition (EMT), in which cells lose their polarity and their cell-cell adhesion and gain migratory and invasive properties. This is the driver for the development of metastasis, a process that accounts for approximately 90% of all cancer-related deaths (Parkin et al., 2005; Fantozzi and Christofori, 2006).

1.3 ErbB receptors

The ErbB (Erythroblastic Leukemia Viral Oncogene Homolog) family of transmembrane receptor tyrosine kinases plays an important role in the pathogenesis of many cancers and is one of the main targets of anticancer therapy. Members of the ErbB family contribute to a wide range of cellular signaling processes including proliferation, apoptosis, survival and differentiation. The ErbB (also known as HER) family consists of four structurally related type 1

receptor tyrosine kinases (RTK): epidermal growth factor receptor (EGFR; also known as Her1 or ErbB1), ErbB2 (Her2), ErbB3 (Her3) and ErbB4 (Her4) (Figure 2).

Figure 2: ErbB receptor family. (A) Structure of the four members of the ErbB receptor family. Each receptor has an extracellular domain for ligand binding, an α-helical transmembrane domain and an intracellular domain comprising the tyrosine kinase activity and binding motifs for the interaction with intracellular signaling molecules (Olayioye et al., 2000). In the absence of an external ligand, EGFR, ErbB3 and ErbB4 exist in a closed (tethered) conformation where the dimerization domain is hidden and therefore not accessible for the interaction with the other receptors. ErbB2 is always in an active (open) position and therefore permanently available for dimerization. Furthermore, while ErbB2 has no known external ligand, ErbB3 has an impaired intracellular kinase domain (Burgess et al., 2003). (B) Mechanism of receptor activation. Ligand binding induces a conformational change, thereby exposing the dimerization domain which is now available for dimerization. After the formation of a receptor dimer, the intracellular domains are transphosphorylated and activated. The figure is reproduced from Baselga and Swain (Baselga and Swain, 2009).

The four ErbB receptors are composed of an extracellular ligand binding domain, an α-helical transmembrane domain and an intracellular domain which contains the protein tyrosine kinase and further phosphotyrosine binding motifs for intracellular signaling molecules (Olayioye et al., 2000). In the absence of an external ligand, EGFR, ErbB3 and ErbB4 exist

in a closed (tethered) conformation where its external dimerization domain is hidden to pre- vent dimerization. Ligand binding induces a conformational change unveiling its dimerization domain and making it accessible for the interaction with other active ErbB receptors. By contrast, ErbB2 always exists in an open (extended) conformation and is permanently available for dimerization and is thus the preferred interaction partner for the other ErbB receptors. Nevertheless, ErbB2 lacks an external ligand. Therefore, homodimerization is very unlikely and happens only upon an unphysiologically high overexpression of ErbB2. After the formation of a dimer, the intracellular domains are in close proximity leading to the transphosphorylation and activation of each tyrosine kinase. ErbB3 has an impaired kinase domain lacking catalytic function and thus can only be phosphorylated within a heterodimeric complex (Burgess et al., 2003; Berger et al., 2004; Hynes and Lane, 2005). The activation of the kinase initiates further phosphorylation events in the intracellular domain of the receptors. This triggers the recruitment and activation of downstream proteins which initiate further downstream signaling cascades (Olayioye et al., 2000). Major signaling pathways activated by ErbB receptors include the phosphatidylinositol 3-kinase/Akt (PKB) pathway, the Ras/Raf/MEK/ERK1/2 pathway, and the phospholipase C γ (PLCγ) pathway, which stimulate cellular responses such as survival, proliferation, and migration. The identities of the activated downstream pathways are dependent on the ligand itself and the individual dimer partners due to their ability to bind distinct effector proteins (Baselga and Swain, 2009). The expression levels of the ErbB receptors are dynamically regulated via transcriptional and translational mechanisms, whereas the amplitude of ErbB signaling is determined by the amount of the ligand and by the abundance of proximal ErbB receptors. Additionally, signaling duration is regulated by the engagement of positive and negative effectors mediating membrane localization, protein stabilization and protein dephosphorylation (Fry et al., 2009). In this context the family of cytohesins are reported to function as conformational activators, facilitating the formation of EGFR dimers after ligand binding, while negative effectors, such as Nrdp1 or LRIG-1 increase the ubiquitination of the receptors leading to enhanced proteasomal degradation (Fry et al., 2009; Bill et al., 2010).

1.4 ErbB2-ErbB3 receptor dimer

Among all signaling dimers, the ErbB2-ErbB3 heterodimer is considered as the most potent signaling complex in terms of cell growth and transformation. This might be surprising at first sight as ErbB2 lacks an external ligand and ErbB3, on the other hand, has an impaired kinase domain. But upon the activation of ErbB3 by the binding of neuregulin ligands such as heregulin β-1 (HRG), it can readily dimerize with its preferred partner ErbB2 (Campbell et al., 2010). Heterodimerization with the catalytically active ErbB2 permits the tyrosine phosphorylation of several docking sites within the carboxyterminal domain of each partner, which facili- tates the recruitment of different signaling molecules (Songyang et al., 1993) (Figure 3). The main downstream pathway includes the PI3K/Akt pathway and the Ras/Raf/MEK/ERK1/2 mediating diverse biological processes including proliferation and survival. The PI3K/Akt pathway is mainly mediated by ErbB3, which harbors six binding motifs for the regulatory subunit (p85) of PI3K in its carboxyterminal domain. Although of minor importance, activation 20

of the PI3K/Akt pathway can also be mediated through the adaptor protein Grb2 which is present in both receptors (further information is provided in section 1.5). Both ErbB2 and ErbB3 contribute to the activation of the MAPK pathway as they both have docking sites for the adapter proteins Grb2 and Shc. Binding of these adaptors to the receptors activates the Ras/Ref/MEK/ERK1/2 signaling module (detailed information is provided in section 1.6).

Figure 3: Signaling downstream of the ErbB2-ErbB3 dimer. (A) Depicted is the carboxyterminal part of the receptors including the tyrosine phosphorylation sites and the corresponding binding molecules. Residue numbers correspond to the nascent protein including the signal peptides. The figure is reproduced from Wilson et al. (Wilson et al., 2009). (B) Main downstream modules of the ErbB2-ErbB3 receptor dimer. GRB2, Shc and regulatory subunit (p85) of PI3K bind to their phosphorylated tyrosine consensus site residues within the carboxyterminal parts of the receptors initializing the Ras/Ref/MEK/ERK1/2 and PI3K/Akt signaling cascades. The figure is reproduced from Baselga and Swain (Baselga and Swain, 2009).

Many studies have revealed that the mitogenic potential of the ErbB2-ErbB3 dimer is particularly caused by the very potent direct interaction of ErbB3 and phosphoinositide 3-kinase (PI3K). Furthermore, PI3K signaling is critical for ErbB3-driven breast cancer cell motility and metastasis. Deleting the direct binding of the p85 subunit of PI3K to the receptor by mutating the tyrosine residues decreased tumor cell motility and metastic burden in vivo (Smirnova et al., 2012). Furthermore, it has been shown that ErbB2 overexpression alone is insufficient to promote cell growth of breast cancer cells. For proper proliferation, additional signaling of ErbB3 is required as it couples active ErbB2 to the PI3K signaling (Holbro et al., 2003). Moreover, while aberrant ErbB2 function can be successfully blocked by the use of monoclonal antibodies such as Herceptin/Trastuzumab targeting the extracellular part of ErbB2, a certain number of tumors eventually become resistant to this treatment (Roskoski, 2014).

The acquired resistance to targeting therapies in ErbB2 overexpressing breast cancers can be partially attributed to the PI3K pathway by the activation of ErbB3 (Fiddes et al., 1998). Furthermore, although the ErbB3 gene is rarely amplified in human cancers, ErbB2 overexpression, which is usually caused by gene amplification, is frequently associated with the upregulation of ErbB3 protein levels (Slamon et al., 1987; DiGiovanna et al., 2002; Sithanandam and Anderson, 2008). This upregulation of ErbB3 might be a mechanism to compensate for the inhibition of the other family members (Sergina et al., 2007). For example, the ErbB3-dependent activation of the Ras/Raf/MEK/Erk and PI3K-Akt pathways has also been implicated in the development of Gefitinib resistance in non-small-lung carcino- mas, which are driven by activating EGFR mutations. In these cells, elevated ErbB3 signaling was caused by an amplification of the Met receptor tyrosine kinase which promotes the activation of the ErbB3 pathway (Engelman et al., 2007). Beside ErbB3 upregulation, overexpression of its ligand heregulin was also reported to increase tumorigenicity and metastasis whereas blocking heregulin expression reversed these effects (Atlas et al., 2003). Due to the fact that ErbB3 has a key role in driving oncogenic proliferation and survival in several human tumors, it is of special interest for the use of targeting therapies. MM-121, a therapeutic anti-ErbB3 antibody, was shown to block ligand-dependent activation of ErbB3 and using a lung cancer mouse model with an activating EGFR mutation resistant to cetuximab, an antagonistic anti-EGFR antibody, concomitant cetuximab treatment with MM-121 blocked reactivation of ErbB3 and resulted in a sustained and durable response (Schoeberl et al., 2010).

1.5 PI3K/Akt signaling

The key player of the PI3K/Akt signaling pathway is the serine/threonine kinase Akt, also known as protein kinase B (PKB). Since its discovery as an oncogene, Akt has gained great attention because of its impact on cancer cell growth, survival, motility and metabolism. The family of Akt proteins consists of three highly homologous isoforms: Akt1, Akt2, and Akt3. These isoforms differ slightly in their tissue-specific expression, their substrate specificity and their localization. While Akt1 and Akt2 are the predominantly expressed isoforms, Akt3 is usually expressed at the lowest level and is absent in several tissues. Furthermore, Akt1 was reported to be primarily localized in the cytoplasm, Akt2 was colocalized with the mitochon- dria and Akt3 in the nucleus (Santi and Lee, 2010). This distinct localization may also contribute to their slightly different target spectrum. Nevertheless it was shown that these isoforms are able to partly compensate for each other, as the single knockout of Akt members in mice resulted in a rather mild but viable phenotype. While Akt1 deficient mice showed growth retardation of all organs and increased apoptosis (Chen et al., 2001), knockout of Akt2 was accompanied by insulin resistance (Cho et al., 2001), and mice lacking Akt3 expression exhibited a selective decrease in brain size (Easton et al., 2005). Furthermore it was shown that Akt1 is probably the most essential isoform within the family as the Akt1/Akt2 and Akt1/Akt3 double-knockout were lethal (Peng et al., 2003; Yang et al., 2005), whereas mice lacking Akt2/Akt3 expression were viable (Dummler et al., 2006). Furthermore, elevated Akt levels or Akt activity have been reported in a variety of human cancers. For instance, 22

Akt1 is reported to be involved in tumor growth, invasion and chemoresistance, Akt2 is related to invasion and survival, while Akt3 is implicated in tumor growth and drug resistance (Fortier et al., 2011).

Figure 4: PI3K/Akt signaling pathway. Activated receptor tyrosine kinases (RTKs), like growth factor receptors, activate class I phosphatidylinositol 3-kinase (PI3K) through direct binding or through tyrosine phosphorylation of scaffolding adaptors which then bind and activate PI3K. Active PI3K catalyzes the phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) to phosphatidylinositol 3,4,5- trisphosphate (PIP3). Direct binding of PIP3 recruits Akt and PDK1 to the plasma membrane where Akt is phosphorylated on T308 by PDK1 and on S473 by mTOR complex 2 (mTORC2). Termination of the signaling cascade is mediated by PTEN by dephosphorylation of PIP3, and by PHLPP mediated dephosphorylation of Akt on S473. After its activation, Akt translocates to different subcellular compartments where it triggers the phosphorylation of its substrates. Akt activates mTORC1 indirectly starting with the multisite phosphorylation of the TSC1-TSC2 complex. This blocks the ability of TSC2 to inhibit Rheb, thereby allowing Rheb-GTP to accumulate. Rheb-GTP activates mTORC1 which phosphorylates its downstream target 4E-BP1 and S6 kinases (S6K). Among the other targets of Akt are many transcription factors and kinases contributing to survival, growth, proliferation, glucose up- take, metabolism, and angiogenesis (Courtney et al., 2010; Manning and Cantley, 2007). The figure is reproduced from Baselga and Swain (Baselga and Swain, 2009).

Akt signaling can be activated by an extremely versatile spectrum of different stimuli including receptor tyrosine kinases, integrins, B and T cell receptors, cytokine receptors, G-protein- coupled receptors and many others. The initial step of pathway activation is the production of phosphatidylinositol 3,4,5-trisphosphate (PIP3) by phosphoinositide 3-kinase (PI3K) and in the case of receptor tyrosine kinase activation this is mediated by class IA phosphoinositide 3-kinase (PI3K) (Figure 4) (Manning and Cantley, 2007). Class IA PI3Ks are composed of a p110 catalytic and a p85 regulatory subunit. These subunits exist as different isoforms en-

coded by the genes PIK3CA/p110α, PIK3CB/p110β, PK3CD/p110δ for the catalytic subunit and by PIK3R1/p85α, PIK3R2CB/p85β, PK3R3/p85γ for the regulatory subunit. The regulatory p85 subunit binds to the phosphotyrosine consensus sites on the RTK or its adaptor proteins. This results in the allosteric activation of the p110 catalytic subunit which then catalyzes the phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) to form phosphatidylinositol 3,4,5-trisphosphate (PIP3) (Zhao and Vogt, 2008). Furthermore, PI3K activity can also be stimulated by activated Ras or by G-protein coupled receptors which directly bind the p110 subunit (Shaw and Cantley, 2006). The lipid phosphates PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) can revert PI3K activity by the hydrolysis of

PIP3, thereby terminating the signal cascade. The membrane-bound PIP3 serves as a docking site for Akt and Phosphoinositide-Dependent Protein Kinase-1 (PDK1). Both proteins bind to the lipid by their pleckstrin-homology (PH) domain, recruiting them to the plasma membrane where PDK1 phosphorylates Akt in its activation loop at T308. Mammalian target of rapamycin complex 2 (mTORC2) fully activates Akt by the phosphorylation of S473 which can be reverted by the phosphatase PHLPP (Cantley and Neel, 1999; Manning and Cantley, 2007). The bi-phosphorylated, fully active Akt then translocates to the different subcellular compartments where it phosphorylates its substrates, resulting in various downstream effects.

Among the targets are many components regulating cell-cycle, survival or apoptosis. Akt promotes survival by the functional inhibition of the proapoptotic Bcl-2 family members BAD and BAX which bind and inactivate prosurvival Bcl-2 family members (Engelman et al., 2006). Akt also blocks cell cycle arrest by the inhibition of forkhead transcription factors (FOXO) which mediate the expression of Bcl-2 homology domain 3 (BH3)-only proteins. An- other important downstream effector molecule of Akt is Mdm2 which antagonizes p53- mediated apoptosis and Akt also impedes the negative regulation of the transcription factor NF-κB to enhance the transcription of antiapoptotic and prosurvival genes (Duronio, 2008). The role of Akt in promoting cell growth is predominantly mediated through its effect on mTOR complex 1 (mTORC1) which is a critical regulator of protein biosynthesis. Akt activates mTORC1 indirectly by inhibiting TSC2, thereby allowing Rheb-GTP to activate mTORC1 signaling (Manning and Cantley, 2007). mTORC1 then triggers downstream signaling via phosphorylation of its effector molecules eukaryotic initiation factor 4E (eIF4E)- binding protein 1 (4E-BP1) and the ribosomal protein S6 kinase (S6K1). S6K acts in a feedback mechanism as it can phosphorylate the adaptor protein insulin receptor substrate 1, thereby inhibiting insulin-like growth factor 1–mediated PI3K activation. Moreover, activation of mTORC1 also contributes to an enhanced cell proliferation, which is also mediated by the phosphorylation and inactivation of p27Kip1 cyclin-dependent kinase inhibitor (Liang et al., 2002).

The PI3K/Akt signaling is activated in a wide range of human cancers via several mechanisms. Beside the aberrant activation of an upstream receptor pathway, loss of PTEN activity resulting in enhanced PIP3 levels is a common mechanism for increased Akt signaling. Loss of PTEN is caused by genetic loss-of-function mutations, epigenetic alterations or promoter hypermethylation, respectively (Cantley and Neel, 1999; Vivanco and Sawyers, 2002). Fur-

thermore, mutational activation or amplification of the genes encoding key components of the PI3K pathway is also reported. For example, the genes encoding the catalytic p110α and the regulatory p85 subunit of class IA PI3K, PIK3CA and PIK3R1, are frequently implicated to carry somatic mutations in human cancer (Philp et al., 2001; Mizoguchi et al., 2004; Samuels and Velculescu, 2004; Ikenoue et al., 2005; Yuan and Cantley, 2008). Mutations are also reported within the genes of the Akt family. A mutation within the PH domain of Akt1 leads to its constitutive membrane localization also in the absence of PIP3 (Carpten et al., 2007). Be- cause genomic aberrations can predict responsiveness to targeted therapies, and because multiple PI3K pathway members are frequently aberrant in breast tumors, targeting this pathway may provide a highly effective therapeutic approach (Samuels et al., 2004; Hen- nessy et al., 2005).

1.6 Ras-ERK (Extracellular Signal Regulated Kinase) and PLCγ signaling

Beside the PI3K/Akt pathway, the Ras/Raf/MEK/ERK1/2 and PLCγ pathways are two other major pathways activated by the ErbB2-ErbB3 mediated signaling.

Mitogen-Activated Protein Kinases (MAPKs) are Ser/Thr kinases and are among the best- studied signal transduction components. In mammals, 14 different MAPKs have been identified and downstream signaling of ErbB2-ErbB3 is mainly mediated by MAPK1/2, also called Erk1/2. The Erk1/2 pathway is initiated by the adaptor proteins GRB2 (Growth Factor Recep- tor-Bound Protein-2) or SHC which bind to phosphotyrosine consensus sites within the ErbB receptors. GRB2 is then recognized by the guanine exchange factor SOS (Son of Sevenless), which is recruited from the cytosol to the plasma membrane where it activates Ras by stimulating the exchange of GDP to GTP. Active-GTP-bound Ras then activates Raf which then in turn stimulates the dual-specificity kinases MEK1/2 and finally, MEK1/2 phosphorylates Erk1/2. Active Erk1/2 phosphorylates several substrates, like the cytoplasmic ribosomal S6 kinase (RSK) family or members of the cytoskeleton. Furthermore, Erk1/2 also translocates to the nucleus, where it activates a number of transcription factors, including Elk1, c-Fos, c-Jun, STAT3, and the oncogenic c-Myc, known to have oncogenic potential driving proliferation (Cargnello and Roux, 2011; Roskoski, 2012). ErbB1, ErbB2, and ErbB4 possess several potential PLCγ phosphotyrosine binding sites (Wilson et al., 2009). After its activation, PLCγ catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to form inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Kadamur and Ross, 2013). IP3 triggers the release of Ca2+ from the endoplasmatic reticulum and together with DAG activates the protein-serine/threonine kinase C (PKC). The target spectrum of PKC, contributing to gene transcription, angiogenesis, cell proliferation, cell death, but also to migration and adhesion, is very diverse. Interestingly, PKC can activate the Raf/MEK/ERK1/2 pathway, thereby circumventing the involvement of Ras kinase (Basu and Sivaprasad, 2007; Roskoski, 2012).

1.7 Cell motility

Cell motility plays a key role in many physiological processes including embryogenesis, differentiation and immune response, but also in pathological processes like cancer cell migration and invasion (Le Clainche and Carlier, 2008; Petrie et al., 2009). Cell motility is a highly complex process constantly integrating and coordinating various biochemical and biome- chanical signals. It requires the coordinated remodeling of the cytoskeleton and the regulation of membrane dynamics as these factors are the major determinants for cell shape and motility (Le Clainche and Carlier, 2008). In general, cell motility can be subdivided into different inter-connected cellular processes, including adhesion, spreading, migration and invasion, with each process being characterized by a distinct set of proteins and molecules. Cell adhesions are of special importance here as they anchor the cells to the surrounding ECM and generate the traction force necessary for cell movement. They also act as important inside-out signaling nodes as they transmit information about matrix composition, rigidity and topography inside the cells (Geiger et al., 2009). These focal adhesions are multiprotein complexes consisting of ~160 different components, including scaffolding proteins and enzymes regulating the activity of the focal adhesion components (Zaidel-Bar et al., 2007; Gei- ger et al., 2009). Especially during migration processes these focal adhesions undergo per- manent turnover with a constant formation of new adhesions at the cell front and a release of adhesions at the cell rear pushing the cell forward. This multistep process begins at the front where cells initially scan the ECM by the lamellipodium, a small membrane protrusion which is enriched with a branched network of actin filaments generated by the (Arp2/3) complex (Small et al., 2002). The predominant class of transmembrane proteins recognizing and con- necting the ECM with the cytoskeleton are integrins, which are dimeric proteins composed of an α and a β subunit (Geiger et al., 2009). These subunits exist in different isoforms and their identity within the dimer is matrix-dependent. Fixing the cells and establishing a traction point for cell migration, cells locally recruit proteins to these focal contact sites, leading to the formation of several short-lived nascent adhesions, which mature into larger focal adhesions and finally become large and prominent mature focal adhesions. The initial steps of focal adhesion assembly requires proteins like talin, integrin-linked-kinase (ILK), tensin, and integrin-binding proteins (kindlins) which are essential for the conformational activation of the integrins and provide a first link to the actin-filaments (Nayal et al., 2004; Geiger et al., 2009). Integrin engagement also triggers the activation of the focal adhesion-linked protein kinases Src and FAK, which then recruit additional components and activate downstream pathways (Geiger et al., 2009; Eleniste and Bruzzaniti, 2012; Ross et al., 2012). Further strengthening of the focal adhesions requires the scaffolding protein vinculin, which is recruited to talin and induces the clustering of the integrin dimers (Humphries et al., 2007; Le Clainche and Carlier, 2008; Geiger et al., 2009). During the maturation process, focal adhesions increase their length and thickness. A hallmark for the mature focal adhesions is the presence of stress fibers, actin-filament bundles containing filamentous actin, α-actinin and myosin II. These stress fibers are the driver for cell contractility and migration (Geiger et al., 2009). The integrity of cell adhesion, spreading and migration is guaranteed by the coordinated activity of a wide range of regulatory proteins controlling the spatiotemporal activation and inactiva-

tion of small Rho-family GTPases, like Cdc42, Rac, and Rho. These small GTPases cycle between an active GTP-bound state and an inactive GDP-bound state and their activity is controlled by three classes of proteins; guanine nucleotide dissociation inhibitors (GDIs), guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs) (Petrie et al., 2009). Local activation of Cdc42 and Rac is necessary for the formation of nascent adhesions as they are required for cell polarization and the formation of membrane exten- sions including the lamellipodium. In contrast, Rho is predominantly involved in cell migration, promoting the adhesion maturation at the leading edge and adhesion disassembly at the rear of the cell (Ridley, 2001; Raftopoulou and Hall, 2004).

1.8 miRNAs microRNAs (miRNAs) are a class of endogenous small non-coding RNAs of approximately 17 to 24 nucleotides that act as key regulators of gene expression and their discovery in 1993 by Ambros et al. has uncovered a new mechanism of gene regulation at the post- transcriptional level. Ambros and Lee et al. described a 22-nucleotide long RNA encoded by the lin-4 gene that interferes with the expression of the lin-14 transcript in C. elegans, thereby contributing to the postembryonic development (Lee et al., 1993). In the beginning, it was assumed that this mechanism of gene regulation was specific for nematodes until seven years later Pasquinelli identified let-7, a miRNA that was conserved in many species, including vertebrates, suggesting that gene regulation by RNA interference is a widespread phe- nomenon (Pasquinelli et al., 2000). Finally, in 2001, the term miRNA was formally introduced and since then the field of miRNA research has expanded tremendously. Currently, according to the miRBASE database, a searchable database of published miRNA sequences and annotations, 2578 mature miRNAs are encoded within the human genome [Release 20: June 2013], which theoretically target more than one third of the protein-coding genes (Esteller, 2011). Moreover, there is increasing evidence that altered miRNA expression is strongly associated with the development of several diseases. Consequently, miRNAs represent a promising field for basic research, biomarker discovery, and therapeutic application.

1.8.1 miRNA biogenesis The biogenesis of miRNAs is a multi-step process starting in the nucleus where miRNAs are encoded by the genome either as single genes or as a cluster of several miRNAs which are processed as a unique transcript and are therefore often co-regulated (Rodriguez et al., 2004). Furthermore, several miRNAs, so called mirtrons, are found to be located in the intronic sequences of protein coding genes and are co-expressed with their host genes.

Transcription of miRNAs is carried out by the polymerase machinery, starting with the generation of a capped and polyadenylated primary miRNA (pri-miRNA) by RNA polymerase II. The pri-miRNA is about hundreds to thousands nucleotides in length and its characteristic hairpin stem-loop structure is recognized by the microprocessor complex composed of the RNase type III enzyme Drosha and the double stranded RNA-binding protein DGCR8 (DiGeorge syndrome critical region 8). Drosha excises the hairpin structures, resulting in the 27

generation of a precursor-miRNA (pre-miRNA) composed of the characteristic 22-bp stem, a loop, and a 2-nucleotide overhang at the 3’end. This pre-miRNA is then exported to the cytoplasm by exportin-5 in a Ran-GTP dependent manner and is further cleaved by the RNase III enzyme Dicer into a double-stranded miRNA-miRNA* duplex. After the separation of this duplex by a helicase, the mature strand (miRNA) is taken up into the Argonaute (Ago)- containing miRNA-induced silencing complex (RISC), whereas the other strand (miRNA*) is degraded. The mature miRNA within miRISC serves as a guide for recognizing target mRNAs by partial base-pairing, which leads to a block of the translation of the mRNA target and/or its degradation (Figure 5) (Berezikov, 2011; Esteller, 2011).

Figure 5: Biogenesis of miRNAs. miRNAs are initially transcribed as primary-miRNA (pri-miRNA) either as single units or as a cluster of several miRNAs by RNA polymerase II. Then the pri-miRNA is further processed by the microprocessor complex Drosha-DGCR8 into a precursor miRNA (pre- miRNA), which is then exported to the cytosol by exportin-5 in a Ran-GTP dependant manner. In the cytosol the pre-miRNA is further cleaved by Dicer into a double-stranded miRNA-miRNA* duplex structure. After unwinding the mature miRNA strand it is loaded into the Argonaute (Ago)-containing RNA-induced silencing complex (RISC). Within this complex the miRNA interacts with the 3’ untranslated region (3’UTR) of target mRNA via complementary base-pairing. Depending in the degree of complementarity this initiates either mRNA degradation or translational repression (Berezikov, 2011; Esteller, 2011). ORF (open reading frame). The figure is reproduced from (He and Hannon, 2004).

1.8.2 miRNA targeting miRNA target recognition involves base-pairing between the miRNA and the mRNA strand. It is hypothesized that depending on the degree of complementarity this results either in translational repression or mRNA cleavage and degradation. In animals, mRNA targeting is mainly mediated by the 5’end of the miRNA strand. Mutational profiles have revealed that espe- 28

cially the nucleotides 2 to 8 contribute to the sequence-specific binding of the 3’ untranslated region (3’ UTR) of the target mRNA (Bartel, 2009). This conserved region is also referred to as seed region and as this sequence is relatively short, a miRNA is able to target multiple mRNAs, thereby regulating entire gene networks. Furthermore, many miRNAs share the same seed sequence and are grouped into families and members of one seed family have a largely overlapping target spectrum (Bartel, 2009). Based on sequence information, 30% of all human miRNAs can be grouped into such seed families (Ambros et al., 2003). But seed matching alone is not an absolute prerequisite for efficient mRNA targeting as other nucleotides of the miRNA are known to be involved, too. Furthermore, these additional interactions can also compensate for a mismatch within the seed region and are schematically presented in Figure 6 (Grimson et al., 2007; Bartel, 2009). Another important aspect of stable binding is the local context of the mRNA target itself. Parameters such as the relative proximity of the miRNA binding site to the 3’UTR end or also the A and U content influence the efficiency of gene regulation. Finally, multiple binding of miRNAs in close proximity within the 3’UTR seems to enhance the degree of downregulation in a synergistic way (Bartel, 2009). This is either mediated by binding of identical or different miRNAs.

Figure 6: miRNA-mRNA interaction. Schematical presentation of the different interaction sites between miRNA and mRNA contributing to efficient targeting. Perfect base-pairing of the seed region (red), comprising nucleotide 2-8, predominately contributes to efficient mRNA targeting. The presence of an adenosine at the opposite position of base 1 of the miRNA is thought to be recognized by RISC and improves the degree of silencing. Consecutive base pairing of additional 3-4 nucleotides at position 13-16 of the miRNA enhances the target efficiency and may compensate for a mismatch in the seed region.

1.8.3 Nomenclature of miRNAs Classification of the mature miRNA follows a common nomenclature which was stated by Ambros et al. in 2003, exemplified here for hsa-miR-121 (Ambros et al., 2003). The first three letters of a miRNA refer to the organism, “hsa-“ for homo sapiens followed by the numbering of the miRNA, which is simply sequential corresponding to its discovery. The mature miRNA is designated as miR-121, while the gene or the primary stem-loop transcript is designated as miR-121. Identical mature sequences originated from different genomic loci are marked by an additional number, for example hsa-miR-121-1 and hsa-miR-121-2, while closely related mature sequences are denoted by a letter, for example hsa-miR-121a and hsa-miR-121b. If two mature miRNAs are produced from the stem loop structure, this is indicated by a suffix; miR-121-5p (from the 5’ arm) and miR-121-3p (from the 3’ arm). Furthermore, when the relative abundance clearly indicates which is the predominantly expressed miRNA, the mature 29

sequences are assigned miR-121 (the predominant product) and miR-121* (from the opposite arm of the precursor). let-7 and lin-4 are obvious exceptions to the numbering scheme, and these names are retained for historical reasons (Ambros et al., 2003).

1.8.4 miRNA target prediction Because of the high complexity of miRNA biogenesis, miRNA-target interactions as well as the immense amount of data received from high through-put sequencing screenings, bioinformatic approaches are pivotal for precise miRNA identification and target prediction. Most of the databases providing sequence information and target predictions are web-based tools and algorithms. The largest web-accessible database is the miRBase which lists all discovered miRNAs and provides additional information including their secondary structure and their precursor sequences. So far, numerous computational algorithms have been designed to predict miRNA-mRNA interactions based on the biological features of miRNAs, e.g. Watson-Crick base pairing, hairpin structure, conservation between different species or RNA conformation. An overview of commonly used target prediction algorithms is given in Table 1.

Table 1: List of commonly used target prediction algorithms. Prediction algorithm Parameters contributing to the final score miRanda . complementarity to 3’UTR . binding energy of the duplex structure . evolutionary conservation of the target site . position within the 3’UTR TargetScan . seed match . 3’ complementarity . local AU content . position contribution: proximity to 3’UTR ends . conservation PicTar . complementarity to 3’UTR . binding energy of the duplex structure . conservation DIANA-microT . complementarity to 3’UTR . binding energy of the duplex structure PITA . target site accessibility defined by secondary structure of the 3’UTR . binding energy of the duplex structure Rna22 . pattern recognition and folding energy

Nevertheless, these prediction algorithms still yield many false positive targets and furthermore, since the prediction algorithms differ in certain parameters, they do not always yield identical target lists. Therefore, the comparison of several target lists may be useful to narrow down the predicted list in order to obtain higher confidence targets. This is provided, for example, by the miRecords online database, which integrates the predicted targets of 11 miRNA target prediction tools (Farazi et al., 2013). Recently, certain databases, including miRecords, have integrated experimental data from validated targets and miRNA-mRNA profiling studies. But as global experimental data are very limited and many miRNAs have only been investigated in context-specific manner, the provided miRNA-mRNA interaction information covers only a small number of miRNAs and mRNAs. For example, miRecords currently lists 644 miRNAs and 1901 target genes in 9 animal species. [April 27, 2013, miRecords]. Nevertheless, the increasing experimental knowledge largely contributes to the

refinement of theoretical target predictions and helps to improve their reliability as most computational algorithms are based on machine-learning approaches.

1.8.5 miRNAs and their biological function The fact that about 75% of the human genome is transcribed into RNA, whereas only 3% is transcribed into protein-coding genes, indicates that the number of non-coding RNAs such as miRNAs is potentially much higher than that of protein-coding genes (Djebali et al., 2012). Furthermore, Bernstein et al. reported in 2003 that the presence of miRNAs is of vital importance as the disruption of miRNA biogenesis by inhibiting Dicer function in mice causes embryo death before gastrulation (Bernstein et al., 2003). Meanwhile, miRNAs are implicated in the regulation of almost all fundamental biological cellular processes such as embryogenesis, organogenesis, development, proliferation and apoptosis. For example, the miR-290 cluster is strongly associated with self-renewal and pluripotency of embryonal stem cells by suppressing proteins that inhibit Oct4 expression, while miR-21 was reported to counteract miR-290 activity as it directly targets Oct4. Subsequently, levels of these miRNAs are inversely correlated in embryonic stem cells. (Singh et al., 2008; Sinkkonen et al., 2008). miR- 1 and miR-133 have been shown to possess distinct roles in modulating skeletal muscle proliferation and differentiation. miR-1 promotes myogenesis by targeting histone deacetylase 4 (HDAC4), a transcriptional repressor of muscle gene expression, while miR-133 enhances myoblast proliferation by repressing serum response factor (SRF) (Chen et al., 2006). Ex- pression of miRNAs is also reported to display regulatory functions in response to certain stimuli. For example, oxidative stress induced the expression of the miR-200 family which regulates epithelial-mesenchymal transition through inhibition of the E-cadherin transcriptional repressors ZEB1 and ZEB2. Thus, downmodulation of ZEB1 has a key role in ROS- induced apoptosis and senescence of endothelial cells (Magenta et al., 2011). Like other regulatory molecules, the expression level of each miRNA has to be controlled in a context- specific and spatiotemporal manner as the dysregulation of miRNA activity interferes with proper cell function and is at the root of many diseases.

1.8.6 miRNAs in cancer Due to their pivotal role in various biological processes and their diverse target spectrum, miRNAs are strongly associated with the development and progression of various diseases. Especially in the context of cancer, they are obviously of major interest as according to Pubmed 40% of all publications dealing with miRNAs are connected to cancer. The first miRNAs involved in the development of cancer, miR-15 and miR-16, were reported by Calin et al. in 2002 and were found to be downregulated in B cell chronic lymphocytic leukemia (B- CLL) (Calin et al., 2002). Meanwhile, ablation of these miRNAs has been implicated in many other cancers as well and, additionally, their tumor-suppressive function was attributed to the downregulation of cell cycle proteins like Bcl2 and CDK6 (Cimmino et al., 2005; Klein et al., 2010).

Several expression profiling studies of different tumor samples have revealed that the expression patterns of several miRNAs are profoundly altered in malignant cells and, moreover, 31

their expression often correlates with developmental lineages, differential states and clinical prognoses of cancer. In a study by Enerly et al., microarray analyses of primary human breast tumors identified 26 miRNAs that separated almost perfectly the basal-like and luminal a samples (Enerly et al., 2011). Among them was the oncogenic miR-17-92 cluster, which was distinctively overexpressed in highly proliferative samples including the basal-like subtype. This cluster is frequently upregulated in a broad range of cancers and miRNA members of this cluster are effectors of the oncogene MYC and are known to target the tumor suppressors PTEN and BIM (Mu et al., 2009; Ling et al., 2013). In another study, altered expression of single miRNAs, like miR-21, miR-126, miR-199a, and miR-335, was closely associated with clinicopathologic features of breast cancer such as histological tumor grades and hormone receptor expression (Iorio et al., 2005; Wang et al., 2010). Based on these observations, many research groups focused on the role and function of single miRNAs, em- phasizing their dual function acting as oncogenes and/or tumor suppressors as well.

One of the best characterized oncogenic miRNAs, a so called oncomir, is miR-21 which is frequently overexpressed in a variety of tumors (Volinia et al., 2010). miR-21 exerts its oncogenic function at multiple levels, for example, overexpression of miR-21 enhances KRAS- dependent lung carcinogenesis in mice by inhibiting negative regulators of the Ras/MEK/ERK pathway (Hatley et al., 2010) and vice versa, genetic deletion of miR-21 pro- tects against tumor formation. Furthermore, miR-21 mediates the downregulation of PTEN, which was reported to contribute to acquired resistance against trastuzumab treatment in HER2 overexpressing tumors (Gong et al., 2011). Underscoring the enormous potential of gene regulation, it was shown that miR-221, which is frequently overexpressed in various types of cancer, affects multiple oncogenic pathways by modulating the mRNA level of approximately 600 genes (Lupini et al., 2013). Among these targeted genes were prominent proteins, such as PTEN and PUMA, involved in apoptosis and proliferation (Sarkar et al., 2013). Interestingly, a study by Fornari, et al. revealed that miR-221 can stimulate its own expression in a miRNA-transcription factor feedback mechanism, where the miRNA- mediated downregulation of Mdm2 activates p53 which in turn stimulates the expression of miR-221 (Fornari et al., 2014). Beside these oncogenic functions, there are also various miRNAs with inherent tumor-suppressive activity. A prominent example is the let-7 family which is often downregulated in advanced stage and high grade tumors. (Dangi-Garimella et al., 2009). Members of the let-7 family target the oncogenes KRAS and MYC, resulting in reduced proliferation and metastasis of cancer cells (Sampson et al., 2007; Dangi-Garimella et al., 2009; Ling et al., 2013). miR-31 on the other hand mainly exerts its tumor-suppressive function in later stages of cancer progression by affecting metastasis. Overexpression of this miRNA in mice causes the regression of metastasis without affecting the growth of the primary tumor via the suppression of prometastatic target genes including integrin α5 (ITGA5), radixin (RDX), and RhoA (Valastyan et al., 2010, 2011).

In the context of breast cancer, miRNAs influencing the ErbB signaling pathway are of special interest due to its major contribution to tumorigenesis and therapy resistance. One of the first published miRNAs regulating the ErbB pathway at the receptor level was miR-7, which targets EGFR and its downstream signaling molecules including the MAPK effector protein

Raf1 (Webster et al., 2009). Furthermore, miR-125a and miR-125b* were shown to target ErbB2 and ErbB3, which was accompanied by the suppression of the downstream Akt-PI3K signaling pathway. In line with this, the expression levels of these miRNAs have been found to be decreased in various cancer tissues when compared to normal tissues (Scott et al., 2007). A common mechanism for sustained ErbB receptor signaling is the downregulation of the lipid phosphatase PTEN and several miRNAs have been described to exert their oncogenic function partly by targeting PTEN like miR-21, the miR-17-92 cluster, miR-26a or miR- 214, respectively. In contrast, miR-199a mediates its oncogenic effect by reducing the protein level of Necl-2 which is a negative effector of ErbB3-signaling. Necl-2 promotes the dephosphorylation of the receptor via PTPN13 resulting in enhanced HRG-induced ErbB2- ErbB3 signaling (Kawano et al., 2009; Minami et al., 2013).

This complex interaction network of protein-coding genes and miRNAs emphasizes the high capacity of miRNAs for prognostic and therapeutic purposes and has already led to the development of miRNA-based therapies with some of them being tested in clinical trials. But nevertheless, the knowledge about the detailed regulation of miRNAs and their target network has barely skimmed the surface and needs to be further investigated.

1.8.7 Aim of the thesis microRNAs are small non-coding RNAs and their discovery unveiled a novel mechanism of regulating gene expression at the post-transcriptional level. In their function as master regulators of the genome, they are essential for the regulation of a multitude of biological processes but they are also implicated in the development of various diseases including breast cancer. Their capacity to simultaneously target multiple genes and pathways represents a powerful tool for diagnostic and therapeutic purposes. Nevertheless, the clinical use of miRNAs requires the investigation of miRNAs in a context specific manner as their function is often tissue-specific and, furthermore, a profound knowledge about the molecular targets of each miRNA.

The objective of the first part of this thesis was to investigate the extent to which miRNAs modulate the ErbB receptor signaling pathway. In breast cancer, the ErbB2-ErbB3 receptor dimer has attracted growing attention because upregulation of signaling through this receptor dimer plays an important role in the resistance to targeted therapies. This can be explained by the very efficient coupling of ErbB3 to the PI3K/Akt survival pathway. Therefore, I performed a genome-wide miRNA screen in the breast cancer cell line MCF7 based on heregulin-induced Akt phosphorylation as a read-out. Using a bioinformatical approach, I aimed to identify the molecular targets within the ErbB/PI3K/Akt signaling network followed by the validation of these predictions using biochemical and cellular assays. The second part of this thesis focuses on the screen hit miR-149, which is indicated to have a tumor- suppressive function in a broad range of tumors including the basal-like breast cancer subtype. Applying a genome wide pathway analysis, I aimed to identify the signaling modules responsible for this tumor-suppressive phenotype, the contribution of which was investigated in the basal like breast cancer cell line MDA MB 231 using a broad range of different biological assays. 33

2 Materials and Methods

2.1 Materials

2.1.1 Equipment

Table 2: List of equipment used in this thesis Equipment Company CASY® cell counter Roche, Basel, Switzerland Cell Observer system (Plan Apochromat 20×/0.8 M27 Carl Zeiss MicroImaging GmbH, Jena, objective lense) Germany Beckman Coulter Centrifuge Avanti J-30I (Rotor J20) Beckman Coulter, Krefeld, Germany Beckman Coulter Centrifuge J2-MC Centrifuge (Rotor Beckman Coulter, Krefeld, Germany J20) Curix 60 processor (western blot device) Agfa, Düsseldorf Cytomics FC-500 Beckman Coulter, Krefeld, Germany Electroblotter: Semi Dry Blotter PEGASUS Phase, Lübeck, Germany Eppendorf Centrifuge 5415D Eppendorf, Hamburg, Germany Eppendorf Centrifuge 5415R Eppendorf, Hamburg, Germany Eppendorf Research® (0,5 – 10 µl)(multichannel pipette) Eppendorf, Hamburg, Germany Eppendorf Xplorer® (2 – 200 µl / 50 – 1250 µl) (electronic Eppendorf, Hamburg, Germany multichannel pipette) EPS 301 Power Supply GE Healthcare Life Science, Uppsala, Sweden FACSDiVa option – FACSVantage SE BD Bioscience, Heidelberg, Germany Gel Documentation Camera Felix 2000, Dark hood DH- Biostep, Jahnsdorf, Germany 50, transilluminator UST-20M-8R iBlot® Gel Transfer Device Life technologies, Carlsbad, CA, USA Infinite 200M (fluorescent 96-well plate reader) Tecan, Crailsheim Jouan Centrifuge GR4i (Rotor Jouan 2) Thermo Scientific, Fremont, MA, USA Jouan Centrifuge CR422 Thermo Scientific, Fremont, MA, USA MKR 13 (orbital microplate shaker) HLC BioTech, Bovenden NanoDrop® ND-1000 (Spectrophotometer) ThermoFisher Scientific, Waltham, MA, USA Neubauer counting chamber Multimed, Kirchheim, Germany Nucleofector™ 2b Device Lonza, Basel, Switzerland NuAire IR Autoflow, CO2 Water-Jacketed Incubator NuAire, Plymouth, MN, USA Quantitative PCR Cfx96 Biorad, Munich, Germany Pipettes (1 – 20 μl / 20 – 200 μl / 200 – 1000 μl) Eppendorf, Hamburg, Germany RoboCycler Gradient 96 (PCR cycler) Stratagene, La Jolla, USA Semi Dry Blotter Pegasus Phase, Lübeck, Germany Thermoshaker MKR 13 HLC BioTech, Bovenden Transferpette® (5 – 50 μl / 20 – 200 μl) (multichannel BRAND, Wertheim, Germany pipette) Vortex Genie 2 Scientific Industries, Bohemia, USA XCell4 SureLock™ Midi-Cell (electrophoresis chamber) Life technologies, Carlsbad, CA, USA xCELLigence device (RTCA DP) Roche, Basel, Switzerland

2.1.2 Chemicals and consumables

Table 3: List of chemicals used in this thesis Chemical Company Acetic acid Carl Roth GmBH & Co., Karlsruhe, Germany

Acid sulfur (H2SO4) Carl Roth GmBH & Co., Karlsruhe, Germany Acrylamide (Rotiphorese Gel 30) Carl Roth GmBH & Co., Karlsruhe, Germany Agar Carl Roth GmBH & Co., Karlsruhe, Germany Agarose Carl Roth GmBH & Co., Karlsruhe, Germany Ammonium persulfate (APS) Carl Roth GmBH & Co., Karlsruhe, Germany -Mercaptoethanol Sigma-Aldrich, Taufkirchen, Germany Blocking reagent Roche Diagnostics, Basel, Switzerland Bovine Serum Albumin (BSA) Sigma-Aldrich, Taufkirchen, Germany Bromphenol blue Serva, Heidelberg, Germany Complete protease inhibitor cocktail Roche, Mannheim, Germany Crystal violet Merck, Darmstadt, Germany 4',6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich, Taufkirchen, Germany Dimethyl sulfoxide (DMSO) Carl-Roth GmBH & Co., Karlsruhe, Germany Dithiothreitol (DTT) Carl-Roth GmBH & Co., Karlsruhe, Germany DNAorange Sigma-Aldrich, Taufkirchen, Germany Ethylenediaminetetraacetic acid (EDTA) Carl-Roth GmbH & Co., Karlsruhe, Germany Ethanol VWR, Darmstadt, Germany Ethidium bromide Roche Diagnostics, Basel, Switzerland Fluoromount-G Southern Biotechnology, Birmingham, UK Gene Ruler 1 kb Ladder MBI Fermentas, St. Leon-Rot, Germany Glycerol Carl-Roth GmbH & Co., Karlsruhe, Germany Glycine Carl-Roth GmbH & Co., Karlsruhe, Germany Isopropanol Carl Roth GmbH & Co., Karlsruhe, Germany Methanol Carl-Roth GmbH & Co., Karlsruhe, Germany

Magnesium chloride (MgCl2) Carl-Roth GmbH & Co., Karlsruhe, Germany “PageRuler” prestained protein ladder MBI Fermentas, St. Leon-Rot, Germany Peptone Carl Roth GmbH & Co., Karlsruhe, Germany Phenylmethylsulfonyl fluoride (PMSF) Sigma-Aldrich, Taufkirchen, Germany Potassium chloride Carl-Roth GmbH & Co., Karlsruhe, Germany

Potassium dihydrogen phosphate ( KH2PO4) Carl Roth GmBH & Co., Karlsruhe, Germany Propidium iodide (PI) Life technologies, Carlsbad, CA, USA Sodium azide Sigma-Aldrich, Taufkirchen, Germany Sodium chloride Carl Roth GmbH, Karlsruhe, Germany Sodium fluoride Carl Roth GmbH & Co., Karlsruhe, Germany Sodium dodecyl sulfate (SDS) Carl Roth GmbH & Co., Karlsruhe, Germany Sodium hydroxide (NaOH) Carl Roth GmbH & Co., Karlsruhe, Germany

Sodium dihydrogen phosphate (Na2HPO4) Carl Roth GmBH & Co., Karlsruhe, Germany

Sodium orthovanadate Na3VO4 Sigma-Aldrich, Taufkirchen, Germany Tetramethyldiethyldiamine (TEMED) Carl Roth GmbH & Co., Karlsruhe, Germany Thiozolylblue tetrazolium bromide (MTT) Sigma-Aldrich, Taufkirchen, Germany Thimerosal Carl Roth GmbH & Co., Karlsruhe, Germany Tris-(hydroxymethyl)-aminomethane (Tris) Carl Roth GmbH & Co., Karlsruhe, Germany Triton X-100 Carl Roth GmbH & Co., Karlsruhe, Germany Tween-20 Carl Roth GmbH & Co., Karlsruhe, Germany

Zinc chloride (ZnCl2) Carl Roth GmbH & Co., Karlsruhe, Germany Table 4: List of consumables used in this thesis Consumable Company Cell culture flasks, plates, dishes, falcon tubes, pi- Greiner, Frickenhausen, Germany pette tips and cryo vials Costar® Stripette® Serological Pipets (2 ml, 5 ml, 10 Corning Incorporated, Corning, NY, USA ml, 25 ml, 50 ml) E-Plate 16 Roche, Basel, Switzerland Eppendorf Tubes and Safe-Lock Tubes (1.5 µl/ 2 µl) Eppendorf, Hamburg, Germany epT.I.P.S. Reloads 50 – 1250 µl Eppendorf, Hamburg, Germany glass coverslips 18 mm × 18 mm Carl Roth GmbH Co, Karlsruhe, Germany iBlot Gel Transfer Stacks Nitrocellulose, Regular Life technologies, Carlsbad, CA, USA Microseal ‘B’ Film (PCR Sealers) Bio-Rad Laboratories, Hercules, CA, USA MultiplateTM PCR Plates (MLL9651) Bio-Rad Laboratories, Hercules, CA, USA NuPAGE® Novex® 4-12% Bis-Tris Midi Protein Gels Life technologies, Carlsbad, CA, USA Replica dishes Sterilin Sterlin Ltd., Newport, UK Transwells (24-well plate plus inserts) for cell migra- Costar/Vitaris AG, Baar, Germany tion assays, (0.8 μm pore size) Roti®-PVDF transfermembrane Carl Roth GmbH & Co., Karlsruhe, Germany Whatman® cellulose chromatography papers 3 mm Schleicher & Schuell, Dassel, Germany

2.1.3 Buffers and solutions

Table 5: List of buffers and solutions used in this thesis Buffer Recipe Acrylamide running gel solution 8% and 15% (v/v) acrylamide, 375 mM Tris pH 8.8, 0.1% SDS, 0.1% ammonium persulfate, 0.06% N,N,N,N- tetramethylethylenediamine Acrylamide stacking gel solution 5% (v/v) acrylamide, 130 mM Tris pH 6.8, 0.1% (w/v) SDS, 0.1% ammonium persulfate, 0.1% N,N,N,N tetramethylethylenediamine Blocking solution (microscopy) 5% (v/v) goat serum, 0.1% (v/v) Tween 20 in PBS Blocking solution (Western blot, In-Cell 0.5% (v/v) blocking reagent, 0.05% (v/v) Tween 20, Western) 0.01% (v/v) Thimerosal in PBS Blotting buffer 200 mM glycine, 25 mM Tris base, 20% (v/v) methanol Firefly substrate 470 μM D-luciferin, 530 μM ATP, 270 μM CoA, 33 mM DTT,

20 mM tricine, 2.67 mM MgSO4, 0.1 mM EDTA (pH 7.8) Laemmli protein sample buffer (5×) 400 mM Tris, pH 6.8, 500 mM dithiothreitol, 50% (v/v) glycerol, 10% (w/v) SDS, 0.2% (w/v) bromophenol blue NuPAGE® MES SDS Running Buffer Life Technologies, Carlsbad, CA, USA (20×) and NuPAGE® Antioxidant Passive lysis buffer Promega, Mannheim (for Luciferase reporter assays) PFA 4% (w/v) in PBS

Phosphate Buffered Saline (PBS) 140 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.5 mM

KH2PO4 PBS-Tween (PBS-T) 0.05% (v/v) Tween 20 in PBS Propidium iodide (PI) staining solution PI (50 μg/μl), RNaseA (20 pg/μl) in PBS

RIPA lysis buffer 50 mM Tris (pH 7.5), 150 mM NaCl, 1% NP40, 0.5% sodium 37

deoxycholate, 0.1% SDS, 1 mM sodium orthovanadate, 10 mM sodium fluoride, 20 mM ß-glycerophosphate, Com- plete Protease Inhibitor Cocktail (1:25)

Renilla substrate solution 0.7 coelenterazine, 2.2 mM Na2EDTA, 0.44 mg/ml, bovine

serum albumin, 1.1 M NaCl, 1.3 mM NaN3, 0.22 M potassium phosphate buffer (pH 5.0)

SDS running buffer 25 mM Tris pH 8.8, 192 mM glycine, 0.1% SDS Tris-Acetat-EDTA (TAE) buffer 40 mM Tris-acetate, 1 mM EDTA, pH 8.3

2.1.4 Bacterial strain The competent bacteria strain DH5α (E. coli) was from Invitrogen, Karlsruhe in Germany.

2.1.5 Cell lines, cell culture medium

Table 6: List of cell lines used in this thesis Cell lines Source BT474 Nancy Hynes (Friedrich Miescher Institute, Basel, Switzerland) BT549 CLS, Heidelberg, Germany HEK293T American Type Culture Collection (ATCC), Manassas, VA, USA Hs578T Bernhard Lüscher (RWTH Aachen University, Germany) MCF7 Cornelius Knabbe (Institute of Clinical Pharmacology, Stuttgart, Germany) MDA-MB-231 CLS, Heidelberg, Germany MDA-MB-436 Bernhard Lüscher (RWTH Aachen University, Germany) MDA-MB-468 Bernhard Lüscher (RWTH Aachen University, Germany) PC3 CLS, Heidelberg, Germany SKBR3 CLS, Heidelberg, Germany T47D Cornelius Knabbe (Institute of Clinical Pharmacology, Stuttgart, Germany)

Table 7: List of cell culture reagents used in this thesis Cell culture reagents Company Collagen R solution Serva, Heidelberg, Germany Epidermal growth factor (EGF) R&D Systems, Minneapolis, MN, USA Fetal calf serum (FCS) PAA, Laboratories, Pasching, Austria G418 Life Technologies, Carlsbad, CA, USA Heregulin Tebu-Bio, Offenbach, Germany Lipofectamine® RNAiMAX Transfection Reagent Life Technologies, Carlsbad, CA, USA Lipofectamine® LTX with Plus™ Reagent Life Technologies, Carlsbad, CA, USA Matrigel™ Basement Membrane Matrix BD Bioscience, Franklin Lakes, NJ, USA Medium (MEM, DMEM, RPMI 1640, DMEM/F12, Life Technologies, Carlsbad, CA, USA Opti.MEM) MEM non-essential amino acids solution (100 ×) Life Technologies, Carlsbad, CA, USA NSC23766 (Rac Inhibitor III) Millipore Corporation, Billerica, MA, USA Sodium Pyruvate (100 mM) Life Technologies, Carlsbad, CA, USA Trypsin/EDTA (10 x) Life Technologies, Carlsbad, CA, USA

2.1.6 Animals Eight-weeks-old female CB17 SCID mice were obtained from Harlan Laboratories GmbH Indianapolis, IN, USA.

2.1.7 Oligonucleotides

2.1.7.1 miRNA library The microRNA library (CS-001010 mimic microRNA library, lot #09167) was purchased from Dharmacon and detailed information is attached in the appendix.

2.1.7.2 miRNAs miRIDIAN microRNA Mimics were purchased from Thermo Scientific, Waltham, MA, USA.

Table 8: List of miRNAs used in this thesis. miRNA Sequence (5’ – 3’) miRNA negative control #1 not known has-miR-148b-3p (miR-148b) UCAGUGCAUCACAGAACUUUGU hsa-miR-149-5p (miR-149) UCUGGCUCCGUGUCUUCACUCCC hsa-miR-326 CCUCUGGGCCCUUCCUCCAG has-miR-486-3p (miR-486) CGGGGCAGCUCAGUACAGGAU hsa-miR-520a-3p (miR-520a) AAAGUGCUUCCCUUUGGACUGU

2.1.7.3 siRNAs Short interference siRNAs were obtained from Eurofins MWG Operon, Ebersberg, Germany.

Table 9: List of siRNAs used in this thesis siRNA Sequence (5’ – 3’) siLacZ GCGGCUGCCGGAAUUUACC(dTdT) siLacZ-FAM FAM-GCGGCUGCCGGAAUUUACC(dTdT) siErbB2#1 GGACGAAUUCUGCACAAUG(dTdT)

2.1.7.4 SMARTpools ON-TARGET plus SMARTpool siRNAs were purchased from Thermo Scientific, Karlsruhe, Germany.

Table 10: List of SMARTpools used in this thesis SMARTpool siRNA Sequence (5’ – 3’) siControl Non-targeting pool AUGAACGUGAAUUGCUCAA UAAGGCUAUGAAGAGAUAC AUGUAUUGGCCUGUAUUAG UAGCGACUAAACACAUCAA siEGFR pool GGAAAUAUGUACUACGAAA GUAACAAGCUCACGCAGUU CAAAGUGUGUAACGGAAUA CCGCAAAGUGUGUAACGGA siErbB3 pool GCAGUGGAUUCGAGAAGUG AGAUUGUGCUCACGGGACA GUGGAUUCGAGAAGUGACA

GCGAUGCUGAGAACCAAUA siErbB4 pool GCAGGAAACAUCUAUAUUA GAUCACAACUGCUGCUUAA GCUCUGGAGUGUAUACAUU GGAAUUCCAACGCGAGAAA

2.1.7.5 Primers for site directed mutagenesis Primers for side directed mutagenesis were synthesized by MWG, Ebersberg, Germany. Successful mutagenesis was verified by sequencing (GATC Biotech AG, Konstanz, Germa- ny).

Table 11: List of primers used in this thesis Mutagenesis primer Sequence (5’ – 3’) ErbB3-del-3’UTR forward CATAATTCAGCACTTAACTATGCATCATACTAAACTTCACC ErbB3-del-3’UTR reverse GGTGAAGTTTAGTATGATGCATAGTTAAGTGCTGAATTATG

2.1.7.6 Primers for RT-qPCR analysis (mRNA) Primers for ErbB3, RAP1A and GAPDH were QuantiTect Primer Assays from Qiagen, Venlo, Netherlands. Primers for SOS1 were designed using PRIMER3 (Koressaar and Remm, 2007; Untergasser et al., 2012), and synthesized by biomers.net GmbH, Ulm, Germany.

Table 12: List of qPCR primers used in this thesis qPCR primer Catalogue number ADAM17 QT00055580 ErbB3 QT00019831 GAPDH QT01192646 RICTOR QT00065793 RAP1A QT00040495 RAP1B QT01666560 SOS1 forward: 5’-CGAGCCCTTTTCACTCAAGC-3’ reverse: 5’-GCCATGGGGCAGAGTAACTT-3’ VAV2 QT00002009

2.1.7.7 Primers for RT-qPCR analysis (miRNA) Primers for the reverse transcription and qPCR were included in the TaqMan Small RNA Assays and were obtained from Life Technologies, Carlsbad, CA, USA.

Table 13: List of qPCR primers used in this thesis qPCR primer Assay ID (reverse transcription and TaqMan reaction) miR-149 002255 RNU6B 001093

2.1.7.8 Plasmid vectors

Table 14: List of plasmid vectors used in this thesis Plasmid Source pEGFP-C1 Vector Clontech laboratories, Inc., Mountain View, CA, USA pGL3-ErbB3 3’UTR firefly lucifer- kindly provided by Christopher C. Benz ase Reporter Plasmid pRL-TK Renilla Luciferase Control Promega, Madison, WI, USA 40

Reporter Plasmid pEGFP-Rac WT Kindly provided by Francisco Sanchez-Madrid (Centro Nacional de Investigaciones Cardiovasculares, Madrid, Spain). pEGFP-Rac G12V Kindly provided by Francisco Sanchez-Madrid (Centro Nacional de Investigaciones Cardiovasculares, Madrid, Spain).

2.1.7.9 Fluorescence labeled primary antibodies

Table 15: List of fluorescence labeled primary antibodies used in this thesis Antibody Species Source PE-labeled anti-EGFR IgG2b mAb mouse Santa Cruz Biotechnology, Dallas, Texas, USA PE-labeled anti-ErbB2/Neu IgG1 mAb mouse Santa Cruz Biotechnology, Dallas, Texas, USA PE-labeled anti-ErbB3 IgG2a mAb mouse BioLegend, San Diego, CA, USA PE-labeled anti-ErbB4 IgG2a mAb mouse R&D Systems, Minneapolis, MN, USA PE-labeled IgG1 mouse ImmunoTools, Friesoythe, Germany PE-labeled IgG2a mouse ImmunoTools, Friesoythe, Germany PE-labeled IgG2b mouse BioLegend, San Diego, CA, USA

2.1.7.10 Primary antibodies

Table 16: List of primary antibodies used in this thesis Antibody Species Dilution Source anti-Akt(pan) mAb mouse 1:1000 (WB, Cell Signaling, Danvers, MA, USA ICW) anti-pAkt (T308) mAb rabbit 1:1000 (WB, Cell Signaling, Danvers, MA, USA ICW) anti-ErbB2 mAb mouse 1:1000 (WB) Thermo Scientific, Fremont, MA, USA anti-pErbB2 (Y1221/1222) mAb rabbit 1:1000 (WB) Cell Signaling, Danvers, MA, USA anti-ErbB3 mAb mouse 1:1000 (WB) Thermo Scientific, Fremont, MA, USA anti-pErbB3 (Y1289) mAb rabbit 1:1000 (WB) Cell Signaling, Danvers, MA, USA anti -Erk1/2 (3A7) mAb mouse 1:1000 (WB) Cell Signaling, Denvers, MA, USA anti-pErk1/2 (T202/204) pAb rabbit 1:1000 (WB) Cell Signaling, Denvers, MA, USA anti-FAK mouse 1:1000 (WB) BD Biosciences, Franclin Lakes, USA anti-pFAK (pY387) mouse 1:1000 (WB) BD Biosciences, Franclin Lakes, USA anti-Paxillin mAb mouse 1:500 (IF) BD Biosciences, Franclin Lakes, USA 1:1000 (WB) anti-pPaxillin (Y118) pAb rabbit 1:500 (IF) Cell Signaling, Denvers, MA, USA 1:1000 (WB) anti-Rac1 (23A8) mAb mouse 1:100 (WB) Millipore Corporation, Billerica, MA, USA anti-Src (36D10) mAb rabbit 1:500 (IF) Cell Signaling, Denvers, MA, USA 1:1000 (WB) anti-pSrc(Y416) (D49G4) mAb rabbit 1:500 (IF) Cell Signaling, Denvers, MA, USA 1:1000 (WB) anti-α-tubulin mAb mouse 1:5000 (WB) Sigma-Aldrich, St Louis, MO, USA anti-vinculin mouse 1:400 (IF) Cell Signaling, Denvers, MA, USA

2.1.7.11 Secondary antibodies

Table 17: List of secondary antibodies used in this thesis antibody: species Dilution company Alexa Fluor® 488 anti-mouse goat 1:500 (IF) Invitrogen, Karlsruhe, Germany Alexa Fluor® 488 anti-rabbit goat 1:500 (IF) Invitrogen, Karlsruhe, Germany Alexa Fluor® 546 anti-mouse goat 1:500 (IF) Invitrogen, Karlsruhe, Germany Alexa Fluor® 546 anti-rabbit goat 1:500 (IF) Invitrogen, Karlsruhe, Germany Alexa Fluor® 633 anti-mouse goat 1:500 (IF) Invitrogen, Karlsruhe, Germany Alexa Fluor® 633 anti-rabbit goat 1:500 (IF) Invitrogen, Karlsruhe, Germany HRP-anti-mouse IgG sheep 1:10000 (WB) GE Healthcare, Munich, Germany HRP-anti-rabbit IgG donkey 1:10000 (WB) GE Healthcare, Munich, Germany IRDye680RD-anti-mouse IgG goat 1:1000 (ICW) Li-COR Biosciences, Nebraska USA IRDye800CW-anti-rabbit IgG goat 1:1000 (ICW) Li-COR Biosciences, Nebraska USA

2.1.8 Kits and enzymes

Table 18: List of kits and enzymes used in this thesis Kit and enzymes Company Cell Line Nucleofector® Kit V Lonza, Basel, Switzerland DC Protein Assay Bio-Rad, Hercules, USA DyNAmo ColorFlash Probe qPCR Kit Thermo Scientific, Fremont, MA, USA SuperSignal® West Pico Chemiluminescent Substrate Thermo Scientific, Fremont, MA, USA SuperSignal® West Duro Extended Duration Substrate Thermo Scientific, Fremont, MA, USA mirVana™ miRNA Isolation Kit Life Technologies, Carlsbad, CA, USA PureLink® HiPure Plasmid Midiprep Kit Life Technologies, Carlsbad, CA, USA PureLink® Quick Gel Extraction Kit Life Technologies, Carlsbad, CA, USA QuikChange site-directed PCR mutagenesis Kit Stratagene, La Jolla, CA, USA QuantiTect® Primer Assay Qiagen, Venlo, Netherlands RNAse A Life Technologies, Carlsbad, CA, USA TaqMan® MicroRNA Reverse Transcription Kit Life Technologies, Carlsbad, CA, USA TaqMan® Small RNA Assays Life Technologies, Carlsbad, CA, USA

2.2 Methods

2.2.1 Cell culture Fresh cultures of the human cell lines were established every three months from frozen stocks stored in liquid nitrogen. BT474, BT549, MCF7, MDA-MB-436, MDA-MB-468, T47D and HEK293T cells were cultured in RPMI 1640 with 2 mM L-glutamine supplemented with 10% FCS. MDA-MB-231 and SKBR3 cells were cultured in DMEM with 2 mM L-glutamine supplemented with 10% FCS. PC3 were cultured in DMEM:Ham’s F12 medium (1:1 mixture) supplemented with 2 mM L-glutamine and 10% FCS. Du145 were cultured in MEM supplemented with 2 mM L-glutamine, 0.1 mM non-essential amino acids (NEAA), 1.0 mM sodium pyruvate and 10% FCS. All cells were incubated in a humidified atmosphere of 5% CO2 at 37°C. Cells were passaged using trypsin/EDTA every 3 to 4 days when cell confluency was reached. Cell number per ml was measured by the CASY® cell counter. 42

2.2.2 Cell transfection MCF7, MDA-MB-231, PC3, SKBR3 and T47D cells were transiently transfected with siRNAs and miRNAs at a final concentration of 10 nM using RNAiMax according to manufacturer’s instructions. In brief for the transient transfection within a 6-Well, 3 µl RNA (10 µM stock conc.) was mixed with 5 µl Lipofectamine RNAiMAX and 500 µl Opti-MEM and incubated for 15 min. Then 250.000 cells (in 2.5 ml medium) were added to the Well. For the transfection in different tissue culture formats, the transfection amounts and volumes were adjusted to the relative surface area.

2.2.3 Screening workflow

2.2.3.1 Screen protocol The miRNA library comprising 879 miRNA mimics was segmented into 11 x 96-well plates, each plate containing 80 miRNA mimics, 2 negative controls (siLacZ and miR-con) and 3 positive controls (siErbB2, siErbB3 and miR-149). MCF7 cells were reversely transfected with the miRNA library and different control RNAs in two biological replicates using Lipofectamine RNAiMAX according to manufacturer’s instruction with some minor modifications. Per Well 1.2 µl RNA with a stock concentration of 1 µM was mixed with 20 µl of a Lipofectamine RNAiMax/Opti-MEM dilution (1:100) and incubated for 15 min at room temperature. Then 7.500 cells in 100 µl medium were added to each Well and cultured in a CO2 incubator. 72 h later, cells either stimulated with 10 ng/ml Heregulin for 1 h or left untreated and further subjected to In-Cell Western analysis subsequently followed by assessing cell proliferation by crystal violet staining.

2.2.4 In-Cell Western analysis (ICW) Medium was removed and cells were fixed with 4% PFA for 20 min, permeabilized with PBS containing 0.1% Triton X-100 for 5 minutes and washed twice with PBS containing 0.1% Tween 20. Unspecific binding was blocked by incubation with blocking solution for 20 min. Cells were then incubated with primary antibodies in blocking solution for 2 h followed by incubation with IR dye-conjugated secondary antibodies in blocking solution for 1 h. After each incubation step, cells were washed 4 × 5 min with PBS containing 0.1% Tween 20. For the detection of pAkt(T308) and Akt signal intensities, cells were covered with 100 µl PBS. Visualization was carried out with the odyssey device and images were processed with the Odyssey software version 2.1.

2.2.4.1 Bioinformatical analysis of the screen data Bioinformatical screen data analysis were performed in collaboration with Michaela Bayerlová & Tim Beissbarth (Department of Medical Statistics, University Medical Center Göttingen, Germany). All statistical and bioinformatic analyses were conducted using R statistical computing environment (R Core Team, 2012). First, raw data of each 96-well plate was corrected for the signal decay of pAkt caused by the successive PFA fixation of the individual columns. This was done by comparing the medians of the first and the last column per plate harboring the same set of controls, which theoretically should have identical median 43

values. Assuming a linear signal decay, a correction value for each column was calculated and added to corresponding column. For corrected values, the ratio of pAkt/Akt was calculated resulting in the value for Akt activity. Next, the ratios were log2-transformed. HRG- induced Akt activation was calculated by subtracting the pAkt/Akt ratio for HRG-stimulated cells from that of basal, untreated cells, yielding the increase in Akt activation upon heregulin stimulation (ΔpAkt). Two-sided t-test was applied to compare ΔpAkt of each miRNA in the screen against negative controls and resulting p-values were adjusted for multiple compari- sons using Benjamini & Hochberg correction (Benjamini and Hochberg, 1995). miRNAs with adjusted p-value < 0.05 were considered as significant.

2.2.5 Plasmid Constructs – QuickChange Site directed PCR Mutagenesis The nucleotides 527-533 of the ErbB3 3’UTR containing the miR-149 seed region were deleted by site directed mutagenesis according to the manufacturer’s instructions using the pGL3-ErbB3 3’UTR firefly luciferase plasmid as template and the following primers: ErbB3- del-3’UTR forward 5’-CATAATTCAGCACTTAACTATGCATCATACTAAACTTCACC-3’ and ErbB3-del-3’UTR reverse 5’-GGTGAAGTTTAGTATGATGCATAGTTAAGTGCTGAATTATG- 3’. Sample reaction was prepared as indicated in Table 19.

Table 19: Reagents for PCR volume [µl] Reagent 1 Template: plasmid DNA (~25 ng) 1.5 Primer forward 1.5 Primer reverse 1.5 10 mM dNTP-Mix, Stratagene 5 10× Pfu Ultr reaction buffer, Stratagene 1 PfuUltra DNA Polymerase, 2.5 U/µl, Stratagene

38.5 ddH2O The program for the thermal cycler is described in Table 20.

Table 20: program for the thermal cycler segment cycles temperature time 1 1 95°C 90 seconds 2 18 95°C 30 seconds 55°C 1 min 68°C 10 min The methylated, parental DNA template was then digested by addition of 2 µl DPN I to the PCR product and incubated at 37°C for 4 h.

2.2.6 Transformation of E.coli 100 µl competent E.coli cells were thawed on ice and 1 µl of the digested PCR- product was added and incubated on ice for 10 min followed by incubation for 1 min at 42°C and 2 min on ice. After addition of 1 ml LB medium the reaction mix was incubated on an orbital shaker for recovery at 37°C for 1 h. Then either 100 µl of the cell suspension were plated onto LB- ampicillin agar plates (Mini-Prep) or added to 100 ml of LB-ampicillin medium (Midi-Prep). The ampicillin concentration was 100 µg/ml.

2.2.7 Purification of plasmid DNA (Mini-Prep) A colony of the transformed E.coli cells was picked and incubated in 2 ml of LB-ampicillin medium overnight at 37°C. The next day 1.5 ml of the cell suspension was subjected to centrifugation (13000 rpm, 2 min, and 25°C) and the pellet was resuspended in 150 µl buffer S1, followed by addition of 50 µl of buffer S2 and the mix was gently mixed by inverting the reaction tube. After incubation on ice for 5 min, 150 µl of buffer S3 were added, gently mixed and incubated on ice for 5 min. After centrifugation (10 min, 13000 rpm), the supernatant was transferred to a new reaction tube and centrifuged again (2 min, 13000 rpm). The supernatant was then transferred to a new reaction tube and 1 ml of 100% EtOH was added and incubated on ice for 10 min followed by centrifugation (5 min, 13000 rpm). Then the DNA pellet was washed with 70% EtOH, centrifuged (2 min, 13000 rpm), dried and finally the pellet was dissolved in 30 µl of ddH2O. Successful mutagenesis of the plasmid construct was verified by sequencing (GATC Biotech AG, Konstanz, Germany).

2.2.8 Preparation of plasmid DNA (Midi-Prep) Midi-Prep was performed using the PureLink HiPure plasmid DNA purification Kit (Invitrogen) according to the manufacturer’s instructions with one minor modification. Instead of cell lysate clearance by centrifugation, a filtration through filter paper (Macherey – Nagel, Ø 125 mm) was used to separate the aqueous phase from the mixture. Purified plasmid-DNA was diluted in ddH2O in a final concentration of 0.5 µg/µl.

2.2.9 Migration/Invasion (Transwell) Assay For haptotactic migration, 0.5×105 cells were seeded in medium containing 0.5% FCS into Transwells (8 µm pore size; Sigma Aldrich) coated with 10 µg/ml collagen on the underside and allowed to migrate for 3 h (MDA-MB-231) or 4 h (MDA-MB-436, BT549, Hs578T). The bottom chamber contained medium with 0.5% FCS. For invasion, Transwells were coated on the upper side with 50 µl growth factor reduced matrigel diluted 1:20 in medium containing 0.5% FCS and cells (1×105 in medium containing 0.5% FCS) were allowed to invade overnight (MDA-MB-231) or for 22 h (MDA-MB-436, BT549, Hs578T). The bottom chamber contained medium with 10% FCS supplemented with 190 ng/ml EGF. In the case of MDA-MB- 436 cells, the bottom chamber contained medium with 0.5% FCS supplemented with 190 ng/ml EGF. Cells on the underside of the membrane were fixed with 4% PFA and stained with crystal violet, followed by counting of five independent microscopic fields at a 20-fold magnification.

2.2.10 Impedance measurement 1×104 cells were plated into collagen coated (10 µg/ml) 96-well E-plates (Roche) in medium containing 0.5% FCS, except for MDA-MB-436, which where plated in medium containing 10% FCS. The impedance of cells was measured using the xCELLigence device (Roche).

2.2.11 Proliferation Assay One day after transfection, 2.5×103 cells were plated into 96-well plates. The next day, medium was replaced by medium containing either 10% FCS, or starvation medium containing 0.5% FCS, or starvation medium supplemented with 0.5 or 5 ng/ml heregulin, respectively. Five and seven days after transfection, cells were fixed with paraformaldehyde and stained with crystal violet. Crystal violet was dissolved in methanol and measured at 550 nm with the multimode reader Infinite® 200 PRO.

2.2.12 Life cell imaging Three days after transfection, 1×104 cells were seeded onto collagen coated (10 µg/ml) glass bottom dishes (CELLview, Greiner Bio-One) in medium containing 10% FCS and were allowed to adhere for 5 h before imaging with a wide-field fluorescence microscope (Axio Cell Observer Z1, Zeiss) using the objective Plan-Apochromat 20x/0.8 M27. Raw data were exported to Image J and quantification was done with the ImageJ plugin MTracjJ.

2.2.13 Luciferase Reporter Assay 4×104 HEK293T cells were plated into 96-well plates. The next day, cells were cotransfected with 10 ng wild-type or mutated (Δ527-533) ErbB3 3’UTR pGL3 firefly luciferase plasmid, 10 ng pRL Renilla luciferase plasmid, and 50 nM miR-149 or negative control miRNA using Lipofectamine 2000 (Invitrogen). 24 h after transfection, cells were lysed with 200 µl passive lysis buffer (Promega). The luciferase activities in 10 µl lysate were measured by sequential addition of 50 µl firefly substrate followed by addition of 100 µl Renilla substrate as described by Dyer et al. (21) and detected at 562 nm with the multimode reader Infinite® 200 PRO. Firefly luciferase activities were normalized to those of Renilla luciferase activities in each sample. Samples were performed as triplicates.

2.2.14 Rac activity assay. Rac activity was assessed with the G-LISA Rac1/2/3 Activation Assay Biochem Kit (Cyto- skeleton) according to manufacturer’s instructions. Absorbance was measured with the multimode reader Infinite® 200 PRO.

2.2.15 Quantitative Real Time PCR Total RNA was isolated from 5×105-1×106 cells using the mirVANATM miRNA Isolation Kit according to the manufacturer’s instructions. Concentration of purified samples was quantified with a Nanophotometer at OD 260/280 nm. qRT-PCR was performed on a Cfx96 device.

2.2.15.1 Expression of miR-149 (two-step procedure) For the RT reaction 10 ng of total RNA was used and expression of miRNA-149 and RNU6B (Taqman® microRNA Assay, Life Technologies) were measured with the TaqMan® MicroRNA Reverse Transcription Kit (Invitrogen) according to manufacturer´s instructions. Levels of mature miRNA-149 were normalized to RNU6B. Relative miRNA expression levels

were calculated with the 2-ΔΔCt method using MCF7 cells as reference (Biorad CFX manager software 3.1.). For the program for the thermal cycler see Table 21.

Table 21: Program used for reverse transcription and qPCR. I.step: reverse transcription II.step: qPCR 30 min 16°C 10 min 95°C 1 cycle 30 min 42°C 15 sec 95°C 40 cycles 5 min 85°C 60 sec 60°C

2.2.15.2 mRNA expression (one-step procedure) For each purified sample 100 ng of total RNA was used. Levels of ErbB3, VAV2, RAP1A, RAP1B, RICTOR, ADAM17, SOS1 and GAPDH mRNA were quantified using the QuantiTect Primer Assays and QuantiTect SYBR Green RT-PCR Kit according to manufacturer’s instructions. GAPDH was used as the endogenous control gene. Changes in the relative expression level of the mRNAs were calculated with the 2-ΔΔCt method using miR-con transfected cells as reference (Biorad CFX manager software 3.1.). For the program for the thermal cycler see Table 22.

Table 22: Program used for RT-qPCR. qPCR 30 min 50°C reverse transcription 15 min 95°C PCR initial activation step 30 sec 95°C 40 cycles 30 sec 50°C 30 sec 72°C 65°C – 95°C melting curve analysis

2.2.16 Cell lysis, SDS-PAGE and Western Blotting Cells were lysed in RIPA buffer and lysates were clarified by centrifugation at 16,000 x g for 10 min. Proteins where separated by SDS-Page and transferred to a Nitrocellulose membrane using the iBlot Gel Transfer Device (Life Technologies, Carlsbad, CA, USA). The membrane was blocked with 0.5% blocking reagent (Roche, Basel, Switzerland) in PBS containing 0.1% Tween-20 and then incubated with primary antibodies, followed by HRP- conjugated secondary antibodies. Visualization was carried out using the ECL detection system (Thermo Fischer, Waltham, MA).

2.2.17 FACS analysis After detachment, 5×105 cells were washed with PBS and incubated with PE-labeled antibodies or isotype matched control IgGs in PBS containing 2% FCS (PAA Laboratories, Cölbe, Germany) and 0,01% sodium azide at 4°C for 1 h. Cells were then washed with PBS and analyzed using a EPICS FC500 (Beckman Coulter, Krefeld, Germany). Post-acquisition data analysis was performed using CXP software (Beckman Coulter).

2.2.18 Immunofluorescence microscopy Cells seeded onto glass coverslips coated with 10 µg/ml collagen (Serva) were fixed with 4% PFA, permeabilized with PBS containing 0.1% Triton X-100 and blocked with 5% goat serum (Life Technologies) in PBS containing 0.1% Tween-20. Cells were then incubated with primary antibodies in blocking buffer, washed with PBS containing 0.1% Tween-20 and incubated with secondary antibodies in blocking buffer. Slides were mounted in Fluoromount-G and analyzed on a confocal laser scanning microscope (LSM 700, Zeiss) using 488, 561 and 633 nm excitation with the objectives Plan-Apochromat 20x/0.8 M27 and oil objective lenses EC Plan-Neofluar 40/1.30 DIC M27 and Plan-Apochromat 63/1.40 DIC M27. Images were processed with the ZEN software.

2.2.19 Animal experiment MDA-MB-231 cells (0.5×106 in 100 µl HBSS) were injected into the tail veins of eight-weeks- old female CB17 SCID mice (Harlan Laboratories GmbH). Four weeks later, mice were sacrificed, and the lungs were fixed and stained in Bouin’s solution. The number of macro- metastases on the lung surface was counted. Six mice per group were used. Animal care and experiments were in accordance with federal guidelines and approved by the University and state authorities.

2.2.20 Target prediction analysis for miR-149 using KEGG miRecords online tool (http://mirecords.biolead.org/) which integrates eleven miRNA prediction programs was used for target prediction analysis. Genes that were listed by at least four different prediction algorithms were mapped on the Kyoto Encyclopedia of Genes and Ge- nomes (KEGG) pathway database (Kanehisa et al., 2011).

3 Results

3.1 miRNA Screen

In the first part of the thesis, we established and performed a large-scale miRNA library screen containing 879 mature human miRNAs in the breast cancer cell line MCF7 in order to identify miRNAs acting on heregulin (HRG)-induced Akt activation via the ErbB2/ErbB3 coreceptors. Screen data analysis was then carried out using a bioinformatical approach resulting in 43 miRNAs that altered Akt activation upon HRG stimulation. Based on the predicted target spectrum within the ErbB2/ErbB3 and PI3K pathway, we investigated the underlying molecular mechanisms of several promising miRNAs reducing Akt activity in detail.

3.1.1 Establishment of a screening procedure to monitor Akt activation upon HRG stimulation The screening procedure was established for the breast cancer cell line MCF7, a frequently used and well characterized luminal breast cancer cell line that expresses all four ErbB receptors and is responsive to HRG. As a screening procedure has to match stringent requirements, each parameter of the protocol was checked in detail. Furthermore, because of the high sample amount, it was necessary to establish a simple screening procedure in a small scale format. For this reason, miRNA transfection and the determination of Akt activity were optimized in a 96-well plate format.

One major source of variability of a miRNA screen is the transfection procedure and the transfection efficiency. After testing different transfection methods, we chose the transfection reagent Lipofectamine® RNAiMAX due to its low toxicity and high transfection efficiency (data not shown). To measure Akt activity, we used the In-Cell Western technique, which is an immunocytochemical assay where the target proteins are labeled with highly specific primary antibodies and infrared-labeled secondary antibodies which can be detected with the LI- COR® Odyssey® Infrared Imaging System. Akt activation in unstimulated and in HRG- stimulated cells was analyzed using a phosphospecific antibody recognizing the phosphorylation at T308 and was normalized to the signal of total protein levels using an antibody de- tecting total Akt levels. Both primary antibodies were highly specific as revealed by Western Blot analysis (data not shown).

In order to specifically highlight the HRG-induced Akt activation, we introduced the value ΔpAkt (formula 1). Therefore, the ratios of pAkt/Akt were calculated resulting in the value for Akt activity. Next, these ratios were log2-transformed. Finally, the ratio of HRG-stimulated cells was substracted from that of unstimulated (basal) cells yielding the increase in Akt activation upon HRG stimulation (ΔpAkt).

(formula 1)

A prerequisite for the In-Cell Western is a homogenous cell growth and furthermore, due to the fact that miRNAs can also affect cell proliferation, it was also important to check that a

simple variation of cell density did not alter Akt activity in untreated cells. So in order to determine the optimal cell density, we seeded different numbers of cells in 96-well plates and analyzed cell growth by crystal violet staining and Akt activation upon heregulin treatment using the In-Cell Western technique. As revealed in Figure 7A-C, seeding a cell number between 6000-8000 cells/well was found to be optimal, guaranteeing a homogenous cell growth and a proper Akt activation on day 3.

Figure 7: Determination of screen set up. (A, B, C) Indicated cell numbers were seeded in 96-Well plates. (A) One and three days after seeding the cells, cells were fixed and stained with crystal violet and pictures were taken. (B) Crystal violet was then dissolved in Methanol and absorbance was measured with the Tecan reader. Depicted is the absorbance for the cell density on day 3. Shown is a representative experiment performed with triplicate samples. (C) Three days after seeding, different cell numbers, MCF7 cells were either stimulated with heregulin for 1 h or left untreated. Then cells were fixed and subjected to In-Cell Western analysis. Shown is the heregulin specific Akt activation (ΔpAkt) of a representative experiment performed with triplicate samples. (D) 7500 MCF7 cells were seeded in 96-well plates. Three days later, cells were stimulated with the indicated concentrations of heregulin and subjected to In-Cell Western analysis. Shown is ΔpAkt of a representative experiment performed with duplicate samples.

The screening procedure should allow the detection of miRNAs positively or also negatively influencing Akt activity. To assure that cells were still sensitive towards positive and negative alterations of Akt activity, a heregulin concentration that did not result in the maximum response to Akt activation was required. Therefore, we stimulated MCF7 cells with different amounts of heregulin for 1 h and subjected them to In-Cell Western analysis ending up with a

medium heregulin concentration of 10 ng/ml causing an appropriate but not maximal Akt activation (Figure 7D).

3.1.2 miR-149 serves as a positive control for the screen targeting the ErbB3 3’UTR To establish the screen and define the magnitude of miRNA-mediated effects we first sought a control miRNA that directly targets ErbB receptors. Because miR-125a, previously reported to co-target ErbB2 and ErbB3 (Scott et al., 2007), did not affect expression of these receptors in MCF7 cells, we validated miR-149 as a potential miRNA control. Using the miRanda prediction algorithm (www.microrna.org) we identified a conserved binding site for hsa-miR- 149-5p (miR-149) within the 3’-UTR of the ErbB3 sequence (Figure 8).

Figure 8: miR-149 is predicted to bind ErbB3. Schematic representation of the miR-149 recognition site in the ErbB3 3’UTR spanning nucleotides 527-533, as determined by miRBase (www.microrna.org).

Using a vector containing the 3’UTR of ErbB3 cloned downstream of the luciferase cDNA, we confirmed that miR-149 directly targets ErbB3. Coexpression of a miR-149 mimic reduced luciferase activity in cell lysates compared to the activity measured in lysates from cells co- expressing the control miRNA (Figure 9A). Deletion of the seven nucleotides complementary to the miR-149 seed region from the potential recognition motif in the ErbB3 3’UTR partially restored luciferase activity, indicating that miR-149 blocks luciferase expression by directly binding the ErbB3 3’UTR (Figure 9A). Transient transfection of MCF7 cells with miR-149 followed by qRT-PCR analysis and immunoblotting revealed potent suppression of ErbB3 transcript and protein levels, respectively, compared with those in miRNA-control transfected cells (Figure 9B & C). As a positive control, an ErbB3-specific siRNA pool was used, which completely silenced ErbB3 expression. Overexpression of miR-149 further induced the selective loss of ErbB3 from the cell surface as assessed by FACS analysis of cells stained with an ErbB3-specific antibody (Figure 9D), without affecting the surface expression of the other ErbB receptors (data not shown).

Figure 9: Expression of miR-149-5p affects Akt activation by directly targeting ErbB3 3’UTR. (A) HEK293T cells were transiently co-transfected with miR-con or miR-149 along with a luciferase reporter construct containing the wild-type ErbB3-UTR (WT) or a mutated ErbB3-UTR, in which the miR- 149 seed region was deleted (mt; Δ527-533). The next day, luciferase activity in the cell lysates was measured and normalized to the activity of the co-expressed Renilla reporter. Data correspond to the mean ± SEM of four independent experiments performed with triplicate samples. Data were analyzed by using two-way Anova, followed by Bonferroni posttests. **p < 0.01, n.s. (non-significant) p > 0.05 (B, C, D) MCF7 cells were transiently transfected with an ErbB3-specific siRNA pool (siErbB3), a control miRNA (miR-con) or miR-149, respectively. Three days post transfection cells were subjected to further analysis. (B) RNA was extracted and ErbB3 transcript levels were determined by RT-qPCR. Values were normalized to the reference gene GAPDH as an internal control. Data are shown as the mean ± SEM of three independent experiments and were analyzed with one-way Anova followed by Tukey´s multiple comparison test. **p < 0.01. (C) Cells were lysed and ErbB3 expression was analyzed by immunoblotting. The membrane was probed with a tubulin-specific antibody as a loading control. (D) Cells were incubated with a PE-conjugated ErbB3-specific antibody reactive with the extracellular domain and analyzed by flow cytometry. An isotype matched control IgG was used as a negative control (filled in grey).

Having established ErbB3 as a target of miR-149, we next investigated the impact of miR- 149 on HRG-induced phosphorylation kinetics by immunoblotting of the receptors and the downstream kinases Erk1/2 and Akt as readouts for PI3K and MAPK pathways, respectively. In agreement with the data shown in Figure 9C, miR-149 expression decreased ErbB3 protein levels, thereby impairing HRG-induced phosphorylation and activation of ErbB3 itself and its dimerization partner ErbB2 (Figure 10A). This potent suppression of ErbB2/ErbB3 phosphorylation was accompanied by modestly reduced Akt and Erk1/2 phosphorylation, most likely due to the amplification occurring as the signal is transmitted further downstream. Apart from its effect on ErbB3, miR-149 expression also reduced Erk1 protein levels. Be- cause miRNAs often co-regulate several targets within a specific signaling pathway, it is possible that miR-149 also regulates Erk1 post-transcriptionally; alternatively, miR-149 may affect Erk1 expression indirectly.

Figure 10: Expression of miR-149-5p affects ErbB2/3 downstream signaling. (A) MCF7 cells were transiently transfected with an ErbB3-specific siRNA pool (siErbB3), a control miRNA (miR-con) or miR-149, respectively. Three days post transfection; cells were either left unstimulated (0 min) or stimulated with 10 ng/ml heregulin for the indicated times prior to lysis. Equal amounts of cell lysate were analyzed by immunoblotting using phosphospecific antibodies specific for ErbB3(pY1289), ErbB2(pY1221/1222), Akt(pT308) and Erk1/2(pT202/pY204). Membranes were further probed with antibodies that detect the total level of these proteins. Tubulin was detected to confirm equal loading. (B) MCF7 cells were transiently transfected with a control miRNA (miR-con) or miR-149, respectively. Three days post transfection, cells were stimulated with 10 ng/ml heregulin for 1 h, fixed with PFA and subjected to In-Cell Western analysis using an phosphospecific antibodies for Akt(pT308) and an antibody specific for total Akt protein level. Data are presented as the relative Akt activation after heregulin stimulation (ΔAkt) calculated as described in materials and methods and section 3.1.1. One representative experiment performed with triplicate samples is shown.

For screening purposes, we transferred the analysis of HRG signaling to a 96-Well format using the In-Cell Western protocol. MCF7 cells transfected with control miRNA, miR-149, a control siRNA (siLacZ), and siRNAs against all members of the ErbB family were therefore stimulated with 10 ng/ml HRG for 1 h followed by staining with pAkt and Akt antibodies, respectively. In parallel, untreated cells were stained to determine basal Akt activity. pAkt/Akt ratios were determined for each sample and the basal values were then subtracted from the HRG-stimulated ones, yielding ΔpAkt (see Material and Methods or section 3.1.1 for details). Compared with the controls, ErbB2 and ErbB3 knockdowns almost completely abolished HRG-induced Akt activation, whereas ErbB1 and ErbB4 had minimal effects (Figure 10B), confirming that ErbB2/3 is the relevant signal heterodimer in this setting. Ectopic expression of miR-149 reduced ΔpAkt by ~40%, demonstrating that miRNA-mediated modulation of ErbB receptor signaling can be quantified using this method. As Akt phosphorylation is a dynamic process, the optimal incubation time with HRG was experimentally assessed. There- fore, cells were exemplarily transfected with one plate of the whole miRNA library screen according to the screening protocol and three days later cells were stimulated with 10 ng/ml HRG for 20 min, 60 min or 180 min or left untreated. Values of ΔpAkt after 20 min and 60 min of HRG stimulation were comparable for the identical set of miRNAs or siRNAs. Howev- er, after 180 min, values for ΔpAkt generally increased for positive as well as negative controls compared to the previous time-points (data not shown). This is probably due to second- 53

ary effects, like signal amplification. Because of practical reasons, we choose an incubation time of 60 min for the screening procedure.

3.1.3 Genome-wide miRNA screening for regulators of HRG-induced Akt activation In-Cell Western screening of a miRNA mimic library comprising 879 miRNAs was performed as detailed in Figure 11. The screen was repeated to obtain a second independent data set for both the basal and HRG-stimulated condition.

Figure 11: Workflow of the screening procedure. MCF7 cells were transiently transfected in 96- Well format with a human mimic microRNA library comprising 879 human microRNAs. Three days post transfection, cells were either left unstimulated (basal) or stimulated with heregulin (HRG) for one hour followed by the detection of total Akt and phosphorylated Akt(pT308) protein level using the In- Cell Western technique.

Screen data were then normalized by determining Akt-activity (pAkt/Akt ratios) for all replicate samples. For quality control, the replicates were correlated yielding an average Pear- son’s coefficient of 0.74 (basal) and 0.68 (HRG), respectively (Figure 12A). Additionally, crystal violet data were correlated with the corresponding values of Akt activity under basal and HRG-stimulated condition, resulting in a Spearman coefficient of 0.39 (basal) and 0.03 (HRG), respectively. This indicates a minimal correlation of cell number and Akt activity only under basal conditions (Figure 12B).

Figure 12: Correlation analysis. (A) For quality control the Akt activities, representing the ratios of the detected phosphorylated Akt and total Akt signal intensities (pAkt/Akt ratio) of each replicate were correlated for the unstimulated (basal, left) and heregulin stimulated (HRG, right) condition. (B) The mean values of crystal violet signal and Akt activity (pAkt/Akt ratio) of both replicates were correlated for the unstimulated (basal, left) and heregulin stimulated (HRG, right) condition. Dotted lines represent the linear regression of the screen data points

HRG-induced Akt activation (ΔpAkt) was determined and plotted for all miRNAs (Figure 13A). The majority of miRNAs had no effect on ΔpAkt values and clustered in the range of the negative controls miR-con and siLacZ (Figure 13B). By contrast, ΔpAkt values for the positive controls miR-149, siErbB2 and siErbB3 were ≤1 (Figure 13B) and therefore used to define a cut-off: Only those miRNAs were considered as screen hits for which ΔpAkt changes were significant and either below 1 or greater than 2 (Figure 13A).

Figure 13: MicroRNA screen data. (A) Screen data visualization. Akt activation upon heregulin stimulation (ΔAkt) for each miRNA is plotted. Data are shown as the mean of the two replicates and miRNAs are presented in ascending number. Screen hits are depicted in light grey. (B) Depicted in the scatter blot is the Akt activation upon heregulin stimulation (ΔpAkt) for all controls and plates. The miRNA library was presented in 11 96-Well plates and transfected in two biological replicates. Each plate contained a duplicate set of five controls; two negative (miR-con, siLacZ) and three positive controls (miR-149, siErbB2, siErbB3); to monitor transfection efficiency and the dynamic range of Akt activation. As marked by the dotted lines ΔAkt values values <1 indicate a reduction and ∆pAkt values >2 indicate an enhancement of Akt activation upon heregulin stimulation. Data were analyzed by one way Anova followed by Bonferroni’s multiple comparison test. ***p < 0.001, **p < 0.01, n.s. (non-significant) p > 0.05.

42 miRNAs plus the positive control miR-149 met these criteria, 19 of which significantly reduced (ΔpAkt < 1) and 24 of which significantly increased HRG-induced Akt activation (ΔpAkt > 2) (Figure 14).

Figure 14: Bioinformatical analysis of the screen data. For each replicate the ratio of pAkt/Akt signal intensity was calculated and the difference between unstimulated and stimulated condition was computed. miRNAs which significantly (p < 0.01) alter Akt-activity and had a value < 1 or ˃ 2 were considered as screen hits.

In Figure 15 the ΔpAkt values as well as the basal and HRG-stimulated pAkt/Akt ratios are depicted for the miRNA screen hits. Red coloring indicates an increase, green coloring a decrease of the pAkt/Akt level compared to that in miR-con expressing cells. This reveals that those miRNAs that enhance HRG-stimulated pAkt/Akt levels generally suppressed basal pAkt/Akt levels. This is most pronounced for miR-886-3p, for which the greatest difference in 56

HRG-induced Akt activation was observed (ΔpAkt = 2.8). In the case of miR-1304 and miR- 654-3p, basal pAkt/Akt levels were unaffected, thus, the increase in ΔpAkt was specifically due to enhanced Akt activity upon HRG stimulation. For those miRNAs that negatively affected ΔpAkt, there was no uniform trend regarding basal pAkt/Akt levels, as some miRNAs such as miR-204 enhanced, whereas others, e.g. miR-520a-3p, reduced basal pAkt/Akt levels. Regardless of the effect on basal Akt activity, all miRNA hits in this category attenuated Akt activation in response to HRG. This is best reflected by miR-148b, for which the lowest ΔpAkt value was obtained, indicating almost complete suppression of HRG-induced Akt activation. Furthermore, a general reduction of pAkt/Akt levels for the basal and HRG-stimulated situation is seen for miR-520a-3p, miR-519c-3p, miR-485-3p, miR-302c, and miR-520d-3p. Notably, three of these miRNAs possess the same seed region, which is critical for target recognition. The similar ΔpAkt values obtained for the different seed family members under- scores the reliability of the screen and suggests that the effects of these miRNAs are mediated by common targets (Figure 15B).

Figure 15: Analysis of the screen data. (A) Screen hits including the positive control miR-149 depicted in list format. Akt activity (pAkt/Akt ratio) under unstimulated (basal, column 2) and heregulin- stimulated (HRG, column 3) condition is color-coded with green indicating a reduction and red indicating an enhancement of Akt activity compared to the mean of miR-con (black). Akt activity is calculated based on the ratio of the log2 transformed signal intensities of pAkt and Akt (pAkt/Akt). For each con-

dition a separate color key is depicted as the range of Akt activity differs between unstimulated and heregulin stimulated cells. Specific Akt activation upon heregulin stimulation (ΔpAkt) for each miRNA is shown as a bar chart in the last column of the table. ΔpAkt value represents the difference between the heregulin-stimulated and unstimulated Akt activity (pAkt/Akt). Because miRNAs are selected based on the ΔpAkt value the cut off for screen hits is shown as dotted lines, with values < 1 indicating a reduction and ∆pAkt values > 2 indicating an enhancement of heregulin-dependent Akt activation. pAkt/Akt ratios and ∆pAkt values correspond to the mean of the replicates. (B) miRNAs were clustered according to their seed region and for each miRNA the ∆pAkt is visualized as a color-coded value. All seed families with more than three members are listed. Values correspond to the mean of the two replicates.

3.1.4 Identification of a miRNA-ErbB interaction network. For the construction of ErbB/Akt signaling network we used data from the Reactome database and identified 24 pathways connected to ErbB/Akt signaling (Croft et al., 2011). These pathways were parsed into R using r-package rBiopaxParser as directed graphs (Kramer et al., 2013). Next, 24 graphs were merged into a single signaling network comprising 312 nodes representing genes and 3582 edges representing activation or inhibition effects. Be- cause some of the genes are components of protein complexes and to simplify the network we merged these gene-nodes into protein-complex-nodes. This was done for PIK3 (PIK3CA, PIK3R1), mTORC1 (AKT1S1, MLST8, MTOR) and mTORC2 (RICTOR, MLST8, MTOR). This results in 309 nodes and 3524 edges.

To acquire miRNA-target information for the 43 screen hits miRNAs including miR-149, we searched 3 databases with computationally predicted miRNA targets: MicroCosm Targets release v5 (Griffiths-Jones et al., 2008), miRDB v4.0 (Wang, 2008) and microRNA.org Au- gust 2010 release (Betel et al., 2008). For three miRNAs (miR-1304, miR-1259, miR-1915) no targets were found in any database. The remaining 40 miRNAs were divided into two groups: a first group with negative effects on ΔpAkt comprising 19 miRNAs and a second group with positive effects on ΔpAkt comprising 21 miRNAs. We pooled miRNA – target information from all three databases and identified 298 target genes in the ErbB/Akt signaling network. Next, we separately connected both groups of miRNAs with the network by 959 and 750 miRNA – target gene edges for the first and second miRNA group, respectively. This resulted in the construction of two miRNA-ErbB/Akt signaling networks. To visualize the networks, the target genes in each network were ranked by the number of targeting miRNAs and the top target genes were then selected. For the network with miRNAs that negatively affected ΔpAkt, a sub-network of the top 14 genes, which were targeted by 9 or more miRNAs, was extracted with corresponding miRNAs. In the case of the network with positively acting miRNAs, a sub-network of the top 17 genes, targeted by 6 or more miRNAs, was extracted with corresponding miRNAs. A list of the miRNA-target gene interactions is given in Figure 16.

miRNAs negatively affecting ΔpAkt miRNAs positively affecting ΔpAkt

miR-302c miR-520a-3p miR-520d-3p miR-148b miR-204 miR-539 miR-155 miR-30d miR-19a miR-149 miR-326 miR-520f miR-649 miR-519c-3p miR-1301 miR-1202 miR-486-3p frequency miR-181d miR-488 miR-34c-5p miR-548c-3p miR-122 miR-382 miR-579 miR-18b miR-193b miR-146a miR-509-3p miR-574-5p miR-632 miR-654-3p miR-558 miR-640 miR-363* miR-708* target frequency target SOS1 12 x x x x x x x x x x x x INPP5B 8 x x x x x x x x RPS6KA5 11 x x x x x x x x x x x PDE4D 7 x x x x x x x PDE4D 10 x x x x x x x x x x EPS15L1 7 x x x x x x x RAP1A 10 x x x x x x x x x x MYH11 7 x x x x x x x mTORC2 10 x x x x x x x x x x EGFR 7 x x x x x x x FRS2 9 x x x x x x x x x PRLR 7 x x x x x x x CALD1 9 x x x x x x x x x MYLK 7 x x x x x x x ADAM17 9 x x x x x x x x x mTORC2 6 x x x x x x ERBB3 9 x x x x x x x x x TAB2 6 x x x x x x APBB1IP 9 x x x x x x x x x STAM 6 x x x x x x EGFR 9 x x x x x x x x x PHLPP2 6 x x x x x x PIK3 9 x x x x x x x x x GAB1 6 x x x x x x CPA3 9 x x x x x x x x x TPM3 6 x x x x x x CDKN1B 9 x x x x x x x x x RAP1A 6 x x x x x x TBL1XR1 6 x x x x x x MAP3K8 6 x x x x x x HPGD 6 x x x x x x

Figure 16: miRNAs-target gene interaction network. The most frequently targeted genes for those miRNAs that significantly reduced ΔpAkt activity (left) and significantly enhanced ΔpAkt (right) are shown. The frequency accounts for the number of miRNA targeting this particular genes and predicted miRNA-protein interactions are marked by crosses.

To gain better insight into the regulatory sub-networks of negatively and positively acting miRNAs we created two protein-protein interaction networks using STRING database, which integrates predicted protein interaction based on physical and functional associations (Figure 17) (Franceschini et al., 2013).

Figure 17: Regulatory protein/protein interaction network predicted by STRING database. (A) Sub-network of miRNAs negatively affecting ΔpAkt. The network includes the 14 most frequently targeted genes targeted by at least 9 miRNAs. (B) Sub-network of miRNAs positively affecting ΔpAkt. The network includes the 17 most frequently targeted genes targeted by at least 18 miRNAs. Type of interaction is indicated as colored lines. The single proteins Akt1 and Akt2 were included manually and are merged into Akt. This was also done for the protein complexes PIK3 (PIK3CA, PIK3R1), mTORC1 (AKT1S1, MLST8, MTOR) and mTORC2 (RICTOR, MLST8, MTOR).

Next, we focused our attention on those miRNAs that reduced Akt activation because their effect can be explained by the direct targeting of key players within the ErbB-Akt pathway. Interestingly, ErbB3 and PIK3 were among the most frequently predicted target genes. To investigate the potential co-regulation of these genes, we created a simplified miRNA-protein interaction graph comprising only directly connected proteins and miRNAs predicted to target ErbB3, namely miR-520a-3p, miR-520d-3p, miR-302c, miR-19a, miR-148b, miR-204, miR- 155, miR-149, miR-326 and additionally integrated information of protein-protein interactions from STRING and Reactome databases into this sub-network (Figure 18).

Figure 18: miRNA-protein interaction network for negative regulators of HRG signaling. The 12 most frequently targeted genes plus Akt are shown. The edges between them are based on signaling data of Reactome and protein-protein interactions of STRING databases. Only those miRNAs that co- target ErbB3 are depicted.

Intriguingly, all nine miRNAs including miR-520a-3p, miR-520d-3p and miR-302c, which are members of the same seed family, had largely overlapping target spectra. Apart from ErbB3 and PIK3, genes such as RAP1A, a member of the Ras GTPase family, mTOR complex 2 and the Ras GDP exchange factor SOS1 were predicted as targets. This indicates that this subset of miRNAs negatively regulates HRG-induced Akt activation by targeting the PI3K pathway at multiple levels, thereby multiplying the effects caused by the post-transcriptional suppression of single pathway components.

3.1.5 Expression of miR-148b, miR-149, miR-326 and miR-520a-3p reduces ErbB3- expression and affects Erk and Akt signaling We next sought to validate ErbB3 as a target for selected miRNA screen hits: miR-148b gave rise to the strongest reduction of ΔpAkt; miR-520a-3p was chosen as a representative of the 520/302 seed family; miR-326 was the only miRNA for which no co-regulation of ErbB3 and PIK3 was predicted. To this end, MCF7 cells were transiently transfected with the non- targeting control miRNA (miR-con), miR-149, miR-148b, miR-326 and miR-520a-3p, followed by Western blot analyses of total cell lysates. miR-486-3p, a screen hit that was not predicted to target ErbB3, was included to reveal any potential post-translational feedback regulation resulting from the suppression of Akt phosphorylation, however, ErbB3, PI3KCA and Akt pro- 61

tein levels were comparable to those in the control (Figure 19A). In line with the target prediction, reduced ErbB3 expression was confirmed for miR-148b, miR-326, and miR-520a-3p. By contrast, downregulation of PIK3CA was only evident in cells overexpressing miR-520a-3p and furthermore Akt protein levels were also reduced. In addition, considering the whole predicted target spectrum of miR-520a-3p Akt is also a potential target of this miRNA (see appendix). qRT-PCR analyses confirmed reduced ErbB3 transcript levels (Figure 19B), suggesting that the ErbB3 mRNA is directly targeted by these miR-148b, miR-326, and miR- 520a-3p. Furthermore mRNA levels of RICTOR, RAP1A, ADAM17, and SOS1 were partly also reduced upon overexpression of the miRNAs (Figure 19C).

Figure 19: miR-148b, miR-149, miR-326 and miR-520a-3p target key molecules of the pathway (A) MCF7 cells were transfected with a control miRNA (miR-con), miR-148b, miR-486, miR-326 or miR520a, respectively. Three days after transfection cells were lysed and analyzed by immunoblotting using the indicated antibodies. Tubulin was detected to confirm equal loading. The screen hit miR-486 was included as a negative control because it is not predicted to target any of the detected proteins. (B,C) MCF7 cells were transfected with a control miRNA (miR-con), miR-148b, miR-149, miR-326 or miR-520a-3p (miR-520a), respectively. (B) Two days post transfection, RNA was extracted and ErbB3 transcript levels were determined by RT-qPCR. Values were normalized to the reference gene GAPDH as an internal control. Data are shown as the mean ± SEM of two independent experiments (C) Three days post transfection, RNA was extracted and ADAM17, RAP1A, RICTOR and SOS1 transcript levels were determined by RT-qPCR. Values were normalized to the reference gene GAPDH as an internal control. Data are shown as the mean ± SEM of three independent experiments and were analyzed with one way Anova followed by Tukey’s multiple comparison test. *p < 0.05.

We next explored how the selected miRNAs affected ErbB2/3 receptor activation and downstream signaling by immunoblotting of cell lysates derived from HRG-stimulated cells. In agreement with Figure 19A, the expression of miR-148b, miR-326 and miR-520a-3p reduced ErbB3 protein and phosphorylation levels, which was accompanied by reduced ErbB2, Akt and Erk1/2 phosphorylation (Figure 20). Moreover, miR-520a-3p again reduced total Akt lev-

els. In addition, overexpression of miR-520a-3p and miR-326 reduced Erk1 protein levels. Erk1 is not a predicted target for these miRNAs based on our analysis. Taken together, these experiments confirm that miR-148b, miR-326 and miR-520a-3p reduce ErbB3 expression and severely impact HRG-induced ErbB receptor downstream signaling.

Figure 20: miR-148b, miR-326 and miR-520a-3p affect the ErbB2-ErbB3 signaling pathway on multiple levels. (A) MCF7 cells were transfected with a control miRNA (miR-con), miR-148b, miR- 486, miR-326 or miR520a, respectively. Three days after transfection, cells were either left unstimulated (0 min) or stimulated with 10 ng/ml heregulin for the indicated times prior to lysis. Equal amounts of cell lysate were analyzed by immunoblotting using phosphospecific antibodies specific for ErbB3(pY1289), ErbB2(pY1221/1222), Akt(pT308) and Erk1/2(pT202/pY204). Membranes were further probed with antibodies that detect the total level of these proteins. Tubulin was detected to confirm equal loading.

3.1.6 Overexpression of miR-148b, miR-149, miR-326 and miR-520a-3p reduces the heregulin-driven proliferation. HRG is known to drive proliferation of breast cancer cells. To assess the impact of the selected negative miRNA screen hits in a biological assay, we measured proliferation of cells ectopically expressing miR-148b, miR-149, miR-326 and miR-520a-3p in the presence of HRG. In control cells, miRNA proliferation was increased 2.8 fold in medium containing 0.5% FCS and HRG compared with medium supplemented with 0.5% FCS only. HRG-driven proliferation was reduced by all miRNAs, with miR-149 and miR-148b suppressing growth by 50% in comparison to the control. These data provide support for the inhibition of HRG- induced biological responses by these miRNAs.

Figure 21: miR-148b, miR326 and miR-520a-3p affect HRG-dependent cell growth. MCF7 cells were transfected with the indicated miRNAs. One day after transfection 2.5×104 cells were plated into 96-Well plates and grown in starvation medium containing 0.5% FCS (starved), or starvation medium supplemented with 5 ng/ml heregulin, respectively. Five days later, cells were fixed and stained with crystal violet and the absorbance at 550 nm was measured. Data were normalized on the proliferation in starvation medium. The mean ± SEM of 2-4 independent experiments and are analyzed by one way Anova followed by Tukey’s multiple comparison test is shown. **p < 0.01, *p < 0.05.

3.2 miR-149 in breast cancer

In the first part of the thesis we focused on the role of miRNAs in regulating the heregulin dependent Akt activation and only pathways that were closely centered on the ErbB2-ErbB3- Akt axis were taken into account. In the second part of the thesis we specifically focused on the molecular function of miR-149, a screen hit miRNA which is downregulated in basal breast cancer. We analyzed the potential target spectrum of affected downstream signaling pathways and characterized the biological effects resulting from overexpression of miR-149 in breast cancer cells.

3.2.1 Clinical data of miR-149 Many profiling studies revealed that the miRNA and gene expression pattern is strongly altered in tumor tissue when compared to normal tissue. Moreover, the expression signature of some miRNAs correlates with specific features of cancer, like metastatic potential or growth capacity. Based on these observations we re-analyzed the microarray-based miRNA expression data of 101 primary breast tumors studied by Enerly et al. These data revealed a reduced expression of miR-149 in basal compared with luminal A/B, ErbB2/HER2 positive and normal-like breast cancers (Figure 22A)(Enerly et al., 2011). These findings were confirmed by another expression profiling study of 93 primary breast tumors performed by Blenkiron et al. (Blenkiron et al., 2007), in which miR-149 expression was further shown to be reduced in stage III tumors (Figure 22B, C). The number of the stages indicates the severeness of the disease. Stage III tumors are characterized by a larger tumor size and are accompanied by the spread of the cancer to the lymph nodes marking the initialization of metastasis.

Figure 22: Reduced expression of miR-149 in basal breast cancer. (A, B, C) Boxplot visualization of miR-149 expression in different tumor subtypes and stages based on datasets by (A) Enerly et al. (Enerly et al., 2011) and (B, C) Blenkiron et al. (Blenkiron et al., 2007), respectively. Data are presented as mean ± SEM and were analyzed by (A, C) two way Anova followed by Bonferroni posttest and by (B) one way Anova followed by Tukey’s posttest, respectively. ***p < 0.001, **p < 0.01.

In order to check that this miR-149 expression pattern is reflected also in established breast cancer cell lines we performed quantitative RT-qPCR analysis of different breast cancer cell lines and subtypes. Indeed, we showed that in the basal-like MDA-MB-468, MDA-MB-231, 65

Hs578T, BT549, and MDA-MB-436 cell lines, miR-149 levels were lower compared with those in the luminal MCF7 and T47D and the ErbB2-positive BT474 and SKBR3 cell lines (Figure 22). For further studies we particularly chose the basal-like cell line MDA-MB-231 which is one of the best characterized basal-like breast cancer cell lines.

Figure 23: Reduced expression of miR-149 in basal breast cancer cells. RNA was extracted from the indicated breast cancer cell lines and expression levels of miR-149 were determined by qRT-PCR. RNU6B was used as an internal control. miR-149 expression level of MCF7 cells was used as reference. A representative experiment performed with triplicate samples is shown.

3.2.2 Expression of miR-149 impairs directional cell migration and invasion

To get a first indication about the pathways that are potentially affected we overexpressed miR-149 in MDA-MB-231 cells and assed proliferation migration and invasion of these cells. Overexpression of a mature miR-149 mimic did not have any impact on cell proliferation (Figure 24A). In contrast, overexpression of miR-149 in the luminal cell line MCF7 strongly reduced cell proliferation (Figure 21), which could be attributed to the miRNA-mediated downregulation of ErbB3. However, ErbB3 expression is almost absent in MDA-MB-231 indicating a subtype specific function of miR-149. Indeed, in Transwell assays measuring haptotactic migration towards a collagen gradient, miR-149 strongly reduced the number of migrated MDA-MB-231 cells (Figure 24B) and in the presence of a matrigel layer, cell invasion towards a serum plus EGF gradient was almost completely blocked (Figure 24C).

Figure 24: Expression of miR-149 reduces cell migration and invasion in MDA-MB-231. MDA- MB-231 cells were transiently transfected with control miRNA (miR-con) or miR-149. (A) One day after 66

transfection cells were plated into 96-well plates and stained with crystal violet after 3 and 5 days, respectively. A representative experiment is shown. (B, C) Three days post transfection cells were harvested and subjected to transwell assays. (B) For haptotactic migration the bottom side of the filters was coated with collagen. (C) For invasion, transwells were coated with matrigel and cells were left to migrate overnight toward a serum and EGF gradient. Shown is the mean ± SEM of three independent experiments. Data were analyzed using Student’s t-test (unpaired, two-tailed). **p < 0.01

As the migration through the pores of a transwell filter requires a complex remodeling of the cytoskeleton we analyzed the ability for general cell motility by time-lapse microscopy. There- fore, we transiently transfected MDA-MB-231 cells with control miRNA and miR-149, respectively, and plated the cells onto collagen-coated dishes. Tracking of single cells revealed that general cell motility was not affected by miR-149 overexpression in MDA–MB-231 cells, since the distance (track length) and thus the velocity was similar for control and miR-149- transfected cells. However, the net displacement was reduced by miR-149 expression (Figure 25A & B), indicating a defect in the directionality of cell movement.

Figure 25: Expression of miR-149 impairs the directionality of cell movement. MDA-MB-231 cells were transiently transfected with control miRNA (miR-con) or miR-149. Three days after transfection cells were plated onto collagen-coated glass bottom dishes and subjected to time-lapse microscopy. Images were taken every 10 min over a time period of 5 h. (A) Representative trajectories of 10 cells for each condition are plotted. Axis origin refers to the starting point of cell tracking. (B) Quantitative analysis of cell displacement, cell velocity and track length. Data correspond to a representative experiment with ≥ 25 cells per condition and are reported as mean ± SEM. Statistical significance was analyzed using Student’s t-test (unpaired, two-tailed). ***p < 0.001, n.s. (non-significant) p > 0.05.

3.2.3 miR-149 expression affects cell adhesion and cell spreading Cell adhesion and spreading are prerequisites for matrix-dependent cell migration. To study this in more detail, we transiently transfected MDA-MB-231 cells with control miRNA and miR-149, respectively, and plated the cells onto collagen-coated dishes for different periods of time (Figure 26A). While control cells were fully spread 4 hours after plating, miR-149 expressing cells had a rounder morphology and after 24 hours they were still less spread (Figure 26A). To measure cell adhesion and spreading in real-time, we plated cells onto collagen-coated E-plates and analyzed the impedance (cell index) using the xCELLigence device. The cell index is proportional to coverage of the surface area by spreading cells. Figure 26B shows that the plateau reached by miR-149 expressing cells was lower than that of the 67

control cells. The number of adherent cells was unaffected by miR-149 expression (data not shown), indicating a defect in cell spreading rather than cell adhesion.

Figure 26: miR-149 interferes with cell spreading on collagen. MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149. Three days post transfection cells were harvested and plated onto collagen in 0.5% FCS. (A) Cells were fixed and stained with crystal violet at the indicated times. (B) Cell adhesion and spreading on collagen-coated E-plates was measured using the xCELLigence device. Values correspond to the mean ± SEM of duplicate samples.

For a better understanding of the molecular details we analyzed cellular architecture of MDA- MB-231 cells at early times of adhesion by phalloidin and vinculin staining. Phalloidin binds to filamentous actin thereby visualizing the cytoskeleton, while the focal adhesion protein vinculin connects integrins with the actin cytoskeleton. Compared with the control, miR-149 expressing cells exhibited a depolarized actin cytoskeleton and failed to establish prominent cell protrusions and lamellipodia (Figure 27).

Figure 27: miR-149 affects polarization of actin cytoskeleton during cell spreading on collagen. MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149. Three days post transfection cells were harvested and plated onto collagen-coated coverslips for the indicated times in 0.5% FCS followed by staining with phalloidin and an anti-vinculin antibody. The confocal images shown are stacks of three sections taken from the bottom of the cell.

We next examined biochemically how miR-149 expression affected the activation of key signaling molecules downstream of integrin engagement by analyzing Src and paxillin phosphorylation. The focal adhesion protein paxillin and the intracellular non-receptor tyrosine kinase Src are involved in the regulation of focal adhesions and cytoskeletal remodeling. The activity of both proteins is regulated by phosphorylation. In miR-149 overexpressing cells Src phosphorylation was strongly reduced especially at early times of adhesion and spreading, whereas paxillin phosphorylation, an indicator of focal adhesion formation and turnover, was still low 4 hours after plating onto collagen (Figure 28). This is in line with the impaired spreading phenotype in miR-149 expressing cells.

Figure 28: miR-149 interferes with cell spreading on collagen. MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149. Three days post transfection cells were harvested and seeded onto collagen-coated dishes in the presence of 0.5% FCS. After the indicated times cells were lysed and lysates were immunoblotted using the indicated antibodies. The blots were cropped and in each case the corresponding panels are from the same gel.

3.2.4 Molecular targets of miR-149

To obtain insight into the potential signaling molecules affected by miR-149, we used the miRecords online tool (http://mirecords.biolead.org/) that integrates eleven miRNA prediction programs, resulting in 325 unique targets predicted by at least four different algorithms. The- se genes were mapped on the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database, enabling the annotation of 79 genes. The pie chart in Figure 29 depicts pathways that contain at least three annotated genes and comprises 49 genes in total (see Table 23).

FOCAL ADHESION (13)

Figure 29: miR-149 targets molecules downstream of the integrin pathway. The pie chart depicts the mapping of 325 unique miR-149 target genes onto KEGG pathways (Version 2.5). Human pathways containing at least three target genes are shown, comprising 49 genes in total.

Notably, apart from ‘cytokine cytokine receptor interaction’, ‘MAPK signaling pathway’ and ‘regulation of actin cytoskeleton’, ‘focal adhesion’ contained the highest number of predicted miR-149 target genes.

Table 23: List of predicted miR-149 target genes according to their KEGG pathway annotation. KEGG pathway gene symbol HSA04510 focal adhesion PAK3, PDGFRA, PGF, TNXB, PDGFC, KDR, VAV2, PXN, RAP1B, RAP1A, BCL2, TLN2, SRC HSA04060 cytokine cytokine receptor CLCF1, PDGFRA, EDA, TNFRSF19, PDGFC, KDR, pathway INHBB, IL6, ACVR1B HSA04010 MAPK signaling pathway PRKACG, PDGFRA, DUSP16, SRF, NTRK2, RAP1B, RAP1A, ACVR1B HSA04810 regulation of actin cyto- PAK3, PIP4K2B, BAIAP2, PDGFRA, VAV2, PXN, skeleton ARPC4 HSA04540 GAP junction ADCY1, PRKACG, PDGFRA, PDGFC, PRKG1, SRC HSA04310 WNT siganling pathway PRKACG, CAMK2G, FZD5, SFRP1, TBL1X, FOSL1, HSA04350 TGFβ signaling pathway SP1, ID4, INHBB, ACVRL1, ACVR1B HSA04360 axon giudance SEMA4G, PAK3, EPHB3, UNC5C, SEMA5A HSA04720 long term potentiation ADCY1, PRKACG, CAMK2G, RAP1B, RAP1A HSA04916 melanogenesis ADCY1, PRKACG, CREB3L3, CAMK2G, FZD5 HSA04020 Ca signaling pathway ADCY1, PRKACG, PDGFRA, ATP2A2, CAMK2G HSA05211 renal cell carconoma PAK3, PGF, EGLN3, RAP1B, RAP1A HSA04210 Apoptosis PRKAR2A, PRKACG, BCL2, IRAK4 HSA04670 leukocyte transendothelial VAV2, PXN, RAP1B, RAP1A migration HSA04912 GNRH signaling pathway ADCY1, PRKACG, CAMK2G, SRC HSA05210 colorectal cancer PDGFRA, FZD5, BCL2, ACVR1B

HSA04012 ErbB signaling pathway PAK3, CAMK2G, SRC HSA04370 VEGF signaling pathway KDR, PXN, SRC HSA04640 hematopoetic cell lineage CD59, MS4A1, IL6 HSA04740 olfactory transduction PRKACG, CAMK2G, PRKG1 HSA05215 prostate cancer PDGFRA, CREB3L3, BCL2 HSA04520 adherens junction BAIAP2, ACVR1B, SRC HSA04530 tight junction EPB41L1, EXOC4, SRC

The focal adhesion pathway includes the Ras related small GTPases Rap1A and Rap1B and the guanine nucleotide exchange factor (GEF) Vav2. To assess whether Rap1a/b and Vav2 were targeted by miR-149, we performed qRT-PCR analyses of mRNA samples extracted from MDA-MB-231 cells transfected with control miRNA and miR-149, respectively. Indeed, compared with the control, the transcript levels of Rap1A/B and Vav2 were significantly reduced by miR-149 expression (Figure 30). Of note, we did not observe any changes in the expression levels of PAK3, Src or paxillin, which were also predicted as targets and are associated with the focal adhesion pathway.

Figure 30: mir-149 targets molecules downstream of the integrin pathway. MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149, respectively. Two days post transfection, RNA was extracted and Vav2, Rap1A and Rap1B transcript levels were determined by qRT-PCR. Values were normalized to GAPDH. Data are shown as the mean ± SEM of four independent experiments and were analyzed using two way Anova with Bonferroni posttests. ***p < 0.001.

3.2.5 miR-149 expression affects Rac activity Vav2 and Rap1A/B mediate activation of Rac, a small GTPase that transduces signals downstream of tyrosine-kinases, G-protein-coupled-receptors (GPCR), and integrins. Rap1a/b binds to a subset of GEFs, including VAV2, localizing them in membrane protrusions at the cell periphery, where it can activate Rac by stimulating the exchange of GDP to GTP. Rac function is critical for cell spreading, lamellipodia formation and directed migration (Arthur et al., 2004). We therefore investigated the activation of Rac after miR-149 overexpression upon integrin and RTK stimulation by GLISA. Increased miR-149 expression resulted in reduced Rac-GTP levels, preventing the transient increase in Rac activation observed 45 min after plating onto collagen or upon EGF stimulation (Figure 31A), while total Rac protein levels were unaffected by miR-149 expression (Figure 31B).

Figure 31: miR-149 impairs Rac activation MDA-MB-231. Cells were transiently transfected with a control miRNA (miR-con) or miR-149, respectively. (A) Three days post transfection, cells were seeded in 0.5% FCS onto collagen-coated dishes, lysed at the indicated times and Rac levels were measured by GLISA. Data are shown as the mean ± SEM of three experiments and were analyzed using two way Anova with Bonferroni posttests. *p < 0.05, n.s. (non-significant) p > 0.05. (B) Three days post transfection, cells were stimulated with 50 ng/ml EGF for indicated times, lysed and Rac-GTP levels were measured by GLISA. Data are shown as the mean ± SEM of three experiments. (C, D) Cell lysates were analyzed by immunoblotting using the indicated antibodies.

The importance of Rac for cell motility was confirmed by the suppression of MDA-MB-231 directed cell migration by pharmacological Rac inhibition in the Transwell assay. The used Rac inhibitor NSC23766 prevents Rac activation by binding into a surface groove which is known to be critical for GEF interaction (Gao et al., 2004). To investigate the functional contribution of Rac inactivation in the context of miR-149 function, we transiently transfected cells expressing either control miRNA or miR-149 with a vector encoding constitutively active GFP-Rac G12V, where the intrinsic- and GAP-stimulated GTP hydrolysis is inhibited (Xu et al., 1994). Expression of active Rac, but not GFP alone, partially rescued the cell spreading defect of miR-149 expressing cells (Figure 32). This was also confirmed using the vector GFP-Rac Q61L encoding for another constitutively active Rac variant (data not shown) (Xu et al., 1994).

Figure 32: Rac inhibition blocks cell migration and active Rac restores spreading of miR-149 expressing cells. (A) Transwell migration of MDA-MB-231 cells was measured in the absence (control) and presence of 100 µM NSC23766 in the upper chamber. (B; C) MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149, respectively. Two days post transfection cells were transiently transfected with a vector encoding GFP alone or GFP-Rac G12V. The next day, cells were replated onto collagen-coated coverslips for 1 hour, fixed and stained with phalloidin and an anti-vinculin antibody. (B) The confocal images shown are stacks of five sections taken from the bottom of the cell. (C) For the quantitative analysis of the area of spread cells pictures (1024×1024 pixel) were taken at a 20-fold magnification. Analysis was performed with ImageJr. Only cells with a mean pixel dwell intensity greater than 10 were considered as GFP positive. 22-59 cells per condition were analyzed. Shown is the mean ± SEM of three independent experiments. Data were analyzed using two way Anova with Bonferroni posttests. **p < 0.01, n.s. (non-significant) p > 0.05.

3.2.6 miR-149 affects migration and invasion also in the prostate cancer cell line PC3 So far, the function of miR-149 has been mainly investigated in basal-like breast cancer cells. But according to KEGG pathway analysis miR-149 function is also annotated in the context of ‘melanogenesis’, ‘renal cell carcinoma’, ‘colorectal cancer’, and ‘prostate cancer’. Indeed in prostate cancer, miR-149 downregulation has already been reported (Schaefer et al., 2009), indicating a broader tumor-suppressive function of miR-149. To explore whether the cellular effects induced by miR-149 are conserved in a different cell type, we transfected PC3 prostate cancer cells, which also express very low levels of endogenous miR-149 (data not shown), with the control miRNA and miR-149 mimic. As seen in the basal-like breast cancer cell lines, upon miR-149 transfection, cell spreading on collagen and haptotactic cell migration were severely impaired (Figure 33A & B). Furthermore in accordance with the effect observed in MDA-MB-231, Rac activation was also compromised in PC3 cells (Figure 33C), demonstrating that miR-149 impacts the same signaling pathway in these cells.

Figure 33: miR-149 impairs with integrin-dependent signaling and cell motility in the prostate cancer cell line PC3. PC3 cells were transiently transfected with a control miRNA (miR-con) or miR- 149. Three days post transfection cells were harvested and subjected to further analysis (A) Cells were plated onto collagen-coated E-plates in medium containing 0.5% FCS. Cell adhesion and spreading was measured using the xCELLigence device. Values correspond to the mean ± SEM of duplicate samples. (B) For haptotactic migration the bottom side of the filters was coated with collagen. Shown is the mean ± SEM of three independent experiments. (C) Cells were seeded onto collagen-coated dishes and cell lysates were taken at the indicated times. Rac-GTP levels were measured using a commercial GLISA kit. Data are shown as the mean ± SEM of two independent experiments and were analyzed using two way Anova with Bonferroni posttests. *p < 0.05.

3.2.7 miR-149 expression in vivo model Finally, to test the impact of miR-149 expression on cell migration and invasion in vivo, we analyzed in immunocompromised mice the efficiency of lung colonization of MDA-MB-231 cells transfected with miR-149 upon tail vein injection. Four weeks after injection, lungs were dissected and the number of macroscopic metastases counted, revealing a significant block in metastatic lung colonization by miR-149 expression compared with the control (Figure 34). Together, our data provide strong support for a tumor-suppressive role of miR-149 in basal breast cancer.

Figure 34: miR-149 blocks lung colonization in vivo. MDA-MB-231 cells were transiently transfected with a control miRNA (miR-con) or miR-149. Three days post transfection, cells were harvested and injected into the tail veins of SCID mice (0.5 x 105 cells; six mice per group). Four weeks later, the 74

mice were sacrificed; the lungs were fixed in Boiun´s solution and photographed. (B) Quantification of the number of macro-metastases per lung. Data are shown as mean ± SEM and were analyzed using Student’s t-test (unpaired, two-tailed). ***p < 0.001.

4 Discussion The discovery of miRNAs has unveiled an entirely new repertoire of molecular factors for gene regulation reported in virtually all biological processes. To date, there is hardly any disease that has not revealed significant differences in miRNA expression compared with normal tissue (Bader AG, Lammers P, 2011). So far, several miRNAs have been associated with the development of cancer and it has been shown that miRNAs are frequently located within cancer-associated genomic regions, or fragile sites, thus potentiating their role in cancer (Calin et al., 2002). In their function as main molecular players, miRNAs can be used to study and develop new therapeutic strategies as they offer the opportunity to repress many oncogenes at the same time. Alternatively, inhibition of miRNA expression can restore expression of tumor suppressors. Nevertheless, target identification and validation are the key for the correct selection of miRNAs causally involved in a specific disease process. However, the detailed function and clinical relevance of most miRNAs is largely unknown and only a handful of miRNAs have been profoundly studied in the context of breast cancer. miR-21, for instance, has been comprehensively characterized as an oncomir contributing to Herceptin resistance particularly by targeting PTEN, while miR-335 and miR-200c have been shown to possess tumor-suppressive functions inhibiting metastatic cell invasion. Consequently, there is still a great demand for further intensive research including the identification of new miRNAs and their mRNA targets, thus improving our knowledge on these novel biomarkers.

4.1 miRNA Screen

4.1.1 Screening for miRNAs altering the ErbB/Akt pathway Using a functional screen, we investigated the effect of 798 miRNAs on HRG-induced ErbB2/ErbB3/Akt signaling in the luminal breast cancer cell line MCF7. As an indicator for pathway activation, we detected the Akt phosphorylation on T308, which is essential for enzyme function as in the absence of this phosphorylation the catalytic domain of Akt is disor- dered (Yang et al., 2002). This initial phosphorylation is mediated by the ErbB2/ErbB3 downstream effector PDK1 (Cantley, 2002). Thus, we were able to measure the specific ErbB2/ErbB3 dependent Akt activation which we also confirmed by the siRNA-mediated knockdown of the dimer partners (Figure 10). In addition, establishing the screening protocol, we successfully validated ErbB3 as a novel target of the positive control miR-149 that directly bound to the recognition site in the ErbB3 3’UTR spanning nucleotides 527-533 as shown by luciferase assay (Figure 9). Consequently, overexpression of miR-149 resulted in a strong reduction of ErbB3 protein and RNA levels and strongly affected ErbB2/ErbB3 pathway activation (Figure 10). Using miR-149 as a reference, we identified 43 miRNAs significantly changing ΔpAkt, 19 negatively and 24 positively (Figure 13), with several miRNAs that were reported for the first time in the context of ErbB/Akt signaling. So far, there are only a few comparable published screens investigating the role of miRNAs in ErbB signaling pathways. However, these approaches have focused on different aspects leading to a distinct set of regulatory miRNAs. For instance, Uhlman et al. studied the miRNA-mediated regulation of 26

proteins within the EGFR pathway in the basal-like breast cancer cell line MDA-MB-231 (Uhlmann et al., 2012). They identified miR-124, miR-147, and miR-193-3p as novel tumor suppressors co-regulating the EGFR-driven cell cycle network. Leivonen et al. investigated the role of miRNAs in regulating the ErbB2 pathway and cell growth in two ErbB2 amplified, Trastuzumab non-responsive breast cancer cell lines monitoring the protein levels of pErk, pAkt, Her2, Ki67, and cPARP (Leivonen et al., 2014). They identified several miRNAs potently inhibiting ErbB2 signaling and they specifically revealed tumor-suppressive function of miR-342-5p affecting ErbB2 levels, and inhibiting cell growth in ErbB2(+) cells. Beside these large scale approaches, there are only a few other reports describing the regulation of ErbB signaling in breast cancer by single miRNAs. Consequently, with our screening approach, we have extended the number of miRNAs regulating the ErbB/Akt network.

4.1.2 miRNAs alter heregulin-dependent Akt activation As the ΔpAkt value represents the difference of HRG-induced and basal Akt activity, it particularly accounts for the capacity of a miRNA to modulate the responsiveness of cells towards HRG-induced signaling. The tightly controlled HRG response is of fundamental importance for proper cell function as, on the one hand, HRG-induced signaling is essential for the morphogenesis and the differentiation of the mammary gland (Breuleux, 2007), on the other hand, up-regulation of HRG signaling is sufficient to drive malignant transformation and the development of tumors in the breast (Atlas et al., 2003), indicating that miRNAs reducing ΔpAkt may be involved in tissue homeostasis. And indeed, miR-148b, associated with the strongest reduction of ΔpAkt (Figure 13), was shown to act as a tumor suppressor and is downregulated in aggressive breast cancer and gastric cancer (Song et al., 2011). At the same time, miRNAs enhancing ΔpAkt may contribute to oncogenic signaling leading to prolonged Akt signaling or a higher amplitude of Akt activation. Notably, in a screen by Kekliglou et al. several miRNA clusters, including miR-181, miR15/16, miR-518, let-7, and miR373/520 (Keklikoglou et al., 2012), had a similar effect on NF-kB activity as they did on ΔpAkt in our screen. This is of particular interest, as it was shown that efficient HRG-induced mammosphere formation of breast cancer cells requires the concomitant activity of the PI3K/Akt and NF-κB pathway (Hinohara et al., 2012), further supporting their role in breast cancer development. Nevertheless, alteration of ΔpAkt alone is not necessarily an indicator for tumor-suppressive or oncogenic properties. miR-34c-5p, for example, which significantly enhanced ΔpAkt, was reported to have strong tumor-suppressive function by reducing the metastatic behavior of breast cancer cells (Yang et al., 2012) and, apart from that, miR-19a which reduced ΔpAkt in our screen acted as a mediator of multi-drug resistance (MDR) (Liang et al., 2011). But depending on the specific target genes and the cancer-specific cir- cumstances, miRNAs can function as tumor suppressors or as oncogenes. miR-205, for instance, is able to inhibit the proliferation and invasion of tumor cells, but has also been shown to facilitate tumor initiation (Qin et al., 2013). Consequently, each miRNA has to be studied in the appropriate cellular context. Moreover, it has to be considered that the ΔpAkt value depends on the basal and HRG-induced Akt activity and these two activities are not necessarily coregulated by a specific miRNA. In fact, some miRNAs reduced or enhanced both basal and HRG-induced Akt activity, such as miR-302c or miR-539, whereas others 78

displayed an inverse activation pattern, such as miR-210 or miR-632. This exemplifies that there are various mechanisms contributing to ErbB and Akt pathway regulation. However, it is commonly known that Akt supports cell proliferation and Enerly et al. revealed that miRNAs affecting cell proliferation are often associated with the regulation of cell cycle genes (Enerly et al., 2011), including genes which are among the downstream effectors of Akt. In- deed, our data also displayed a slight correlation between basal Akt activity and cell number (Figure 12). Such a correlation was not seen in the case of HRG stimulation. This is not surprising as the short 1 hour pulse of HRG is insufficient to affect cell numbers. The effects of prolonged HRG stimulation have to be addressed with a different experimental setting.

4.1.3 Protein target network of miRNAs negatively affecting ΔpAkt miRNAs reducing ΔpAkt often displayed similar target specificity and the proteins within the corresponding network were functionally highly interconnected (Figure 16 – 18). This indicates that the miRNAs modulate ΔpAkt by the coordinated downregulation of various proteins within the pathway including the ErbB3 receptor itself, thereby multiplying the effects achieved by the knockdown of single proteins. This mechanism is also supported by a few recent publications. For example, miR-7 was reported to directly target the EGFR and Raf1, and affected the levels of several other genes within the EGFR pathway, including MEK, PAK1, and the direct EGFR effector proteins IRS1/2 (Kefas et al., 2008; Webster et al., 2009). Furthermore, coordinative suppression of several pathway proteins does not seem to be restricted to the ErbB signaling network as the expression of members of the miR- 373/520 cluster influenced the level of various proteins within the TGFβ-signaling pathway as revealed by microarray analysis (Keklikoglou et al., 2012).

In this study, we confirmed the downregulation of the ErbB3 protein and mRNA levels for a selected subset of promising screen hits, including miR-148b, miR-149, miR-326 and miR- 520 (Figure 19A & B). Further, we were able to show that these miRNAs coregulated the ErbB network at multiple levels affecting protein or mRNA expression of Erk1/2, PIK3 (PIK3CA), mTORC2 (RICTOR), and ADAM17 (Figure 19, Figure 20). Although the observed downregulation partly differed from the predicted miRNA target specificity and requires further experimental validation to confirm direct miRNA-mRNA interaction, overexpression of these miRNAs severely interfered with ErbB receptor phosphorylation and downstream signaling and strongly reduced HRG-dependent proliferation of MCF7 cells (Figure 21).

Targeting ErbB3 most likely accounts for the very potent inhibition of HRG-induced ErbB2/ErbB3 signaling observed for the selected screen miRNAs. In the case of miR-486, for example, which did not affect the ErbB3 protein level, other targets must be responsible for its influence on ΔpAkt. An obvious candidate is PI3K and several miRNAs were predicted to target PI3KCA encoding for the catalytical domain of PI3K. PI3K mediates the generation of

PIP3 at the plasma membrane, which then serves as the activation platform for Akt, and loss of PI3K prevents Akt activation. Therefore, therapeutic inhibition of PI3K is highly effective in reducing tumor burden as PI3K activity is essential for mammary tumorigenesis and angiogenesis (Renner et al., 2008). Furthermore, in ~30% of all breast cancer samples, the PIK3CA gene harbors activating mutations with 80% of them residing in the helical (E542K 79

and E545K) or catalytic (H1047R) domains (Miller et al., 2011). Due to the fact that several tumors harboring PIK3CA activating mutations have been shown to be intrinsically resistant to PI3K p110α inhibitors (Elkabets et al., 2013), the miRNA-mediated downregulation of PI3K might be a promising approach for therapeutic application. Indeed, we confirmed the predicted downregulation of PI3KCA protein levels for miR-520a-3p (Figure 19). This is very likely mediated by direct targeting as PI3KCA was validated as a target in colorectal cancer cells (Arcaroli et al., 2012). Another promising candidate is the metalloproteinase ADAM17, which is overexpressed in multiple cancer types (Duffy et al., 2009), and has sheddase activity for the release of growth factor receptor ligands, including HRG and TGFβ (Gijsen et al., 2010). We were able to show that overexpression of the selected subset of miRNAs clearly reduced the ADAM17 mRNA levels. Downregulation of ADAM17 is of particular interest in the context of breast cancer as HRG is expressed in 30% of invasive breast tumor biopsies and is sufficient to promote tumorigenicity and metastasis of breast cancer cells in vivo (Atlas et al., 2003). Moreover, recent reports have indicated that increased ligand secretion is a compensatory mechanism to avoid treatment with kinase inhibitors (Harbinski et al., 2012). Neverthe- less, it remains to be clarified if downregulation of ADAM17 also occurs at the protein level resulting in a decreased HRG release.

Along with the impaired Akt activation, overexpression of the miRNA subset also strongly interfered with MAPK pathway activation as revealed by the reduced phosphorylation of Erk1/2 (Figure 20). Besides the targeting of ErbB3, reduced MAPK signaling can also be attributed to the loss of the predicted target genes SOS1, FRS2 or RAP1A. SOS1 and FRS2 mediate MAPK activation downstream of RTKs by binding to the receptor associated with Grb2 (Gotoh, 2008; Roskoski, 2012), while Rap1a is activated by multiple cell surface receptors and activates the MAPK pathway by stimulation of B-Raf (Vossler et al., 1997). In addition, reduced total protein levels of Erk1/2 were observed upon overexpression of miR-326, miR-520a-3p and miR-149 (Figure 10, Figure 20), although Erk1/2 was not among the predicted targets for these miRNAs (Figure 16). But recent evidence suggests that at least miR- 520a-3p-mediated downregulation of Erk1/2 might be a conserved mechanism as this was also observed in MDA-MB-231 cells (Uhlmann et al., 2012). miRNAs targeting Erk1/2 might be useful for the treatment of cells with acquired tamoxifen resistance as Erk and EGFR upregulation are frequently observed in tamoxifen-resistant breast cancer patients (Osborne et al., 2005; Nahta and O'Regan, 2012; Thrane et al., 2013). Moreover, the strong coregulation of the Akt and Erk pathways by the mRNAs is of special clinical interest as it was shown that sustained ErbB signaling after PI3K inhibition in ErbB2(+) cells is Erk dependent (Serra et al., 2011).

As the siRNA-mediated knockdown of ErbB2 had the severest effect on ΔpAkt, it is surprising that neither ErbB2 emerged as a high frequency target nor was a miRNA among the screen hits that targeted ErbB2, although there are several miRNAs published to target ErbB2, such as miR-125 (Scott et al., 2007), miR-193a-5p, miR-134, and, miR-331-3p (Leivonen et al., 2014). In conclusion, the miRNA-mediated regulation of ErbB2 is possibly of minor relevance in MCF7 cells. Considering that ErbB2 and EGFR function can already be efficiently blocked by pharmacological inhibition in the clinic and ErbB3 is transcriptionally

upregulated to compensate for the pharmacological inhibition of other RTKs not only in the context of breast cancer (Engelman et al., 2007; Sergina et al., 2007), the miRNA-mediated targeting of ErbB3 is of particular clinical relevance. This upregulation of ErbB3 levels is reported to be dependent on decreased PI3K/Akt pathway activity. Inactive Akt no longer phosphorylates the FoxO3a transcription factor which then translocates to the nucleus where it promotes expression of ErbB3 (Serra et al., 2011).

In conclusion, the broad target spectrum with ErbB3 as its central player unravels a novel tumor-suppressive function of miR-148b, miR-149, miR-326 and miR-520a-3p, which is in line with previous reports. miR-148b, for instance, has been shown to be downregulated in gastric cancer tissues and aggressive breast tumors (Song et al., 2011). Overexpression of miR-148b in cell lines impaired various steps of tumor progression, including chemotherapy response, tumor growth and metastasis formation partly caused by the downregulation of ITGA5, ROCK, and PI3KCA (Cimino et al., 2013). However, regulation of PI3KCA appears to depend on the cell type, as miR-148b did not affect PIK3CA expression in MCF7 cells, in accordance with our observations. By contrast, miR-520a-3p was highly potent in the downregulation of almost all investigated key molecules, including Akt itself (Figure 19, Fig- ure 20). This is of particular interest as to date apart from miR-100, there is only little experimental evidence for miRNAs directly targeting Akt (Jin et al., 2013). Considering the fact that Akt function is essential for a viable organism, the evolution of miRNAs targeting Akt might be restricted. Further, as Akt exists in different isoforms partly exerting isoform-specific functions, it has to be clarified which isoform is targeted. By activating downstream transcription factors, Akt was recently reported to regulate the expression of miRNAs, such as miR-149, the miR-34 cluster and miR-200 cluster, partly also in a isoform specific manner (Ju et al., 2007; Maroulakou et al., 2007; Iliopoulos et al., 2009). With this in mind, Akt might also act in a feedback mechanism by initiating the expression of miRNAs which potentially modulate Akt activity. Nevertheless, apart from its strong influence on ErbB/Akt signaling, the function of miRNA-520a-3p in cancer is a bit controversial as members of this cluster have oncogenic potential promoting breast cancer metastasis and invasion by targeting CD44 (Huang et al., 2008). But a recent report suggests that in ER(-) breast cancer cells miR-520c acts as a tumor suppressor by negatively affecting the TGFβ and NF-κB pathway at multiple levels and reducing migration and invasion of ER(-) breast cancer cells (Keklikoglou et al., 2012). This highlights the bivalent activity of certain miRNAs depending on the specific cellular context.

The role of miR-149 is also dependent on the cellular context as it was shown to be reduced especially in basal-like breast cancers where it functions as a tumor suppressor by strongly affecting cell motility as reported in the second part of the thesis. miR-326 was first reported in neurons where it is coexpressed with its host gene beta-arrestin (Arrb1) (Kim et al., 2004; Kefas et al., 2008), and downregulation of miR-326 in glioblastomas is associated with poor prognosis and high pathological grade (Kefas et al., 2008; Qiu et al., 2013). However, in breast cancer, expression of the host gene β-arrestin 1 promotes survival and metastatic growth (Shenoy et al., 2012). Nevertheless, recent studies suggest that intronic miRNAs are not necessarily transcribed with their host genes, and that their expression may be dependent on intronic drivers that can be activated in a tissue-specific manner (Monteys et al., 2010;

Marsico et al., 2013). And indeed, miR-326 expression levels were reported to be decreased in advanced breast cancer samples compared to normal tissue and inversely correlated with multidrug resistance (Liang et al., 2010). Another recent publication revealed that, in breast cancer cells, miR-326 directly targets B7-H3, an immunoregulatory protein which is involved in the anti-tumor response and is frequently overexpressed in several cancers (Nygren et al., 2014).

Profound analysis of the miRNA target network and further validation experiments will help to define the biological relevance of these miRNAs.

4.1.4 Protein target network of miRNAs enhancing ΔpAkt The miRNA/mRNA network of miRNAs enhancing ΔpAkt is less complex and interconnected, reflecting the fact that the number of proteins reducing ErbB2/ErbB3/Akt pathway activity is substantially smaller than the number of proteins being essential for pathway activity. Never- theless, target identification is of special interest as miRNAs enhancing ΔpAkt may act as oncomirs.

Increased ΔpAkt can be caused by a larger abundance of proximal ErbB receptors or a higher amount of downstream effector molecules. In fact, the top targeted protein inositol polyphosphate 5-phosphatase (INPP5B) is reported in both processes (Figure 16). In its function as a phosphatase, it mediates the hydrolysis of the 5-position of PtdIns(4,5)P2 and

PtdIns(3,4,5)P3 (Jefferson and Majerus, 1995) and loss of INPP5B may therefore yield a higher amount of the PI3K substrate PtdIns(4,5)P2 resulting in an higher amplitude of Akt activation. In addition, INPP5B has been found to act within the endocytic pathway as it local- izes to the membrane together with the early endosome marker Rab5 after serum stimulation (Shin et al., 2005), probably locally regulating membrane dynamics and receptor recycling (Williams et al., 2007). Moreover, the lipid composition itself is a major determinant of receptor abundance at the plasma membrane. A recent publication revealed that elevated levels of the ErbB downstream effector PIP3 favor the clathrin- and dynamin-based recycling of the EGFR rather than its proteasomal degradation, providing a constant reservoir of activated EGFR at the plasma membrane (Laketa et al., 2014).

As lipid homeostasis seems to be of major relevance to the ErbB and Akt signaling pathway, it is surprising that the lipid phosphatase PTEN was not among the top targets of the screen. PTEN is the predominant phosphatase involved in the negative regulation of Akt activity as it reverts PI3K activity by the hydrolysis of PIP3 at its 3-position. Moreover, PTEN is lost in ~30% of all breast cancer samples and loss of PTEN occurs mainly on the RNA or protein level as mutations are relatively uncommon in breast cancer (<5%) (Hennessy et al., 2005). But PTEN was neither among the predicted top targeted genes nor could we identify a miRNA downregulating PTEN protein levels, although several miRNAs are reported to target PTEN, including miR-214, miR-21, and miR-221 (Farazi et al., 2013). One reason might be the very strict cut-off, enriching especially those miRNAs that strongly enhanced HRG- induced Akt activity but displayed a reduced basal activity, which is not in accordance with PTEN loss.

In follow-up studies in the lab performed by Michaela Strotbek, the phosphatase PHLPP2, which mediates the dephosphorylation of Akt on S473, was confirmed to be downregulated by the screen hit miR-181d. In colorectal and lung cancer cells, suppression of PHLPP2, is reported to be mediated by miR-205 and miR-224. This was accompanied by the activation of Akt signaling and increased tumor growth in vivo. This effect was not only dependent on PHLPP2 as also other phosphatases were among the targets, like PTEN and PHLPP1 (Cai et al., 2013; Liao et al., 2013), indicating that modulating levels of phosphatases might be a possible mechanism for enhanced ΔpAkt. Indeed, apart from PHLPP2, the protein levels of INPP4B were also reduced upon overexpression of miR-181d (Michaela Strotbek, personal communication). Targeting INPP4B is of special interest as it dephosphorylates the 4- position phosphate of the inositol ring of PtdIns(3,4)P inhibiting PI3K-dependent Akt activation and loss of INPP4B occurs in 84% of all basal-like breast cancers (Fedele et al., 2010; Bertucci and Mitchell, 2013). Furthermore, a recent report has shown that INPP4B can reduce tyrosine phosphorylation of Akt and increasing evidence suggests that Akt tyrosine on Y176 or Y474 phosphorylation (Lopez et al., 2013), promotes recruitment to the plasma membrane and increases phosphorylation of Akt on T308 and S473 (Mahajan et al., 2010). The oncogenic role of the miR-181 family is further supported by some recent findings as miR-181c serves as a predictive marker for HER2(+) breast cancers (Lowery et al., 2009) and miR-181a was shown to be upregulated in triple-negative breast cancers (Taylor et al., 2013).

4.1.5 miRNAs regulate multiple targets within the ErbB/Akt pathway Target prediction was based on the most frequently targeted genes. Using this new approach, we aimed to reduce the number of false positive hits as bioinformatical target prediction is not fully reliable and targets were assembled without implementing a cut-off. Confirm- ing the reliability of this approach, the predicted positive and negative miRNA/target gene networks showed little overlapping target specificities, which is in agreement with their op- posing effects on ΔpAkt (Figure 17). The target networks provide a first insight how these miRNAs may regulate ΔpAkt. However, there are a few proteins that are present in both networks; PDE4D, RAP1A, EGFR, and mTORC2. These proteins are either false positive hits or, although targeted, their function may be of minor importance in our screen set-up as exemplified for the siRNA-mediated knockdown of the EGFR, which did not affect ΔpAkt (Figure 10B). This may also be the case for RAP1A which is critical for the regulation of migration and invasion processes (Alemayehu et al., 2013). The role of phosphodiesterase 4D (PDE4D), which has the highest overall frequency being targeted by 17 of the 43 screen hit miRNAs, is less clear as there are only very few reports focusing on the function of PDE4D. Nevertheless, a recent report revealed that PDE4D is part of a multi-protein complex that may contribute to the activation of mTORC1 and mTORC2 at the plasma membrane (Misra and Pizzo, 2011). Furthermore, in patients with triple negative breast cancer, the PDE4D gene frequently harbors homozygous microdeletions resulting in the expression of different isoforms and an increased protein level (Pullamsetti et al., 2013). However, further studies are necessary to interpret its role in the ErbB2/ErbB3/Akt pathway. By contrast, the presence of mTORC2 in both networks may be a little bit surprising as it mediates the second phos- 83

phorylation of Akt on S473, which strongly increases the catalytic activity of Akt and further broadens the substrate specificity of Akt to include FOXO transcription factors which are not phosphorylated in the absence of S473 phosphorylation (Guertin et al., 2006). Furthermore, mTORC2 is a well established therapeutic target for pharmacologic inhibition. However, phosphorylation of S473 was not the subject of our screen set-up as the readout was based on the initial phosphorylation of T308 mediated by PDK1. Therefore, targeting mTORC2 is not necessarily in conflict with the observed modulation of ΔpAkt and although mTORC2 is the predominant kinase of Akt phosphorylation on S473, it has been shown that other kinases like integrin-linked kinase (ILK) can also mediate this phosphorylation (Lee et al., 2013). Finally, because the relevant miRNAs target only single subunits of the mTORC2 protein complex, namely MTOR, RICTOR or MLST8, and it remains to be clarified if this really affects protein abundance or function.

4.1.6 Clinical relevance of miR-148b, miR-149 miR-326, and miR-520a-3p Taken together, we were able to show that the miRNAs affected the ErbB signaling pathway at multiple levels. Further the selected set of miRNAs reducing ΔpAkt, miR-149, miR-148b, miR-326, and miR-520a-3p all downregulated ErbB3. Consequently, and in agreement with previous publications and clinical data, these miRNAs might play an important tumor- suppressive role in breast cancer. But further experimental validation is necessary to confirm that the observed target specificity is conserved among different cell lines and is mediated by direct miRNA-mRNA interaction. miRNAs targeting ErbB3 and other regulatory proteins of the network would be ideal candidates for therapeutic application as clinical trials have shown that dual inhibition of the pathway is often superior to single pathway inhibitors. There- fore, by using miRNAs, cancer cells may less frequently escape targeted therapy by the upregulation of compensatory mechanisms. In conclusion, the identification and functional characterization of miRNAs targeting the ErbB signaling network may provide important insight into tumor cell behavior and potential resistance mechanisms to anti-cancer therapies.

4.2 miR-149 functions as a tumor suppressor by controlling breast epithelial cell migration and invasion

4.2.1 miR-149 is a novel tumor suppressor in basal-like breast cancer The function of miRNAs often depends on the cellular context and the specific gene expression pattern. Thus, for defining a physiological and pathological role of the miRNA candidates, we checked their expression levels using published datasets. We observed a significant downregulation of miR-149 in basal-like breast cancer cells and were able to confirm this expression pattern in a subset of different breast cancer cell lines (Enerly et al., 2011). In the previous section, we revealed that overexpression of miR-149 strongly reduced cell proliferation of the luminal cell line MCF7, which was partly attributed to the loss of ErbB3. In contrast, overexpression of miR-149 in the basal-like breast cancer cell line MDA-MB-231 did not affect proliferation (Figure 24A). However, this can in part be explained by the absence of ErbB3 expression in these cells. Nevertheless, overexpression of miR-149 potently suppressed migration and invasion in vitro (Figure 24B & C), and almost completely blocked lung colonization of MDA-MB-231 cells in vivo (Figure 34). The very potent anti-metastatic function of miR-149 is further supported by another dataset revealing the downregulation of miR-149 in more advanced stages of breast cancer (Blenkiron et al., 2007). Furthermore, downregulation of miR-149 is also reported in other cancers, including gliomas, gastric cancer and prostate cancer (Schaefer et al., 2009; Pan et al., 2012; Wang et al., 2012). Indeed, using the prostate cancer cell line PC3, we confirmed low miRNA expression of miR-149 (data not shown). Further, the miR-149-induced inhibitory effects on migration, adhesion and invasion seen in MDA-MB-231 cells was recapitulated in PC3 cells (Figure 33), indicating that the mechanisms contributing to the observed phenotype might be conserved. In this context, the transcription factors SP1, FOXM1, and ZBTB2 were identified as direct miR-149 targets and their inhibition was assumed to be responsible for the tumor-suppressive function of miR-149 (Wang et al., 2012; Ke et al., 2013; Wang et al., 2013). Moreover, a very recent publication by Chan et al. revealed additional downregulation of miR-149 in highly metastatic sublines of MDA-MB-231. The authors attributed the tumor-suppressive function of miR-149 to the direct targeting of GIT1 (Chan et al., 2014). miR-149 thus appears to act as a general oncosuppressive miRNA by interfering with different proliferative and metastatic signaling pathways, the precise nature of which are dependent on the cell type.

4.2.2 miR-149 affects the activity of focal adhesion proteins and focal adhesion formation Our data revealed that overexpression of miR-149 strongly impaired cell motility in different basal-like breast cancer cell lines and the prostate cancer cell line PC3. In general, cell motility can be subdivided into different inter-connected cellular processes, including adhesion, spreading, migration and invasion, with each process being characterized by a distinct set of proteins and molecules. To reveal which of these processes might be regulated by miR-149, we overexpressed miR-149 in different cell lines and assessed cell motility using a broad

range of cellular assays. In cells overexpressing miR-149, the process of initial adhesion was obviously not affected as the number of freshly adhered cells was comparable to the control (data not shown). However, we observed an impaired cell spreading on collagen (Figure 26), fibronectin and plastic (data not shown), indicating that the spreading defect seems to be ECM-independent. In fact, immunofluorescent studies of adhering cells overexpressing miR- 149 revealed that although cells readily assembled focal adhesion components at focal contact sites (Figure 27), they failed to establish mature adhesions as shown by vinculin and active β1-integrin staining (data not shown). Lacking stable focal adhesions, these cells exhibited a disorganized cell cytoskeleton and did not develop prominent stress fibers. Never- theless, total signal intensities remained unaffected, indicating that the observed phenotype might be due to reduced protein activity rather than to the loss of essential scaffolding proteins. This idea was further supported by Western Blot analysis revealing reduced phosphorylation of paxillin (Y118) and Src, leaving the total protein levels unchanged (Figure 28). Re- duced paxillin phosphorylation can partly be attributed to the reduced Src activity as upon integrin engagement, paxillin is phosphorylated at the residues Y31 and Y118 in a FAK- and Src-dependent manner (Bellis et al., 1997; Thomas et al., 1999). On the one hand, phosphorylated paxillin serves as a docking site for the Rac1- and Cdc42-GEF activity of DOCK180 promoting local Rac1 activity. On the other hand, phosphorylated paxillin indirectly inhibits RhoA activity by releasing p190RhoGAP (Tsubouchi et al., 2002). This spatiotemporal activation of Rac1 and inhibition of RhoA is necessary for efficient leading edge protrusion and the formation of nascent adhesions during cell migration (Petrie et al., 2009).

4.2.3 Overexpression of miR-149 reduces Rac activity and has anti-metastatic function in vitro and in vivo Based on target prediction, we were able to identify several targets relevant for Rac activity and confirmed reduced total Rac activity in miR-149 expressing MDA-MB-231 and PC3 cells (Figure 31, Figure 33C), thus providing an explanation for both the suppression of cell spreading and the impaired directionality of single cell motility and haptotactic migration in Transwell assays (Figure 24B & C, Figure 33B). Rac exists in three isforms; Rac1, Rac2, and Rac3; with Rac1 being best studied (Bustelo et al., 2007). Upon integrin engagement, Rac1 is locally activated at the plasma membrane and promotes protrusions and directional cell migration. Rac is known to drive the mesenchymal type of cancer cell motility characterized by cell polarization and the matrix-dependent establishment of cell protrusions at the leading edge (Petrie et al., 2009). Overexpression of constitutively active Rac1 in MDA-MB-231 cells rescued the initial spreading defect induced by miR-149 (Figure 32B & C), but was not sufficient to restore migration in Transwell assays. This can be explained by the fact that Rac hyperactivation generates multiple lamellipodia, thereby preventing polarization and inducing random motility (Petrie et al., 2009). This phenotype was confirmed by the immunofluorescence studies, as control cells overexpressing active Rac displayed a rounder morphology and were not polarized when compared to the control cells only expressing the empty vector (Figure 32B).

To assess the tumor suppressive potential of miR-149 in vivo, we investigated the metastatic potential of cells overexpressing miR-149 in a mouse model. Because we did not obtain MDA-MB-231 cells stably expressing miR-149, an orthotopic mouse model measuring metastasis formation from the primary tumor could not be investigated. Instead, we injected cells into the tail veins of mice, a procedure compatible with transient miRNA expression. Shortly after injection, cells are trapped in the lung capillaries where they extravasate and then colonize the lung (Bos et al., 2010). In fact, in mice injected with cells overexpressing miR-149, metastatic lung colonization was almost blocked completely (Figure 34). Based on the in vitro data, it can be assumed that miR-149 expression blocks the first steps of this process that rely on cell adhesion and invasion. However, because miR-149 overexpression was still detected 9 days post transfection in vitro (data not shown), we cannot rule out that miR-149 also negatively affected additional factors that facilitate metastatic colonization of the lung.

4.2.4 miR-149 downregulates the Rac effector proteins Rap1A, Rap1B and Vav2 Bioinformatical analysis already indicated a dramatic regulatory function of miR-149 in various processes influencing actin dynamics and membrane associated processes, with the most prominent being ‘focal adhesion’ consisting of 13 proteins. We showed that miR-149 expression reduced the transcript levels of Rap1A, Rap1B and Vav2, most likely by a direct mechanism that involves miR-149 binding to the predicted recognition sites within the 3’ UTRs. Rap1, a member of the Ras subfamily of small GTPases, is reported to activate Rac1 to enhance cell spreading, integrin activation and focal adhesion formation. There are two isoforms of Rap1 encoded by two separate genes, RAP1A and RAP1B. Rap1a also interacts with Vav2, which is then recruited to the plasma membrane where it acts as a GEF for RhoA, Cdc42 and Rac1 (Arthur et al., 2004; Hornstein et al., 2004). The downregulation of these genes is likely to contribute to the reduced Rac-GTP levels measured in spreading cells (Figure 31). However, it is important to note that Rap1 and Vav2 possess additional Rac- independent functions associated with the metastatic process. It was recently shown that Vav2 and Vav3 synergize to sustain tumor growth, neoangiogenesis, and lung-specific metastasis of breast cancer cells, in part by Rho GTPase independent pathways (Citterio et al., 2012). Similarly, apart from its function in integrin signaling, Rap1 utilizes different effectors to control cell polarity and cell-cell adhesion, the deregulation of which contributes to neoplastic transformation (Frische and Zwartkruis, F J T, 2010).

Thus far, there is little evidence for the direct miRNA-mediated suppression of the individual Rac isoforms. miR-142-3p was reported to target Rac1, regulating migration and invasion of hepatocellular carcinoma cell lines (Wu et al., 2011). Tiam as a positive upstream regulator of Rac was identified to be subject to miRNA regulation by miR-10b which suppressed cell migration and invasion of breast cancer cells (Moriarty et al., 2010). However, in colon cancer cells, downregulation of Tiam by miR-21 and miR-31 was associated with enhanced motility (Cottonham et al., 2010), again highlighting the importance of the specific cell context. Interestingly, in head and neck squamous cell carcinoma cells, the loss of let-7i induced a morphological switch to a mesenchymal, Rac-dependent mode of invasion. let-7i was identi-

fied to target Nedd9 and DOCK3, both of which are activators of Rac (Yang et al., 2010). The latter report is in accordance with the notion that miRNA function is not mediated by a single target but rather corresponds to the net effect of the regulation of an entire set of targets.

4.2.5 Conclusions and outlook In their function as regulators of gene expression, miRNAs have emerged as promising tools as novel biomarkers and for therapeutic application. In this thesis, we focused especially on the role of miRNAs in two processes that are of major interest to breast cancer research: the ErbB2/ErbB3/Akt signaling pathway contributing to therapy resistance, and cell motility being of central importance for cancer metastasis.

With regard to the ErbB2/ErbB3/Akt signaling pathway, we revealed that the selected subset of screen hit miRNAs may exert their regulatory function by coordinated suppression of multiple proteins within the pathway, including the key molecule ErbB3. Loss of ErbB3 was very likely the major cause for the observed decrease in pathway activity and the reduced HRG- dependent proliferation. In the future, further experiments will be necessary to validate direct targeting or to reveal the mechanism by which downregulation of the proteins is achieved. Furthermore, the specific inhibition of the endogenous miRNA by LNA-modified antisense oligonucleotides should revert the phenotype, confirming the physiological importance of these miRNAs in HRG signaling. Moreover, to validate the tumor-suppressive function of our miRNA subset, clinical datasets should be analyzed to prove clinical significance and finally experiments should be performed in the appropriate cancer specific context. Regarding miR- 149 function, we have already been able to address some of these aspects in the second part of this thesis. Based on clinical datasets revealing reduced miR-149 levels in basal-like breast cancer, we investigated miR-149 function in different basal-like breast cancer cell lines. We were able to show very clearly that miR-149 possesses anti-metastatic function in vitro and in vivo. We also addressed the underlying mechanisms, providing evidence that miR-149 interfered with signaling downstream of integrin receptors and RTKs at multiple levels by impairing Rac activation. Moreover, we shed light on the fact that Rac activity was reduced by the downregulation of several Rac regulatory proteins, including Rap1A and Rap1B, and Vav2. Taken together, our present study, in line with other publications, suggests that miR-149 is a potential candidate for prognostic and therapeutic application. How- ever, one obstacle is still the appropriate application of miRNA into the human body. Not only are more and more miRNAs now being integrated into clinical trials as biomarkers for prognosis and clinical response, they are also promising as anti-cancer therapeutics. For example, MRX34, an intravenously injected liposome-formulated miR-34 mimic, has recently en- tered clinical trials for patients with advanced or metastatic liver cancer (Bader, 2012). The increased understanding of miRNA biology and function together with improved targeted de- livery systems will hopefully also promote the development of miRNA-based agents for the treatment of basal breast cancer.

List of Figures

Figure 1: Cancer development ...... 18 Figure 2: ErbB receptor family...... 19 Figure 3: Signaling downstream of the ErbB2-ErbB3 dimer ...... 21 Figure 4: PI3K/Akt signaling pathway ...... 23 Figure 5: Biogenesis of miRNAs ...... 28 Figure 6: miRNA-mRNA interaction ...... 50 Figure 8: miR-149 is predicted to bind ErbB3 ...... 51 Figure 9: Expression of miR-149-5p affects Akt activation by directly targeting ErbB3...... 53 Figure 11: Workflow of the screening procedure ...... 54 Figure 12: Correlation analysis...... 55 Figure 13: MicroRNA screen data ...... 56 Figure 14: Bioinformatical analysis of the screen data ...... 56 Figure 15: Analysis of the screen data ...... 57 Figure 16: miRNAs-target gene interaction network ...... 60 Figure 18: miRNA-protein interaction network for negative regulators of HRG signaling ...... 61 Figure 19: miR-148b, miR-149, miR-326 and miR-520a-3p target key molecules of the pathway ...... 62 Figure 20: miR-148b, miR-326 and miR-520a-3p affect the ErbB2-ErbB3 signaling pathway on multiple levels ...... 63 Figure 21: miR-148b, miR326 and miR-520a-3p affect HRG-dependent cell growth ...... 64 Figure 22: Reduced expression of miR-149 in basal breast cancer...... 65 Figure 23: Reduced expression of miR-149 in basal breast cancer cells ...... 66 Figure 24: Expression of miR-149 reduces cell migration and invasion in MDA-MB-231...... 66 Figure 25: Expression of miR-149 impairs the directionality of cell movement ...... 67 Figure 26: miR-149 interferes with cell spreading on collagen ...... 68 Figure 27: miR-149 affects polarization of actin cytoskeleton during cell spreading on collagen...... 69 Figure 28: miR-149 interferes with cell spreading on collagen ...... 69 Figure 29: miR-149 targets molecules downstream of the integrin pathway ...... 70 Figure 30: mir-149 targets molecules downstream of the integrin pathway ...... 71 Figure 31: miR-149 impairs Rac activation MDA-MB-231 ...... 72 Figure 32: Rac inhibition blocks cell migration and active Rac restores spreading of miR-149 expressing cells ...... 73 Figure 33: miR-149 impairs with integrin-dependent signaling and cell motility in the prostate cancer cell line PC3 ...... 74 Figure 34: miR-149 blocks lung colonization in vivo...... 74 89

List of Tables

Table 1: List of commonly used target prediction algorithms...... 30 Table 2: List of equipment used in this thesis ...... 35 Table 3: List of chemicals used in this thesis ...... 36 Table 4: List of consumables used in this thesis ...... 37 Table 5: List of buffers and solutions used in this thesis ...... 37 Table 6: List of cell lines used in this thesis ...... 38 Table 7: List of cell culture reagents used in this thesis ...... 38 Table 8: List of miRNAs used in this thesis...... 39 Table 9: List of siRNAs used in this thesis ...... 39 Table 10: List of SMARTpools used in this thesis ...... 39 Table 11: List of primers used in this thesis ...... 40 Table 12: List of qPCR primers used in this thesis ...... 40 Table 13: List of qPCR primers used in this thesis ...... 40 Table 14: List of plasmid vectors used in this thesis ...... 40 Table 15: List of fluorescence labeled primary antibodies used in this thesis ...... 41 Table 16: List of primary antibodies used in this thesis ...... 41 Table 17: List of secondary antibodies used in this thesis ...... 42 Table 18: List of kits and enzymes used in this thesis...... 42 Table 19: Reagents for PCR ...... 44 Table 20: program for the thermal cycler ...... 44 Table 21: Program used for reverse transcription and qPCR...... 47 Table 22: Program used for RT-qPCR...... 47 Table 23: List of predicted miR-149 target genes according to their KEGG pathway annotation...... 70 Table 24: Detailed list of the Dharmacon miRIDIAN® microRNA Library...... 107 Table 25: Screen data results...... 112 Table 26: miRNA target list predicted by microRNA.org...... 124 Table 27: miRNA target list predicted by MicroCosm...... 127 Table 28: miRNA target list predicted by miRDB...... 129

5 List of References Alemayehu, M., Dragan, M., Pape, C., Siddiqui, I., and Sacks, D.B., et al. (2013). β-Arrestin2 regulates lysophosphatidic acid-induced human breast tumor cell migration and invasion via Rap1 and IQGAP1. PLoS ONE 8, e56174. Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., and Carrington, J.C., et al. (2003). A uniform system for microRNA annotation. RNA 9, 277-279. Arcaroli, J.J., Quackenbush, K.S., Powell, R.W., Pitts, T.M., and Spreafico, A., et al. (2012). Common PIK3CA mutants and a novel 3' UTR mutation are associated with increased sensitivity to saracatinib. Clin. Cancer Res. 18, 2704-2714. Arthur, W.T., Quilliam, L.A., and Cooper, J.A. (2004). Rap1 promotes cell spreading by localizing Rac guanine nucleotide exchange factors. J Cell Biol 167, 111-122. Atlas, E., Cardillo, M., Mehmi, I., Zahedkargaran, H., and Tang, C., et al. (2003). Heregulin is sufficient for the promotion of tumorigenicity and metastasis of breast cancer cells in vivo. Mol. Cancer Res. 1, 165-175. Bader, A.G. (2012). miR-34 - a microRNA replacement therapy is headed to the clinic. Front Genet 3, 120. Bader AG, Lammers P (2011). The therapeutic potential of microRNAs. Innovations in Phar- maceutical Technology., 52-55. Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136, 215- 233. Baselga, J., and Swain, S.M. (2009). Novel anticancer targets: revisiting ERBB2 and discov- ering ERBB3. Nat. Rev. Cancer 9, 463-475. Basu, A., and Sivaprasad, U. (2007). Protein kinase Cepsilon makes the life and death deci- sion. Cell. Signal. 19, 1633-1642. Bellis, S.L., Perrotta, J.A., Curtis, M.S., and Turner, C.E. (1997). Adhesion of fibroblasts to fibronectin stimulates both serine and tyrosine phosphorylation of paxillin. Biochem. J. 325 ( Pt 2), 375-381. Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B 57, 289-300. Berezikov, E. (2011). Evolution of microRNA diversity and regulation in animals. Nat. Rev. Genet. 12, 846-860. Berger, M.B., Medrola, J.M., and Lemmon, M.A. (2004). ErbB3/HER3 does not homodimerize upon neuregulin binding at the cell surface. FEBS Letters 569, 332-336. Bernstein, E., Kim, S.Y., Carmell, M.A., Murchison, E.P., and Alcorn, H., et al. (2003). Dicer is essential for mouse development. Nat. Genet. 35, 215-217. Bertucci, M.C., and Mitchell, C.A. (2013). Phosphoinositide 3-kinase and INPP4B in human breast cancer. Ann. N. Y. Acad. Sci. 1280, 1-5.

Betel, D., Wilson, M., Gabow, A., Marks, D.S., and Sander, C. (2008). The microRNA.org resource: targets and expression. Nucleic Acids Res. 36, D149-53. Bill, A., Schmitz, A., Albertoni, B., Song, J.-N., and Heukamp, L.C., et al. (2010). Cytohesins are cytoplasmic ErbB receptor activators. Cell 143, 201-211. Blenkiron, C., Goldstein, L.D., Thorne, N.P., Spiteri, I., and Chin, S.-F., et al. (2007). MicroRNA expression profiling of human breast cancer identifies new markers of tumor subtype. Genome Biol. 8, R214. Bos, P.D., Nguyen, D.X., and Massagué, J. (2010). Modeling metastasis in the mouse. Curr Opin Pharmacol 10, 571-577. Breuleux, M. (2007). Role of heregulin in human cancer. Cell. Mol. Life Sci. 64, 2358-2377. Burgess, A.W., Cho, H.-S., Eigenbrot, C., Ferguson, K.M., and Garrett, Thomas P J, et al. (2003). An open-and-shut case? Recent insights into the activation of EGF/ErbB receptors. Mol. Cell 12, 541-552. Bustelo, X.R., Sauzeau, V., and Berenjeno, I.M. (2007). GTP-binding proteins of the Rho/Rac family: regulation, effectors and functions in vivo. Bioessays 29, 356-370. Cai, J., Fang, L., Huang, Y., Li, R., and Yuan, J., et al. (2013). miR-205 targets PTEN and PHLPP2 to augment AKT signaling and drive malignant phenotypes in non-small cell lung cancer. Cancer Res. 73, 5402-5415. Calin, G.A., Dumitru, C.D., Shimizu, M., Bichi, R., and Zupo, S., et al. (2002). Frequent dele- tions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. U.S.A. 99, 15524-15529. Campbell, M.R., Amin, D., and Moasser, M.M. (2010). HER3 comes of age: new insights into its functions and role in signaling, tumor biology, and cancer therapy. Clin. Cancer Res. 16, 1373-1383. Cantley, L.C. (2002). The phosphoinositide 3-kinase pathway. Science 296, 1655-1657. Cantley, L.C., and Neel, B.G. (1999). New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc. Natl. Acad. Sci. U.S.A. 96, 4240-4245. Cargnello, M., and Roux, P.P. (2011). Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 75, 50-83. Carpten, J.D., Faber, A.L., Horn, C., Donoho, G.P., and Briggs, S.L., et al. (2007). A trans- forming mutation in the pleckstrin homology domain of AKT1 in cancer. Nature 448, 439- 444. Chan, S.-H., Huang, W.-C., Chang, J.-W., Chang, K.-J., and Kuo, W.-H., et al. (2014). MicroRNA-149 targets GIT1 to suppress integrin signaling and breast cancer metastasis. Oncogene 0. e10.1038/onc.2014.10 Chen, J.-F., Mandel, E.M., Thomson, J.M., Wu, Q., and Callis, T.E., et al. (2006). The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 38, 228-233.

Chen, W.S., Xu, P.Z., Gottlob, K., Chen, M.L., and Sokol, K., et al. (2001). Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 15, 2203-2208. Cho, H., Mu, J., Kim, J.K., Thorvaldsen, J.L., and Chu, Q., et al. (2001). Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292, 1728-1731. Cimino, D., Pitta, C. de, Orso, F., Zampini, M., and Casara, S., et al. (2013). miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. The FASEB Journal 27, 1223-1235. Cimmino, A., Calin, G.A., Fabbri, M., Iorio, M.V., and Ferracin, M., et al. (2005). miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. U.S.A. 102, 13944- 13949. Citterio, C., Menacho-Márquez, M., García-Escudero, R., Larive, R.M., and Barreiro, O., et al. (2012). The rho exchange factors vav2 and vav3 control a lung metastasis-specific transcriptional program in breast cancer cells. Sci Signal 5, ra71. Collado, M., Blasco, M.A., and Serrano, M. (2007). Cellular senescence in cancer and aging. Cell 130, 223-233. Cottonham, C.L., Kaneko, S., and Xu, L. (2010). miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J. Biol. Chem. 285, 35293- 35302. Croft, D., O'Kelly, G., Wu, G., Haw, R., and Gillespie, M., et al. (2011). Reactome: a database of reactions, pathways and biological processes. Nucleic Acids Res. 39, D691-7. Dangi-Garimella, S., Yun, J., Eves, E.M., Newman, M., and Erkeland, S.J., et al. (2009). Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J. 28, 347-358. DiGiovanna, M.P., Chu, P., Davison, T.L., Howe, C.L., and Carter, D., et al. (2002). Active signaling by HER-2/neu in a subpopulation of HER-2/neu-overexpressing ductal carcinoma in situ: clinicopathological correlates. Cancer Res. 62, 6667-6673. Djebali, S., Davis, C.A., Merkel, A., Dobin, A., and Lassmann, T., et al. (2012). Landscape of transcription in human cells. Nature 489, 101-108. Downward, J. (2003). Targeting RAS signalling pathways in cancer therapy. Nat. Rev. Can- cer 3, 11-22. Duffy, M.J., McKiernan, E., O'Donovan, N., and McGowan, P.M. (2009). Role of ADAMs in cancer formation and progression. Clin. Cancer Res. 15, 1140-1144. Dummler, B., Tschopp, O., Hynx, D., Yang, Z.-Z., and Dirnhofer, S., et al. (2006). Life with a single isoform of Akt: mice lacking Akt2 and Akt3 are viable but display impaired glucose homeostasis and growth deficiencies. Mol. Cell. Biol. 26, 8042-8051. Duronio, V. (2008). The life of a cell: apoptosis regulation by the PI3K/PKB pathway. Biochem. J. 415, 333-344.

Easton, R.M., Cho, H., Roovers, K., Shineman, D.W., and Mizrahi, M., et al. (2005). Role for Akt3/protein kinase Bgamma in attainment of normal brain size. Mol. Cell. Biol. 25, 1869- 1878. Eleniste, P.P., and Bruzzaniti, A. (2012). Focal adhesion kinases in adhesion structures and disease. J Signal Transduct 2012, 296450. Elkabets, M., Vora, S., Juric, D., Morse, N., and Mino-Kenudson, M., et al. (2013). mTORC1 inhibition is required for sensitivity to PI3K p110α inhibitors in PIK3CA-mutant breast cancer. Sci Transl Med 5, 196ra99. Enerly, E., Steinfeld, I., Kleivi, K., Leivonen, S.-K., and Aure, M.R., et al. (2011). miRNA- mRNA integrated analysis reveals roles for miRNAs in primary breast tumors. PLoS ONE 6, e16915. Engelman, J.A., Luo, J., and Cantley, L.C. (2006). The evolution of phosphatidylinositol 3- kinases as regulators of growth and metabolism. Nat. Rev. Genet. 7, 606-619. Engelman, J.A., Zejnullahu, K., Mitsudomi, T., Song, Y., and Hyland, C., et al. (2007). MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 316, 1039-1043. Esteller, M. (2011). Non-coding RNAs in human disease. Nat. Rev. Genet. 12, 861-874. Fantozzi, A., and Christofori, G. (2006). Mouse models of breast cancer metastasis. Breast Cancer Res. 8, 212. Farazi, T.A., Hoell, J.I., Morozov, P., and Tuschl, T. (2013). MicroRNAs in human cancer. Adv. Exp. Med. Biol. 774, 1-20. Fedele, C.G., Ooms, L.M., Ho, M., Vieusseux, J., and O'Toole, S.A., et al. (2010). Inositol polyphosphate 4-phosphatase II regulates PI3K/Akt signaling and is lost in human basal- like breast cancers. Proc. Natl. Acad. Sci. U.S.A. 107, 22231-22236. Fiddes, R.J., Campbell, D.H., Janes, P.W., Sivertsen, S.P., and Sasaki, H., et al. (1998). Analysis of Grb7 recruitment by heregulin-activated erbB receptors reveals a novel target selectivity for erbB3. J. Biol. Chem. 273, 7717-7724. Fornari, F., Milazzo, M., Galassi, M., Callegari, E., and Veronese, A., et al. (2014). p53/mdm2 Feedback Loop Sustains miR-221 Expression and Dictates the Response to Anticancer Treatments in Hepatocellular Carcinoma. Mol. Cancer Res. Fortier, A.-M., Asselin, E., and Cadrin, M. (2011). Functional specificity of Akt isoforms in cancer progression. BioMolecular Concepts 2, 1-11. Franceschini, A., Szklarczyk, D., Frankild, S., Kuhn, M., and Simonovic, M., et al. (2013). STRING v9.1: protein-protein interaction networks, with increased coverage and integra- tion. Nucleic Acids Res. 41, D808-15. Frische, E.W., and Zwartkruis, F J T (2010). Rap1, a mercenary among the Ras-like GTPases. Dev. Biol. 340, 1-9. Fry, W.H., Kotelawala, L., Sweeney, C., and Carraway, K.L. (2009). Mechanisms of ErbB receptor negative regulation and relevance in cancer. Experimental Cell Research 315, 697-706.

Gao, Y., Dickerson, J.B., Guo, F., Zheng, J., and Zheng, Y. (2004). Rational design and characterization of a Rac GTPase-specific small molecule inhibitor. Proc Natl Acad Sci U S A 101, 7618-7623. Geiger, B., Spatz, J.P., and Bershadsky, A.D. (2009). Environmental sensing through focal adhesions. Nat. Rev. Mol. Cell Biol. 10, 21-33. Gijsen, M., King, P., Perera, T., Parker, P.J., and Harris, A.L., et al. (2010). HER2 Phosphor- ylation Is Maintained by a PKB Negative Feedback Loop in Response to Anti-HER2 Her- ceptin in Breast Cancer. PLoS Biol 8, e1000563. Gong, C., Yao, Y., Wang, Y., Liu, B., and Wu, W., et al. (2011). Up-regulation of miR-21 mediates resistance to trastuzumab therapy for breast cancer. J. Biol. Chem. 286, 19127- 19137. Gotoh, N. (2008). Regulation of growth factor signaling by FRS2 family docking/scaffold adaptor proteins. Cancer Sci. 99, 1319-1325. Griffiths-Jones, S., Saini, H.K., van Dongen, S., and Enright, A.J. (2008). miRBase: tools for microRNA genomics. Nucleic Acids Res. 36, D154-8. Grimson, A., Farh, K.K.-H., Johnston, W.K., Garrett-Engele, P., and Lim, L.P., et al. (2007). MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol. Cell 27, 91-105. Guertin, D.A., Stevens, D.M., Thoreen, C.C., Burds, A.A., and Kalaany, N.Y., et al. (2006). Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Dev. Cell 11, 859-871. Harbinski, F., Craig, V.J., Sanghavi, S., Jeffery, D., and Liu, L., et al. (2012). Rescue screens with secreted proteins reveal compensatory potential of receptor tyrosine kinases in driving cancer growth. Cancer Discov 2, 948-959. Hatley, M.E., Patrick, D.M., Garcia, M.R., Richardson, J.A., and Bassel-Duby, R., et al. (2010). Modulation of K-Ras-dependent lung tumorigenesis by MicroRNA-21. Cancer Cell 18, 282-293. He, L., and Hannon, G.J. (2004). MicroRNAs: small RNAs with a big role in gene regulation. Nature reviews. Genetics 5, 522-531. Hennessy, B.T., Smith, D.L., Ram, P.T., Lu, Y., and Mills, G.B. (2005). Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 4, 988-1004. Hinohara, K., Kobayashi, S., Kanauchi, H., Shimizu, S., and Nishioka, K., et al. (2012). ErbB receptor tyrosine kinase/NF-κB signaling controls mammosphere formation in human breast cancer. Proc. Natl. Acad. Sci. U.S.A. 109, 6584-6589. Holbro, T., Beerli, R.R., Maurer, F., Koziczak, M., and Barbas, C.F., et al. (2003). The ErbB2/ErbB3 heterodimer functions as an oncogenic unit: ErbB2 requires ErbB3 to drive breast tumor cell proliferation. Proc. Natl. Acad. Sci. U.S.A. 100, 8933-8938. Hornstein, I., Alcover, A., and Katzav, S. (2004). Vav proteins, masters of the world of cytoskeleton organization. Cell. Signal. 16, 1-11.

Huang, Q., Gumireddy, K., Schrier, M., Le Sage, C., and Nagel, R., et al. (2008). The mi- croRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat. Cell Biol. 10, 202-210. Humphries, J.D., Wang, P., Streuli, C., Geiger, B., and Humphries, M.J., et al. (2007). Vinculin controls focal adhesion formation by direct interactions with talin and actin. J. Cell Biol. 179, 1043-1057. Hynes, N.E., and Lane, H.A. (2005). ERBB receptors and cancer: the complexity of targeted inhibitors. Nat. Rev. Cancer 5, 341-354. Ikenoue, T., Kanai, F., Hikiba, Y., Obata, T., and Tanaka, Y., et al. (2005). Functional analysis of PIK3CA gene mutations in human colorectal cancer. Cancer Res. 65, 4562-4567. Iliopoulos, D., Polytarchou, C., Hatziapostolou, M., Kottakis, F., and Maroulakou, I.G., et al. (2009). MicroRNAs differentially regulated by Akt isoforms control EMT and stem cell renewal in cancer cells. Sci Signal 2, ra62. Iorio, M.V., Ferracin, M., Liu, C.-G., Veronese, A., and Spizzo, R., et al. (2005). MicroRNA gene expression deregulation in human breast cancer. Cancer Res. 65, 7065-7070. Jefferson, A.B., and Majerus, P.W. (1995). Properties of type II inositol polyphosphate 5- phosphatase. J. Biol. Chem. 270, 9370-9377. Jin, Y., Tymen, S.D., Chen, D., Fang, Z.J., and Zhao, Y., et al. (2013). MicroRNA-99 Family Targets AKT/mTOR Signaling Pathway in Dermal Wound Healing. PLoS ONE 8, e64434. Ju, X., Katiyar, S., Wang, C., Liu, M., and Jiao, X., et al. (2007). Akt1 governs breast cancer progression in vivo. Proc. Natl. Acad. Sci. U.S.A. 104, 7438-7443. Kadamur, G., and Ross, E.M. (2013). Mammalian phospholipase C. Annu. Rev. Physiol. 75, 127-154. Kanehisa, M., Goto, S., Sato, Y., Furumichi, M., and Tanabe, M. (2011). KEGG for integra- tion and interpretation of large-scale molecular data sets. Nucleic Acids Research 40, D109. Kastan, M.B., and Bartek, J. (2004). Cell-cycle checkpoints and cancer. Nature 432, 316- 323. Kawano, S., Ikeda, W., Kishimoto, M., Ogita, H., and Takai, Y. (2009). Silencing of ErbB3/ErbB2 signaling by immunoglobulin-like Necl-2. J. Biol. Chem. 284, 23793-23805. Ke, Y., Zhao, W., Xiong, J., and Cao, R. (2013). miR-149 Inhibits Non-Small-Cell Lung Can- cer Cells EMT by Targeting FOXM1. Biochem Res Int 2013, 506731. Kefas, B., Godlewski, J., Comeau, L., Li, Y., and Abounader, R., et al. (2008). microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 68, 3566-3572. Keklikoglou, I., Koerner, C., Schmidt, C., Zhang, J.D., and Heckmann, D., et al. (2012). MicroRNA-520/373 family functions as a tumor suppressor in estrogen receptor negative breast cancer by targeting NF-κB and TGF-β signaling pathways. Oncogene 31, 4150- 4163.

Kim, J., Krichevsky, A., Grad, Y., Hayes, G.D., and Kosik, K.S., et al. (2004). Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc. Natl. Acad. Sci. U.S.A. 101, 360-365. Klein, U., Lia, M., Crespo, M., Siegel, R., and Shen, Q., et al. (2010). The DLEU2/miR- 15a/16-1 cluster controls B cell proliferation and its deletion leads to chronic lymphocytic leukemia. Cancer Cell 17, 28-40. Koressaar, T., and Remm, M. (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics 23, 1289-1291. Kramer, F., Bayerlova, M., Klemm, F., Bleckmann, A., and Beissbarth, T. (2013). rBiopaxParser--an R package to parse, modify and visualize BioPAX data. Bioinformatics 29, 520-522. Laketa, V., Zarbakhsh, S., Traynor-Kaplan, A., Macnamara, A., and Subramanian, D., et al. (2014). PIP₃ induces the recycling of receptor tyrosine kinases. Sci Signal 7, ra5. Le Clainche, C., and Carlier, M.-F. (2008). Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiol. Rev. 88, 489-513. Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843-854. Lee, S.-L., Chou, C.-C., Chuang, H.-C., Hsu, E.-C., and Chiu, P.-C., et al. (2013). Functional Role of mTORC2 versus Integrin-Linked Kinase in Mediating Ser473-Akt Phosphorylation in PTEN-Negative Prostate and Breast Cancer Cell Lines. PLoS ONE 8, e67149. Leivonen, S.-K., Sahlberg, K.K., Mäkelä, R., Due, E.U., and Kallioniemi, O., et al. (2014). High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol 8, 93-104. Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., and Connor, M.K., et al. (2002). PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated G1 arrest. Nat. Med. 8, 1153-1160. Liang, Z., Li, Y., Huang, K., Wagar, N., and Shim, H. (2011). Regulation of miR-19 to Breast Cancer Chemoresistance Through Targeting PTEN. Pharm Res 28, 3091-3100. Liang, Z., Wu, H., Xia, J., Li, Y., and Zhang, Y., et al. (2010). Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem. Pharmacol. 79, 817-824. Liao, W.-T., Li, T.-T., Wang, Z.-G., Wang, S.-Y., and He, M.-R., et al. (2013). microRNA-224 promotes cell proliferation and tumor growth in human colorectal cancer by repressing PHLPP1 and PHLPP2. Clin. Cancer Res. 19, 4662-4672. Ling, H., Fabbri, M., and Calin, G.A. (2013). MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat Rev Drug Discov 12, 847-865. Lopez, S.M., Hodgson, M.C., Packianathan, C., Bingol-Ozakpinar, O., and Uras, F., et al. (2013). Determinants of the tumor suppressor INPP4B protein and lipid phosphatase activities. Biochem. Biophys. Res. Commun. 440, 277-282.

100

Lowery, A.J., Miller, N., Devaney, A., McNeill, R.E., and Davoren, P.A., et al. (2009). MicroRNA signatures predict oestrogen receptor, progesterone receptor and HER2/neu receptor status in breast cancer. Breast Cancer Res. 11, R27. Lupini, L., Bassi, C., Ferracin, M., Bartonicek, N., and D'Abundo, L., et al. (2013). miR-221 affects multiple cancer pathways by modulating the level of hundreds messenger RNAs. Front Genet 4, 64. Magenta, A., Cencioni, C., Fasanaro, P., Zaccagnini, G., and Greco, S., et al. (2011). miR- 200c is upregulated by oxidative stress and induces endothelial cell apoptosis and senescence via ZEB1 inhibition. Cell Death Differ. 18, 1628-1639. Mahajan, K., Coppola, D., Challa, S., Fang, B., and Chen, Y.A., et al. (2010). Ack1 mediated AKT/PKB tyrosine 176 phosphorylation regulates its activation. PLoS ONE 5, e9646. Manning, B.D., and Cantley, L.C. (2007). AKT/PKB signaling: navigating downstream. Cell 129, 1261-1274. Maroulakou, I.G., Oemler, W., Naber, S.P., and Tsichlis, P.N. (2007). Akt1 ablation inhibits, whereas Akt2 ablation accelerates, the development of mammary adenocarcinomas in mouse mammary tumor virus (MMTV)-ErbB2/neu and MMTV-polyoma middle T transgenic mice. Cancer Res. 67, 167-177. Marsico, A., Huska, M.R., Lasserre, J., Hu, H., and Vucicevic, D., et al. (2013). PROmiRNA: a new miRNA promoter recognition method uncovers the complex regulation of intronic miRNAs. Genome Biol. 14, R84. Miller, T.W., Rexer, B.N., Garrett, J.T., and Arteaga, C.L. (2011). Mutations in the phosphatidylinositol 3-kinase pathway: role in tumor progression and therapeutic implications in breast cancer. Breast Cancer Res. 13, 224. Minami, A., Shimono, Y., Mizutani, K., Nobutani, K., and Momose, K., et al. (2013). Reduc- tion of the ST6 β-galactosamide α-2,6-sialyltransferase 1 (ST6GAL1)-catalyzed sialylation of nectin-like molecule 2/cell adhesion molecule 1 and enhancement of ErbB2/ErbB3 signaling by microRNA-199a. J. Biol. Chem. 288, 11845-11853. Misra, U.K., and Pizzo, S.V. (2011). Upregulation of mTORC2 activation by the selective ag- onist of EPAC, 8-CPT-2Me-cAMP, in prostate cancer cells: Assembly of a multi-protein signaling complex. J. Cell. Biochem., n/a. Mizoguchi, M., Nutt, C.L., Mohapatra, G., and Louis, D.N. (2004). Genetic alterations of phosphoinositide 3-kinase subunit genes in human glioblastomas. Brain Pathol. 14, 372- 377. Monteys, A.M., Spengler, R.M., Wan, J., Tecedor, L., and Lennox, K.A., et al. (2010). Struc- ture and activity of putative intronic miRNA promoters. RNA 16, 495-505. Moriarty, C.H., Pursell, B., and Mercurio, A.M. (2010). miR-10b targets Tiam1: implications for Rac activation and carcinoma migration. J. Biol. Chem. 285, 20541-20546. Mu, P., Han, Y.-C., Betel, D., Yao, E., and Squatrito, M., et al. (2009). Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas. Genes Dev. 23, 2806-2811.

100

101

Nahta, R., and O'Regan, R.M. (2012). Therapeutic implications of estrogen receptor signaling in HER2-positive breast cancers. Breast Cancer Res. Treat. 135, 39-48. Nayal, A., Webb, D.J., and Horwitz, A.F. (2004). Talin: an emerging focal point of adhesion dynamics. Curr. Opin. Cell Biol. 16, 94-98. Nishimura, R., and Arima, N. (2008). Is triple negative a prognostic factor in breast cancer? Breast Cancer 15, 303-308. Nygren, M.K., Tekle, C., Ingebrigtsen, V.A., Mäkelä, R., and Krohn, M., et al. (2014). Identify- ing microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br. J. Cancer. Olayioye, M.A., Neve, R.M., Lane, H.A., and Hynes, N.E. (2000). The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J. 19, 3159-3167. Osborne, C.K., Shou, J., Massarweh, S., and Schiff, R. (2005). Crosstalk between estrogen receptor and growth factor receptor pathways as a cause for endocrine therapy resistance in breast cancer. Clin. Cancer Res. 11, 865s-70s. Pan, S.-J., Zhan, S.-K., Pei, B.-G., Sun, Q.-F., and Bian, L.-G., et al. (2012). MicroRNA-149 inhibits proliferation and invasion of glioma cells via blockade of AKT1 signaling. Int J Immunopathol Pharmacol 25, 871-881. Parkin, D.M., Bray, F., Ferlay, J., and Pisani, P. (2005). Global cancer statistics, 2002. CA Cancer J Clin 55, 74-108. Pasquinelli, A.E., Reinhart, B.J., Slack, F., Martindale, M.Q., and Kuroda, M.I., et al. (2000). Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 408, 86-89. Patel, R.R., Sharma, Catherine G N, and Jordan, V.C. (2007). Optimizing the antihormonal treatment and prevention of breast cancer. Breast Cancer 14, 113-122. Peng, X.-D., Xu, P.-Z., Chen, M.-L., Hahn-Windgassen, A., and Skeen, J., et al. (2003). Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev. 17, 1352- 1365. Petrie, R.J., Doyle, A.D., and Yamada, K.M. (2009). Random versus directionally persistent cell migration. Nat. Rev. Mol. Cell Biol. 10, 538-549. Philp, A.J., Campbell, I.G., Leet, C., Vincan, E., and Rockman, S.P., et al. (2001). The phosphatidylinositol 3'-kinase p85alpha gene is an oncogene in human ovarian and colon tumors. Cancer Res. 61, 7426-7429. Pullamsetti, S.S., Banat, G.A., Schmall, A., Szibor, M., and Pomagruk, D., et al. (2013). Phosphodiesterase-4 promotes proliferation and angiogenesis of lung cancer by crosstalk with HIF. Oncogene 32, 1121-1134. Qin, A.-Y., Zhang, X.-W., Liu, L., Yu, J.-P., and Li, H., et al. (2013). MiR-205 in cancer: an angel or a devil? Eur. J. Cell Biol. 92, 54-60. Qiu, S., Lin, S., Hu, D., Feng, Y., and Tan, Y., et al. (2013). Interactions of miR-323/miR- 326/miR-329 and miR-130a/miR-155/miR-210 as prognostic indicators for clinical outcome of glioblastoma patients. J Transl Med 11, 10. 101

102

R Core Team (2012). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Raftopoulou, M., and Hall, A. (2004). Cell migration: Rho GTPases lead the way. Dev. Biol. 265, 23-32. Renner, O., Blanco-Aparicio, C., Grassow, M., Canamero, M., and Leal, J.F., et al. (2008). Activation of Phosphatidylinositol 3-Kinase by Membrane Localization of p110 Predisposes Mammary Glands to Neoplastic Transformation. Cancer Research 68, 9643-9653. Ridley, A.J. (2001). Rho GTPases and cell migration. J. Cell. Sci. 114, 2713-2722. Rodriguez, A., Griffiths-Jones, S., Ashurst, J.L., and Bradley, A. (2004). Identification of mammalian microRNA host genes and transcription units. Genome Res. 14, 1902-1910. Roskoski, R. (2012). ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol. Res. 66, 105-143. Roskoski, R. (2014). The ErbB/HER family of protein-tyrosine kinases and cancer. Pharmacol. Res. 79, 34-74. Ross, S.H., Spanjaard, E., Post, A., Vliem, M.J., and Kristyanto, H., et al. (2012). Rap1 can bypass the FAK-Src-Paxillin cascade to induce cell spreading and focal adhesion formation. PLoS ONE 7, e50072. Sampson, V.B., Rong, N.H., Han, J., Yang, Q., and Aris, V., et al. (2007). MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 67, 9762-9770. Samuels, Y., and Velculescu, V.E. (2004). Oncogenic mutations of PIK3CA in human cancers. Cell Cycle 3, 1221-1224. Samuels, Y., Wang, Z., Bardelli, A., Silliman, N., and Ptak, J., et al. (2004). High frequency of mutations of the PIK3CA gene in human cancers. Science 304, 554. Santi, S.A., and Lee, H. (2010). The Akt isoforms are present at distinct subcellular locations. AJP: Cell Physiology 298, C580. Sarkar, S., Dubaybo, H., Ali, S., Goncalves, P., and Kollepara, S.L., et al. (2013). Down- regulation of miR-221 inhibits proliferation of pancreatic cancer cells through up-regulation of PTEN, p27(kip1), p57(kip2), and PUMA. Am J Cancer Res 3, 465-477. Schaefer, A., Jung, M., Mollenkopf, H.-J., Wagner, I., and Stephan, C., et al. (2009). Diag- nostic and prognostic implications of microRNA profiling in prostate carcinoma. Int. J. Can- cer, NA. Schoeberl, B., Faber, A.C., Li, D., Liang, M.-C., and Crosby, K., et al. (2010). An ErbB3 antibody, MM-121, is active in cancers with ligand-dependent activation. Cancer Res. 70, 2485-2494. Scott, G.K., Goga, A., Bhaumik, D., Berger, C.E., and Sullivan, C.S., et al. (2007). Coordi- nate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J. Biol. Chem. 282, 1479-1486.

102

103

Sergina, N.V., Rausch, M., Wang, D., Blair, J., and Hann, B., et al. (2007). Escape from HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature 445, 437-441. Serra, V., Scaltriti, M., Prudkin, L., Eichhorn, P J A, and Ibrahim, Y.H., et al. (2011). PI3K inhibition results in enhanced HER signaling and acquired ERK dependency in HER2- overexpressing breast cancer. Oncogene 30, 2547-2557. Shaw, R.J., and Cantley, L.C. (2006). Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 441, 424-430. Shenoy, S.K., Han, S., Zhao, Y.L., Hara, M.R., and Oliver, T., et al. (2012). β-arrestin1 mediates metastatic growth of breast cancer cells by facilitating HIF-1-dependent VEGF expression. Oncogene 31, 282-292. Shin, H.-W., Hayashi, M., Christoforidis, S., Lacas-Gervais, S., and Hoepfner, S., et al. (2005). An enzymatic cascade of Rab5 effectors regulates phosphoinositide turnover in the endocytic pathway. J. Cell Biol. 170, 607-618. Singh, S.K., Kagalwala, M.N., Parker-Thornburg, J., Adams, H., and Majumder, S. (2008). REST maintains self-renewal and pluripotency of embryonic stem cells. Nature 453, 223- 227. Sinkkonen, L., Hugenschmidt, T., Berninger, P., Gaidatzis, D., and Mohn, F., et al. (2008). MicroRNAs control de novo DNA methylation through regulation of transcriptional repressors in mouse embryonic stem cells. Nat. Struct. Mol. Biol. 15, 259-267. Sithanandam, G., and Anderson, L.M. (2008). The ERBB3 receptor in cancer and cancer gene therapy. Cancer Gene Ther. 15, 413-448. Slamon, D.J., Clark, G.M., Wong, S.G., Levin, W.J., and Ullrich, A., et al. (1987). Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Small, J.V., Stradal, T., Vignal, E., and Rottner, K. (2002). The lamellipodium: where motility begins. Trends Cell Biol. 12, 112-120. Smirnova, T., Zhou, Z.N., Flinn, R.J., Wyckoff, J., and Boimel, P.J., et al. (2012). Phosphoinositide 3-kinase signaling is critical for ErbB3-driven breast cancer cell motility and metastasis. Oncogene 31, 706-715. Song, Y.-X., Yue, Z.-Y., Wang, Z.-N., Xu, Y.-Y., and Luo, Y., et al. (2011). MicroRNA-148b is frequently down-regulated in gastric cancer and acts as a tumor suppressor by inhibiting cell proliferation. Mol. Cancer 10, 1. Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., and Pawson, T., et al. (1993). SH2 domains recognize specific phosphopeptide sequences. Cell 72, 767-778. Sørlie, T. (2007). Molecular classification of breast tumors: toward improved diagnostics and treatments. Methods Mol. Biol. 360, 91-114. Taylor, M.A., Sossey-Alaoui, K., Thompson, C.L., Danielpour, D., and Schiemann, W.P. (2013). TGF-β upregulates miR-181a expression to promote breast cancer metastasis. J. Clin. Invest. 123, 150-163.

103

104

Thomas, J.W., Cooley, M.A., Broome, J.M., Salgia, R., and Griffin, J.D., et al. (1999). The role of focal adhesion kinase binding in the regulation of tyrosine phosphorylation of paxillin. J. Biol. Chem. 274, 36684-36692. Thrane, S., Lykkesfeldt, A.E., Larsen, M.S., Sorensen, B.S., and Yde, C.W. (2013). Estrogen receptor α is the major driving factor for growth in tamoxifen-resistant breast cancer and supported by HER/ERK signaling. Breast Cancer Res. Treat. 139, 71-80. Tsubouchi, A., Sakakura, J., Yagi, R., Mazaki, Y., and Schaefer, E., et al. (2002). Localized suppression of RhoA activity by Tyr31/118-phosphorylated paxillin in cell adhesion and migration. J. Cell Biol. 159, 673-683. Uhlmann, S., Mannsperger, H., Zhang, J.D., Horvat, E.-Á., and Schmidt, C., et al. (2012). Global microRNA level regulation of EGFR-driven cell-cycle protein network in breast cancer. Mol. Syst. Biol. 8, 570. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., and Faircloth, B.C., et al. (2012). Pri- mer3--new capabilities and interfaces. Nucleic Acids Res. 40, e115. Valastyan, S., Chang, A., Benaich, N., Reinhardt, F., and Weinberg, R.A. (2010). Concurrent suppression of integrin alpha5, radixin, and RhoA phenocopies the effects of miR-31 on metastasis. Cancer Res. 70, 5147-5154. Valastyan, S., Chang, A., Benaich, N., Reinhardt, F., and Weinberg, R.A. (2011). Activation of miR-31 function in already-established metastases elicits metastatic regression. Genes Dev. 25, 646-659. Vivanco, I., and Sawyers, C.L. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat. Rev. Cancer 2, 489-501. Volinia, S., Galasso, M., Costinean, S., Tagliavini, L., and Gamberoni, G., et al. (2010). Re- programming of miRNA networks in cancer and leukemia. Genome Res. 20, 589-599. Vossler, M.R., Yao, H., York, R.D., Pan, M.G., and Rim, C.S., et al. (1997). cAMP activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent pathway. Cell 89, 73-82. Wang, F., Ma, Y.-L., Zhang, P., Shen, T.-Y., and Shi, C.-Z., et al. (2013). SP1 mediates the link between methylation of the tumour suppressor miR-149 and outcome in colorectal cancer. J. Pathol. 229, 12-24. Wang, F., Zheng, Z., Guo, J., and Ding, X. (2010). Correlation and quantitation of microRNA aberrant expression in tissues and sera from patients with breast tumor. Gynecol. Oncol. 119, 586-593. Wang, X. (2008). miRDB: a microRNA target prediction and functional annotation database with a wiki interface. RNA 14, 1012-1017. Wang, Y., Zheng, X., Zhang, Z., Zhou, J., and Zhao, G., et al. (2012). MicroRNA-149 inhibits proliferation and cell cycle progression through the targeting of ZBTB2 in human gastric cancer. PLoS ONE 7, e41693. Webster, R.J., Giles, K.M., Price, K.J., Zhang, P.M., and Mattick, J.S., et al. (2009). Regula- tion of epidermal growth factor receptor signaling in human cancer cells by microRNA-7. J. Biol. Chem. 284, 5731-5741.

104

105

What is Cancer? (2012). Retrieved January 25, 2015 from http://www.unc.edu/depts/our/hhmi/hhmi- ft_learning_modules/cancermodule/pages/cancer.html. Williams, C., Choudhury, R., McKenzie, E., and Lowe, M. (2007). Targeting of the type II inositol polyphosphate 5-phosphatase INPP5B to the early secretory pathway. J. Cell. Sci. 120, 3941-3951. Wilson, K.J., Gilmore, J.L., Foley, J., Lemmon, M.A., and Riese, D.J. (2009). Functional selectivity of EGF family peptide growth factors: implications for cancer. Pharmacol. Ther. 122, 1-8. Wu, L., Cai, C., Wang, X., Liu, M., and Li, X., et al. (2011). MicroRNA-142-3p, a new regulator of RAC1, suppresses the migration and invasion of hepatocellular carcinoma cells. FEBS Lett. 585, 1322-1330. Xu, X., Barry, D.C., Settleman, J., Schwartz, M.A., and Bokoch, G.M. (1994). Differing struc- tural requirements for GTPase-activating protein responsiveness and NADPH oxidase activation by Rac. J Biol Chem 269, 23569-23574. Yang, J., Cron, P., Thompson, V., Good, V.M., and Hess, D., et al. (2002). Molecular mechanism for the regulation of protein kinase B/Akt by hydrophobic motif phosphorylation. Mol. Cell 9, 1227-1240. Yang, M.-H., Hsu, D.S.-S., Wang, H.-W., Wang, H.-J., and Lan, H.-Y., et al. (2010). Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition. Nat. Cell Biol. 12, 982-992. Yang, S., Li, Y., Gao, J., Zhang, T., and Li, S., et al. (2012). MicroRNA-34 suppresses breast cancer invasion and metastasis by directly targeting Fra-1. Oncogene 32, 4294-4303. Yang, Z.-Z., Tschopp, O., Di-Poï, N., Bruder, E., and Baudry, A., et al. (2005). Dosage- dependent effects of Akt1/protein kinase Balpha (PKBalpha) and Akt3/PKBgamma on thymus, skin, and cardiovascular and nervous system development in mice. Mol. Cell. Biol. 25, 10407-10418. Yuan, T.L., and Cantley, L.C. (2008). PI3K pathway alterations in cancer: variations on a theme. Oncogene 27, 5497-5510. Zaidel-Bar, R., Itzkovitz, S., Ma'ayan, A., Iyengar, R., and Geiger, B. (2007). Functional atlas of the integrin adhesome. Nat. Cell Biol. 9, 858-867. Zhao, L., and Vogt, P.K. (2008). Class I PI3K in oncogenic cellular transformation. Oncogene 27, 5486-5496.

105

106

107

6 Supplements

6.1 mimic miRNA library

Table 24: Detailed list of the Dharmacon miRIDIAN® microRNA Library – Human Mimic CS-

001010, Lot 09167. well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence A02 C-300879-01 hsa-miR-561 MI0003567 CAAAGUUUAAGAUCCUUGAAGU E02 C-301164-01 hsa-miR-302d* MI0000774 ACUUUAACAUGGAGGCACUUGC A03 C-301123-01 hsa-miR-615-5p MI0003628 GGGGGUCCCCGGUGCUCGGAUC E03 C-300947-01 hsa-miR-621 MI0003635 GGCUAGCAACAGCGCUUACCU A04 C-301117-01 hsa-miR-589 MI0003599 UGAGAACCACGUCUGCUCUGAG E04 C-301181-01 hsa-miR-32* MI0000090 CAAUUUAGUGUGUGUGAUAUUU A05 C-300597-07 hsa-miR-128 MI0000447 UCACAGUGAACCGGUCUCUUU E05 C-301070-01 hsa-miR-200c* MI0000650 CGUCUUACCCAGCAGUGUUUGG A06 C-300875-01 hsa-miR-557 MI0003563 GUUUGCACGGGUGGGCCUUGUCU E06 C-300764-05 hsa-miR-193b MI0003137 AACUGGCCCUCAAAGUCCCGCU A07 C-301168-01 hsa-miR-500 MI0003184 UAAUCCUUGCUACCUGGGUGAGA E07 C-300639-03 hsa-miR-190 MI0000486 UGAUAUGUUUGAUAUAUUAGGU A08 C-301282-01 hsa-miR-1225- MI0006311 UGAGCCCCUGUGCCGCCCCCAG E08 C-301470-00 hsa-miR-1973 MI0009983 ACCGUGCAAAGGUAGCAUA A09 C-301364-00 hsa-miR-1305 MI0006372 UUUUCAACUCUAAUGGGAGAGA E09 C-300795-05 hsa-miR-518f* MI0003154 CUCUAGAGGGAAGCACUUUCUC A10 C-300919-01 hsa-miR-595 MI0003607 GAAGUGUGCCGUGGUGUGUCU E10 C-300602-03 hsa-miR-135a MI0000452 UAUGGCUUUUUAUUCCUAUGUGA A11 C-300877-01 hsa-miR-559 MI0003565 UAAAGUAAAUAUGCACCAAAA E11 C-301427-00 hsa-miR-1255b MI0006435 CGGAUGAGCAAAGAAAGUGGUU B02 C-301213-01 hsa-miR-891a MI0005524 UGCAACGAACCUGAGCCACUGA F02 C-300656-03 hsa-miR-299-3p MI0000744 UAUGUGGGAUGGUAAACCGCUU B03 C-301093-01 hsa-miR-193b* MI0003137 CGGGGUUUUGAGGGCGAGAUGA F03 C-300482-03 hsa-miR-15a MI0000069 UAGCAGCACAUAAUGGUUUGUG B04 C-301160-01 hsa-miR-374a* MI0000782 CUUAUCAGAUUGUAUUGUAAUU F04 C-300748-05 hsa-miR-488* MI0003123 CCCAGAUAAUGGCACUCUCAA B05 C-301030-01 hsa-miR-92a-1* MI0000093 AGGUUGGGAUCGGUUGCAAUGCU F05 C-301175-01 hsa-miR-106b* MI0000734 CCGCACUGUGGGUACUUGCUGC B06 C-301066-01 hsa-miR-146a* MI0000477 CCUCUGAAAUUCAGUUCUUCAG F06 C-301180-01 hsa-miR-16-2* MI0000115 CCAAUAUUACUGUGCUGCUUUA B07 C-300551-07 hsa-miR-34a MI0000268 UGGCAGUGUCUUAGCUGGUUGU F07 C-301209-01 hsa-miR-671-3p MI0003760 UCCGGUUCUCAGGGCUCCACC B08 C-301020-01 hsa-miR-19a* MI0000073 AGUUUUGCAUAGUUGCACUACA F08 C-301111-01 hsa-miR-556-3p MI0003562 AUAUUACCAUUAGCUCAUCUUU B09 C-300746-03 hsa-miR-486-5p MI0002470 UCCUGUACUGAGCUGCCCCGAG F09 C-301031-01 hsa-miR-99a* MI0000101 CAAGCUCGCUUCUAUGGGUCUG B10 C-301045-01 hsa-miR-30b* MI0000441 CUGGGAGGUGGAUGUUUACUUC F10 C-300972-01 hsa-miR-645 MI0003660 UCUAGGCUGGUACUGCUGA B11 C-300618-05 hsa-miR-9 MI0000466 UCUUUGGUUAUCUAGCUGUAUGA F11 C-301009-01 hsa-miR-802 MI0003906 CAGUAACAAAGAUUCAUCCUUGU

C02 C-300931-01 hsa-miR-606 MI0003619 AAACUACUGAAAAUCAAAGAU G02 C-301179-01 hsa-miR-29c* MI0000735 UGACCGAUUUCUCCUGGUGUUC plate1 C03 C-301116-01 hsa-miR-548b- MI0003596 AAAAGUAAUUGUGGUUUUGGCC G03 C-300942-01 hsa-miR-548c- MI0003630 CAAAAAUCUCAAUUACUUUUGC C04 C-301245-01 hsa-miR-887 MI0005562 GUGAACGGGCGCCAUCCCGAGG G04 C-301018-01 hsa-miR-15a* MI0000069 CAGGCCAUAUUGUGCUGCCUCA C05 C-300680-03 hsa-miR-373 MI0000781 GAAGUGCUUCGAUUUUGGGGUGU G05 C-300640-05 hsa-miR-193a- MI0000487 AACUGGCCUACAAAGUCCCAGU C06 C-300864-03 hsa-miR-363* MI0000764 CGGGUGGAUCACGAUGCAAUUU G06 C-300861-05 hsa-miR-545 MI0003516 UCAGCAAACAUUUAUUGUGUGC C07 C-301467-00 hsa-miR-2113 MI0003939 AUUUGUGCUUGGCUCUGUCAC G07 C-301202-01 hsa-miR-181a- MI0000269 ACCACUGACCGUUGACUGUACC C08 C-301351-00 hsa-miR-1299 MI0006359 UUCUGGAAUUCUGUGUGAGGGA G08 C-300675-03 hsa-miR-369-3p MI0000777 AAUAAUACAUGGUUGAUCUUU C09 C-300724-07 hsa-miR-450a MI0001652 UUUUGCGAUGUGUUCCUAAUAU G09 C-301264-01 hsa-miR-935 MI0005757 CCAGUUACCGCUUCCGCUACCGC C10 C-301256-01 hsa-miR-921 MI0005713 CUAGUGAGGGACAGAACCAGGAU G10 C-301433-00 hsa-miR-1306 MI0006443 ACGUUGGCUCUGGUGGUG C11 C-300509-07 hsa-miR-33a MI0000091 GUGCAUUGUAGUUGCAUUGCA G11 C-300671-05 hsa-miR-302c MI0000773 UAAGUGCUUCCAUGUUUCAGUGG D02 C-301218-01 hsa-miR-220b MI0005529 CCACCACCGUGUCUGACACUU H02 C-301212-01 hsa-miR-298 MI0005523 AGCAGAAGCAGGGAGGUUCUCCC D03 C-301100-01 hsa-miR-518d- MI0003171 CUCUAGAGGGAAGCACUUUCUG H03 C-301192-01 hsa-miR-185* MI0000482 AGGGGCUGGCUUUCCUCUGGUC D04 C-301259-01 hsa-miR-924 MI0005716 AGAGUCUUGUGAUGUCUUGC H04 C-301439-00 hsa-miR-1324 MI0006657 CCAGACAGAAUUCUAUGCACUUUC D05 C-301235-01 hsa-miR-876-5p MI0005542 UGGAUUUCUUUGUGAAUCACCA H05 C-300638-07 hsa-miR-188-5p MI0000484 CAUCCCUUGCAUGGUGGAGGG D06 C-300796-05 hsa-miR-518f MI0003154 GAAAGCGCUUCUCUUUAGAGG H06 C-301397-00 hsa-miR-1268 MI0006405 CGGGCGUGGUGGUGGGGG D07 C-300633-03 hsa-miR-154 MI0000480 UAGGUUAUCCGUGUUGCCUUCG H07 C-300989-01 hsa-miR-655 MI0003677 AUAAUACAUGGUUAACCUCUUU D08 C-300754-03 hsa-miR-146b- MI0003129 UGAGAACUGAAUUCCAUAGGCU H08 C-300631-07 hsa-miR-149 MI0000478 UCUGGCUCCGUGUCUUCACUCCC D09 C-301292-01 hsa-miR-1236 MI0006326 CCUCUUCCCCUUGUCUCUCCA G H09 C-301001-01 hsa-miR-668 MI0003761 UGUCACUCGGCUCGGCCCACUAC D10 C-300862-01 hsa-miR-487b MI0003530 AAUCGUACAGGGUCAUCCACUU H10 C-301254-01 hsa-miR-208b MI0005570 AUAAGACGAACAAAAGGUUUGU D11 C-300707-07 hsa-miR-339-5p MI0000815 UCCCUGUCCUCCAGGAGCUCACG H11 C-301230-01 hsa-miR-541 MI0005539 UGGUGGGCACAGAAUCUGGACU A02 C-300505-03 hsa-miR-30a MI0000088 UGUAAACAUCCUCGACUGGAAG E02 C-300655-03 hsa-miR-34c-5p MI0000743 AGGCAGUGUAGUUAGCUGAUUGC A03 C-301446-00 hsa-miR-1468 MI0003782 CUCCGUUUGCCUGUUUCGCUG E03 C-300698-05 hsa-miR-323-3p MI0000807 CACAUUACACGGUCGACCUCU A04 C-301017-01 hsa-let-7e* MI0000066 CUAUACGGCCUCCUAGCUUUCC E04 C-301196-01 hsa-miR-130b* MI0000748 ACUCUUUCCCUGUUGCACUAC A05 C-301233-01 hsa-miR-875-5p MI0005541 UAUACCUCAGUUUUAUCAGGUG E05 C-301407-00 hsa-miR-1275 MI0006415 GUGGGGGAGAGGCUGUC A06 C-301412-00 hsa-miR-548p MI0006420 UAGCAAAAACUGCAGUUACUUU E06 C-301429-00 hsa-miR-1280 MI0006437 UCCCACCGCUGCCACCC A07 C-300652-07 hsa-miR-302a* MI0000738 ACUUAAACGUGGAUGUACUUGCU E07 C-301084-01 hsa-miR-337-5p MI0000806 GAACGGCUUCAUACAGGAGUU A08 C-301443-00 hsa-miR-1825 MI0008193 UCCAGUGCCCUCCUCUCC E08 C-300556-03 hsa-miR-181c MI0000271 AACAUUCAACCUGUCGGUGAGU A09 C-300823-03 hsa-miR-516-3p MI0003180 UGCUUCCUUUCAGAGGGU E09 C-301043-01 hsa-let-7g* MI0000433 CUGUACAGGCCACUGCCUUGC A10 C-300676-05 hsa-miR-370 MI0000778 GCCUGCUGGGGUGGAACCUGGU E10 C-300863-05 hsa-miR-542-5p MI0003686 UCGGGGAUCAUCAUGUCACGAGA A11 C-300592-05 hsa-miR-124 MI0000443 UAAGGCACGCGGUGAAUGCC E11 C-301153-01 hsa-miR-214* MI0000290 UGCCUGUCUACACUUGCUGUGC B02 C-300691-03 hsa-miR-382 MI0000790 GAAGUUGUUCGUGGUGGAUUCG F02 C-300649-05 hsa-miR-106b MI0000734 UAAAGUGCUGACAGUGCAGAU B03 C-300550-07 hsa-miR-10b MI0000267 UACCCUGUAGAACCGAAUUUGUG F03 C-300615-07 hsa-miR-153 MI0000463 UUGCAUAGUCACAAAAGUGAUC B04 C-301377-00 hsa-miR-1250 MI0006385 ACGGUGCUGGAUGUGGCCUUU F04 C-300491-03 hsa-miR-20a MI0000076 UAAAGUGCUUAUAGUGCAGGUAG B05 C-300777-03 hsa-miR-519e* MI0003145 UUCUCCAAAAGGGAGCACUUUC F05 C-300975-01 hsa-miR-648 MI0003663 AAGUGUGCAGGGCACUGGU B06 C-300697-05 hsa-miR-337-3p MI0000806 CUCCUAUAUGAUGCCUUUCUUC F06 C-300577-05 hsa-miR-220a MI0000297 CCACACCGUAUCUGACACUUU B07 C-301462-00 hsa-miR-1913 MI0008334 UCUGCCCCCUCCGCUGCUGCCA F07 C-300905-01 hsa-miR-548a- MI0003593 CAAAACUGGCAAUUACUUUUGC B08 C-301108-01 hsa-miR-194* MI0000732 CCAGUGGGGCUGCUGUUAUCUG F08 C-301086-01 hsa-miR-151-5p MI0000809 UCGAGGAGCUCACAGUCUAGU

B09 C-300515-05 hsa-miR-98 MI0000100 UGAGGUAGUAAGUUGUAUUGUU F09 C-301151-01 hsa-miR-149* MI0000478 AGGGAGGGACGGGGGCUGUGC plate2 B10 C-300870-01 hsa-miR-553 MI0003558 AAAACGGUGAGAUUUUGUUUU F10 C-301076-01 hsa-miR-296-3p MI0000747 GAGGGUUGGGUGGAGGCUCUCC B11 C-300902-01 hsa-miR-583 MI0003590 CAAAGAGGAAGGUCCCAUUAC F11 C-300856-05 hsa-miR-455-5p MI0003513 UAUGUGCCUUUGGACUACAUCG C02 C-300967-01 hsa-miR-640 MI0003655 AUGAUCCAGGAACCUGCCUCU G02 C-301112-01 hsa-miR-551b* MI0003575 GAAAUCAAGCGUGGGUGAGACC C03 C-301130-01 hsa-miR-33b* MI0003646 CAGUGCCUCGGCAGUGCAGCCC G03 C-300659-03 hsa-miR-296-5p MI0000747 AGGGCCCCCCCUCAAUCCUGU C04 C-301215-01 hsa-miR-886-3p MI0005527 CGCGGGUGCUUACUGACCCUU G04 C-301311-00 hsa-miR-1323 MI0003786 UCAAAACUGAGGGGCAUUUUCU C05 C-301125-01 hsa-miR-548c- MI0003630 AAAAGUAAUUGCGGUUUUUGCC G05 C-300929-01 hsa-miR-604 MI0003617 AGGCUGCGGAAUUCAGGAC C06 C-301080-01 hsa-miR-379* MI0000787 UAUGUAACAUGGUCCACUAACU G06 C-300868-01 hsa-miR-551a MI0003556 GCGACCCACUCUUGGUUUCCA C07 C-300683-03 hsa-miR-376a MI0000784 AUCAUAGAGGAAAAUCCACGU G07 C-300881-01 hsa-miR-563 MI0003569 AGGUUGACAUACGUUUCCC C08 C-300828-05 hsa-miR-518a- MI0003170 GAAAGCGCUUCCCUUUGCUGGA G08 C-301465-00 hsa-miR-1915 MI0008336 CCCCAGGGCGACGCGGCGGG C09 C-301065-01 hsa-miR-138-1* MI0000476 GCUACUUCACAACACCAGGGCC G09 C-300766-05 hsa-miR-181d MI0003139 AACAUUCAUUGUUGUCGGUGGGU C10 C-300982-01 hsa-miR-662 MI0003670 UCCCACGUUGUGGCCCAGCAG G10 C-300987-01 hsa-miR-411 MI0003675 UAGUAGACCGUAUAGCGUACG C11 C-300487-05 hsa-miR-18a MI0000072 UAAGGUGCAUCUAGUGCAGAUAG G11 C-301237-01 hsa-miR-708* MI0005543 CAACUAGACUGUGAGCUUCUAG D02 C-301330-00 hsa-miR-663b MI0006336 GGUGGCCCGGCCGUGCCUGAGG H02 C-301309-00 hsa-miR-320c MI0003778 AAAAGCUGGGUUGAGAGGGU D03 C-300923-01 hsa-miR-599 MI0003611 GUUGUGUCAGUUUAUCAAAC H03 C-301110-01 hsa-miR-92b* MI0003560 AGGGACGGGACGCGGUGCAGUG D04 C-300948-01 hsa-miR-622 MI0003636 ACAGUCUGCUGAGGUUGGAGC H04 C-300738-05 hsa-miR-409-3p MI0001735 GAAUGUUGCUCGGUGAACCCCU D05 C-300956-01 hsa-miR-630 MI0003644 AGUAUUCUGUACCAGGGAAGGU H05 C-301389-00 hsa-miR-1262 MI0006397 AUGGGUGAAUUUGUAGAAGGAU

107

108

well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence D06 C-300672-05 hsa-miR-302d MI0000774 UAAGUGCUUCCAUGUUUGAGUGU H06 C-301473-00 hsa-miR-1976 MI0009986 CCUCCUGCCCUCCUUGCUGU D07 C-300662-05 hsa-miR-30e* MI0000749 CUUUCAGUCGGAUGUUUACAGC H07 C-300855-05 hsa-miR-18a* MI0000072 ACUGCCCUAAGUGCUCCUUCUGG D08 C-300660-05 hsa-miR-130b MI0000748 CAGUGCAAUGAUGAAAGGGCAU H08 C-300625-05 hsa-miR-126* MI0000471 CAUUAUUACUUUUGGUACGCG

D09 C-300871-01 hsa-miR-554 MI0003559 GCUAGUCCUGACUCAGCCAGU H09 C-301344-00 hsa-miR-1290 MI0006352 UGGAUUUUUGGAUCAGGGA plate2 D10 C-300941-01 hsa-miR-616* MI0003629 ACUCAAAACCCUUCAGUGACUU H10 C-300661-07 hsa-miR-30e MI0000749 UGUAAACAUCCUUGACUGGAAG D11 C-300599-06 hsa-miR-132 MI0000449 UAACAGUCUACAGCCAUGGUCG H11 C-300847-05 hsa-miR-507 MI0003194 UUUUGCACCUUUUGGAGUGAA A02 C-300573-05 hsa-miR-218 MI0000294 UUGUGCUUGAUCUAACCAUGU E02 C-301139-01 hsa-miR-19b-2* MI0000075 AGUUUUGCAGGUUUGCAUUUCA A03 C-301475-00 hsa-miR-1978 MI0009988 GGUUUGGUCCUAGCCUUUCUA E03 C-301380-00 hsa-miR-1254 MI0006388 AGCCUGGAAGCUGGAGCCUGCAG A04 C-301075-01 hsa-miR-99b* MI0000746 CAAGCUCGUGUCUGUGGGUCCG E04 C-301452-00 hsa-miR-1539 MI0007260 UCCUGCGCGUCCCAGAUGCCC A05 C-300586-05 hsa-miR-1 MI0000651 UGGAAUGUAAAGAAGUAUGUAU E05 C-300485-05 hsa-miR-17 MI0000071 CAAAGUGCUUACAGUGCAGGUAG A06 C-300713-05 hsa-miR-384 MI0001145 AUUCCUAGAAAUUGUUCAUA E06 C-301127-01 hsa-miR-625* MI0003639 GACUAUAGAACUUUCCCCCUCA A07 C-301174-01 hsa-miR-20b* MI0001519 ACUGUAGUAUGGGCACUUCCAG E07 C-301083-01 hsa-miR-342-5p MI0000805 AGGGGUGCUAUCUGUGAUUGA A08 C-300688-03 hsa-miR-380* MI0000788 UGGUUGACCAUAGAACAUGCGC E08 C-300516-03 hsa-miR-99a MI0000101 AACCCGUAGAUCCGAUCUUGUG A09 C-300993-01 hsa-miR-658 MI0003682 GGCGGAGGGAAGUAGGUCCGUUG E09 C-301146-01 hsa-miR-15b* MI0000438 CGAAUCAUUAUUUGCUGCUCUA A10 C-300629-03 hsa-miR-136 MI0000475 ACUCCAUUUGUUUUGAUGAUGGA E10 C-300488-03 hsa-miR-19a MI0000073 UGUGCAAAUCUAUGCAAAACUGA A11 C-301278-01 hsa-miR-1224- MI0003764 CCCCACCUCCUCUCUCCUCAG E11 C-301194-01 hsa-miR-362-3p MI0000762 AACACACCUAUUCAAGGAUUCA B02 C-301289-01 hsa-miR-1231 MI0006321 GUGUCUGGGCGGACAGCUGC F02 C-301253-01 hsa-miR-216b MI0005569 AAAUCUCUGCAGGCAAAUGUGA B03 C-300859-01 hsa-miR-539 MI0003514 GGAGAAAUUAUCCUUGGUGUGU F03 C-300645-05 hsa-miR-320a MI0000542 AAAAGCUGGGUUGAGAGGGCGA B04 C-300793-05 hsa-miR-525-3p MI0003152 GAAGGCGCUUCCCUUUAGAGCG F04 C-301250-01 hsa-miR-374b MI0005566 AUAUAAUACAACCUGCUAAGUG B05 C-300565-03 hsa-miR-210 MI0000286 CUGUGCGUGUGACAGCGGCUGA F05 C-300478-07 hsa-let-7d MI0000065 AGAGGUAGUAGGUUGCAUAGUU B06 C-300832-03 hsa-miR-517c MI0003174 AUCGUGCAUCCUUUUAGAGUGU F06 C-301468-00 hsa-miR-1204 MI0006337 UCGUGGCCUGGUCUCCAUUAU B07 C-300701-07 hsa-miR-135b MI0000810 UAUGGCUUUUCAUUCCUAUGUGA F07 C-300981-01 hsa-miR-661 MI0003669 UGCCUGGGUCUCUGGCCUGCGCGU B08 C-300991-01 hsa-miR-549 MI0003679 UGACAACUAUGGAUGAGCUCU F08 C-301287-01 hsa-miR-1228* MI0006318 GUGGGCGGGGGCAGGUGUGUG B09 C-300965-01 hsa-miR-638 MI0003653 AGGGAUCGCGGGCGGGUGGCGGC F09 C-300665-05 hsa-miR-363 MI0000764 AAUUGCACGGUAUCCAUCUGUA B10 C-300692-03 hsa-miR-383 MI0000791 AGAUCAGAAGGUGAUUGUGGCU F10 C-301162-01 hsa-miR-331-5p MI0000812 CUAGGUAUGGUCCCAGGGAUCC B11 C-301071-01 hsa-miR-155* MI0000681 CUCCUACAUAUUAGCAUUAACA F11 C-300908-01 hsa-miR-548b- MI0003596 CAAGAACCUCAGUUGCUUUUGU

C02 C-301340-00 hsa-miR-1286 MI0006348 UGCAGGACCAAGAUGAGCCCU G02 C-301238-01 hsa-miR-708 MI0005543 AAGGAGCUUACAAUCUAGCUGGG plate3 C03 C-300579-07 hsa-miR-222 MI0000299 AGCUACAUCUGGCUACUGGGU G03 C-300739-03 hsa-miR-412 MI0002464 ACUUCACCUGGUCCACUAGCCGU C04 C-301366-00 hsa-miR-548f MI0006374 AAAAACUGUAAUUACUUUU G04 C-301222-01 hsa-miR-450b- MI0005531 UUGGGAUCAUUUUGCAUCCAUA C05 C-300960-01 hsa-miR-633 MI0003648 CUAAUAGUAUCUACCACAAUAAA G05 C-301286-01 hsa-miR-1228 MI0006318 UCACACCUGCCUCGCCCCCC C06 C-301318-00 hsa-miR-1298 MI0003938 UUCAUUCGGCUGUCCAGAUGUA G06 C-300669-05 hsa-miR-302b MI0000772 UAAGUGCUUCCAUGUUUUAGUAG C07 C-300894-01 hsa-miR-575 MI0003582 GAGCCAGUUGGACAGGAGC G07 C-300886-01 hsa-miR-568 MI0003574 AUGUAUAAAUGUAUACACAC C08 C-301451-00 hsa-miR-1538 MI0007259 CGGCCCGGGCUGCUGCUGUUCCU G08 C-301270-01 hsa-miR-941 MI0005763 CACCCGGCUGUGUGCACAUGUGC C09 C-300763-05 hsa-miR-496 MI0003136 UGAGUAUUACAUGGCCAAUCUC G09 C-301231-01 hsa-miR-541* MI0005539 AAAGGAUUCUGCUGUCGGUCCCAC C10 C-301099-01 hsa-miR-518a- MI0003170 CUGCAAAGGGAAGCCCUUUC G10 C-300865-03 hsa-miR-376a* MI0000784 GUAGAUUCUCCUUCUAUGAGUA C11 C-301166-01 hsa-miR-509-5p MI0003196 UACUGCAGACAGUGGCAAUCA G11 C-300737-05 hsa-miR-409-5p MI0001735 AGGUUACCCGAGCAACUUUGCAU D02 C-300811-05 hsa-miR-517a MI0003161 AUCGUGCAUCCCUUUAGAGUGU H02 C-300874-03 hsa-miR-556-5p MI0003562 GAUGAGCUCAUUGUAAUAUGAG D03 C-301479-00 hsa-miR-2054 MI0010488 CUGUAAUAUAAAUUUAAUUUAUU H03 C-300730-03 hsa-miR-433 MI0001723 AUCAUGAUGGGCUCCUCGGUGU D04 C-300501-07 hsa-miR-26b MI0000084 UUCAAGUAAUUCAGGAUAGGU H04 C-300786-03 hsa-miR-519c- MI0003148 AAAGUGCAUCUUUUUAGAGGAU D05 C-300690-03 hsa-miR-381 MI0000789 UAUACAAGGGCAAGCUCUCUGU H05 C-301469-00 hsa-miR-1972 MI0009982 UCAGGCCAGGCACAGUGGCUCA D06 C-300867-01 hsa-miR-532-5p MI0003205 CAUGCCUUGAGUGUAGGACCGU H06 C-300634-03 hsa-miR-154* MI0000480 AAUCAUACACGGUUGACCUAUU D07 C-301073-01 hsa-miR-34b MI0000742 CAAUCACUAACUCCACUGCCAU H07 C-301121-01 hsa-miR-593 MI0003605 UGUCUCUGCUGGGGUUUCU D08 C-301205-01 hsa-miR-148a* MI0000253 AAAGUUCUGAGACACUCCGACU H08 C-301126-01 hsa-miR-624 MI0003638 CACAAGGUAUUGGUAUUACCU D09 C-301432-00 hsa-miR-664 MI0006442 UAUUCAUUUAUCCCCAGCCUACA H09 C-300792-03 hsa-miR-525-5p MI0003152 CUCCAGAGGGAUGCACUUUCU D10 C-300804-03 hsa-miR-518c* MI0003159 UCUCUGGAGGGAAGCACUUUCUG H10 C-300722-05 hsa-miR-429 MI0001641 UAAUACUGUCUGGUAAAACCGU D11 C-300834-05 hsa-miR-522 MI0003177 AAAAUGGUUCCCUUUAGAGUGU H11 C-300980-01 hsa-miR-548d- MI0003668 CAAAAACCACAGUUUCUUUUGC A02 C-300492-03 hsa-miR-21 MI0000077 UAGCUUAUCAGACUGAUGUUGA E02 C-301387-00 hsa-miR-548g MI0006395 AAAACUGUAAUUACUUUUGUAC A03 C-300839-05 hsa-miR-501-5p MI0003185 AAUCCUUUGUCCCUGGGUGAGA E03 C-300858-03 hsa-miR-493 MI0003132 UGAAGGUCUACUGUGUGCCAGG A04 C-301055-01 hsa-miR-140-3p MI0000456 UACCACAGGGUAGAACCACGG E04 C-301402-00 hsa-miR-1274a MI0006410 GUCCCUGUUCAGGCGCCA A05 C-301394-00 hsa-miR-548o MI0006402 CCAAAACUGCAGUUACUUUUGC E05 C-300964-01 hsa-miR-637 MI0003652 ACUGGGGGCUUUCGGGCUCUGCGU A06 C-301015-03 hsa-miR-675 MI0005416 UGGUGCGGAGAGGGCCCACAGUG E06 C-300873-01 hsa-miR-555 MI0003561 AGGGUAAGCUGAACCUCUGAU A07 C-301386-00 hsa-miR-1260 MI0006394 AUCCCACCUCUGCCACCA E07 C-300841-05 hsa-miR-503 MI0003188 UAGCAGCGGGAACAGUUCUGCAG A08 C-300613-05 hsa-miR-145 MI0000461 GUCCAGUUUUCCCAGGAAUCCCU E08 C-301050-01 hsa-miR-125b- MI0000446 ACGGGUUAGGCUCUUGGGAGCU A09 C-301382-00 hsa-miR-1256 MI0006390 AGGCAUUGACUUCUCACUAGCU E09 C-301391-00 hsa-miR-548n MI0006399 CAAAAGUAAUUGUGGAUUUUGU A10 C-300840-05 hsa-miR-502-5p MI0003186 AUCCUUGCUAUCUGGGUGCUA E10 C-300529-05 hsa-miR-196a MI0000238 UAGGUAGUUUCAUGUUGUUGGG A11 C-301430-00 hsa-miR-1308 MI0006441 GCAUGGGUGGUUCAGUGG E11 C-301258-01 hsa-miR-923 MI0005715 GUCAGCGGAGGAAAAGAAACU B02 C-301293-01 hsa-miR-1237 MI0006327 UCCUUCUGCUCCGUCCCCCA G F02 C-300750-05 hsa-miR-490-3p MI0003125 CAACCUGGAGGACUCCAUGCUG B03 C-301379-00 hsa-miR-1253 MI0006387 AGAGAAGAAGAUCAGCCUGCA F03 C-300517-03 hsa-miR-100 MI0000102 AACCCGUAGAUCCGAACUUGUG B04 C-300699-03 hsa-miR-326 MI0000808 CCUCUGGGCCCUUCCUCCAG F04 C-301375-00 hsa-miR-1248 MI0006383 ACCUUCUUGUAUAAGCACUGUGCU B05 C-300962-01 hsa-miR-635 MI0003650 ACUUGGGCACUGAAACAAUGUCC F05 C-300477-03 hsa-let-7c MI0000064 UGAGGUAGUAGGUUGUAUGGUU B06 C-301350-00 hsa-miR-1297 MI0006358 UUCAAGUAAUUCAGGUG F06 C-300693-05 hsa-miR-340* MI0000802 UCCGUCUCAGUUACUUUAUAGC B07 C-300916-01 hsa-miR-592 MI0003604 UUGUGUCAAUAUGCGAUGAUGU F07 C-300549-03 hsa-miR-10a MI0000266 UACCCUGUAGAUCCGAAUUUGUG B08 C-300951-03 hsa-miR-625 MI0003639 AGGGGGAAAGUUCUAUAGUCC F08 C-301327-00 hsa-miR-1201 MI0006333 AGCCUGAUUAAACACAUGCUCUG B09 C-301098-01 hsa-miR-518e* MI0003169 CUCUAGAGGGAAGCGCUUUCUG F09 C-301268-01 hsa-miR-939 MI0005761 UGGGGAGCUGAGGCUCUGGGGGU B10 C-301078-01 hsa-miR-371-5p MI0000779 ACUCAAACUGUGGGGGCACU F10 C-300788-03 hsa-miR-520a- MI0003149 AAAGUGCUUCCCUUUGGACUGU B11 C-300720-05 hsa-miR-20b MI0001519 CAAAGUGCUCAUAGUGCAGGUAG F11 C-300494-03 hsa-miR-23a MI0000079 AUCACAUUGCCAGGGAUUUCC

C02 C-300682-05 hsa-miR-375 MI0000783 UUUGUUCGUUCGGCUCGCGUGA G02 C-300495-07 hsa-miR-24-1* MI0000080 UGCCUACUGAGCUGAUAUCAGU plate4 C03 C-300946-01 hsa-miR-620 MI0003634 AUGGAGAUAGAUAUAGAAAU G03 C-301169-01 hsa-miR-505* MI0003190 GGGAGCCAGGAAGUAUUGAUGU C04 C-301408-00 hsa-miR-1276 MI0006416 UAAAGAGCCCUGUGGAGACA G04 C-300560-05 hsa-miR-187 MI0000274 UCGUGUCUUGUGUUGCAGCCGG C05 C-301294-01 hsa-miR-1238 MI0006328 CUUCCUCGUCUGUCUGCCCC G05 C-300666-03 hsa-miR-365 MI0000767 UAAUGCCCCUAAAAAUCCUUAU C06 C-300846-05 hsa-miR-506 MI0003193 UAAGGCACCCUUCUGAGUAGA G06 C-300940-03 hsa-miR-615-3p MI0003628 UCCGAGCCUGGGUCUCCCUCUU C07 C-301279-01 hsa-miR-877 MI0005561 GUAGAGGAGAUGGCGCAGGG G07 C-300762-05 hsa-miR-495 MI0003135 AAACAAACAUGGUGCACUUCUU C08 C-300646-05 hsa-miR-200c MI0000650 UAAUACUGCCGGGUAAUGAUGGA G08 C-300744-03 hsa-miR-485-5p MI0002469 AGAGGCUGGCCGUGAUGAAUUC C09 C-301079-01 hsa-miR-377* MI0000785 AGAGGUUGCCCUUGGUGAAUUC G09 C-300508-07 hsa-miR-32 MI0000090 UAUUGCACAUUACUAAGUUGCA C10 C-300818-03 hsa-miR-520g MI0003166 ACAAAGUGCUUCCCUUUAGAGUGU G10 C-301152-01 hsa-miR-7-1* MI0000263 CAACAAAUCACAGUCUGCCAUA C11 C-300986-03 hsa-miR-653 MI0003674 GUGUUGAAACAAUCUCUACUG G11 C-301448-00 hsa-miR-1470 MI0007075 GCCCUCCGCCCGUGCACCCCG D02 C-300587-05 hsa-miR-15b MI0000438 UAGCAGCACAUCAUGGUUUACA H02 C-301236-01 hsa-miR-876-3p MI0005542 UGGUGGUUUACAAAGUAAUUCA D03 C-301206-01 hsa-miR-96* MI0000098 AAUCAUGUGCAGUGCCAAUAUG H03 C-300952-01 hsa-miR-626 MI0003640 AGCUGUCUGAAAAUGUCUU D04 C-300955-01 hsa-miR-629* MI0003643 GUUCUCCCAACGUAAGCCCAGC H04 C-300673-05 hsa-miR-367 MI0000775 AAUUGCACUUUAGCAAUGGUGA D05 C-301161-01 hsa-miR-335* MI0000816 UUUUUCAUUAUUGCUCCUGACC H05 C-301474-00 hsa-miR-1977 MI0009987 GAUUAGGGUGCUUAGCUGUUAA D06 C-300963-03 hsa-miR-636 MI0003651 UGUGCUUGCUCGUCCCGCCCGCA H06 C-300733-05 hsa-miR-453 MI0001727 AGGUUGUCCGUGGUGAGUUCGCA D07 C-300496-05 hsa-miR-24 MI0000080 UGGCUCAGUUCAGCAGGAACAG H07 C-301026-01 hsa-miR-24-2* MI0000081 UGCCUACUGAGCUGAAACACAG D08 C-300997-01 hsa-miR-425 MI0001448 AAUGACACGAUCACUCCCGUUGA H08 C-301142-01 hsa-let-7a* MI0000060 CUAUACAAUCUACUGUCUUUC D09 C-301333-00 hsa-miR-1207- MI0006340 UGGCAGGGAGGCUGGGAGGGG H09 C-300702-03 hsa-miR-148b MI0000811 UCAGUGCAUCACAGAACUUUGU D10 C-300528-03 hsa-miR-192 MI0000234 CUGACCUAUGAAUUGACAGCC H10 C-301246-01 hsa-miR-665 MI0005563 ACCAGGAGGCUGAGGCCCCU D11 C-300740-03 hsa-miR-410 MI0002465 AAUAUAACACAGAUGGCCUGU H11 C-301064-01 hsa-miR-136* MI0000475 CAUCAUCGUCUCAAAUGAGUCU A02 C-300769-03 hsa-miR-512-3p MI0003140 AAGUGCUGUCAUAGCUGAGGUC E02 C-300572-07 hsa-miR-217 MI0000293 UACUGCAUCAGGAACUGAUUGGA A03 C-301092-01 hsa-miR-146b- MI0003129 UGCCCUGUGGACUCAGUUCUGG E03 C-301260-01 hsa-miR-509-3- MI0005717 UACUGCAGACGUGGCAAUCAUG plate5 A04 C-301308-00 hsa-miR-320b MI0003776 AAAAGCUGGGUUGAGAGGGCAA E04 C-301239-01 hsa-miR-147b MI0005544 GUGUGCGGAAAUGCUUCUGCUA 108

109

well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence A05 C-301074-01 hsa-miR-34c-3p MI0000743 AAUCACUAACCACACGGCCAGG E05 C-300944-01 hsa-miR-618 MI0003632 AAACUCUACUUGUCCUUCUGAGU A06 C-300990-01 hsa-miR-656 MI0003678 AAUAUUAUACAGUCAACCUCU E06 C-300716-05 hsa-miR-423-3p MI0001445 AGCUCGGUCUGAGGCCCCUCAGU A07 C-300729-03 hsa-miR-431 MI0001721 UGUCUUGCAGGCCGUCAUGCA E07 C-301165-01 hsa-miR-502-3p MI0003186 AAUGCACCUGGGCAAGGAUUCA A08 C-300936-01 hsa-miR-611 MI0003624 GCGAGGACCCCUCGGGGUCUGAC E08 C-300994-01 hsa-miR-659 MI0003683 CUUGGUUCAGGGAGGGUCCCCA A09 C-301059-01 hsa-miR-145* MI0000461 GGAUUCCUGGAAAUACUGUUCU E09 C-300643-03 hsa-miR-195 MI0000489 UAGCAGCACAGAAAUAUUGGC A10 C-300790-05 hsa-miR-526b* MI0003150 GAAAGUGCUUCCUUUUAGAGGC E10 C-301228-01 hsa-miR-888 MI0005537 UACUCAAAAAGCUGUCAGUCA A11 C-300949-01 hsa-miR-623 MI0003637 AUCCCUUGCAGGGGCUGUUGGGU E11 C-300687-05 hsa-miR-379 MI0000787 UGGUAGACUAUGGAACGUAGG B02 C-300977-01 hsa-miR-650 MI0003665 AGGAGGCAGCGCUCUCAGGAC F02 C-301296-01 hsa-miR-513c MI0006649 UUCUCAAGGAGGUGUCGUUUAU B03 C-300641-05 hsa-miR-194 MI0000488 UGUAACAGCAACUCCAUGUGGA F03 C-301285-01 hsa-miR-1227 MI0006316 CGUGCCACCCUUUUCCCCAG B04 C-300721-05 hsa-miR-448 MI0001637 UUGCAUAUGUAGGAUGUCCCAU F04 C-300791-05 hsa-miR-519b- MI0003151 AAAGUGCAUCCUUUUAGAGGUU B05 C-301090-01 hsa-miR-431* MI0001721 CAGGUCGUCUUGCAGGGCUUCU F05 C-301413-00 hsa-miR-548i MI0006421 AAAAGUAAUUGCGGAUUUUGCC B06 C-300650-07 hsa-miR-29c MI0000735 UAGCACCAUUUGAAAUCGGUUA F06 C-300935-01 hsa-miR-610 MI0003623 UGAGCUAAAUGUGUGCUGGGA B07 C-300899-01 hsa-miR-580 MI0003587 UUGAGAAUGAUGAAUCAUUAGG F07 C-300971-01 hsa-miR-644 MI0003659 AGUGUGGCUUUCUUAGAGC B08 C-301081-01 hsa-miR-340 MI0000802 UUAUAAAGCAAUGAGACUGAUU F08 C-300837-05 hsa-miR-499-5p MI0003183 UUAAGACUUGCAGUGAUGUUU B09 C-300710-05 hsa-miR-325 MI0000824 CCUAGUAGGUGUCCAGUAAGUGU F09 C-301136-01 hsa-miR-33a* MI0000091 CAAUGUUUCCACAGUGCAUCAC B10 C-301269-01 hsa-miR-940 MI0005762 AAGGCAGGGCCCCCGCUCCCC F10 C-300911-01 hsa-miR-589* MI0003599 UCAGAACAAAUGCCGGUUCCCAG B11 C-301349-00 hsa-miR-1295 MI0006357 UUAGGCCGCAGAUCUGGGUGA F11 C-300741-03 hsa-miR-376b MI0002466 AUCAUAGAGGAAAAUCCAUGUU C02 C-300612-05 hsa-miR-144 MI0000460 UACAGUAUAGAUGAUGUACU G02 C-301315-00 hsa-miR-1283 MI0003832 UCUACAAAGGAAAGCGCUUUCU C03 C-300765-03 hsa-miR-497 MI0003138 CAGCAGCACACUGUGGUUUGU G03 C-301312-00 hsa-miR-1271 MI0003814 CUUGGCACCUAGCAAGCACUCA plate5 C04 C-301216-01 hsa-miR-886-5p MI0005527 CGGGUCGGAGUUAGCUCAAGCGG G04 C-300742-05 hsa-miR-483-3p MI0002467 UCACUCCUCUCCUCCCGUCUU C05 C-301431-00 hsa-miR-664* MI0006442 ACUGGCUAGGGAAAAUGAUUGGA G05 C-300805-05 hsa-miR-518c MI0003159 CAAAGCGCUUCUCUUUAGAGUGU C06 C-301094-01 hsa-miR-497* MI0003138 CAAACCACACUGUGGUGUUAGA G06 C-301342-00 hsa-miR-1289 MI0006350 UGGAGUCCAGGAAUCUGCAUUUU C07 C-300531-05 hsa-miR-197 MI0000239 UUCACCACCUUCUCCACCCAGC G07 C-301445-00 hsa-miR-1827 MI0008195 UGAGGCAGUAGAUUGAAU C08 C-300581-07 hsa-miR-224 MI0000301 CAAGUCACUAGUGGUUCCGUU G08 C-301024-01 hsa-miR-22* MI0000078 AGUUCUUCAGUGGCAAGCUUUA C09 C-300745-03 hsa-miR-485-3p MI0002469 GUCAUACACGGCUCUCCUCUCU G09 C-301276-01 hsa-miR-944 MI0005769 AAAUUAUUGUACAUCGGAUGAG C10 C-300703-05 hsa-miR-331-3p MI0000812 GCCCCUGGGCCUAUCCUAGAA G10 C-300999-01 hsa-miR-758 MI0003757 UUUGUGACCUGGUCCACUAACC C11 C-301277-01 hsa-miR-1224- MI0003764 GUGAGGACUCGGGAGGUGG G11 C-300927-01 hsa-miR-602 MI0003615 GACACGGGCGACAGCUGCGGCCC D02 C-301390-00 hsa-miR-1263 MI0006398 AUGGUACCCUGGCAUACUGAGU H02 C-300812-05 hsa-miR-519d MI0003162 CAAAGUGCCUCCCUUUAGAGUG D03 C-300533-03 hsa-miR-199a- MI0000242 CCCAGUGUUCAGACUACCUGUUC H03 C-300906-01 hsa-miR-586 MI0003594 UAUGCAUUGUAUUUUUAGGUCC D04 C-300524-07 hsa-miR-105 MI0000111 UCAAAUGCUCAGACUCCUGUGGU H04 C-300717-05 hsa-miR-424 MI0001446 CAGCAGCAAUUCAUGUUUUGAA D05 C-300978-01 hsa-miR-651 MI0003666 UUUAGGAUAAGCUUGACUUUUG H05 C-301325-00 hsa-miR-1184 MI0006277 CCUGCAGCGACUUGAUGGCUUCC D06 C-301028-01 hsa-miR-27a* MI0000085 AGGGCUUAGCUGCUUGUGAGCA H06 C-301378-00 hsa-miR-1251 MI0006386 ACUCUAGCUGCCAAAGGCGCU D07 C-301362-00 hsa-miR-1303 MI0006370 UUUAGAGACGGGGUCUUGCUCU H07 C-301338-00 hsa-miR-1285 MI0006346 UCUGGGCAACAAAGUGAGACCU D08 C-301158-01 hsa-miR-367* MI0000775 ACUGUUGCUAAUAUGCAACUCU H08 C-301041-01 hsa-miR-196a* MI0000279 CGGCAACAAGAAACUGCCUGAG D09 C-301171-01 hsa-miR-508-5p MI0003195 UACUCCAGAGGGCGUCACUCAUG H09 C-301013-01 hsa-miR-770-5p MI0005118 UCCAGUACCACGUGUCAGGGCCA D10 C-301012-01 hsa-miR-768-5p MI0005117 GUUGGAGGAUGAAAGUACGGAGU H10 C-300580-07 hsa-miR-223 MI0000300 UGUCAGUUUGUCAAAUACCCCA D11 C-300595-03 hsa-miR-125b MI0000446 UCCCUGAGACCCUAACUUGUGA H11 C-300907-01 hsa-miR-587 MI0003595 UUUCCAUAGGUGAUGAGUCAC A02 C-300815-05 hsa-miR-520d- MI0003164 CUACAAAGGGAAGCCCUUUC E02 C-301423-00 hsa-miR-1284 MI0006431 UCUAUACAGACCCUGGCUUUUC A03 C-301396-00 hsa-miR-1267 MI0006404 CCUGUUGAAGUGUAAUCCCCA E03 C-301022-01 hsa-miR-20a* MI0000076 ACUGCAUUAUGAGCACUUAAAG A04 C-301399-00 hsa-miR-1270 MI0006407 CUGGAGAUAUGGAAGAGCUGUGU E04 C-301186-01 hsa-miR-490-5p MI0003125 CCAUGGAUCUCCAGGUGGGU A05 C-301295-01 hsa-miR-513b MI0006648 UUCACAAGGAGGUGUCAUUUAU E05 C-300743-03 hsa-miR-484 MI0002468 UCAGGCUCAGUCCCCUCCCGAU A06 C-300686-05 hsa-miR-378 MI0000786 ACUGGACUUGGAGUCAGAAGG E06 C-300943-01 hsa-miR-617 MI0003631 AGACUUCCCAUUUGAAGGUGGC A07 C-300736-07 hsa-miR-452* MI0001733 CUCAUCUGCAAAGAAGUAAGUG E07 C-300761-05 hsa-miR-494 MI0003134 UGAAACAUACACGGGAAACCUC A08 C-300705-05 hsa-miR-324-3p MI0000813 ACUGCCCCAGGUGCUGCUGG E08 C-301147-01 hsa-miR-513a- MI0003191 UAAAUUUCACCUUUCUGAGAAGG A09 C-300557-07 hsa-miR-182 MI0000272 UUUGGCAAUGGUAGAACUCACAC E09 C-301211-01 hsa-miR-486-3p MI0002470 CGGGGCAGCUCAGUACAGGAU A10 C-301466-00 hsa-miR-1915* MI0008336 ACCUUGCCUUGCUGCCCGGGCC E10 C-300814-03 hsa-miR-521 MI0003176 AACGCACUUCCCUUUAGAGUGU A11 C-300518-07 hsa-miR-101 MI0000103 UACAGUACUGUGAUAACUGAA E11 C-301411-00 hsa-miR-1277 MI0006419 UACGUAGAUAUAUAUGUAUUUU B02 C-300514-07 hsa-miR-96 MI0000098 UUUGGCACUAGCACAUUUUUGCU F02 C-300527-03 hsa-miR-107 MI0000114 AGCAGCAUUGUACAGGGCUAUCA B03 C-300636-07 hsa-miR-185 MI0000482 UGGAGAGAAAGGCAGUUCCUGA F03 C-300570-05 hsa-miR-215 MI0000291 AUGACCUAUGAAUUGACAGAC B04 C-301409-00 hsa-miR-302e MI0006417 UAAGUGCUUCCAUGCUU F04 C-300504-07 hsa-miR-29a MI0000087 UAGCACCAUCUGAAAUCGGUUA B05 C-301463-00 hsa-miR-1914 MI0008335 CCCUGUGCCCGGCCCACUUCUG F05 C-300872-03 hsa-miR-92b MI0003560 UAUUGCACUCGUCCCGGCCUCC B06 C-301319-00 hsa-miR-1178 MI0006271 UUGCUCACUGUUCUUCCCUAG F06 C-300976-01 hsa-miR-649 MI0003664 AAACCUGUGUUGUUCAAGAGUC B07 C-301242-01 hsa-miR-744 MI0005559 UGCGGGGCUAGGGCUAACAGCA F07 C-300668-07 hsa-miR-302b* MI0000772 ACUUUAACAUGGAAGUGCUUUC B08 C-301419-00 hsa-miR-1274b MI0006427 UCCCUGUUCGGGCGCCA F08 C-301284-01 hsa-miR-1226 MI0006313 UCACCAGCCCUGUGUUCCCUAG B09 C-300974-01 hsa-miR-647 MI0003662 GUGGCUGCACUCACUUCCUUC F09 C-301137-01 hsa-miR-92a-2* MI0000094 GGGUGGGGAUUUGUUGCAUUAC B10 C-300880-01 hsa-miR-562 MI0003568 AAAGUAGCUGUACCAUUUGC F10 C-301067-01 hsa-miR-150* MI0000479 CUGGUACAGGCCUGGGGGACAG B11 C-300887-01 hsa-miR-551b MI0003575 GCGACCCAUACUUGGUUUCAG F11 C-301331-00 hsa-miR-1205 MI0006338 UCUGCAGGGUUUGCUUUGAG

C02 C-300755-07 hsa-miR-202* MI0003130 UUCCUAUGCAUAUACUUCUUUG G02 C-300526-07 hsa-miR-106a MI0000113 AAAAGUGCUUACAGUGCAGGUAG plate6 C03 C-300901-01 hsa-miR-582-5p MI0003589 UUACAGUUGUUCAACCAGUUACU G03 C-301046-01 hsa-miR-122* MI0000442 AACGCCAUUAUCACACUAAAUA C04 C-300833-03 hsa-miR-520h MI0003175 ACAAAGUGCUUCCCUUUAGAGU G04 C-301244-01 hsa-miR-885-3p MI0005560 AGGCAGCGGGGUGUAGUGGAUA C05 C-300489-03 hsa-miR-19b MI0000074 UGUGCAAAUCCAUGCAAAACUGA G05 C-300611-05 hsa-miR-143 MI0000459 UGAGAUGAAGCACUGUAGCUC C06 C-300476-05 hsa-let-7b MI0000063 UGAGGUAGUAGGUUGUGUGGUU G06 C-301109-01 hsa-miR-532-3p MI0003205 CCUCCCACACCCAAGGCUUGCA C07 C-301457-00 hsa-miR-1909* MI0008330 UGAGUGCCGGUGCCUGCCCUG G07 C-301156-01 hsa-miR-26b* MI0000084 CCUGUUCUCCAUUACUUGGCUC C08 C-300848-05 hsa-miR-508-3p MI0003195 UGAUUGUAGCCUUUUGGAGUAGA G08 C-300543-03 hsa-miR-30d MI0000255 UGUAAACAUCCCCGACUGGAAG C09 C-300897-01 hsa-miR-578 MI0003585 CUUCUUGUGCUCUAGGAUUGU G09 C-300798-03 hsa-miR-518b MI0003156 CAAAGCGCUCCCCUUUAGAGGU C10 C-300957-01 hsa-miR-631 MI0003645 AGACCUGGCCCAGACCUCAGC G10 C-300758-03 hsa-miR-493* MI0003132 UUGUACAUGGUAGGCUUUCAUU C11 C-301326-00 hsa-miR-1200 MI0006332 CUCCUGAGCCAUUCUGAGCCUC G11 C-301438-00 hsa-miR-1197 MI0006656 UAGGACACAUGGUCUACUUCU D02 C-301056-01 hsa-miR-141* MI0000457 CAUCUUCCAGUACAGUGUUGGA H02 C-300677-05 hsa-miR-371-3p MI0000779 AAGUGCCGCCAUCUUUUGAGUGU D03 C-301007-01 hsa-miR-769-5p MI0003834 UGAGACCUCUGGGUUCUGAGCU H03 C-301425-00 hsa-miR-1292 MI0006433 UGGGAACGGGUUCCGGCAGACGC D04 C-300700-05 hsa-miR-151-3p MI0000809 CUAGACUGAAGCUCCUUGAGG H04 C-300917-01 hsa-miR-593* MI0003605 AGGCACCAGCCAGGCAUUGCUCA D05 C-300507-05 hsa-miR-31 MI0000089 AGGCAAGAUGCUGGCAUAGCU H05 C-301345-00 hsa-miR-1291 MI0006353 UGGCCCUGACUGAAGACCAGCAG D06 C-300988-01 hsa-miR-654-5p MI0003676 UGGUGGGCCGCAGAACAUGUGC H06 C-301061-01 hsa-miR-125b- MI0000470 UCACAAGUCAGGCUCUUGGGAC D07 C-301063-01 hsa-miR-129-3p MI0000473 AAGCCCUUACCCCAAAAAGCAU H07 C-301347-00 hsa-miR-1293 MI0006355 UGGGUGGUCUGGAGAUUUGUGC D08 C-301042-01 hsa-miR-218-2* MI0000295 CAUGGUUCUGUCAAGCACCGCG H08 C-301188-01 hsa-let-7d* MI0000065 CUAUACGACCUGCUGCCUUUCU D09 C-300608-03 hsa-miR-141 MI0000457 UAACACUGUCUGGUAAAGAUGG H09 C-300757-05 hsa-miR-492 MI0003131 AGGACCUGCGGGACAAGAUUCUU D10 C-301210-01 hsa-miR-297 MI0005775 AUGUAUGUGUGCAUGUGCAUG H10 C-301106-01 hsa-miR-499-3p MI0003183 AACAUCACAGCAAGUCUGUGCU D11 C-301198-01 hsa-let-7b* MI0000063 CUAUACAACCUACUGCCUUCCC H11 C-300842-07 hsa-miR-504 MI0003189 AGACCCUGGUCUGCACUCUAUC A02 C-301189-01 hsa-miR-488 MI0003123 UUGAAAGGCUAUUUCUUGGUC E02 C-301372-00 hsa-miR-1245 MI0006380 AAGUGAUCUAAAGGCCUACAU A03 C-300726-03 hsa-miR-191* MI0000465 GCUGCGCUUGGAUUUCGUCCCC E03 C-300898-03 hsa-miR-579 MI0003586 UUCAUUUGGUAUAAACCGCGAUU A04 C-301363-00 hsa-miR-1304 MI0006371 UUUGAGGCUACAGUGAGAUGUG E04 C-301010-01 hsa-miR-765 MI0005116 UGGAGGAGAAGGAAGGUGAUG A05 C-301418-00 hsa-miR-1279 MI0006426 UCAUAUUGCUUCUUUCU E05 C-301398-00 hsa-miR-1269 MI0006406 CUGGACUGAGCCGUGCUACUGG A06 C-301255-01 hsa-miR-920 MI0005712 GGGGAGCUGUGGAAGCAGUA E06 C-300558-05 hsa-miR-182* MI0000272 UGGUUCUAGACUUGCCAACUA A07 C-301118-01 hsa-miR-550 MI0003600 AGUGCCUGAGGGAGUAAGAGCCC E07 C-301321-00 hsa-miR-1180 MI0006273 UUUCCGGCUCGCGUGGGUGUGU

A08 C-301303-00 hsa-miR-205* MI0000285 GAUUUCAGUGGAGUGAAGUUC E08 C-300728-03 hsa-miR-369-5p MI0000777 AGAUCGACCGUGUUAUAUUCGC plate7 A09 C-300588-05 hsa-miR-23b MI0000439 AUCACAUUGCCAGGGAUUACC E09 C-301134-01 hsa-miR-654-3p MI0003676 UAUGUCUGCUGACCAUCACCUU A10 C-300756-07 hsa-miR-202 MI0003130 AGAGGUAUAGGGCAUGGGAA E10 C-301195-01 hsa-miR-105* MI0000111 ACGGAUGUUUGAGCAUGUGCUA A11 C-301040-01 hsa-miR-187* MI0000274 GGCUACAACACAGGACCCGGGC E11 C-301373-00 hsa-miR-1246 MI0006381 AAUGGAUUUUUGGAGCAGG B02 C-301052-01 hsa-miR-132* MI0000449 ACCGUGGCUUUCGAUUGUUACU F02 C-300591-05 hsa-miR-122 MI0000442 UGGAGUGUGACAAUGGUGUUUG B03 C-301200-01 hsa-miR-135b* MI0000810 AUGUAGGGCUAAAAGCCAUGGG F03 C-301144-01 hsa-miR-200b* MI0000342 CAUCUUACUGGGCAGCAUUGGA 109

110

well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence B04 C-300696-05 hsa-miR-342-3p MI0000805 UCUCACACAGAAAUCGCACCCGU F04 C-300884-01 hsa-miR-566 MI0003572 GGGCGCCUGUGAUCCCAAC B05 C-301480-00 hsa-miR-2110 MI0010629 UUGGGGAAACGGCCGCUGAGUG F05 C-301037-01 hsa-miR-7-2* MI0000264 CAACAAAUCCCAGUCUACCUAA B06 C-301297-00 hsa-let-7a-2* MI0000061 CUGUACAGCCUCCUAGCUUUCC F06 C-301288-01 hsa-miR-1229 MI0006319 CUCUCACCACUGCCCUCCCACAG B07 C-300992-01 hsa-miR-657 MI0003681 GGCAGGUUCUCACCCUCUCUAGG F07 C-300959-01 hsa-miR-632 MI0003647 GUGUCUGCUUCCUGUGGGA B08 C-301047-01 hsa-miR-124* MI0000443 CGUGUUCACAGCGGACCUUGAU F08 C-301082-01 hsa-miR-330-5p MI0000803 UCUCUGGGCCUGUGUCUUAGGC B09 C-300806-03 hsa-miR-524-5p MI0003160 CUACAAAGGGAAGCACUUUCUC F09 C-300939-01 hsa-miR-614 MI0003627 GAACGCCUGUUCUUGCCAGGUGG B10 C-300627-03 hsa-miR-127-3p MI0000472 UCGGAUCCGUCUGAGCUUGGCU F10 C-300825-05 hsa-miR-518e MI0003169 AAAGCGCUUCCCUUCAGAGUG B11 C-301023-01 hsa-miR-21* MI0000077 CAACACCAGUCGAUGGGCUGU F11 C-300760-03 hsa-miR-432* MI0003133 CUGGAUGGCUCCUCCAUGUCU C02 C-301150-01 hsa-miR-29b-1* MI0000105 GCUGGUUUCAUAUGGUGGUUUAG G02 C-300844-07 hsa-miR-513a- MI0003191 UUCACAGGGAGGUGUCAU C03 C-300658-03 hsa-miR-99b MI0000746 CACCCGUAGAACCGACCUUGCG G03 C-300893-03 hsa-miR-574-3p MI0003581 CACGCUCAUGCACACACCCACA C04 C-301464-00 hsa-miR-1914* MI0008335 GGAGGGGUCCCGCACUGGGAGG G04 C-301353-00 hsa-miR-548l MI0006361 AAAAGUAUUUGCGGGUUUUGUC C05 C-300921-01 hsa-miR-597 MI0003609 UGUGUCACUCGAUGACCACUGU G05 C-301453-00 hsa-miR-103-as MI0007261 UCAUAGCCCUGUACAAUGCUGCU C06 C-301032-01 hsa-miR-100* MI0000102 CAAGCUUGUAUCUAUAGGUAUG G06 C-301385-00 hsa-miR-1259 MI0006393 AUAUAUGAUGACUUAGCUUUU C07 C-301225-01 hsa-miR-891b MI0005534 UGCAACUUACCUGAGUCAUUGA G07 C-300512-07 hsa-miR-93 MI0000095 CAAAGUGCUGUUCGUGCAGGUAG

C08 C-300934-01 hsa-miR-609 MI0003622 AGGGUGUUUCUCUCAUCUCU G08 C-301420-00 hsa-miR-1281 MI0006428 UCGCCUCCUCCUCUCCC plate7 C09 C-300820-05 hsa-miR-516b MI0003172 AUCUGGAGGUAAGAAGCACUUU G09 C-300920-01 hsa-miR-596 MI0003608 AAGCCUGCCCGGCUCCUCGGG C10 C-300866-03 hsa-miR-542-3p MI0003686 UGUGACAGAUUGAUAACUGAAA G10 C-301135-01 hsa-miR-101* MI0000103 CAGUUAUCACAGUGCUGAUGCU C11 C-301459-00 hsa-miR-1911 MI0008332 UGAGUACCGCCAUGUCUGUUGGG G11 C-300582-07 hsa-miR-200b MI0000342 UAAUACUGCCUGGUAAUGAUGA D02 C-300637-07 hsa-miR-186 MI0000483 CAAAGAAUUCUCCUUUUGGGCU H02 C-300789-05 hsa-miR-526b MI0003150 CUCUUGAGGGAAGCACUUUCUGU D03 C-300523-03 hsa-miR-103 MI0000109 AGCAGCAUUGUACAGGGCUAUGA H03 C-301178-01 hsa-miR-29a* MI0000087 ACUGAUUUCUUUUGGUGUUCAG D04 C-301323-00 hsa-miR-1182 MI0006275 GAGGGUCUUGGGAGGGAUGUGAC H04 C-301472-00 hsa-miR-1975 MI0009985 CCCCCACAACCGCGCUUGACUAGC D05 C-300614-05 hsa-miR-152 MI0000462 UCAGUGCAUGACAGAACUUGG H05 C-301335-00 hsa-miR-1208 MI0006341 UCACUGUUCAGACAGGCGGA D06 C-300759-03 hsa-miR-432 MI0003133 UCUUGGAGUAGGUCAUUGGGUGG H06 C-300679-03 hsa-miR-373* MI0000781 ACUCAAAAUGGGGGCGCUUUCC D07 C-300535-05 hsa-miR-199a- MI0000242 ACAGUAGUCUGCACAUUGGUUA H07 C-300849-07 hsa-miR-509-3p MI0003196 UGAUUGGUACGUCUGUGGGUAG D08 C-300751-05 hsa-miR-491-5p MI0003126 AGUGGGGAACCCUUCCAUGAGG H08 C-300607-05 hsa-miR-140-5p MI0000456 CAGUGGUUUUACCCUAUGGUAG D09 C-301149-01 hsa-miR-29b-2* MI0000107 CUGGUUUCACAUGGUGGCUUAG H09 C-300968-01 hsa-miR-641 MI0003656 AAAGACAUAGGAUAGAGUCACCU D10 C-301140-01 hsa-let-7f-2* MI0000068 CUAUACAGUCUACUGUCUUUCC H10 C-301304-00 hsa-miR-224* MI0000301 AAAAUGGUGCCCUAGUGACUACA D11 C-300670-05 hsa-miR-302c* MI0000773 UUUAACAUGGGGGUACCUGCUG H11 C-301458-00 hsa-miR-1910 MI0008331 CCAGUCCUGUGCCUGCCGCCU A02 C-300684-03 hsa-miR-377 MI0000785 AUCACACAAAGGCAACUUUUGU E02 C-300854-03 hsa-miR-299-5p MI0000744 UGGUUUACCGUCCCACAUACAU A03 C-301341-00 hsa-miR-1287 MI0006349 UGCUGGAUCAGUGGUUCGAGUC E03 C-300628-05 hsa-miR-134 MI0000474 UGUGACUGGUUGACCAGAGGGG A04 C-301199-01 hsa-miR-30c-1* MI0000736 CUGGGAGAGGGUUGUUUACUCC E04 C-301182-01 hsa-miR-545* MI0003516 UCAGUAAAUGUUUAUUAGAUGA A05 C-300715-05 hsa-miR-422a MI0001444 ACUGGACUUAGGGUCAGAAGGC E05 C-300727-05 hsa-miR-200a* MI0000737 CAUCUUACCGGACAGUGCUGGA A06 C-300734-05 hsa-miR-451 MI0001729 AAACCGUUACCAUUACUGAGUU E06 C-301234-01 hsa-miR-875-3p MI0005541 CCUGGAAACACUGAGGUUGUG A07 C-300564-05 hsa-miR-205 MI0000285 UCCUUCAUUCCACCGGAGUCUG E07 C-301006-01 hsa-miR-769-3p MI0003834 CUGGGAUCUCCGGGGUCUUGGUU A08 C-301002-01 hsa-miR-767-5p MI0003763 UGCACCAUGGUUGUCUGAGCAUG E08 C-301201-01 hsa-miR-129* MI0000252 AAGCCCUUACCCCAAAAAGUAU A09 C-301190-01 hsa-miR-188-3p MI0000484 CUCCCACAUGCAGGGUUUGCA E09 C-301383-00 hsa-miR-1257 MI0006391 AGUGAAUGAUGGGUUCUGACC A10 C-300970-01 hsa-miR-643 MI0003658 ACUUGUAUGCUAGCUCAGGUAG E10 C-301371-00 hsa-miR-1244 MI0006379 AAGUAGUUGGUUUGUAUGAGAUG A11 C-300712-03 hsa-miR-346 MI0000826 UGUCUGCCCGCAUGCCUGCCUCU E11 C-301057-01 hsa-miR-143* MI0000459 GGUGCAGUGCUGCAUCUCUGGU B02 C-301348-00 hsa-miR-1294 MI0006356 UGUGAGGUUGGCAUUGUUGUCU F02 C-300714-07 hsa-miR-196b MI0001150 UAGGUAGUUUCCUGUUGUUGGG B03 C-300933-01 hsa-miR-608 MI0003621 AGGGGUGGUGUUGGGACAGCUCC F03 C-300493-03 hsa-miR-22 MI0000078 AAGCUGCCAGUUGAAGAACUGU B04 C-301249-01 hsa-miR-374b* MI0005566 CUUAGCAGGUUGUAUUAUCAUU F04 C-300562-03 hsa-miR-203 MI0000283 GUGAAAUGUUUAGGACCACUAG B05 C-301154-01 hsa-miR-27b* MI0000440 AGAGCUUAGCUGAUUGGUGAAC F05 C-300520-05 hsa-miR-29b MI0000105 UAGCACCAUUUGAAAUCAGUGUU B06 C-300961-01 hsa-miR-634 MI0003649 AACCAGCACCCCAACUUUGGAC F06 C-300909-01 hsa-miR-588 MI0003597 UUGGCCACAAUGGGUUAGAAC B07 C-301329-00 hsa-miR-1203 MI0006335 CCCGGAGCCAGGAUGCAGCUC F07 C-300664-05 hsa-miR-362-5p MI0000762 AAUCCUUGGAACCUAGGUGUGAG B08 C-301265-01 hsa-miR-936 MI0005758 ACAGUAGAGGGAGGAAUCGCAG F08 C-300954-03 hsa-miR-628-3p MI0003642 UCUAGUAAGAGUGGCAGUCGA B09 C-301051-01 hsa-miR-130a* MI0000448 UUCACAUUGUGCUACUGUCUGC F09 C-300817-03 hsa-miR-517b MI0003165 UCGUGCAUCCCUUUAGAGUGUU B10 C-300966-01 hsa-miR-639 MI0003654 AUCGCUGCGGUUGCGAGCGCUGU F10 C-300930-01 hsa-miR-605 MI0003618 UAAAUCCCAUGGUGCCUUCUCCU B11 C-301266-01 hsa-miR-937 MI0005759 AUCCGCGCUCUGACUCUCUGCC F11 C-301027-01 hsa-miR-26a-1* MI0000083 CCUAUUCUUGGUUACUUGCACG

C02 C-301434-00 hsa-miR-1307 MI0006444 ACUCGGCGUGGCGUCGGUCGUG G02 C-300876-01 hsa-miR-558 MI0003564 UGAGCUGCUGUACCAAAAU plate8 C03 C-301217-01 hsa-miR-892a MI0005528 CACUGUGUCCUUUCUGCGUAG G03 C-300995-01 hsa-miR-660 MI0003684 UACCCAUUGCAUAUCGGAGUUG C04 C-300651-05 hsa-miR-200a MI0000737 UAACACUGUCUGGUAACGAUGU G04 C-300937-01 hsa-miR-612 MI0003625 GCUGGGCAGGGCUUCUGAGCUCCU C05 C-300794-05 hsa-miR-523 MI0003153 GAACGCGCUUCCCUAUAGAGGGU G05 C-300647-05 hsa-miR-155 MI0000681 UUAAUGCUAAUCGUGAUAGGGGU C06 C-301393-00 hsa-miR-1265 MI0006401 CAGGAUGUGGUCAAGUGUUGUU G06 C-301208-01 hsa-miR-219-1- MI0000296 AGAGUUGAGUCUGGACGUCCCG C07 C-301187-01 hsa-miR-18b* MI0001518 UGCCCUAAAUGCCCCUUCUGGC G07 C-301460-00 hsa-miR-1911* MI0008332 CACCAGGCAUUGUGGUCUCC C08 C-300678-03 hsa-miR-372 MI0000780 AAAGUGCUGCGACAUUUGAGCGU G08 C-300617-05 hsa-miR-191 MI0000465 CAACGGAAUCCCAAAAGCAGCUG C09 C-301176-01 hsa-miR-222* MI0000299 CUCAGUAGCCAGUGUAGAUCCU G09 C-301005-01 hsa-miR-454* MI0003820 ACCCUAUCAAUAUUGUCUCUGC C10 C-301298-00 hsa-miR-103-2* MI0000108 AGCUUCUUUACAGUGCUGCCUUG G10 C-300803-05 hsa-miR-520c- MI0003158 AAAGUGCUUCCUUUUAGAGGGU C11 C-301035-01 hsa-miR-30d* MI0000255 CUUUCAGUCAGAUGUUUGCUGC G11 C-300624-05 hsa-miR-125a- MI0000469 UCCCUGAGACCCUUUAACCUGUGA D02 C-301157-01 hsa-miR-361-3p MI0000760 UCCCCCAGGUGUGAUUCUGAUUU H02 C-301302-00 hsa-miR-449b* MI0003673 CAGCCACAACUACCCUGCCACU D03 C-301403-00 hsa-miR-548h MI0006411 AAAAGUAAUCGCGGUUUUUGUC H03 C-301167-01 hsa-miR-501-3p MI0003185 AAUGCACCCGGGCAAGGAUUCU D04 C-300606-05 hsa-miR-138 MI0000476 AGCUGGUGUUGUGAAUCAGGCCG H04 C-301003-01 hsa-miR-767-3p MI0003763 UCUGCUCAUACCCCAUGGUUUCU D05 C-301122-01 hsa-miR-548a- MI0003612 AAAAGUAAUUGCGAGUUUUACC H05 C-300735-07 hsa-miR-452 MI0001733 AACUGUUUGCAGAGGAAACUGA D06 C-300915-01 hsa-miR-591 MI0003603 AGACCAUGGGUUCUCAUUGU H06 C-300537-03 hsa-miR-208a MI0000251 AUAAGACGAGCAAAAAGCUUGU D07 C-301337-00 hsa-miR-548j MI0006345 AAAAGUAAUUGCGGUCUUUGGU H07 C-300473-05 hsa-let-7a MI0000060 UGAGGUAGUAGGUUGUAUAGUU D08 C-301392-00 hsa-miR-548m MI0006400 CAAAGGUAUUUGUGGUUUUUG H08 C-300851-07 hsa-miR-514 MI0003198 AUUGACACUUCUGUGAGUAGA D09 C-301226-01 hsa-miR-220c MI0005536 ACACAGGGCUGUUGUGAAGACU H09 C-300578-05 hsa-miR-221 MI0000298 AGCUACAUUGUCUGCUGGGUUUC D10 C-301346-00 hsa-miR-548k MI0006354 AAAAGUACUUGCGGAUUUUGCU H10 C-301280-01 hsa-miR-877* MI0005561 UCCUCUUCUCCCUCCUCCCA G D11 C-300984-01 hsa-miR-663 MI0003672 AGGCGGGGCGCCGCGGGACCGC H11 C-301185-01 hsa-miR-339-3p MI0000815 UGAGCGCCUCGACGACAGAGCCG A02 C-300922-01 hsa-miR-598 MI0003610 UACGUCAUCGUUGUCAUCGUCA E02 C-301044-01 hsa-let-7i* MI0000434 CUGCGCAAGCUACUGCCUUGCU A03 C-300554-07 hsa-miR-181b MI0000270 AACAUUCAUUGCUGUCGGUGGGU E03 C-301184-01 hsa-miR-28-3p MI0000086 CACUAGAUUGUGAGCUCCUGGA A04 C-301376-00 hsa-miR-1249 MI0006384 ACGCCCUUCCCCCCCUUCUUCA E04 C-300896-01 hsa-miR-577 MI0003584 UAGAUAAAAUAUUGGUACCUG A05 C-300480-05 hsa-let-7f MI0000067 UGAGGUAGUAGAUUGUAUAGUU E05 C-300604-07 hsa-miR-137 MI0000454 UUAUUGCUUAAGAAUACGCGUAG A06 C-301317-00 hsa-miR-1185 MI0003844 AGAGGAUACCCUUUGUAUGUU E06 C-300778-05 hsa-miR-519e MI0003145 AAGUGCCUCCUUUUAGAGUGUU A07 C-300610-03 hsa-miR-142-3p MI0000458 UGUAGUGUUUCCUACUUUAUGGA E07 C-301011-01 hsa-miR-768-3p MI0005117 UCACAAUGCUGACACUCAAACUGC A08 C-300718-07 hsa-miR-425* MI0001448 AUCGGGAAUGUCGUGUCCGCCC E08 C-301014-01 hsa-miR-801 MI0005202 GAUUGCUCUGCGUGCGGAAUCGA A09 C-300571-07 hsa-miR-216a MI0000292 UAAUCUCAGCUGGCAACUGUGA E09 C-301229-01 hsa-miR-892b MI0005538 CACUGGCUCCUUUCUGGGUAGA A10 C-300895-03 hsa-miR-576-5p MI0003583 AUUCUAAUUUCUCCACGUCUUU E10 C-300719-07 hsa-miR-18b MI0001518 UAAGGUGCAUCUAGUGCAGUUAG A11 C-300569-07 hsa-miR-214 MI0000290 ACAGCAGGCACAGACAGGCAGU E11 C-300502-03 hsa-miR-27a MI0000085 UUCACAGUGGCUAAGUUCCGC B02 C-301115-01 hsa-miR-582-3p MI0003589 UAACUGGUUGAACAACUGAACC F02 C-301016-01 hsa-let-7c* MI0000064 UAGAGUUACACCCUGGGAGUUA plate9 B03 C-301334-00 hsa-miR-1207- MI0006340 UCAGCUGGCCCUCAUUUC F03 C-300973-01 hsa-miR-646 MI0003661 AAGCAGCUGCCUCUGAGGC B04 C-300731-03 hsa-miR-329 MI0001725 AACACACCUGGUUAACCUCUUU F04 C-300674-05 hsa-miR-376c MI0000776 AACAUAGAGGAAAUUCCACGU B05 C-301034-01 hsa-miR-30c-2* MI0000254 CUGGGAGAAGGCUGUUUACUCU F05 C-301143-01 hsa-miR-219-2- MI0000740 AGAAUUGUGGCUGGACAUCUGU B06 C-300486-05 hsa-miR-17* MI0000071 ACUGCAGUGAAGGCACUUGUAG F06 C-300644-03 hsa-miR-206 MI0000490 UGGAAUGUAAGGAAGUGUGUGG B07 C-300498-05 hsa-miR-25 MI0000082 CAUUGCACUUGUCUCGGUCUGA F07 C-301291-01 hsa-miR-1234 MI0006324 UCGGCCUGACCACCCACCCCAC B08 C-301421-00 hsa-miR-1282 MI0006429 UCGUUUGCCUUUUUCUGCUU F08 C-300711-05 hsa-miR-345 MI0000825 GCUGACUCCUAGUCCAGGGCUC B09 C-301069-01 hsa-miR-195* MI0000489 CCAAUAUUGGCUGUGCUGCUCC F09 C-301019-01 hsa-miR-16-1* MI0000070 CCAGUAUUAACUGUGCUGCUGA B10 C-300890-01 hsa-miR-571 MI0003578 UGAGUUGGCCAUCUGAGUGAG F10 C-301241-01 hsa-miR-744* MI0005559 CUGUUGCCACUAACCUCAACCU B11 C-300583-05 hsa-let-7g MI0000433 UGAGGUAGUAGUUUGUACAGUU F11 C-301374-00 hsa-miR-1247 MI0006382 ACCCGUCCCGUUCGUCCCCGGA C02 C-301476-00 hsa-miR-1979 MI0009989 CUCCCACUGCUUCACUUGACUA G02 C-301424-00 hsa-miR-1288 MI0006432 UGGACUGCCCUGAUCUGGAGA 110

111

well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence C03 C-300950-01 hsa-miR-624* MI0003638 UAGUACCAGUACCUUGUGUUCA G03 C-300626-07 hsa-miR-126 MI0000471 UCGUACCGUGAGUAAUAAUGCG C04 C-300546-07 hsa-miR-7 MI0000263 UGGAAGACUAGUGAUUUUGUUGU G04 C-300590-03 hsa-miR-30b MI0000441 UGUAAACAUCCUACACUCAGCU C05 C-300681-05 hsa-miR-374a MI0000782 UUAUAAUACAACCUGAUAAGUG G05 C-300773-03 hsa-miR-515-5p MI0003144 UUCUCCAAAAGAAAGCACUUUCUG C06 C-301354-00 hsa-miR-1302 MI0006362 UUGGGACAUACUUAUGCUAAA G06 C-300706-05 hsa-miR-338-3p MI0000814 UCCAGCAUCAGUGAUUUUGUUG C07 C-300953-01 hsa-miR-627 MI0003641 GUGAGUCUCUAAGAAAAGAGGA G07 C-301104-01 hsa-miR-516a- MI0003180 UUCUCGAGGAAAGAAGCACUUUC C08 C-300695-03 hsa-miR-328 MI0000804 CUGGCCCUCUCUGCCCUUCCGU G08 C-300888-01 hsa-miR-569 MI0003576 AGUUAAUGAAUCCUGGAAAGU C09 C-301436-00 hsa-miR-1322 MI0006653 GAUGAUGCUGCUGAUGCUG G09 C-301163-01 hsa-miR-221* MI0000298 ACCUGGCAUACAAUGUAGAUUU C10 C-301120-01 hsa-miR-590-3p MI0003602 UAAUUUUAUGUAUAAGCUAGU G10 C-300506-03 hsa-miR-30a* MI0000088 CUUUCAGUCGGAUGUUUGCAGC C11 C-301410-00 hsa-miR-302f MI0006418 UAAUUGCUUCCAUGUUU G11 C-301388-00 hsa-miR-1261 MI0006396 AUGGAUAAGGCUUUGGCUU D02 C-300657-03 hsa-miR-301a MI0000745 CAGUGCAAUAGUAUUGUCAAAGC H02 C-301437-00 hsa-miR-720 MI0006654 UCUCGCUGGGGCCUCCA plate9 D03 C-301305-00 hsa-miR-196b* MI0001150 UCGACAGCACGACACUGCCUUC H03 C-300969-01 hsa-miR-642 MI0003657 GUCCCUCUCCAAAUGUGUCUUG D04 C-301029-01 hsa-miR-31* MI0000089 UGCUAUGCCAACAUAUUGCCAU H04 C-301381-00 hsa-miR-1255a MI0006389 AGGAUGAGCAAAGAAAGUAGAUU D05 C-301384-00 hsa-miR-1258 MI0006392 AGUUAGGAUUAGGUCGUGGAA H05 C-300830-03 hsa-miR-518d- MI0003171 CAAAGCGCUUCCCUUUGGAGC D06 C-301197-01 hsa-miR-223* MI0000300 CGUGUAUUUGACAAGCUGAGUU H06 C-300926-01 hsa-miR-601 MI0003614 UGGUCUAGGAUUGUUGGAGGAG D07 C-301252-01 hsa-miR-301b MI0005568 CAGUGCAAUGAUAUUGUCAAAGC H07 C-301025-01 hsa-miR-23a* MI0000079 GGGGUUCCUGGGGAUGGGAUUU D08 C-301159-01 hsa-miR-106a* MI0000113 CUGCAAUGUAAGCACUUCUUAC H08 C-301336-00 hsa-miR-548e MI0006344 AAAAACUGAGACUACUUUUGCA D09 C-301000-03 hsa-miR-671-5p MI0003760 AGGAAGCCCUGGAGGGGCUGGAG H09 C-300869-01 hsa-miR-552 MI0003557 AACAGGUGACUGGUUAGACAA D10 C-300635-03 hsa-miR-184 MI0000481 UGGACGGAGAACUGAUAAGGGU H10 C-300689-03 hsa-miR-380 MI0000788 UAUGUAAUAUGGUCCACAUCUU D11 C-301145-01 hsa-miR-34a* MI0000268 CAAUCAGCAAGUAUACUGCCCU H11 C-301450-00 hsa-miR-1537 MI0007258 AAAACCGUCUAGUUACAGUUGU A02 C-301251-01 hsa-miR-760 MI0005567 CGGCUCUGGGUCUGUGGGGA E02 C-300510-05 hsa-miR-92a MI0000093 UAUUGCACUUGUCCCGGCCUGU A03 C-300912-01 hsa-miR-550* MI0003600 UGUCUUACUCCCUCAGGCACAU E03 C-301257-01 hsa-miR-922 MI0005714 GCAGCAGAGAAUAGGACUACGUC A04 C-301435-00 hsa-miR-1321 MI0006652 CAGGGAGGUGAAUGUGAU E04 C-300779-03 hsa-miR-520f MI0003146 AAGUGCUUCCUUUUAGAGGGUU A05 C-301332-00 hsa-miR-1206 MI0006339 UGUUCAUGUAGAUGUUUAAGC E05 C-301207-01 hsa-miR-93* MI0000095 ACUGCUGAGCUAGCACUUCCCG A06 C-300532-05 hsa-miR-198 MI0000240 GGUCCAGAGGGGAGAUAGGUUC E06 C-301193-01 hsa-miR-183* MI0000273 GUGAAUUACCGAAGGGCCAUAA A07 C-301275-01 hsa-miR-943 MI0005768 CUGACUGUUGCCGUCCUCCAG E07 C-300775-05 hsa-miR-515-3p MI0003144 GAGUGCCUUCUUUUGGAGCGUU A08 C-300787-03 hsa-miR-520a- MI0003149 CUCCAGAGGGAAGUACUUUCU E08 C-301471-00 hsa-miR-1974 MI0009984 UGGUUGUAGUCCGUGCGAGAAUA A09 C-300600-05 hsa-miR-133a MI0000450 UUUGGUCCCCUUCAACCAGCUG E09 C-301062-01 hsa-miR-127-5p MI0000472 CUGAAGCUCAGAGGGCUCUGAU A10 C-301155-01 hsa-miR-424* MI0001446 CAAAACGUGAGGCGCUGCUAU E10 C-300563-05 hsa-miR-204 MI0000284 UUCCCUUUGUCA UCCUA UGCCU A11 C-301444-00 hsa-miR-1826 MI0008194 AUUGAUCAUCGACACUUCGAACGC E11 C-300767-03 hsa-miR-512-5p MI0003140 CACUCAGCCUUGAGGGCACUUUC B02 C-300567-03 hsa-miR-212 MI0000288 UAACAGUCUCCAGUCACGGCC F02 C-300772-03 hsa-miR-520e MI0003143 AAAGUGCUUCCUUUUUGAGGG B03 C-301281-01 hsa-miR-1225- MI0006311 GUGGGUACGGCCCAGUGGGGGG F03 C-301224-01 hsa-miR-890 MI0005533 UACUUGGAAAGGCAUCAGUUG B04 C-301124-01 hsa-miR-616 MI0003629 AGUCAUUGGAGGGUUUGAGCAG F04 C-300985-01 hsa-miR-449b MI0003673 AGGCAGUGUAUUGUUAGCUGGC B05 C-300553-05 hsa-miR-181a MI0000289 AACAUUCAACGCUGUCGGUGAGU F05 C-301449-00 hsa-miR-1471 MI0007076 GCCCGCGUGUGGAGCCAGGUGU B06 C-301262-01 hsa-miR-933 MI0005755 UGUGCGCAGGGAGACCUCUCCC F06 C-301039-01 hsa-miR-181c* MI0000271 AACCAUCGACCGUUGAGUGGAC B07 C-301477-00 hsa-miR-2052 MI0010486 UGUUUUGAUAACAGUAAUGU F07 C-301033-01 hsa-miR-192* MI0000234 CUGCCAAUUCCAUAGGUCACAG B08 C-301248-01 hsa-miR-543 MI0005565 AAACAUUCGCGGUGCACUUCUU F08 C-300838-05 hsa-miR-500* MI0003184 AUGCACCUGGGCAAGGAUUCUG B09 C-301170-01 hsa-miR-23b* MI0000439 UGGGUUCCUGGCAUGCUGAUUU F09 C-300958-03 hsa-miR-33b MI0003646 GUGCAUUGCUGUUGCAUUGC B10 C-300807-03 hsa-miR-524-3p MI0003160 GAAGGCGCUUCCCUUUGGAGU F10 C-300904-01 hsa-miR-585 MI0003592 UGGGCGUAUCUGUAUGCUA B11 C-300891-01 hsa-miR-572 MI0003579 GUCCGCUCGGCGGUGGCCCA F11 C-300654-03 hsa-miR-34b* MI0000742 UAGGCAGUGUCAUUAGCUGAUUG C02 C-300499-05 hsa-miR-26a MI0000083 UUCAAGUAAUCCAGGAUAGGCU G02 C-300544-05 hsa-miR-139-5p MI0000261 UCUACAGUGCACGUGUCUCCAG plate10 C03 C-301068-01 hsa-miR-193a- MI0000487 UGGGUCUUUGCGGGCGAGAUGA G03 C-300882-01 hsa-miR-564 MI0003570 AGGCACGGUGUCAGCAGGC C04 C-301447-00 hsa-miR-1469 MI0007074 CUCGGCGCGGGGCGCGGGCUCC G04 C-301247-01 hsa-miR-873 MI0005564 GCAGGAACUUGUGAGUCUCCU C05 C-301221-01 hsa-miR-450b- MI0005531 UUUUGCAAUAUGUUCCUGAAUA G05 C-301307-00 hsa-miR-1264 MI0003758 CAAGUCUUAUUUGAGCACCUGUU C06 C-300850-07 hsa-miR-510 MI0003197 UACUCAGGAGAGUGGCAAUCAC G06 C-301401-00 hsa-miR-1273 MI0006409 GGGCGACAAAGCAAGACUCUUUC C07 C-301077-01 hsa-miR-26a-2* MI0000750 CCUAUUCUUGAUUACUUGUUUC G07 C-300889-03 hsa-miR-570 MI0003577 CGAAAACAGCAAUUACCUUUGC C08 C-301456-00 hsa-miR-1909 MI0008330 CGCAGGGGCCGGGUGCUCACCG G08 C-301223-01 hsa-miR-874 MI0005532 CUGCCCUGGCCCGAGGGACCGA C09 C-301191-01 hsa-miR-186* MI0000483 GCCCAAAGGUGAAUUUUUUGGG G09 C-301004-03 hsa-miR-454 MI0003820 UAGUGCAAUAUUGCUUAUAGGGU C10 C-300709-07 hsa-miR-133b MI0000822 UUUGGUCCCCUUCAACCAGCUA G10 C-301087-01 hsa-miR-148b* MI0000811 AAGUUCUGUUAUACACUCAGGC C11 C-300752-03 hsa-miR-511 MI0003127 GUGUCUUUUGCUCUGCAGUCA G11 C-300808-03 hsa-miR-517* MI0003161 CCUCUAGAUGGAAGCACUGUCU D02 C-300584-05 hsa-let-7i MI0000434 UGAGGUAGUAGUUUGUGCUGUU H02 C-300835-05 hsa-miR-519a MI0003178 AAAGUGCAUCCUUUUAGAGUGU D03 C-300568-05 hsa-miR-181a* MI0000289 ACCAUCGACCGUUGAUUGUACC H03 C-301365-00 hsa-miR-1243 MI0006373 AACUGGAUCAAUUAUAGGAGUG D04 C-300938-01 hsa-miR-613 MI0003626 AGGAAUGUUCCUUCUUUGCC H04 C-301320-00 hsa-miR-1179 MI0006272 AAGCAUUCUUUCAUUGGUUGG D05 C-300540-05 hsa-miR-148a MI0000253 UCAGUGCACUACAGAACUUUGU H05 C-301129-01 hsa-miR-629 MI0003643 UGGGUUUACGUUGGGAGAACU D06 C-301263-01 hsa-miR-934 MI0005756 UGUCUACUACUGGAGACACUGG H06 C-301283-01 hsa-miR-1226* MI0006313 GUGAGGGCAUGCAGGCCUGGAUG D07 C-301440-00 hsa-miR-320d MI0008190 AAAAGCUGGGUUGAGAGGA H07 C-300513-05 hsa-miR-95 MI0000097 UUCAACGGGUAUUUAUUGAGCA D08 C-301133-01 hsa-miR-411* MI0003675 UAUGUAACACGGUCCACUAACC H08 C-301131-01 hsa-miR-548d- MI0003668 AAAAGUAAUUGUGGUUUUUGCC D09 C-300860-03 hsa-miR-544 MI0003515 AUUCUGCAUUUUUAGCAAGUUC H09 C-300892-01 hsa-miR-573 MI0003580 CUGAAGUGAUGUGUAACUGAUCA D10 C-301274-01 hsa-miR-942 MI0005767 UCUUCUCUGUUUUGGCCA UGUG H10 C-301114-01 hsa-miR-576-3p MI0003583 AAGAUGUGGAAAAAUUGGAAUC D11 C-300932-01 hsa-miR-607 MI0003620 GUUCAAAUCCAGAUCUAUAAC H11 C-301060-01 hsa-miR-125a- MI0000469 ACAGGUGAGGUUCUUGGGAGCC A02 C-300561-05 hsa-miR-199b- MI0000282 CCCAGUGUUUAGACUAUCUGUUC E02 C-300694-03 hsa-miR-330-3p MI0000803 GCAAAGCACACGGCCUGCAGAGA A03 C-300903-01 hsa-miR-584 MI0003591 UUAUGGUUUGCCUGGGACUGAG E03 C-301021-01 hsa-miR-19b-1* MI0000074 AGUUUUGCAGGUUUGCAUCCAGC A04 C-300914-01 hsa-miR-590-5p MI0003602 GAGCUUAUUCAUAAAAGUGCAG E04 C-301478-00 hsa-miR-2053 MI0010487 GUGUUAAUUAAACCUCUAUUUAC A05 C-300816-05 hsa-miR-520d- MI0003164 AAAGUGCUUCUCUUUGGUGGGU E05 C-300843-07 hsa-miR-505 MI0003190 CGUCAACACUUGCUGGUUUCCU A06 C-301310-00 hsa-miR-1296 MI0003780 UUAGGGCCCUGGCUCCAUCUCC E06 C-301455-00 hsa-miR-1908 MI0008329 CGGCGGGGACGGCGAUUGGUC A07 C-300483-03 hsa-miR-16 MI0000070 UAGCAGCACGUAAAUAUUGGCG E07 C-301085-01 hsa-miR-323-5p MI0000807 AGGUGGUCCGUGGCGCGUUCGC A08 C-300503-05 hsa-miR-28-5p MI0000086 AAGGAGCUCACAGUCUAUUGAG E08 C-300749-07 hsa-miR-489 MI0003124 GUGACAUCACAUAUACGGCAGC A09 C-300747-03 hsa-miR-487a MI0002471 AAUCAUACAGGGACAUCCAGUU E09 C-301204-01 hsa-let-7f-1* MI0000067 CUAUACAAUCUAUUGCCUUCCC A10 C-300685-03 hsa-miR-378* MI0000786 CUCCUGACUCCAGGUCCUGUGU E10 C-300704-03 hsa-miR-324-5p MI0000813 CGCAUCCCCUAGGGCAUUGGUGU A11 C-300559-07 hsa-miR-183 MI0000273 UAUGGCACUGGUAGAAUUCACU E11 C-301088-01 hsa-miR-338-5p MI0000814 AACAAUAUCCUGGUGCUGAGUG B02 C-300575-05 hsa-miR-219-5p MI0000296 UGAUUGUCCAAACGCAAUUCU F02 C-301172-01 hsa-miR-455-3p MI0003513 GCAGUCCAUGGGCAUAUACAC B03 C-301299-00 hsa-miR-365* MI0000769 AGGGACUUUCAGGGGCAGCUGU F03 C-301322-00 hsa-miR-1181 MI0006274 CCGUCGCCGCCACCCGAGCCG B04 C-301128-01 hsa-miR-628-5p MI0003642 AUGCUGACAUAUUUACUAGAGG F04 C-301113-01 hsa-miR-574-5p MI0003581 UGAGUGUGUGUGUGUGAGUGUGU B05 C-300945-01 hsa-miR-619 MI0003633 GACCUGGACAUGUUUGUGCCCAGU F05 C-301008-01 hsa-miR-766 MI0003836 ACUCCAGCCCCACAGCCUCAGC B06 C-300630-03 hsa-miR-146a MI0000477 UGAGAACUGAAUUCCAUGGGUU F06 C-301267-01 hsa-miR-938 MI0005760 UGCCCUUAAAGGUGAACCCAGU plate11 B07 C-301352-00 hsa-miR-1300 MI0006360 UUGAGAAGGAGGCUGCUG F07 C-300545-05 hsa-miR-147 MI0000262 GUGUGUGGAAAUGCUUCUGC B08 C-301058-01 hsa-miR-144* MI0000460 GGAUAUCAUCAUAUACUGUAAG F08 C-301089-01 hsa-miR-423-5p MI0001445 UGAGGGGCAGAGAGCGAGACUUU B09 C-301107-01 hsa-miR-483-5p MI0002467 AAGACGGGAGGAAAGAAGGGAG F09 C-301426-00 hsa-miR-1252 MI0006434 AGAAGGAAAUUGAAUUCAUUUA B10 C-301290-01 hsa-miR-1233 MI0006323 UGAGCCCUGUCCUCCCGCAG F10 C-301417-00 hsa-miR-1278 MI0006425 UAGUACUGUGCAUAUCAUCUAU B11 C-301461-00 hsa-miR-1912 MI0008333 UACCCAGAGCAUGCAGUGUGAA F11 C-300979-03 hsa-miR-652 MI0003667 AAUGGCGCCACUAGGGUUGUG C02 C-301328-00 hsa-miR-1202 MI0006334 GUGCCAGCUGCAGUGGGGGAG G02 C-301306-00 hsa-miR-675* MI0005416 CUGUAUGCCCUCACCGCUCA C03 C-301038-01 hsa-miR-10a* MI0000266 CAAAUUCGUAUCUAGGGGAAUA G03 C-300663-05 hsa-miR-361-5p MI0000760 UUAUCAGAAUCUCCAGGGGUAC C04 C-300925-01 hsa-miR-600 MI0003613 ACUUACAGACAAGAGCCUUGCUC G04 C-301053-01 hsa-miR-135a* MI0000452 UAUAGGGAUUGGAGCCGUGGCG C05 C-301054-01 hsa-miR-138-2* MI0000455 GCUAUUUCACGACACCAGGGUU G05 C-300632-03 hsa-miR-150 MI0000479 UCUCCCAACCCUUGUACCAGUG C06 C-300928-01 hsa-miR-603 MI0003616 CACACACUGCAAUUACUUUUGC G06 C-300609-05 hsa-miR-142-5p MI0000458 CAUAAAGUAGAAAGCACUACU C07 C-300885-01 hsa-miR-567 MI0003573 AGUAUGUUCUUCCAGGACAGAAC G07 C-301232-01 hsa-miR-889 MI0005540 UUAAUAUCGGACAACCAUUGU C08 C-300542-05 hsa-miR-30c MI0000736 UGUAAACAUCCUACACUCUCAGC G08 C-300996-01 hsa-miR-421 MI0003685 AUCAACAGACAUUAAUUGGGCGC C09 C-301395-00 hsa-miR-1266 MI0006403 CCUCAGGGCUGUAGAACAGGGCU G09 C-301227-01 hsa-miR-888* MI0005537 GACUGACACCUCUUUGGGUGAA

111

112

well well Catalog no. Sanger ID Pre-Cursor Mature Sequence Catalog no. Sanger ID Pre-Cursor Mature Sequence C10 C-301138-01 hsa-miR-218-1* MI0000294 AUGGUUCCGUCAAGCACCAUGG G10 C-301173-01 hsa-miR-10b* MI0000267 ACAGAUUCGAUUCUAGGGGAAU C11 C-300708-05 hsa-miR-335 MI0000816 UCAAGAGCAAUAACGAAAAAUGU G11 C-300653-05 hsa-miR-302a MI0000738 UAAGUGCUUCCAUGUUUUGGUGA D02 C-301313-00 hsa-miR-1301 MI0003815 UUGCAGCUGCCUGGGAGUGACUUC H02 C-301183-01 hsa-miR-25* MI0000082 AGGCGGAGACUUGGGCAAUUG D03 C-300479-05 hsa-let-7e MI0000066 UGAGGUAGGAGGUUGUAUAGUU H03 C-301036-01 hsa-miR-139-3p MI0000261 GGAGACGCGGCCCUGUUGGAGU D04 C-300797-03 hsa-miR-520b MI0003155 AAAGUGCUUCCUUUUAGAGGG H04 C-301091-01 hsa-miR-491-3p MI0003126 CUUAUGCAAGAUUCCCUUCUAC D05 C-300771-03 hsa-miR-498 MI0003142 UUUCAAGCCAGGGGGCGUUUUUC H05 C-300900-01 hsa-miR-581 MI0003588 UCUUGUGUUCUCUAGAUCAGU D06 C-300589-05 hsa-miR-27b MI0000440 UUCACAGUGGCUAAGUUCUGC H06 C-301324-00 hsa-miR-1183 MI0006276 CACUGUAGGUGAUGGUGAGAGUG plate11 D07 C-300566-03 hsa-miR-211 MI0000287 UUCCCUUUGUCA UCCUUCGCCU H07 C-301240-01 hsa-miR-190b MI0005545 UGAUAUGUUUGAUAUUGGGUU D08 C-301400-00 hsa-miR-1272 MI0006408 GAUGAUGAUGGCAGCAAAUUCUG H08 C-300723-03 hsa-miR-449a MI0001648 UGGCAGUGUAUUGUUAGCUGGU D09 C-300598-03 hsa-miR-130a MI0000448 CAGUGCAAUGUUAAAAGGGCAU H09 C-300621-07 hsa-miR-9* MI0000466 AUAAAGCUAGAUAACCGAAAGU D10 C-301243-01 hsa-miR-885-5p MI0005560 UCCAUUACACUACCCUGCCUCU H10 C-300538-05 hsa-miR-129-5p MI0000252 CUUUUUGCGGUCUGGGCUUGC D11 C-301214-01 hsa-miR-300 MI0005525 UAUACAAGGGCAGACUCUCUCU

6.2 Screen miRNA raw data

Table 25: Screen data results. B (basal), H (HRG), CV (crystal violet), ‘-1’ (replicate 1), ‘-2’ (replicate 2), NA (not applicable)

well ID qval

ΔAkt_1 ΔAkt_2 Akt_B1 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 B01 miR-Control 35,11 30,23 36,69 34,58 20,14 21,74 6,52 6,27 0,65 0,74 0,69 0,89 -2,43 -2,27 -0,87 -0,67 1,56 1,60 0,0002 C01 miR-149 31,56 28,39 29,06 31,11 15,19 14,60 7,53 6,73 0,50 0,72 0,56 0,81 -2,07 -2,08 -0,94 -1,09 1,13 0,99 0,3363 D01 siLacZ 34,82 30,99 33,98 31,62 23,95 22,90 7,21 7,23 0,67 0,86 0,66 0,85 -2,27 -2,10 -0,50 -0,47 1,77 1,63 0,2685 E01 siErbB2 29,71 27,32 29,60 28,82 5,72 6,35 3,54 4,19 0,56 0,67 0,70 0,76 -3,07 -2,70 -2,37 -2,18 0,70 0,52 0,2158 F01 siErbB3 34,26 29,46 34,37 33,19 11,05 10,48 5,16 4,88 0,58 0,56 0,63 0,70 -2,73 -2,59 -1,64 -1,66 1,09 0,93 0,3363 A02 hsa-miR-561 32,22 92,66 35,13 34,15 22,11 25,32 7,38 41,98 0,57 0,64 0,58 0,80 -2,13 -1,14 -0,67 -0,43 1,46 0,71 0,7324 B02 hsa-miR-891a 34,85 29,22 33,00 32,90 21,82 23,62 7,68 8,02 0,68 0,77 0,70 0,97 -2,18 -1,87 -0,60 -0,48 1,58 1,39 0,5792 C02 hsa-miR-606 35,63 34,18 34,21 36,83 27,80 34,09 8,08 9,82 0,70 0,97 0,71 1,01 -2,14 -1,80 -0,30 -0,11 1,84 1,69 0,2852 D02 hsa-miR-220b 34,57 32,26 35,16 35,55 24,94 28,05 6,55 7,42 0,73 0,94 0,81 1,05 -2,40 -2,12 -0,50 -0,34 1,90 1,78 0,1750 E02 hsa-miR-302d* 30,39 27,59 29,76 29,69 20,72 22,60 7,84 8,01 0,65 0,87 0,65 0,93 -1,95 -1,78 -0,52 -0,39 1,43 1,39 0,3363 F02 hsa-miR-299-3p 31,23 27,82 29,86 29,85 23,78 18,11 4,61 4,37 0,46 0,53 0,48 0,55 -2,76 -2,67 -0,33 -0,72 2,43 1,95 0,4065 G02 hsa-miR-29c* 32,78 29,53 30,87 31,08 25,58 27,38 6,13 6,33 0,66 0,78 0,60 0,83 -2,42 -2,22 -0,27 -0,18 2,15 2,04 0,0702 H02 hsa-miR-298 32,84 27,08 31,92 31,29 14,01 14,82 4,80 4,51 0,58 0,67 0,75 0,78 -2,77 -2,59 -1,19 -1,08 1,58 1,51 0,1636 A03 hsa-miR-615-5p 31,85 33,24 32,46 35,66 20,65 28,04 6,03 8,28 0,59 1,03 0,66 1,02 -2,40 -2,01 -0,65 -0,35 1,75 1,66 0,1057 B03 hsa-miR-193b* 27,75 24,86 28,32 26,27 15,22 18,51 3,28 3,53 0,46 0,54 0,37 0,54 -3,08 -2,82 -0,90 -0,51 2,19 2,31 0,0879 C03 hsa-miR-548b-5p 32,35 31,98 28,27 31,54 16,46 24,03 9,18 10,21 0,70 1,01 0,53 0,85 -1,82 -1,65 -0,78 -0,39 1,04 1,25 0,5146 D03 hsa-miR-518d-5p 33,03 34,22 28,70 35,85 22,19 33,57 5,96 6,93 0,62 0,86 0,59 0,80 -2,47 -2,30 -0,37 -0,09 2,10 2,21 0,0679 E03 hsa-miR-621 33,81 32,77 31,27 33,53 11,39 14,05 6,20 7,48 0,59 0,93 0,55 0,85 -2,45 -2,13 -1,46 -1,26 0,99 0,88 0,1739 F03 hsa-miR-15a 27,99 26,86 25,26 26,88 20,29 21,56 5,22 5,98 0,30 0,45 0,26 0,37 -2,42 -2,17 -0,32 -0,32 2,11 1,85 0,3363 G03 hsa-miR-548c-3p 33,20 33,52 32,59 34,09 24,42 29,87 5,95 7,22 0,68 1,12 0,69 0,94 -2,48 -2,21 -0,42 -0,19 2,06 2,02 0,0000 H03 hsa-miR-185* 30,40 24,22 32,00 27,88 13,08 11,09 3,87 3,53 0,48 0,63 0,64 0,58 -2,97 -2,78 -1,29 -1,33 1,68 1,45 0,5143 A04 hsa-miR-589 33,53 31,68 34,76 33,64 22,36 28,47 5,51 5,27 0,70 0,71 0,67 0,74 -2,60 -2,59 -0,64 -0,24 1,97 2,35 0,3612 B04 hsa-miR-374a* 34,07 31,47 32,91 34,68 23,55 28,30 6,75 6,95 0,76 0,89 0,78 0,96 -2,33 -2,18 -0,48 -0,29 1,85 1,89 0,0000 C04 hsa-miR-887 33,35 30,28 34,60 34,30 20,91 23,80 5,31 5,54 0,60 0,70 0,62 0,72 -2,65 -2,45 -0,73 -0,53 1,92 1,92 0,0000 D04 hsa-miR-924 39,19 34,51 37,47 40,93 29,91 35,50 5,80 5,93 0,56 0,70 0,59 0,82 -2,76 -2,54 -0,33 -0,21 2,43 2,34 0,0218 E04 hsa-miR-32* 31,73 28,95 31,72 34,03 25,00 28,70 5,85 6,51 0,45 0,55 0,45 0,63 -2,44 -2,15 -0,34 -0,25 2,09 1,91 0,2565 F04 hsa-miR-488* 30,95 27,93 30,80 33,43 18,32 18,65 5,91 5,64 0,56 0,71 0,58 0,79 -2,39 -2,31 -0,75 -0,84 1,64 1,47 0,4575 G04 hsa-miR-15a* 12,78 31,57 33,66 33,56 20,58 20,94 1,53 7,38 0,67 0,84 0,64 0,86 -3,06 -2,10 -0,71 -0,68 2,35 1,42 0,6469 H04 hsa-miR-1324 13,88 32,97 32,01 34,78 20,32 21,12 1,63 7,41 0,68 0,83 0,65 0,85 -3,09 -2,15 -0,66 -0,72 2,43 1,43 0,6407

A05 hsa-miR-128 30,90 30,19 32,47 33,66 13,73 17,67 6,55 7,47 0,68 0,99 0,75 1,01 -2,24 -2,01 -1,24 -0,93 1,00 1,08 0,1263 plate 1 plate B05 hsa-miR-92a-1* 29,05 25,59 35,77 30,45 13,72 12,38 3,73 3,41 0,36 0,41 0,40 0,49 -2,96 -2,91 -1,38 -1,30 1,58 1,61 0,0000 C05 hsa-miR-373 28,07 27,45 29,59 31,36 9,55 8,74 3,73 3,91 0,62 0,85 0,63 0,93 -2,91 -2,81 -1,63 -1,84 1,28 0,97 0,5882 D05 hsa-miR-876-5p 34,89 37,17 36,42 43,55 22,21 29,25 6,14 6,45 0,63 0,81 0,66 0,99 -2,51 -2,53 -0,71 -0,57 1,79 1,95 0,2457 E05 hsa-miR-200c* 35,38 34,52 35,97 38,31 27,81 36,47 8,77 9,31 0,63 0,84 0,63 1,01 -2,01 -1,89 -0,37 -0,07 1,64 1,82 0,3363 F08 hsa-miR-556-3p 30,65 33,62 30,03 37,27 14,70 21,55 5,85 6,95 0,48 0,75 0,50 0,80 -2,39 -2,27 -1,03 -0,79 1,36 1,48 0,6182 F05 hsa-miR-106b* 34,00 33,02 34,57 39,30 25,83 32,99 7,12 7,26 0,51 0,74 0,57 0,94 -2,26 -2,19 -0,42 -0,25 1,84 1,93 0,0767 G05 hsa-miR-193a-3p 33,13 28,82 33,40 34,36 17,22 18,08 3,45 3,52 0,37 0,42 0,52 0,56 -3,26 -3,03 -0,96 -0,93 2,31 2,11 0,2274 H05 hsa-miR-188-5p 33,27 31,44 34,85 36,56 27,30 33,32 7,51 6,48 0,70 0,58 0,63 0,77 -2,15 -2,28 -0,35 -0,13 1,80 2,14 0,3975 A06 hsa-miR-557 36,22 33,66 37,60 35,88 19,62 22,75 5,30 5,58 0,62 0,71 0,68 0,68 -2,77 -2,59 -0,94 -0,66 1,83 1,94 0,0879 B06 hsa-miR-146a* 35,38 33,53 36,94 36,82 25,42 29,19 6,94 8,13 0,73 0,98 0,73 0,98 -2,35 -2,04 -0,54 -0,34 1,81 1,71 0,1244 C06 hsa-miR-363* 32,04 27,25 34,04 30,73 23,16 19,89 4,35 3,31 0,42 0,41 0,43 0,44 -2,88 -3,04 -0,56 -0,63 2,32 2,41 0,0156 D06 hsa-miR-518f 38,98 33,21 38,88 39,30 19,08 26,46 5,68 9,22 0,53 0,85 0,61 1,01 -2,78 -1,85 -1,03 -0,57 1,75 1,28 0,7324 E06 hsa-miR-193b 31,08 29,88 32,20 34,77 16,92 20,51 3,49 3,82 0,37 0,52 0,36 0,61 -3,15 -2,97 -0,93 -0,76 2,22 2,21 0,0000 F06 hsa-miR-16-2* 34,58 32,81 33,58 38,83 27,85 34,31 9,17 12,14 0,61 0,91 0,68 1,09 -1,91 -1,43 -0,27 -0,18 1,64 1,26 0,7873 G06 hsa-miR-545 36,66 35,14 37,33 38,85 25,45 30,55 7,04 7,87 0,70 0,86 0,80 1,05 -2,38 -2,16 -0,55 -0,35 1,83 1,81 0,0000 H06 hsa-miR-1268 38,56 34,64 36,24 37,21 20,51 23,83 6,99 7,94 0,68 0,94 0,92 1,04 -2,46 -2,13 -0,82 -0,64 1,64 1,48 0,4238 A07 hsa-miR-500 32,36 28,20 30,41 33,23 19,16 21,92 5,77 5,51 0,53 0,66 0,54 0,75 -2,49 -2,36 -0,67 -0,60 1,82 1,76 0,0112 B07 hsa-miR-34a 37,84 34,41 34,75 38,89 29,09 36,40 7,61 8,46 0,37 0,54 0,38 0,60 -2,31 -2,02 -0,26 -0,10 2,06 1,93 0,1402 C07 hsa-miR-2113 31,25 29,87 31,96 33,99 10,15 9,02 4,53 4,88 0,62 0,83 0,68 0,88 -2,79 -2,61 -1,65 -1,91 1,13 0,70 0,5118 D07 hsa-miR-154 29,77 28,93 30,12 33,45 17,66 25,82 8,41 9,22 0,62 0,86 0,61 1,00 -1,82 -1,65 -0,77 -0,37 1,05 1,28 0,5469 E07 hsa-miR-190 32,29 33,53 31,41 37,43 16,95 25,53 6,32 7,69 0,61 0,91 0,61 1,04 -2,35 -2,12 -0,89 -0,55 1,46 1,57 0,3551 F07 hsa-miR-671-3p 27,73 23,90 24,81 26,87 14,02 19,64 5,00 4,34 0,38 0,44 0,32 0,54 -2,47 -2,46 -0,82 -0,45 1,65 2,01 0,4552 G07 hsa-miR-181a-2* 35,83 36,92 36,26 40,82 21,30 28,48 4,18 10,55 0,65 0,97 0,81 1,06 -3,10 -1,81 -0,77 -0,52 2,33 1,29 0,6990 H07 hsa-miR-655 30,76 29,23 34,02 33,31 13,10 15,00 5,00 5,91 0,48 0,71 0,62 0,90 -2,62 -2,31 -1,38 -1,15 1,25 1,16 0,3335 A08 hsa-miR-1225-3p 34,12 32,52 32,24 37,17 24,11 30,36 5,77 6,07 0,61 0,77 0,55 0,87 -2,56 -2,42 -0,42 -0,29 2,14 2,13 0,0000 B08 hsa-miR-19a* 30,67 27,13 30,14 33,22 15,66 18,93 6,05 6,06 0,60 0,79 0,62 0,98 -2,34 -2,16 -0,94 -0,81 1,40 1,35 0,6660 C08 hsa-miR-1299 34,30 34,03 34,50 39,88 17,35 20,69 4,56 5,70 0,49 0,71 0,52 0,75 -2,91 -2,58 -0,99 -0,95 1,92 1,63 0,4306 D08 hsa-miR-146b-5p 31,22 33,83 31,56 35,79 21,12 30,98 4,34 5,51 0,49 0,86 0,51 0,82 -2,85 -2,62 -0,58 -0,21 2,27 2,41 0,1119 112

113

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval E08 hsa-miR-1973 30,56 32,15 29,94 33,78 16,13 22,88 4,68 5,57 0,50 0,83 0,54 0,79 -2,71 -2,53 -0,89 -0,56 1,81 1,97 0,2274 G08 hsa-miR-369-3p 30,74 34,01 32,57 36,17 16,40 22,56 5,77 8,44 0,62 1,21 0,66 1,21 -2,41 -2,01 -0,99 -0,68 1,42 1,33 0,7583 H08 hsa-miR-149 30,81 32,52 29,64 35,44 11,03 17,46 6,73 8,14 0,48 0,84 0,58 0,95 -2,19 -2,00 -1,43 -1,02 0,77 0,98 0,3363 A09 hsa-miR-1305 33,93 29,07 31,42 37,37 23,14 32,77 9,43 8,68 0,64 0,71 0,56 1,10 -1,85 -1,74 -0,44 -0,19 1,41 1,55 0,5078 B09 hsa-miR-486-5p 28,26 24,63 27,91 30,41 13,40 16,95 4,12 3,76 0,54 0,64 0,53 0,78 -2,78 -2,71 -1,06 -0,84 1,72 1,87 0,2547 C09 hsa-miR-450a 34,15 34,47 32,17 40,53 17,52 22,03 5,49 6,24 0,68 0,90 0,59 1,04 -2,64 -2,47 -0,88 -0,88 1,76 1,59 0,3560 D09 hsa-miR-1236 31,53 26,57 30,05 35,70 20,42 30,95 7,59 7,91 0,50 0,53 0,49 0,88 -2,06 -1,75 -0,56 -0,21 1,50 1,54 0,0136 E09 hsa-miR-518f* 32,07 33,82 30,52 37,22 18,59 32,86 6,62 6,81 0,54 0,82 0,50 0,92 -2,28 -2,31 -0,72 -0,18 1,56 2,13 0,5384 F09 hsa-miR-99a* 32,90 32,36 32,22 37,51 20,18 26,78 8,59 10,78 0,67 0,87 0,63 1,11 -1,94 -1,59 -0,67 -0,49 1,26 1,10 0,4889 G09 hsa-miR-935 30,94 31,45 27,30 36,00 15,00 23,61 6,76 8,29 0,64 0,89 0,54 1,05 -2,20 -1,92 -0,86 -0,61 1,33 1,32 0,6615 H09 hsa-miR-668 33,64 33,57 33,50 35,18 15,05 14,89 6,14 6,91 0,68 0,83 0,55 1,01 -2,45 -2,28 -1,15 -1,24 1,30 1,04 0,5933 A10 hsa-miR-595 35,80 29,07 31,31 31,32 23,66 24,85 7,69 4,84 0,46 1,05 0,49 0,62 -2,22 -2,59 -0,40 -0,33 1,81 2,25 0,4273 B10 hsa-miR-30b* 29,95 25,85 27,89 29,87 11,03 12,59 5,92 5,75 0,49 0,52 0,41 0,62 -2,34 -2,17 -1,34 -1,25 1,00 0,92 0,0493 C10 hsa-miR-921 27,67 25,92 27,10 28,21 18,63 23,23 5,46 5,94 0,57 0,81 0,57 0,79 -2,34 -2,13 -0,54 -0,28 1,80 1,85 0,0000 D10 hsa-miR-487b 32,90 34,83 34,53 37,50 20,91 29,00 7,06 10,04 0,66 1,06 0,65 0,96 -2,22 -1,79 -0,72 -0,37 1,50 1,42 0,3259 E10 hsa-miR-135a 29,81 33,64 29,99 34,62 12,00 19,41 5,67 6,86 0,48 0,69 0,40 0,63 -2,39 -2,29 -1,32 -0,83 1,07 1,46 0,8291

F10 hsa-miR-645 32,17 34,62 31,72 35,54 16,68 23,89 6,08 7,36 0,54 0,83 0,45 0,72 -2,40 -2,23 -0,93 -0,57 1,48 1,66 0,4599 plate 1 plate G10 hsa-miR-1306 29,08 27,66 29,68 26,52 13,66 14,29 6,00 6,59 0,39 0,61 0,47 0,49 -2,28 -2,07 -1,12 -0,89 1,16 1,18 0,0000 H10 hsa-miR-208b 28,94 28,39 30,55 30,80 21,32 24,88 6,22 6,58 0,64 0,61 0,54 0,72 -2,22 -2,11 -0,52 -0,31 1,70 1,80 0,1334 A11 hsa-miR-559 34,89 31,95 33,35 34,34 22,40 27,64 9,37 8,58 0,63 0,93 0,65 0,92 -1,90 -1,90 -0,57 -0,31 1,32 1,58 0,7108 B11 hsa-miR-9 37,76 37,82 37,15 40,60 32,00 38,02 8,98 8,46 0,55 0,72 0,56 0,64 -2,07 -2,16 -0,22 -0,09 1,86 2,07 0,3029 C11 hsa-miR-33a 29,91 31,75 31,50 32,48 20,58 24,89 7,50 8,68 0,49 0,84 0,57 0,69 -2,00 -1,87 -0,61 -0,38 1,38 1,49 0,5132 D11 hsa-miR-339-5p 26,12 28,00 29,84 28,99 18,80 22,34 5,08 5,88 0,41 0,75 0,51 0,61 -2,36 -2,25 -0,67 -0,38 1,70 1,88 0,3241 E11 hsa-miR-1255b 25,82 26,65 28,36 25,19 12,06 12,60 4,97 5,63 0,53 0,85 0,63 0,63 -2,38 -2,24 -1,23 -1,00 1,14 1,24 0,3501 F11 hsa-miR-802 26,45 29,13 31,61 30,93 19,83 23,37 4,21 4,73 0,35 0,54 0,49 0,51 -2,65 -2,62 -0,67 -0,40 1,98 2,22 0,3001 G11 hsa-miR-302c 29,40 28,40 30,48 33,08 8,90 9,24 4,38 4,07 0,57 0,73 0,63 1,49 -2,75 -2,80 -1,78 -1,84 0,97 0,96 0,0000 H11 hsa-miR-541 29,87 28,86 32,36 31,72 14,94 15,36 4,39 3,93 0,35 0,46 0,42 0,54 -2,77 -2,88 -1,11 -1,05 1,65 1,83 0,3362 C12 siErbB3 33,72 29,85 34,38 32,06 11,22 10,26 5,55 4,92 0,46 0,70 0,50 0,48 -2,60 -2,60 -1,62 -1,64 0,99 0,96 0,0000 D12 siErbB2 28,65 26,95 28,79 28,10 6,93 8,35 4,64 4,19 0,51 0,57 0,47 0,59 -2,63 -2,69 -2,05 -1,75 0,57 0,93 0,4146 E12 siLacZ 30,91 30,86 33,47 34,92 18,80 25,91 6,48 7,01 0,55 0,78 0,58 0,90 -2,25 -2,14 -0,83 -0,43 1,42 1,71 0,5616 F12 miR-149 30,60 26,42 31,69 30,59 15,19 14,10 7,53 5,90 0,51 0,50 0,50 0,66 -2,02 -2,16 -1,06 -1,12 0,96 1,05 0,0862 G12 miR-Control 32,21 31,20 33,56 35,33 16,73 21,74 6,43 6,83 0,75 0,69 0,61 0,85 -2,32 -2,19 -1,00 -0,70 1,32 1,49 0,7324 B01 miR-Control 31,89 40,98 31,76 43,20 17,07 19,75 5,66 6,47 0,71 0,98 0,56 1,06 -2,49 -2,66 -0,90 -1,13 1,60 1,53 0,0679 C01 miR-149 26,45 32,85 28,89 39,50 13,40 16,81 6,24 5,84 0,52 0,85 0,49 0,96 -2,08 -2,49 -1,11 -1,23 0,98 1,26 0,5533 D01 siLacZ 28,78 40,54 31,68 42,94 17,89 24,82 6,03 7,49 0,59 1,13 0,60 1,14 -2,25 -2,44 -0,82 -0,79 1,43 1,65 0,5215 E01 siErbB2 25,43 30,67 26,13 35,64 4,72 5,77 2,87 2,67 0,48 0,79 0,46 0,86 -3,15 -3,52 -2,47 -2,63 0,68 0,90 0,3261 F01 siErbB3 26,84 34,46 30,35 40,74 7,92 8,99 3,21 3,50 0,34 0,73 0,41 0,79 -3,06 -3,30 -1,94 -2,18 1,13 1,12 0,0000 A02 hsa-miR-30a 27,40 44,95 36,56 45,76 14,53 14,97 4,13 7,16 0,49 1,27 0,78 1,22 -2,73 -2,65 -1,33 -1,61 1,40 1,04 0,7324 B02 hsa-miR-382 25,28 41,75 35,02 44,62 23,39 26,79 3,86 5,86 0,36 1,02 0,59 1,04 -2,71 -2,83 -0,58 -0,74 2,13 2,10 0,0000 C02 hsa-miR-640 27,63 43,87 35,28 46,37 27,97 30,55 4,00 5,00 0,41 1,11 0,58 1,10 -2,79 -3,13 -0,34 -0,60 2,45 2,53 0,0046 D02 hsa-miR-663b 28,11 42,64 34,61 47,42 21,28 20,17 5,20 7,07 0,54 1,32 0,69 1,35 -2,43 -2,59 -0,70 -1,23 1,73 1,36 0,6615 E02 hsa-miR-34c-5p 31,53 38,81 35,08 50,34 27,67 34,41 5,22 5,80 0,30 0,61 0,37 0,73 -2,59 -2,74 -0,34 -0,55 2,25 2,19 0,0001 F02 hsa-miR-106b 27,79 39,82 34,79 46,44 13,91 12,50 3,77 3,84 0,48 1,04 0,57 1,10 -2,88 -3,38 -1,32 -1,89 1,56 1,48 0,2034 G02 hsa-miR-551b* 29,02 42,28 33,07 45,93 20,19 21,74 4,84 6,33 0,47 1,10 0,54 1,08 -2,58 -2,74 -0,71 -1,08 1,87 1,66 0,3560 H02 hsa-miR-320c 31,73 43,61 34,71 51,33 24,62 27,22 5,60 6,80 0,44 1,06 0,41 1,12 -2,50 -2,68 -0,50 -0,91 2,01 1,77 0,3430 A03 hsa-miR-1468 23,65 34,15 31,06 35,90 20,95 18,00 3,45 4,51 0,40 0,88 0,64 0,89 -2,78 -2,92 -0,57 -1,00 2,21 1,92 0,3363 B03 hsa-miR-10b 25,34 37,82 33,89 40,12 16,96 13,91 2,93 3,57 0,33 0,80 0,58 0,82 -3,11 -3,40 -1,00 -1,53 2,11 1,87 0,3259 C03 hsa-miR-33b* 26,86 41,69 34,02 43,07 18,65 18,66 5,21 6,80 0,56 1,29 0,88 1,16 -2,37 -2,62 -0,87 -1,21 1,50 1,41 0,4169 D03 hsa-miR-599 27,22 41,37 34,83 45,84 17,75 17,68 4,58 5,74 0,49 1,25 0,70 1,19 -2,57 -2,85 -0,97 -1,37 1,60 1,47 0,3770 E03 hsa-miR-323-3p 22,69 35,07 28,43 36,66 14,88 18,00 5,28 7,61 0,43 1,08 0,64 1,03 -2,10 -2,20 -0,93 -1,03 1,17 1,18 0,0000 F03 hsa-miR-153 26,26 38,20 30,26 39,96 15,20 14,19 4,90 5,53 0,51 1,10 0,62 1,01 -2,42 -2,79 -0,99 -1,49 1,43 1,29 0,9138 G03 hsa-miR-296-5p 32,70 36,44 30,38 37,41 15,65 17,49 5,30 3,64 0,70 0,92 0,45 0,79 -2,63 -3,32 -0,96 -1,10 1,67 2,22 0,4972 H03 hsa-miR-92b* 29,73 39,28 29,95 42,80 13,46 16,25 5,68 7,09 0,64 1,25 0,51 1,12 -2,39 -2,47 -1,15 -1,40 1,23 1,07 0,4555 A04 hsa-let-7e* 31,95 42,90 34,44 43,85 21,47 23,68 5,69 5,80 0,69 1,15 0,75 1,11 -2,49 -2,89 -0,68 -0,89 1,81 2,00 0,2982 B04 hsa-miR-1250 24,48 32,52 28,93 34,55 17,08 13,79 3,68 3,58 0,49 0,85 0,46 0,75 -2,73 -3,18 -0,76 -1,33 1,97 1,86 0,1233 C04 hsa-miR-886-3p 30,19 38,82 34,93 43,91 33,73 34,62 3,12 3,17 0,41 0,83 0,50 0,82 -3,27 -3,61 -0,05 -0,34 3,22 3,27 0,0000

D04 hsa-miR-622 31,54 40,67 32,34 44,81 20,51 25,15 7,02 7,67 0,58 1,13 0,68 1,15 -2,17 -2,41 -0,66 -0,83 1,51 1,57 0,0782 plate 2 plate E04 hsa-miR-130b* 29,49 38,66 31,86 42,64 23,15 25,14 6,67 7,16 0,47 0,92 0,66 1,03 -2,14 -2,43 -0,46 -0,76 1,68 1,67 0,0000 F04 hsa-miR-20a 29,46 36,98 31,61 43,58 13,89 12,11 4,30 3,53 0,52 0,83 0,55 0,96 -2,78 -3,39 -1,19 -1,85 1,59 1,54 0,0101 G04 hsa-miR-1323 30,52 40,54 34,37 42,83 22,24 19,49 7,34 7,79 0,65 1,22 0,71 1,08 -2,06 -2,38 -0,63 -1,14 1,43 1,24 0,9537 H04 hsa-miR-409-3p 24,99 32,25 27,38 38,11 13,41 13,69 4,76 4,68 0,48 0,97 0,50 0,98 -2,39 -2,78 -1,03 -1,48 1,36 1,31 0,8571 A05 hsa-miR-875-5p 28,91 42,74 31,57 41,93 16,56 18,08 3,69 5,18 0,61 1,16 0,60 0,98 -2,97 -3,04 -0,93 -1,21 2,04 1,83 0,3117 B05 hsa-miR-519e* 25,12 35,96 27,98 35,74 16,41 18,47 3,13 3,59 0,44 0,92 0,44 0,76 -3,00 -3,32 -0,77 -0,95 2,23 2,37 0,1056 C05 hsa-miR-548c-5p 29,99 42,39 30,41 42,71 18,78 23,96 5,92 8,96 0,64 1,31 0,60 1,15 -2,34 -2,24 -0,70 -0,83 1,65 1,41 0,5592 D05 hsa-miR-630 24,59 36,15 27,31 37,40 17,69 20,66 4,02 5,26 0,36 0,83 0,38 0,75 -2,61 -2,78 -0,63 -0,86 1,99 1,92 0,0015 E05 hsa-miR-1275 26,07 32,24 27,19 34,24 8,25 5,93 2,77 2,51 0,37 0,65 0,37 0,62 -3,23 -3,68 -1,72 -2,53 1,51 1,15 0,9731 F05 hsa-miR-648 22,82 31,24 26,21 33,14 13,98 16,16 2,70 2,70 0,30 0,60 0,31 0,54 -3,08 -3,53 -0,91 -1,04 2,17 2,50 0,3218 G05 hsa-miR-604 29,04 37,88 33,08 44,32 15,29 16,11 5,08 4,16 0,53 0,76 0,51 0,79 -2,52 -3,19 -1,11 -1,46 1,40 1,73 0,5989 H05 hsa-miR-1262 26,99 36,22 30,06 38,54 14,28 16,46 3,89 4,17 0,29 0,61 0,29 0,59 -2,79 -3,12 -1,07 -1,23 1,72 1,89 0,3029 A06 hsa-miR-548p 33,30 42,61 38,02 48,72 26,81 29,64 6,93 6,63 0,79 1,03 0,89 1,28 -2,26 -2,68 -0,50 -0,72 1,76 1,97 0,3261 B06 hsa-miR-337-3p 32,51 42,06 36,65 46,39 17,81 25,41 5,72 5,86 0,59 1,14 0,56 1,01 -2,51 -2,84 -1,04 -0,87 1,47 1,98 0,5815 C06 hsa-miR-379* 27,80 38,04 32,88 43,09 23,53 30,71 5,53 6,40 0,52 0,93 0,69 1,05 -2,33 -2,57 -0,48 -0,49 1,85 2,08 0,3261 D06 hsa-miR-302d 25,31 34,05 28,17 39,60 6,92 7,63 2,97 2,72 0,46 1,00 0,60 1,04 -3,09 -3,65 -2,03 -2,38 1,07 1,27 0,5299 E06 hsa-miR-1280 27,47 37,76 32,18 44,49 19,05 22,60 4,49 4,49 0,38 0,76 0,44 0,85 -2,61 -3,07 -0,76 -0,98 1,86 2,10 0,3261 F06 hsa-miR-220a 30,64 40,38 32,79 48,05 17,24 18,47 5,94 6,43 0,58 1,09 0,60 1,22 -2,37 -2,65 -0,93 -1,38 1,44 1,27 0,9537 G06 hsa-miR-551a 31,78 41,02 38,26 50,79 24,52 24,97 5,74 5,88 0,59 1,06 0,76 1,21 -2,47 -2,80 -0,64 -1,02 1,83 1,78 0,0001 H06 hsa-miR-1976 36,24 41,68 36,01 50,44 22,05 28,61 4,40 4,27 0,49 0,97 0,46 0,94 -3,04 -3,29 -0,71 -0,82 2,33 2,47 0,0919 A07 hsa-miR-302a* 27,37 38,97 34,95 44,15 22,15 27,83 5,18 5,68 0,54 0,98 0,82 1,15 -2,40 -2,78 -0,66 -0,67 1,74 2,11 0,4224 B07 hsa-miR-1913 25,94 37,43 32,24 42,43 14,47 15,48 4,11 4,50 0,55 1,05 0,79 1,15 -2,66 -3,06 -1,16 -1,46 1,50 1,60 0,2757 C07 hsa-miR-376a 26,36 31,72 26,46 38,65 13,11 20,13 3,74 3,00 0,42 0,65 0,38 0,78 -2,82 -3,40 -1,01 -0,94 1,80 2,46 0,4823

113

114

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval D07 hsa-miR-30e* 28,46 37,32 28,64 41,41 15,41 20,26 5,23 5,66 0,61 1,05 0,55 1,15 -2,44 -2,72 -0,89 -1,03 1,55 1,69 0,3363 E07 hsa-miR-337-5p 26,01 35,38 30,86 45,29 23,07 25,76 5,76 6,70 0,51 0,97 0,62 1,18 -2,17 -2,40 -0,42 -0,81 1,76 1,59 0,3555 F07 hsa-miR-548a-3p 28,16 40,43 33,56 48,15 17,86 21,44 5,17 6,53 0,46 1,00 0,55 1,09 -2,45 -2,63 -0,91 -1,17 1,54 1,46 0,2262 G07 hsa-miR-563 26,05 28,03 31,91 39,49 13,42 11,60 4,33 2,87 0,45 0,62 0,56 0,93 -2,59 -3,29 -1,25 -1,77 1,34 1,52 0,6866 H07 hsa-miR-18a* 29,62 37,81 31,76 41,15 14,48 12,83 3,91 3,77 0,49 0,82 0,45 0,86 -2,92 -3,32 -1,13 -1,68 1,79 1,64 0,2982 A08 hsa-miR-1825 28,72 41,03 35,10 46,65 15,76 15,67 5,86 6,32 0,63 1,09 0,80 1,17 -2,29 -2,70 -1,16 -1,57 1,14 1,12 0,0000 B08 hsa-miR-194* 29,25 40,19 30,08 43,96 14,46 21,23 4,72 4,88 0,52 0,87 0,51 0,85 -2,63 -3,04 -1,06 -1,05 1,57 1,99 0,4986 C08 hsa-miR-518a-3p 24,68 40,27 29,08 42,67 12,52 17,25 3,58 5,06 0,40 1,02 0,50 0,98 -2,79 -2,99 -1,22 -1,31 1,57 1,69 0,2685 D08 hsa-miR-130b 27,86 44,25 31,64 45,30 13,54 17,23 4,85 6,69 0,52 1,35 0,61 1,21 -2,52 -2,73 -1,22 -1,39 1,30 1,33 0,5769 E08 hsa-miR-181c 27,05 40,57 30,13 43,76 19,25 31,45 3,90 4,77 0,44 0,95 0,46 0,91 -2,79 -3,09 -0,65 -0,48 2,15 2,61 0,3560 F08 hsa-miR-151-5p 27,96 38,47 31,12 46,87 14,31 23,18 4,40 5,18 0,52 1,08 0,58 1,19 -2,67 -2,89 -1,12 -1,02 1,55 1,88 0,4889 G08 hsa-miR-1915 27,75 37,57 33,91 45,36 19,80 20,59 3,87 4,12 0,52 0,96 0,70 1,12 -2,84 -3,19 -0,78 -1,14 2,07 2,05 0,0000 H08 hsa-miR-126* 29,38 36,81 33,62 44,90 16,92 19,21 4,89 5,31 0,74 0,98 0,61 1,07 -2,59 -2,79 -0,99 -1,22 1,60 1,57 0,0000 A09 hsa-miR-516-3p 28,06 37,18 30,61 40,08 13,21 16,81 4,67 4,32 0,52 0,84 0,55 0,89 -2,59 -3,11 -1,21 -1,25 1,38 1,85 0,6523 B09 hsa-miR-98 27,22 40,94 27,21 41,85 12,33 22,29 5,03 5,82 0,48 1,05 0,45 0,92 -2,44 -2,81 -1,14 -0,91 1,29 1,91 0,7108 C09 hsa-miR-138-1* 31,37 43,48 31,12 45,09 15,09 22,92 5,53 5,99 0,51 1,09 0,66 1,01 -2,50 -2,86 -1,04 -0,98 1,46 1,88 0,5648 D09 hsa-miR-554 28,19 42,25 32,41 47,47 19,39 28,15 4,21 4,85 0,43 0,98 0,54 1,02 -2,74 -3,12 -0,74 -0,75 2,00 2,37 0,3555 E09 hsa-let-7g* 22,58 28,26 24,54 35,29 9,22 14,30 2,82 2,56 0,36 0,64 0,36 0,72 -3,00 -3,47 -1,41 -1,30 1,59 2,16 0,5261 F09 hsa-miR-149* 24,04 33,14 27,10 36,40 12,13 14,06 3,14 3,19 0,45 1,00 0,55 0,97 -2,94 -3,38 -1,16 -1,37 1,78 2,01 0,3363 G09 hsa-miR-181d 27,67 39,44 32,37 44,92 23,12 25,59 4,16 4,81 0,40 0,93 0,46 0,93 -2,73 -3,04 -0,49 -0,81 2,25 2,22 0,0000 H09 hsa-miR-1290 31,73 42,27 38,65 48,34 22,28 22,36 4,26 3,94 0,47 0,87 0,55 0,85 -2,90 -3,42 -0,79 -1,11 2,10 2,31 0,2323

A10 hsa-miR-370 26,19 39,25 34,01 46,43 15,97 20,35 3,91 4,42 0,46 0,90 0,73 1,19 -2,74 -3,15 -1,09 -1,19 1,65 1,96 0,4311 plate 2 plate B10 hsa-miR-553 27,29 39,53 31,90 42,76 17,50 21,63 4,89 5,39 0,56 1,11 0,74 1,19 -2,48 -2,88 -0,87 -0,98 1,61 1,89 0,4327 C10 hsa-miR-662 30,08 37,89 31,26 44,99 14,30 15,10 5,42 4,37 0,62 1,10 0,68 1,24 -2,47 -3,12 -1,13 -1,57 1,34 1,54 0,6730 D10 hsa-miR-616* 29,08 40,87 30,37 44,22 18,09 26,39 5,45 6,45 0,62 1,13 0,64 1,29 -2,42 -2,66 -0,75 -0,74 1,67 1,92 0,3881 E10 hsa-miR-542-5p 29,33 43,72 31,09 45,68 14,80 17,55 3,99 4,06 0,53 0,97 0,56 1,08 -2,88 -3,43 -1,07 -1,38 1,81 2,05 0,3363 F10 hsa-miR-296-3p 29,76 41,27 32,33 45,84 12,77 17,97 5,07 4,91 0,53 1,14 0,69 1,18 -2,55 -3,07 -1,34 -1,35 1,21 1,72 0,8066 G10 hsa-miR-411 26,22 32,44 28,23 38,59 14,94 19,67 5,43 5,26 0,49 0,85 0,61 0,95 -2,27 -2,63 -0,92 -0,97 1,35 1,65 0,6621 H10 hsa-miR-30e 31,30 42,46 34,62 46,55 13,10 12,57 5,31 5,40 0,58 1,00 0,57 1,11 -2,56 -2,98 -1,40 -1,89 1,16 1,09 0,0877 A11 hsa-miR-124 30,20 42,46 32,86 41,79 9,69 11,33 4,92 4,25 0,37 0,71 0,46 0,66 -2,62 -3,32 -1,76 -1,88 0,86 1,44 0,7330 B11 hsa-miR-583 28,25 42,21 31,79 42,48 17,80 24,80 4,53 5,27 0,52 1,02 0,67 1,00 -2,64 -3,00 -0,84 -0,78 1,80 2,22 0,4224 C11 hsa-miR-18a 25,89 36,43 28,94 40,16 15,79 23,84 3,51 3,75 0,38 0,76 0,44 0,79 -2,88 -3,28 -0,87 -0,75 2,01 2,53 0,4034 D11 hsa-miR-132 32,55 41,43 32,61 40,72 13,42 11,37 5,89 3,95 0,50 0,98 0,74 1,19 -2,47 -3,39 -1,28 -1,84 1,19 1,55 0,9537 E11 hsa-miR-214* 27,42 34,75 28,18 37,47 9,29 9,45 3,72 3,30 0,33 0,59 0,36 0,63 -2,88 -3,40 -1,60 -1,99 1,28 1,41 0,9917 F11 hsa-miR-455-5p 26,45 37,53 30,50 38,71 13,26 13,41 4,17 4,15 0,47 0,96 0,66 1,23 -2,67 -3,18 -1,20 -1,53 1,46 1,65 0,4678 G11 hsa-miR-708* 27,09 40,46 32,72 43,80 17,40 18,04 3,43 4,16 0,37 1,10 0,54 0,93 -2,98 -3,28 -0,91 -1,28 2,07 2,00 0,0048 H11 hsa-miR-507 30,24 41,22 34,49 43,79 14,19 14,27 4,54 4,30 0,49 0,90 0,53 0,85 -2,74 -3,26 -1,28 -1,62 1,45 1,64 0,4823 C12 miR-Control 32,82 44,44 34,59 47,62 17,15 19,75 5,66 5,51 0,66 0,98 0,76 1,07 -2,54 -3,01 -1,01 -1,27 1,52 1,74 0,4469 D12 miR-149 30,26 38,32 34,53 38,95 19,23 14,63 5,61 6,29 0,78 0,88 0,80 0,85 -2,43 -2,61 -0,84 -1,41 1,59 1,19 0,9090 E12 siLacZ 27,26 44,91 31,56 46,31 17,33 22,37 3,99 6,94 0,47 1,19 0,63 1,13 -2,77 -2,69 -0,86 -1,05 1,91 1,64 0,4065 F12 siErbB2 27,85 37,13 28,22 37,64 4,72 7,19 3,16 3,23 0,47 0,81 0,55 0,78 -3,14 -3,52 -2,58 -2,39 0,56 1,13 0,5415 G12 siErbB3 29,72 39,41 30,66 45,34 7,60 11,90 3,70 3,50 0,43 0,71 0,44 0,81 -3,01 -3,49 -2,01 -1,93 0,99 1,56 0,9047 B01 miR-Control 49,15 37,25 47,09 35,62 31,50 21,19 11,94 11,12 0,63 1,44 0,35 1,20 -2,04 -1,74 -0,58 -0,75 1,46 0,99 0,7942 C01 miR-149 46,30 30,97 39,81 33,51 21,01 18,95 13,16 10,79 0,56 1,26 0,35 1,11 -1,81 -1,52 -0,92 -0,82 0,89 0,70 0,3051 D01 siLacZ 50,07 35,88 46,97 36,23 34,50 22,86 14,81 12,95 0,76 1,80 0,51 1,54 -1,76 -1,47 -0,45 -0,66 1,31 0,81 0,6503 E01 siErbB2 43,45 29,97 41,54 32,09 8,56 6,97 6,28 4,26 0,52 1,20 0,34 1,06 -2,79 -2,81 -2,28 -2,20 0,51 0,61 0,0469 F01 siErbB3 46,63 33,62 48,08 35,20 16,21 11,42 7,90 6,06 0,44 1,09 0,28 0,92 -2,56 -2,47 -1,57 -1,62 0,99 0,85 0,2592 A02 hsa-miR-218 52,86 36,79 56,26 40,37 36,08 28,30 15,66 12,10 0,76 1,41 0,64 1,53 -1,76 -1,60 -0,64 -0,51 1,11 1,09 0,0000 B02 hsa-miR-1231 40,16 29,32 45,51 29,92 29,84 16,84 6,43 5,03 0,40 0,89 0,43 0,86 -2,64 -2,54 -0,61 -0,83 2,03 1,71 0,4090 C02 hsa-miR-1286 44,98 30,18 41,67 31,73 33,97 25,53 12,69 9,93 0,45 1,07 0,39 1,04 -1,83 -1,60 -0,29 -0,31 1,53 1,29 0,7873 D02 hsa-miR-517a 41,34 29,23 42,03 30,97 25,18 18,40 8,10 6,27 0,60 1,36 0,53 1,19 -2,35 -2,22 -0,74 -0,75 1,61 1,47 0,4128 E02 hsa-miR-19b-2* 44,20 33,10 45,33 33,66 29,22 20,75 12,10 10,02 0,65 1,45 0,55 1,37 -1,87 -1,72 -0,63 -0,70 1,24 1,03 0,4908 F02 hsa-miR-216b 47,98 36,92 47,69 37,55 55,30 40,15 23,09 18,18 0,51 1,29 0,45 1,20 -1,06 -1,02 0,21 0,10 1,27 1,12 0,4875 G02 hsa-miR-708 40,00 30,67 46,15 30,62 25,45 14,61 5,43 4,42 0,30 0,77 0,37 0,73 -2,88 -2,79 -0,86 -1,07 2,02 1,73 0,3932 H02 hsa-miR-556-5p 46,15 34,25 42,37 35,35 37,61 27,83 11,12 9,31 0,45 1,17 0,23 1,10 -2,05 -1,88 -0,17 -0,35 1,88 1,53 0,4986 A03 hsa-miR-1978 49,77 37,98 55,44 37,82 30,54 18,94 9,00 7,60 0,54 1,35 0,70 1,17 -2,47 -2,32 -0,86 -1,00 1,61 1,32 0,7099 B03 hsa-miR-539 47,40 34,04 51,57 32,57 31,96 20,61 15,56 11,17 0,73 1,52 0,88 1,46 -1,61 -1,61 -0,69 -0,66 0,92 0,95 0,0000 C03 hsa-miR-222 50,89 36,51 51,55 36,48 32,77 17,94 10,24 7,25 0,66 1,28 0,60 1,21 -2,31 -2,33 -0,65 -1,02 1,66 1,31 0,7189 D03 hsa-miR-2054 45,39 33,99 41,02 34,71 26,32 21,99 11,10 7,91 0,54 1,22 0,39 1,10 -2,03 -2,10 -0,64 -0,66 1,39 1,44 0,3560 E03 hsa-miR-1254 44,94 34,33 43,58 33,54 27,99 19,67 10,60 8,45 0,48 1,17 0,35 0,99 -2,08 -2,02 -0,64 -0,77 1,44 1,25 0,9917 F03 hsa-miR-320a 51,67 39,57 51,91 39,82 45,71 31,75 15,71 12,41 0,58 1,47 0,57 1,26 -1,72 -1,67 -0,18 -0,33 1,53 1,35 0,6671 G03 hsa-miR-412 52,08 38,01 50,45 39,89 41,35 27,43 15,05 12,30 0,69 1,49 0,52 1,41 -1,79 -1,63 -0,29 -0,54 1,50 1,09 0,9033

H03 hsa-miR-433 43,82 36,45 38,75 35,89 20,20 17,20 7,72 7,31 0,57 1,69 0,29 1,14 -2,50 -2,32 -0,94 -1,06 1,56 1,26 0,8291 plate 3 plate A04 hsa-miR-99b* 52,27 35,69 50,27 37,85 39,21 26,28 17,21 14,77 0,66 1,37 0,67 1,46 -1,60 -1,27 -0,36 -0,53 1,24 0,75 0,5896 B04 hsa-miR-525-3p 52,97 37,31 47,53 42,00 33,87 21,75 13,75 11,52 0,62 1,30 0,48 1,45 -1,95 -1,70 -0,49 -0,95 1,46 0,75 0,7330 C04 hsa-miR-548f 50,46 36,43 49,00 40,45 37,12 26,26 14,85 12,31 0,63 1,55 0,59 1,46 -1,76 -1,56 -0,40 -0,62 1,36 0,94 0,6931 D04 hsa-miR-26b 43,68 32,53 41,93 32,95 31,41 21,54 12,98 12,37 0,63 1,46 0,54 1,24 -1,75 -1,39 -0,42 -0,61 1,33 0,78 0,6646 E04 hsa-miR-1539 42,48 32,95 43,36 33,44 27,78 19,08 10,41 10,02 0,63 1,40 0,54 1,30 -2,03 -1,72 -0,64 -0,81 1,39 0,91 0,7105 F04 hsa-miR-374b 40,63 30,85 36,87 30,87 28,07 20,20 14,39 10,85 0,53 1,21 0,46 1,21 -1,50 -1,51 -0,39 -0,61 1,10 0,90 0,3942 G04 hsa-miR-450b-3p 42,15 31,84 38,04 31,17 22,72 15,40 9,94 8,35 0,40 0,95 0,26 0,82 -2,08 -1,93 -0,74 -1,02 1,34 0,91 0,6660 H04 hsa-miR-519c-3p 45,58 30,08 42,25 32,58 13,83 8,95 9,29 4,86 0,69 1,21 0,54 1,21 -2,29 -2,63 -1,61 -1,86 0,68 0,76 0,0238 A05 hsa-miR-1 48,59 35,24 45,58 40,11 31,47 22,89 8,69 6,75 0,44 1,10 0,41 1,14 -2,48 -2,38 -0,53 -0,81 1,95 1,57 0,4889 B05 hsa-miR-210 38,21 27,56 36,19 31,13 16,52 14,81 10,57 8,29 0,66 1,29 0,67 1,43 -1,85 -1,73 -1,13 -1,07 0,72 0,66 0,0012 C05 hsa-miR-633 41,40 31,53 38,17 30,06 33,63 23,54 9,06 7,79 0,58 1,25 0,52 1,07 -2,19 -2,02 -0,18 -0,35 2,01 1,66 0,4401 D05 hsa-miR-381 51,18 38,54 47,52 38,62 33,82 23,68 16,05 12,43 0,73 1,51 0,61 1,36 -1,67 -1,63 -0,49 -0,71 1,18 0,93 0,4823 E05 hsa-miR-17 48,48 33,68 44,54 33,45 21,73 12,38 9,29 5,79 0,62 1,18 0,46 1,03 -2,38 -2,54 -1,04 -1,43 1,35 1,11 0,6726 F05 hsa-let-7d 46,87 33,10 44,87 36,16 34,57 23,44 15,39 11,28 0,58 1,25 0,49 1,10 -1,61 -1,55 -0,38 -0,63 1,23 0,93 0,5297 G05 hsa-miR-1228 53,08 37,51 48,95 41,34 32,53 21,33 14,56 10,86 0,67 1,23 0,52 1,24 -1,87 -1,79 -0,59 -0,95 1,28 0,83 0,6053 H05 hsa-miR-1972 51,04 36,82 46,04 36,35 35,79 20,41 10,94 8,52 0,63 1,33 0,46 1,10 -2,22 -2,11 -0,36 -0,83 1,86 1,28 0,7189 A06 hsa-miR-384 48,45 37,34 46,81 40,52 35,00 23,05 13,15 11,40 0,73 1,56 0,78 1,62 -1,88 -1,71 -0,42 -0,81 1,46 0,90 0,7728 B06 hsa-miR-517c 41,37 30,65 38,79 30,54 22,75 16,74 8,34 6,36 0,60 1,23 0,62 1,13 -2,31 -2,27 -0,77 -0,87 1,54 1,40 0,5118 C06 hsa-miR-1298 45,19 34,37 44,05 33,21 19,86 14,51 6,96 5,67 0,50 1,13 0,48 0,98 -2,70 -2,60 -1,15 -1,19 1,55 1,40 0,5099 114

115

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval D06 hsa-miR-532-5p 44,95 33,65 40,04 32,37 28,25 19,90 13,50 9,78 0,46 0,89 0,39 0,83 -1,73 -1,78 -0,50 -0,70 1,23 1,08 0,4365 E06 hsa-miR-625* 52,36 38,61 48,27 40,55 45,17 35,94 22,59 16,80 0,71 1,37 0,61 1,27 -1,21 -1,20 -0,10 -0,17 1,12 1,03 0,1609 F06 hsa-miR-1204 39,64 31,10 35,04 30,75 21,37 16,78 11,22 8,80 0,52 1,11 0,46 0,92 -1,82 -1,82 -0,71 -0,87 1,11 0,95 0,3390 G06 hsa-miR-302b 43,99 30,52 39,85 31,74 14,13 8,86 7,01 4,23 0,63 1,12 0,54 1,06 -2,65 -2,85 -1,50 -1,84 1,15 1,01 0,3487 H06 hsa-miR-154* 50,40 38,57 46,26 38,22 38,88 22,66 12,97 10,57 0,69 1,42 0,51 1,19 -1,96 -1,87 -0,25 -0,75 1,71 1,11 0,9138 A07 hsa-miR-20b* 45,34 31,25 40,95 32,94 25,47 16,77 8,89 6,69 0,61 1,11 0,57 1,23 -2,35 -2,22 -0,68 -0,97 1,67 1,25 0,7860 B07 hsa-miR-135b 45,33 31,38 42,84 34,73 25,26 16,24 10,66 7,80 0,43 0,87 0,48 0,96 -2,09 -2,01 -0,76 -1,10 1,33 0,91 0,6581 C07 hsa-miR-575 51,98 36,42 50,41 38,07 46,49 28,12 11,70 9,49 0,76 1,37 0,75 1,45 -2,15 -1,94 -0,12 -0,44 2,04 1,50 0,5576 D07 hsa-miR-34b 53,64 37,54 51,05 39,14 46,38 27,34 12,58 9,70 0,62 1,20 0,68 1,23 -2,09 -1,95 -0,14 -0,52 1,95 1,44 0,6014 E07 hsa-miR-342-5p 47,21 30,86 42,65 34,54 23,55 16,39 7,43 5,04 0,45 0,78 0,35 0,81 -2,67 -2,62 -0,86 -1,08 1,81 1,54 0,4683 F07 hsa-miR-661 44,65 31,69 40,09 33,25 24,13 19,41 10,12 8,28 0,55 1,07 0,48 1,00 -2,14 -1,94 -0,73 -0,78 1,41 1,16 0,8026 G07 hsa-miR-568 51,82 41,34 50,33 41,66 45,90 27,25 13,83 12,90 0,87 1,63 0,86 1,46 -1,91 -1,68 -0,13 -0,61 1,77 1,07 0,9138 H07 hsa-miR-593 50,08 37,08 51,26 37,86 50,51 23,15 10,03 8,14 0,45 0,92 0,47 0,97 -2,32 -2,19 -0,02 -0,71 2,30 1,48 0,6053 A08 hsa-miR-380* 37,10 28,06 36,54 29,16 18,16 15,55 7,68 6,82 0,42 0,96 0,44 0,98 -2,27 -2,04 -1,01 -0,91 1,26 1,13 0,4534 B08 hsa-miR-549 45,00 32,34 43,75 34,44 33,96 24,01 10,49 9,00 0,64 1,28 0,65 1,28 -2,10 -1,85 -0,37 -0,52 1,74 1,33 0,6985 C08 hsa-miR-1538 50,46 34,13 48,16 38,87 33,61 22,20 13,56 11,15 0,76 1,56 0,83 1,59 -1,90 -1,61 -0,52 -0,81 1,38 0,81 0,6990 D08 hsa-miR-148a* 49,55 36,57 46,10 36,61 33,72 26,25 13,68 10,73 0,69 1,23 0,66 1,19 -1,86 -1,77 -0,45 -0,48 1,41 1,29 0,9917 E08 hsa-miR-99a 46,59 31,76 42,17 34,78 32,89 22,49 15,36 12,40 0,75 1,33 0,72 1,30 -1,60 -1,36 -0,36 -0,63 1,24 0,73 0,5908 F08 hsa-miR-1228* 51,32 37,91 46,44 37,41 31,31 20,77 12,77 11,95 0,74 1,45 0,70 1,34 -2,01 -1,67 -0,57 -0,85 1,44 0,82 0,7324 G08 hsa-miR-941 48,98 33,31 44,47 38,29 36,91 23,28 11,10 8,86 0,75 1,33 0,72 1,41 -2,14 -1,91 -0,27 -0,72 1,87 1,19 0,7854 H08 hsa-miR-624 47,45 35,58 49,47 38,02 41,51 25,26 10,16 7,71 0,44 0,86 0,82 0,93 -2,22 -2,21 -0,25 -0,59 1,97 1,62 0,4677 A09 hsa-miR-658 44,66 33,31 44,60 31,22 33,04 23,77 11,20 9,09 0,69 1,41 0,72 1,19 -2,00 -1,87 -0,43 -0,39 1,56 1,48 0,2323 B09 hsa-miR-638 46,99 35,15 48,30 34,72 31,19 22,73 13,99 12,01 0,63 1,44 0,77 1,13 -1,75 -1,55 -0,63 -0,61 1,12 0,94 0,3676 C09 hsa-miR-496 50,19 35,95 49,26 36,85 38,86 23,77 10,42 7,95 0,52 1,08 0,55 1,00 -2,27 -2,18 -0,34 -0,63 1,93 1,54 0,5054 D09 hsa-miR-664 49,96 37,27 48,73 38,27 40,93 26,89 12,57 9,70 0,72 1,36 0,71 1,20 -1,99 -1,94 -0,25 -0,51 1,74 1,43 0,5575

E09 hsa-miR-15b* 44,27 32,60 40,85 34,86 40,40 28,75 14,28 11,17 0,65 1,27 0,59 1,22 -1,63 -1,55 -0,02 -0,28 1,62 1,27 0,7854 plate 3 plate F09 hsa-miR-363 46,35 36,03 41,85 35,66 38,97 30,65 18,08 15,00 0,73 1,38 0,61 1,16 -1,36 -1,26 -0,10 -0,22 1,26 1,05 0,5138 G09 hsa-miR-541* 47,52 35,41 45,21 37,48 43,79 31,74 13,53 10,68 0,69 1,30 0,63 1,24 -1,81 -1,73 -0,05 -0,24 1,77 1,49 0,4986 H09 hsa-miR-525-5p 43,86 32,42 43,10 32,66 29,38 17,57 7,24 5,68 0,43 0,82 0,47 0,77 -2,60 -2,51 -0,55 -0,89 2,05 1,62 0,4889 A10 hsa-miR-136 49,49 37,48 45,90 37,62 29,64 19,86 12,17 10,05 0,78 1,43 0,68 1,84 -2,02 -1,90 -0,63 -0,92 1,39 0,98 0,7189 B10 hsa-miR-383 49,57 36,32 47,49 38,57 31,94 19,14 9,76 7,07 0,41 0,85 0,37 0,90 -2,34 -2,36 -0,57 -1,01 1,77 1,35 0,6666 C10 hsa-miR-518a-5p 52,86 36,16 47,74 40,63 35,61 23,62 14,51 10,73 0,54 1,06 0,50 1,13 -1,87 -1,75 -0,42 -0,78 1,44 0,97 0,7728 D10 hsa-miR-518c* 55,43 41,89 50,05 41,32 37,56 27,14 15,13 11,92 0,67 1,32 0,56 1,25 -1,87 -1,81 -0,41 -0,61 1,46 1,21 0,9567 E10 hsa-miR-19a 46,84 36,21 44,86 35,31 21,40 16,95 12,57 9,83 0,84 1,57 0,77 1,45 -1,90 -1,88 -1,07 -1,06 0,83 0,82 0,0000 F10 hsa-miR-331-5p 46,58 34,85 42,45 35,98 32,54 22,89 13,27 10,44 0,74 1,41 0,69 1,39 -1,81 -1,74 -0,38 -0,65 1,43 1,09 0,7909 G10 hsa-miR-376a* 49,12 38,77 47,05 37,99 45,24 31,75 17,05 13,88 0,58 1,08 0,48 1,00 -1,53 -1,48 -0,06 -0,26 1,47 1,22 0,9995 H10 hsa-miR-429 44,20 32,25 39,78 32,94 19,90 14,19 9,14 6,79 0,74 1,26 0,70 1,17 -2,27 -2,25 -1,00 -1,21 1,27 1,03 0,5533 A11 hsa-miR-1224-3p 44,18 35,12 45,66 36,05 36,78 23,36 12,11 11,28 0,64 1,36 0,63 1,34 -1,87 -1,64 -0,31 -0,63 1,56 1,01 0,9077 B11 hsa-miR-155* 48,37 35,59 45,80 38,66 37,77 26,79 15,82 13,21 0,70 1,41 0,64 1,31 -1,61 -1,43 -0,28 -0,53 1,33 0,90 0,6621 C11 hsa-miR-509-5p 45,69 33,45 41,74 38,16 31,19 20,73 11,86 9,78 0,66 1,36 0,53 1,27 -1,95 -1,77 -0,42 -0,88 1,53 0,89 0,8253 D11 hsa-miR-522 43,47 34,48 43,67 37,24 27,45 17,70 10,16 8,25 0,55 1,10 0,53 1,16 -2,10 -2,06 -0,67 -1,07 1,43 0,99 0,7583 E11 hsa-miR-362-3p 45,89 35,72 43,85 37,84 27,86 19,10 11,24 10,01 0,59 1,17 0,52 1,14 -2,03 -1,84 -0,65 -0,99 1,38 0,85 0,6990 F11 hsa-miR-548b-3p 48,32 37,73 46,56 39,92 33,83 23,24 13,38 11,71 0,86 1,61 0,78 1,56 -1,85 -1,69 -0,46 -0,78 1,39 0,91 0,7143 G11 hsa-miR-409-5p 47,98 38,23 45,71 40,82 24,69 22,31 14,42 13,61 0,74 1,35 0,63 1,31 -1,73 -1,49 -0,89 -0,87 0,85 0,62 0,3243 H11 hsa-miR-548d-3p 39,26 31,07 34,64 30,85 25,32 20,07 12,88 11,31 0,81 1,57 0,69 1,47 -1,61 -1,46 -0,45 -0,62 1,16 0,84 0,4889 C12 miR-Control 49,04 35,87 43,24 38,02 28,71 20,71 11,94 10,08 0,64 1,32 0,47 1,25 -2,04 -1,83 -0,59 -0,88 1,45 0,95 0,7728 D12 miR-149 41,88 31,51 38,12 32,74 21,01 18,95 11,61 10,79 0,50 1,16 0,43 1,03 -1,85 -1,55 -0,86 -0,79 0,99 0,76 0,3560 E12 siLacZ 46,69 37,27 46,75 36,19 32,44 22,09 13,43 12,85 0,74 1,50 0,64 1,37 -1,80 -1,54 -0,53 -0,71 1,27 0,82 0,6014 F12 siErbB2 41,60 31,79 42,37 32,99 15,63 13,26 8,72 6,84 0,58 1,03 0,49 0,97 -2,25 -2,22 -1,44 -1,31 0,82 0,90 0,0510 G12 siErbB3 46,58 35,28 42,11 36,92 18,40 15,31 9,87 8,24 0,50 1,13 0,39 0,99 -2,24 -2,10 -1,19 -1,27 1,04 0,83 0,3652 B01 miR-Control 30,07 38,76 32,64 35,37 18,39 19,47 5,88 9,92 0,96 0,98 1,03 0,89 -2,35 -1,97 -0,83 -0,86 1,53 1,10 0,9455 C01 miR-149 26,48 32,06 29,79 28,82 13,82 10,81 6,65 7,99 0,79 0,78 0,96 0,66 -1,99 -2,00 -1,11 -1,41 0,89 0,59 0,3618 D01 siLacZ 29,23 38,23 32,61 34,53 19,78 21,13 6,65 11,18 0,93 1,19 1,00 1,00 -2,14 -1,77 -0,72 -0,71 1,41 1,07 0,7674 E01 siErbB2 24,76 31,57 29,00 28,56 5,64 5,67 4,13 4,90 0,74 0,81 0,78 0,72 -2,58 -2,69 -2,36 -2,33 0,22 0,36 0,0877 F01 siErbB3 28,64 35,96 32,33 34,17 10,49 11,30 4,96 6,37 0,72 0,77 0,81 0,75 -2,53 -2,50 -1,62 -1,60 0,91 0,90 0,0000 A02 hsa-miR-21 29,91 41,42 33,90 38,02 25,94 31,23 6,52 10,84 0,90 1,05 1,03 1,17 -2,20 -1,93 -0,39 -0,28 1,81 1,65 0,3218 B02 hsa-miR-1237 30,09 39,29 33,16 36,02 20,81 22,61 6,69 9,11 0,92 0,85 0,98 0,81 -2,17 -2,11 -0,67 -0,67 1,50 1,44 0,2036 C02 hsa-miR-375 27,63 36,37 27,20 31,64 10,70 13,78 5,28 5,94 0,78 0,73 0,68 0,83 -2,39 -2,62 -1,35 -1,20 1,04 1,42 0,7583 D02 hsa-miR-15b 25,10 31,90 28,16 28,18 20,28 19,30 5,94 7,36 0,57 0,53 0,61 0,46 -2,08 -2,12 -0,47 -0,55 1,61 1,57 0,0001 E02 hsa-miR-548g 32,05 40,30 33,21 37,83 25,27 27,66 8,73 14,29 1,00 1,24 1,08 1,18 -1,88 -1,50 -0,39 -0,45 1,48 1,04 0,8426 F02 hsa-miR-490-3p 32,38 41,37 34,27 37,47 19,75 22,83 8,79 14,35 0,89 0,94 0,98 0,93 -1,88 -1,53 -0,80 -0,72 1,09 0,81 0,4332 G02 hsa-miR-24-1* 28,13 34,90 30,82 29,98 18,75 17,63 5,49 6,78 0,65 0,66 0,73 0,55 -2,36 -2,36 -0,72 -0,77 1,64 1,60 0,0003 H02 hsa-miR-876-3p 29,21 30,53 29,84 28,78 10,84 9,45 4,59 3,89 0,55 0,39 0,57 0,35 -2,67 -2,97 -1,46 -1,61 1,21 1,37 0,7237 A03 hsa-miR-501-5p 29,23 35,76 32,89 33,33 23,33 23,49 5,86 7,81 0,83 1,19 0,95 0,84 -2,32 -2,19 -0,50 -0,50 1,82 1,69 0,2323 B03 hsa-miR-1253 34,05 42,15 35,05 37,38 22,48 17,10 8,08 11,65 0,96 0,88 0,97 0,96 -2,08 -1,86 -0,64 -1,13 1,44 0,73 0,7231 C03 hsa-miR-620 31,39 40,69 34,27 36,64 18,54 18,57 5,66 7,62 0,67 0,71 0,80 0,70 -2,47 -2,42 -0,89 -0,98 1,59 1,44 0,4678 plate 4 plate D03 hsa-miR-96* 29,40 38,50 33,58 34,31 22,37 21,65 6,39 9,18 0,83 0,90 0,98 0,85 -2,20 -2,07 -0,59 -0,66 1,62 1,40 0,5572 E03 hsa-miR-493 25,48 26,33 26,50 25,25 8,43 7,83 3,86 3,69 0,78 0,62 0,87 0,70 -2,72 -2,83 -1,65 -1,69 1,07 1,15 0,1031 F03 hsa-miR-100 28,94 34,34 29,97 30,41 18,73 19,64 7,88 11,00 0,85 0,93 0,96 0,87 -1,88 -1,64 -0,68 -0,63 1,20 1,01 0,4442 G03 hsa-miR-505* 34,69 41,26 36,02 36,74 19,16 20,55 5,06 6,77 0,74 0,70 0,83 0,65 -2,78 -2,61 -0,91 -0,84 1,87 1,77 0,0927 H03 hsa-miR-626 28,60 33,71 29,69 29,69 13,61 11,54 5,35 7,18 0,81 0,99 0,95 0,81 -2,42 -2,23 -1,12 -1,36 1,29 0,87 0,6248 A04 hsa-miR-140-3p 28,55 37,05 29,63 38,52 15,59 20,45 5,38 7,57 0,88 0,93 0,88 1,22 -2,41 -2,29 -0,93 -0,91 1,48 1,38 0,5229 B04 hsa-miR-326 28,73 35,76 31,18 34,73 11,44 13,02 5,91 7,43 0,75 0,70 0,76 0,86 -2,28 -2,27 -1,45 -1,42 0,84 0,85 0,0000 C04 hsa-miR-1276 32,07 40,98 32,07 37,87 18,04 20,60 5,79 7,76 1,03 1,04 0,92 0,85 -2,47 -2,40 -0,83 -0,88 1,64 1,52 0,3218 D04 hsa-miR-629* 33,36 46,44 34,58 41,72 17,45 20,43 5,07 7,96 0,86 1,15 0,92 0,91 -2,72 -2,55 -0,99 -1,03 1,73 1,52 0,4524 E04 hsa-miR-1274a 34,23 44,13 34,99 38,50 25,49 26,99 7,00 10,09 0,84 0,99 0,88 0,78 -2,29 -2,13 -0,46 -0,51 1,83 1,62 0,3847 F04 hsa-miR-1248 30,81 38,35 32,34 37,10 20,00 21,23 6,12 8,04 0,93 0,95 0,95 0,93 -2,33 -2,25 -0,69 -0,81 1,64 1,45 0,4889 G04 hsa-miR-187 32,41 37,68 32,99 34,95 22,79 22,53 9,51 11,76 1,09 1,10 1,04 1,02 -1,77 -1,68 -0,53 -0,63 1,24 1,05 0,4823 H04 hsa-miR-367 32,39 39,24 33,26 32,49 24,19 24,14 10,51 13,52 0,88 1,01 0,94 0,81 -1,62 -1,54 -0,46 -0,43 1,16 1,11 0,0319 A05 hsa-miR-548o 29,41 44,19 32,05 40,02 21,40 28,21 7,02 12,61 0,86 1,29 0,95 1,23 -2,07 -1,81 -0,58 -0,50 1,48 1,30 0,7873 B05 hsa-miR-635 31,13 38,23 30,69 36,96 19,41 23,04 6,87 8,51 0,89 0,79 0,84 0,92 -2,18 -2,17 -0,66 -0,68 1,52 1,49 0,0046

115

116

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval C05 hsa-miR-1238 25,75 30,96 26,27 29,20 14,43 17,79 7,19 9,08 0,75 0,73 0,80 0,69 -1,84 -1,77 -0,86 -0,72 0,98 1,05 0,0657 D05 hsa-miR-335* 33,97 42,80 32,69 37,83 24,89 27,25 7,82 10,72 0,92 0,96 0,95 0,94 -2,12 -2,00 -0,39 -0,47 1,73 1,52 0,4334 E05 hsa-miR-637 27,71 33,34 27,79 32,85 11,38 14,59 3,95 4,61 0,66 0,67 0,73 0,65 -2,81 -2,85 -1,29 -1,17 1,52 1,68 0,3824 F05 hsa-let-7c 32,08 38,96 30,96 39,25 17,82 22,93 8,53 11,25 0,88 0,96 0,93 1,00 -1,91 -1,79 -0,80 -0,78 1,11 1,02 0,1961 G05 hsa-miR-365 24,42 32,10 25,93 26,47 15,13 18,13 8,09 10,64 0,71 0,74 0,74 0,59 -1,59 -1,59 -0,78 -0,55 0,82 1,05 0,3813 H05 hsa-miR-1977 31,77 37,60 28,86 33,74 17,84 28,87 7,05 8,81 0,62 0,75 0,74 0,69 -2,17 -2,09 -0,69 -0,23 1,48 1,87 0,5472 A06 hsa-miR-675 28,25 38,97 31,68 34,36 15,72 15,55 6,71 9,43 0,79 0,95 0,85 0,88 -2,07 -2,05 -1,01 -1,14 1,06 0,90 0,3261 B06 hsa-miR-1297 27,73 37,99 29,05 36,33 17,09 20,37 6,50 9,84 0,78 0,96 0,92 1,03 -2,09 -1,95 -0,77 -0,83 1,33 1,11 0,6344 C06 hsa-miR-506 31,94 41,24 29,64 38,14 12,29 18,70 4,89 6,74 0,51 0,53 0,52 0,47 -2,71 -2,61 -1,27 -1,03 1,44 1,59 0,4641 D06 hsa-miR-636 33,91 43,95 34,47 42,57 22,30 27,54 6,12 8,16 0,94 1,01 0,98 1,06 -2,47 -2,43 -0,63 -0,63 1,84 1,80 0,0000 E06 hsa-miR-555 34,75 41,94 37,14 37,18 21,41 23,12 7,63 8,44 0,61 0,65 0,70 0,55 -2,19 -2,31 -0,79 -0,69 1,39 1,63 0,5882 F06 hsa-miR-340* 32,02 39,23 31,53 37,52 21,03 29,74 7,54 9,23 0,88 1,02 0,97 1,00 -2,09 -2,09 -0,58 -0,34 1,50 1,75 0,4823 G06 hsa-miR-615-3p 37,31 44,11 34,33 39,94 17,12 19,30 6,45 9,26 0,88 1,13 0,96 1,02 -2,53 -2,25 -1,00 -1,05 1,53 1,20 0,9525 H06 hsa-miR-453 24,66 29,85 25,16 24,08 7,75 6,56 3,42 4,39 0,63 0,68 0,65 0,48 -2,85 -2,77 -1,70 -1,88 1,15 0,89 0,4653 A07 hsa-miR-1260 27,32 39,10 32,38 35,87 21,60 24,51 7,72 11,99 0,71 0,83 0,89 0,81 -1,82 -1,71 -0,58 -0,55 1,24 1,16 0,3001 B07 hsa-miR-592 27,26 35,27 29,08 32,58 15,27 18,23 4,20 5,79 0,74 0,70 0,82 0,72 -2,70 -2,61 -0,93 -0,84 1,77 1,77 0,0000 C07 hsa-miR-877 31,27 41,83 32,67 37,71 22,07 23,75 7,55 11,71 0,96 0,98 1,01 1,05 -2,05 -1,84 -0,57 -0,67 1,48 1,17 0,9522 D07 hsa-miR-24 30,10 36,94 31,54 35,21 11,72 11,06 6,69 8,31 0,86 0,96 0,93 0,93 -2,17 -2,15 -1,43 -1,67 0,74 0,48 0,3237 E07 hsa-miR-503 26,02 33,16 30,34 28,86 17,69 18,14 5,23 6,49 0,55 0,53 0,64 0,47 -2,31 -2,35 -0,78 -0,67 1,54 1,68 0,3555 F07 hsa-miR-10a 28,72 34,84 30,84 34,61 11,05 16,74 4,20 5,36 0,73 0,65 0,75 0,68 -2,77 -2,70 -1,48 -1,05 1,29 1,65 0,7324 G07 hsa-miR-495 33,96 42,95 34,90 37,29 20,33 21,48 6,83 9,24 0,79 0,82 0,84 0,75 -2,31 -2,22 -0,78 -0,80 1,53 1,42 0,4365 H07 hsa-miR-24-2* 33,13 39,54 31,31 32,60 15,75 18,00 5,71 7,43 0,68 0,70 0,73 0,52 -2,54 -2,41 -0,99 -0,86 1,54 1,55 0,0000 A08 hsa-miR-145 29,75 38,21 32,32 36,91 17,81 23,27 5,57 6,73 0,80 0,70 0,83 0,81 -2,42 -2,51 -0,86 -0,67 1,56 1,84 0,4677 B08 hsa-miR-625 27,29 34,27 27,50 32,80 10,39 11,56 4,33 5,44 0,67 0,60 0,70 0,63 -2,65 -2,66 -1,40 -1,50 1,25 1,15 0,3560 C08 hsa-miR-200c 27,52 34,06 26,26 31,47 9,12 9,06 3,81 5,49 0,85 0,90 0,85 0,88 -2,85 -2,63 -1,53 -1,80 1,33 0,84 0,6610 D08 hsa-miR-425 27,73 37,76 30,93 33,73 18,05 16,01 4,88 7,60 0,76 0,89 0,88 0,82 -2,51 -2,31 -0,78 -1,07 1,73 1,24 0,7829 E08 hsa-miR-125b-1* 36,45 43,95 35,29 39,63 20,60 24,78 8,34 10,33 0,87 0,95 0,96 0,91 -2,13 -2,09 -0,78 -0,68 1,35 1,41 0,6555 F08 hsa-miR-1201 33,32 36,41 31,02 31,93 16,11 17,40 7,00 8,94 1,03 0,98 0,95 0,83 -2,25 -2,03 -0,95 -0,88 1,31 1,15 0,5529 G08 hsa-miR-485-5p 31,44 40,12 32,02 32,75 21,22 24,11 7,58 10,50 0,84 0,97 0,87 0,78 -2,05 -1,93 -0,59 -0,44 1,46 1,49 0,0182 H08 hsa-let-7a* 33,20 38,16 32,71 32,23 12,35 13,24 5,97 7,11 0,69 0,73 0,74 0,57 -2,47 -2,42 -1,41 -1,28 1,07 1,14 0,0879 plate 4 plate A09 hsa-miR-1256 28,56 35,07 28,91 35,22 12,05 11,67 3,21 4,30 0,50 0,33 0,48 0,42 -3,15 -3,03 -1,26 -1,59 1,89 1,43 0,5928 B09 hsa-miR-518e* 30,34 38,46 30,58 42,51 25,27 31,82 8,18 10,89 0,91 0,91 0,92 0,87 -1,89 -1,82 -0,28 -0,42 1,62 1,40 0,5580 C09 hsa-miR-377* 24,31 27,61 22,28 28,12 16,37 19,24 5,34 6,83 0,88 0,81 0,83 0,89 -2,19 -2,01 -0,44 -0,55 1,74 1,47 0,5146 D09 hsa-miR-1207-5p 24,95 29,75 25,69 28,22 14,91 15,56 4,35 5,70 0,65 0,61 0,70 0,58 -2,52 -2,38 -0,79 -0,86 1,73 1,52 0,4365 E09 hsa-miR-548n 32,48 37,43 32,84 35,12 23,86 27,48 8,64 10,06 0,93 0,87 0,88 0,87 -1,91 -1,90 -0,46 -0,35 1,45 1,54 0,3363 F09 hsa-miR-939 32,80 41,26 33,05 35,94 15,81 21,82 5,33 6,62 0,86 0,85 0,90 0,79 -2,62 -2,64 -1,06 -0,72 1,56 1,92 0,4912 G09 hsa-miR-32 33,76 41,94 31,48 34,49 18,29 25,11 9,72 14,03 0,94 1,08 0,89 0,94 -1,80 -1,58 -0,78 -0,46 1,01 1,12 0,2398 H09 hsa-miR-148b 34,38 42,38 33,30 38,31 11,91 13,60 8,33 10,65 0,90 1,06 0,94 1,03 -2,04 -1,99 -1,48 -1,49 0,56 0,50 0,0008 A10 hsa-miR-502-5p 26,23 38,67 27,40 32,74 16,35 19,93 3,79 6,63 0,65 0,92 0,70 0,77 -2,79 -2,54 -0,75 -0,72 2,04 1,83 0,3218 B10 hsa-miR-371-5p 32,61 44,04 31,88 40,55 18,11 21,78 9,53 12,93 0,96 1,16 0,92 1,14 -1,77 -1,77 -0,82 -0,90 0,96 0,87 0,0688 C10 hsa-miR-520g 29,54 37,94 28,54 34,80 12,59 9,47 3,78 5,02 0,88 0,94 0,85 0,92 -2,97 -2,92 -1,18 -1,88 1,78 1,04 0,9284 D10 hsa-miR-192 30,81 36,91 28,13 33,47 13,64 15,81 6,14 8,30 0,67 0,72 0,61 0,59 -2,33 -2,15 -1,04 -1,08 1,28 1,07 0,5487 E10 hsa-miR-196a 26,90 33,56 27,24 28,59 18,55 20,54 4,80 6,97 0,58 0,69 0,63 0,43 -2,49 -2,27 -0,55 -0,48 1,93 1,79 0,2142 F10 hsa-miR-520a-3p 27,81 27,68 26,64 30,54 9,77 8,44 5,69 4,48 0,84 0,50 0,85 0,80 -2,29 -2,63 -1,45 -1,86 0,84 0,77 0,0088 G10 hsa-miR-7-1* 29,28 42,38 30,15 30,57 17,51 16,86 6,49 11,61 0,82 1,28 0,93 0,73 -2,17 -1,87 -0,78 -0,86 1,39 1,01 0,7189 H10 hsa-miR-665 31,18 34,64 35,66 31,20 18,11 15,75 4,70 5,75 0,69 0,70 0,88 0,62 -2,73 -2,59 -0,98 -0,99 1,75 1,60 0,3227 A11 hsa-miR-1308 31,69 40,68 30,23 35,77 18,32 19,86 6,35 8,35 0,75 0,78 0,72 0,70 -2,32 -2,28 -0,72 -0,85 1,60 1,44 0,4823 B11 hsa-miR-20b 30,73 41,24 30,47 37,92 13,38 13,19 4,39 6,86 0,80 0,93 0,82 0,91 -2,81 -2,59 -1,19 -1,52 1,62 1,06 0,9958 C11 hsa-miR-653 26,84 31,26 24,36 28,80 12,46 13,02 4,21 5,51 0,76 0,78 0,65 0,65 -2,67 -2,50 -0,97 -1,14 1,71 1,36 0,6615 D11 hsa-miR-410 34,73 42,88 28,86 34,93 20,35 20,92 8,42 11,26 1,02 1,18 0,90 0,89 -2,04 -1,93 -0,50 -0,74 1,54 1,19 0,9565 E11 hsa-miR-923 35,33 42,99 33,13 36,24 19,85 24,67 7,76 10,34 0,94 1,15 0,94 0,88 -2,19 -2,06 -0,74 -0,55 1,45 1,50 0,1219 F11 hsa-miR-23a 35,49 41,46 32,54 38,48 12,35 18,99 6,98 8,35 1,02 0,97 1,00 1,00 -2,35 -2,31 -1,40 -1,02 0,95 1,29 0,6053 G11 hsa-miR-1470 36,64 47,48 33,28 40,36 14,66 15,53 6,71 8,71 1,10 1,07 0,91 0,92 -2,45 -2,45 -1,18 -1,38 1,27 1,07 0,5155 H11 hsa-miR-136* 26,32 31,82 26,18 26,72 16,61 15,82 3,81 5,87 0,42 0,43 0,53 0,34 -2,79 -2,44 -0,66 -0,76 2,13 1,68 0,4732 C12 miR-Control 32,17 40,34 31,43 37,81 16,86 18,55 5,76 8,64 0,84 0,86 0,84 0,88 -2,48 -2,22 -0,90 -1,03 1,58 1,20 0,9099 D12 miR-149 29,86 33,27 26,81 31,84 13,82 13,63 7,30 7,99 0,79 0,73 0,75 0,67 -2,03 -2,06 -0,96 -1,22 1,08 0,83 0,4065 E12 siLacZ 35,18 39,65 29,16 37,84 15,80 20,61 7,95 10,65 0,93 1,03 0,80 0,98 -2,15 -1,90 -0,88 -0,88 1,26 1,02 0,5373 F12 siErbB2 30,44 35,26 27,71 32,49 9,29 7,87 3,52 5,29 0,74 0,74 0,77 0,66 -3,11 -2,74 -1,58 -2,05 1,54 0,69 0,7854 G12 siErbB3 33,45 40,37 29,68 36,50 11,84 11,30 4,96 6,82 0,70 0,68 0,69 0,64 -2,75 -2,57 -1,33 -1,69 1,43 0,87 0,7324 B01 miR-Control 33,00 29,06 37,48 28,16 18,56 24,34 10,20 8,08 0,96 0,90 0,85 0,92 -1,69 -1,85 -1,01 -0,21 0,68 1,64 0,8393 C01 miR-149 28,44 27,21 32,39 28,67 14,33 25,72 10,99 10,98 0,84 0,88 0,78 0,96 -1,37 -1,31 -1,18 -0,16 0,20 1,15 0,5911 D01 siLacZ 31,37 28,67 36,69 28,65 19,26 24,93 11,90 9,33 1,08 0,82 1,02 0,97 -1,40 -1,62 -0,93 -0,20 0,47 1,42 0,7092 E01 siErbB2 27,10 27,31 30,03 27,11 4,90 9,56 5,06 5,72 0,80 0,85 0,80 0,84 -2,42 -2,26 -2,62 -1,50 -0,19 0,75 0,4894 F01 siErbB3 30,15 27,53 32,61 30,43 8,01 16,21 7,12 6,34 0,76 0,60 0,65 0,86 -2,08 -2,12 -2,03 -0,91 0,06 1,21 0,6278 A02 hsa-miR-512-3p 28,58 26,23 47,58 26,19 18,37 17,95 7,99 7,33 0,95 0,91 0,99 0,95 -1,84 -1,84 -1,37 -0,55 0,47 1,29 0,6523 B02 hsa-miR-650 29,33 27,50 31,59 28,77 13,31 23,85 5,73 5,78 0,79 0,73 0,70 1,00 -2,36 -2,25 -1,25 -0,27 1,11 1,98 0,8155 C02 hsa-miR-144 33,48 30,31 40,03 30,16 24,77 34,01 10,40 9,84 0,93 0,86 0,88 1,38 -1,69 -1,62 -0,69 0,17 0,99 1,80 0,9525 D02 hsa-miR-1263 31,49 29,30 34,67 29,80 19,38 33,31 7,66 8,01 0,79 0,74 0,63 0,83 -2,04 -1,87 -0,84 0,16 1,20 2,03 0,7521 E02 hsa-miR-217 33,55 28,95 38,36 29,96 22,20 31,32 14,44 12,05 1,12 0,88 1,00 1,07 -1,22 -1,26 -0,79 0,06 0,43 1,33 0,6660 F02 hsa-miR-513c 31,71 26,23 34,73 29,03 20,16 32,82 12,81 10,75 1,15 0,89 0,89 1,00 -1,31 -1,29 -0,78 0,18 0,52 1,46 0,7231

G02 hsa-miR-1283 34,91 29,20 39,30 31,30 22,89 30,44 13,15 10,69 1,24 0,98 1,06 1,14 -1,41 -1,45 -0,78 -0,04 0,63 1,41 0,7101 plate 5 plate H02 hsa-miR-519d 34,99 31,04 39,66 33,05 11,97 22,89 8,96 8,00 1,11 0,85 0,89 1,04 -1,97 -1,96 -1,73 -0,53 0,24 1,43 0,7061 A03 hsa-miR-146b-3p 36,35 28,57 39,30 29,80 15,90 23,33 13,56 8,56 1,01 0,78 0,80 0,91 -1,42 -1,74 -1,31 -0,35 0,12 1,39 0,6890 B03 hsa-miR-194 32,55 27,44 32,02 27,76 12,97 19,27 9,40 6,83 1,05 0,84 0,70 1,00 -1,79 -2,01 -1,30 -0,53 0,49 1,48 0,7285 C03 hsa-miR-497 24,62 23,96 28,43 24,46 16,07 22,00 6,01 5,91 0,46 0,47 0,36 0,55 -2,03 -2,02 -0,82 -0,15 1,21 1,87 0,7728 D03 hsa-miR-199a-5p 33,01 27,03 36,03 30,88 22,27 31,32 11,29 8,42 1,22 0,91 0,89 1,05 -1,55 -1,68 -0,69 0,02 0,85 1,70 0,9368 E03 hsa-miR-509-3-5p 36,15 30,35 37,74 29,48 19,95 26,41 12,98 9,97 1,15 1,09 0,81 0,90 -1,48 -1,61 -0,92 -0,16 0,56 1,45 0,7189 F03 hsa-miR-1227 28,83 24,60 30,03 26,04 21,95 26,62 11,03 9,39 0,97 0,87 0,86 0,91 -1,39 -1,39 -0,45 0,03 0,93 1,42 0,7330 G03 hsa-miR-1271 39,17 31,64 41,21 31,48 20,33 29,06 9,44 8,06 0,79 0,77 0,72 0,81 -2,05 -1,97 -1,02 -0,12 1,03 1,86 0,9035 H03 hsa-miR-586 31,40 26,65 33,06 27,82 17,99 27,60 11,84 8,29 0,91 0,74 0,78 0,89 -1,41 -1,69 -0,88 -0,01 0,53 1,67 0,8267 A04 hsa-miR-320b 13,02 29,20 37,17 29,82 21,27 29,17 2,55 8,94 0,91 0,86 0,76 0,98 -2,35 -1,71 -0,81 -0,03 1,55 1,68 0,3261

116

117

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval B04 hsa-miR-448 12,85 26,84 36,62 27,42 17,85 22,28 2,60 8,39 0,98 0,85 0,96 0,92 -2,30 -1,68 -1,04 -0,30 1,27 1,38 0,8291 C04 hsa-miR-886-5p 13,24 31,18 45,91 30,01 25,76 30,26 2,61 12,17 1,01 1,00 1,31 0,98 -2,34 -1,36 -0,83 0,01 1,51 1,37 0,5896 D04 hsa-miR-105 13,16 22,97 27,49 22,88 16,78 21,46 2,37 7,64 0,67 0,67 0,75 0,71 -2,47 -1,59 -0,71 -0,09 1,76 1,50 0,4902 E04 hsa-miR-147b 13,29 28,98 39,03 28,15 17,22 22,03 2,85 9,06 1,12 0,99 1,09 1,03 -2,22 -1,68 -1,18 -0,35 1,04 1,32 0,6406 F04 hsa-miR-519b-3p 12,85 27,51 33,99 27,73 7,14 12,11 2,77 6,62 1,05 0,99 0,95 1,03 -2,21 -2,05 -2,25 -1,20 -0,04 0,86 0,5054 G04 hsa-miR-483-3p 13,08 29,91 35,37 28,55 15,94 24,79 2,66 8,26 0,69 0,74 0,57 0,73 -2,30 -1,86 -1,15 -0,20 1,15 1,65 0,9138 H04 hsa-miR-424 13,53 26,89 27,18 27,26 12,85 25,75 2,61 7,49 0,64 0,60 0,34 0,63 -2,37 -1,84 -1,08 -0,08 1,29 1,76 0,7189 A05 hsa-miR-34c-3p 35,16 28,21 38,39 31,52 21,74 32,99 7,91 6,21 0,68 0,64 0,64 0,81 -2,15 -2,18 -0,82 0,07 1,33 2,25 0,6816 B05 hsa-miR-431* 32,56 28,02 37,37 29,59 18,46 26,68 8,28 6,65 0,80 0,74 0,72 0,87 -1,97 -2,07 -1,02 -0,15 0,96 1,92 0,9205 C05 hsa-miR-664* 38,40 33,28 40,05 32,34 22,06 32,50 12,10 10,53 0,73 0,73 0,59 0,82 -1,67 -1,66 -0,86 0,01 0,81 1,67 0,8996 D05 hsa-miR-651 37,72 29,64 42,36 30,37 30,25 33,66 12,63 10,50 1,01 0,77 0,89 0,90 -1,58 -1,50 -0,49 0,15 1,09 1,64 0,9664 E05 hsa-miR-618 36,91 28,76 41,38 28,86 27,42 31,82 15,41 13,57 1,20 0,89 0,99 1,02 -1,26 -1,08 -0,59 0,14 0,67 1,22 0,5886 F05 hsa-miR-548i 35,06 28,90 41,72 30,58 23,57 32,97 13,07 12,18 1,05 0,92 0,90 1,09 -1,42 -1,25 -0,82 0,11 0,60 1,35 0,6784 G05 hsa-miR-518c 32,36 27,19 35,82 31,06 12,67 26,39 10,58 9,46 0,86 0,85 0,68 0,95 -1,61 -1,52 -1,50 -0,24 0,11 1,29 0,6581 H05 hsa-miR-1184 32,69 28,55 36,08 29,13 19,94 29,21 13,53 11,90 0,90 0,80 0,72 0,86 -1,27 -1,26 -0,86 0,00 0,42 1,27 0,6378 A06 hsa-miR-656 31,98 27,40 39,06 25,35 23,31 23,10 10,57 8,40 0,90 0,72 0,90 0,70 -1,60 -1,71 -0,74 -0,13 0,85 1,57 0,8426 B06 hsa-miR-29c 30,30 25,84 35,07 23,43 21,30 23,57 10,77 8,73 0,78 0,67 0,73 0,58 -1,49 -1,57 -0,72 0,01 0,77 1,57 0,8253 C06 hsa-miR-497* 31,06 28,32 34,39 25,44 14,31 20,78 8,80 7,49 0,89 0,85 0,74 0,72 -1,82 -1,92 -1,26 -0,29 0,55 1,63 0,8066 D06 hsa-miR-27a* 31,96 27,41 33,28 25,84 17,26 21,35 6,45 5,12 0,68 0,61 0,53 0,59 -2,31 -2,42 -0,95 -0,28 1,36 2,15 0,6660 E06 hsa-miR-423-3p 31,77 26,53 35,06 25,35 18,10 23,30 12,70 11,08 0,98 0,85 0,82 0,76 -1,32 -1,26 -0,95 -0,12 0,37 1,14 0,5673 F06 hsa-miR-610 37,77 31,74 34,23 30,89 17,22 29,49 11,14 9,01 0,91 0,78 0,44 0,72 -1,76 -1,82 -0,99 -0,07 0,77 1,75 0,9284 G06 hsa-miR-1289 28,65 23,64 32,20 23,82 7,35 10,75 7,61 6,22 0,64 0,53 0,53 0,53 -1,91 -1,93 -2,13 -1,15 -0,22 0,78 0,4986 H06 hsa-miR-1251 34,18 29,59 36,45 28,74 17,62 24,69 11,35 9,03 1,11 0,91 0,81 0,94 -1,59 -1,71 -1,05 -0,22 0,54 1,49 0,7330 A07 hsa-miR-431 34,51 27,94 39,18 30,64 24,40 32,79 8,56 7,28 0,83 0,69 0,77 0,87 -2,01 -1,94 -0,68 0,10 1,33 2,04 0,6855 B07 hsa-miR-580 35,46 30,08 41,56 31,17 28,65 35,17 8,84 7,50 0,91 0,74 0,79 0,94 -2,00 -2,00 -0,54 0,17 1,47 2,18 0,6020 C07 hsa-miR-197 31,11 28,00 36,38 29,18 21,92 29,61 8,55 7,04 0,75 0,72 0,66 0,84 -1,86 -1,99 -0,73 0,02 1,13 2,01 0,7919 D07 hsa-miR-1303 35,75 31,89 48,76 30,96 33,12 35,68 10,72 9,88 1,01 0,90 1,27 1,07 -1,74 -1,69 -0,56 0,20 1,18 1,90 0,7873 E07 hsa-miR-502-3p 28,38 25,36 34,15 27,64 22,03 29,02 8,40 8,05 0,74 0,68 0,70 0,83 -1,76 -1,66 -0,63 0,07 1,12 1,73 0,8969 F07 hsa-miR-644 23,41 21,28 24,87 22,72 5,30 11,38 4,80 3,66 0,46 0,45 0,35 0,46 -2,29 -2,54 -2,23 -1,00 0,06 1,54 0,7272 G07 hsa-miR-1827 31,60 29,45 39,74 28,87 28,57 31,61 9,20 10,09 0,64 0,72 0,78 0,77 -1,78 -1,55 -0,48 0,13 1,30 1,68 0,7189 H07 hsa-miR-1285 26,76 23,58 25,41 24,05 7,59 14,12 6,64 5,87 0,62 0,58 0,37 0,58 -2,01 -2,01 -1,74 -0,77 0,27 1,24 0,6278 A08 hsa-miR-611 32,89 27,85 39,67 29,66 21,61 27,50 10,95 9,90 1,07 0,87 1,06 0,99 -1,59 -1,49 -0,88 -0,11 0,71 1,38 0,6990 B08 hsa-miR-340 23,08 20,18 30,66 23,01 14,71 19,95 5,78 4,22 0,38 0,33 0,42 0,49 -2,00 -2,26 -1,06 -0,21 0,94 2,05 0,8941 C08 hsa-miR-224 29,87 24,75 36,43 27,23 25,91 33,43 9,66 8,44 0,71 0,57 0,62 0,70 -1,63 -1,55 -0,49 0,30 1,14 1,85 0,8291

D08 hsa-miR-367* 33,11 28,02 42,32 28,27 16,58 21,24 9,68 7,77 0,94 0,77 1,04 0,85 -1,77 -1,85 -1,35 -0,41 0,42 1,44 0,7143 plate 5 plate E08 hsa-miR-659 32,07 30,81 39,41 31,25 21,94 28,83 7,37 7,72 0,75 0,80 0,76 0,87 -2,12 -2,00 -0,84 -0,12 1,28 1,88 0,7189 F08 hsa-miR-499-5p 29,63 25,38 35,49 27,26 19,67 28,32 9,53 8,04 0,81 0,72 0,74 0,85 -1,64 -1,66 -0,85 0,06 0,79 1,71 0,9141 G08 hsa-miR-22* 29,62 26,32 32,97 26,88 12,92 20,79 8,23 7,53 0,77 0,72 0,65 0,83 -1,85 -1,81 -1,35 -0,37 0,50 1,44 0,7143 H08 hsa-miR-196a* 35,93 29,79 37,77 30,46 16,11 24,61 7,79 6,26 0,85 0,67 0,59 0,75 -2,21 -2,25 -1,23 -0,31 0,98 1,94 0,9048 A09 hsa-miR-145* 33,04 24,28 36,24 26,04 14,39 19,55 8,22 5,51 0,97 0,57 0,59 0,74 -2,01 -2,14 -1,33 -0,41 0,67 1,73 0,8908 B09 hsa-miR-325 33,43 26,88 37,35 28,49 23,30 32,78 13,84 11,10 1,08 0,83 0,88 1,02 -1,27 -1,28 -0,68 0,20 0,59 1,48 0,7324 C09 hsa-miR-485-3p 33,60 28,94 35,67 28,66 12,88 22,65 9,53 8,11 0,85 0,67 0,66 0,83 -1,82 -1,84 -1,47 -0,34 0,35 1,50 0,7266 D09 hsa-miR-508-5p 30,60 23,81 32,30 26,42 13,00 21,52 8,89 6,50 0,85 0,62 0,66 0,79 -1,78 -1,87 -1,31 -0,30 0,47 1,58 0,7741 E09 hsa-miR-195 27,94 23,26 29,11 25,85 15,24 25,67 7,93 5,97 0,53 0,44 0,34 0,55 -1,82 -1,96 -0,93 -0,01 0,88 1,95 0,9486 F09 hsa-miR-33a* 32,84 27,09 33,83 23,35 17,55 20,98 9,80 9,25 0,82 0,73 0,61 0,54 -1,75 -1,55 -0,95 -0,15 0,80 1,40 0,7105 G09 hsa-miR-944 31,55 27,92 31,62 28,22 17,35 27,97 8,38 7,33 0,70 0,63 0,45 0,68 -1,91 -1,93 -0,87 -0,01 1,05 1,92 0,8742 H09 hsa-miR-770-5p 32,30 29,22 36,20 30,02 19,32 24,86 10,19 10,58 0,88 0,86 0,75 0,89 -1,66 -1,47 -0,91 -0,27 0,76 1,19 0,5445 A10 hsa-miR-526b* 36,08 30,28 41,75 32,19 13,74 19,22 9,30 7,28 0,97 0,84 0,77 0,96 -1,96 -2,06 -1,60 -0,74 0,35 1,31 0,6615 B10 hsa-miR-940 34,06 29,07 35,87 30,86 16,87 31,03 10,62 9,07 0,81 0,73 0,53 0,82 -1,68 -1,68 -1,09 0,01 0,59 1,69 0,8426 C10 hsa-miR-331-3p 34,33 30,15 37,01 30,98 21,78 31,62 11,23 9,84 0,98 0,97 0,74 1,05 -1,61 -1,62 -0,76 0,03 0,85 1,64 0,8998 D10 hsa-miR-768-5p 30,31 26,79 31,24 25,25 8,14 18,52 7,76 5,92 0,94 0,81 0,68 0,89 -1,97 -2,18 -1,94 -0,45 0,03 1,73 0,7854 E10 hsa-miR-888 35,09 29,32 39,90 28,50 25,61 34,50 14,30 13,65 0,97 0,89 0,90 0,98 -1,30 -1,10 -0,64 0,28 0,66 1,38 0,6963 F10 hsa-miR-589* 34,17 28,94 37,43 31,05 22,09 34,61 11,22 10,56 0,91 0,82 0,78 1,04 -1,61 -1,45 -0,76 0,16 0,85 1,61 0,8755 G10 hsa-miR-758 35,71 31,99 39,26 31,97 16,14 29,82 10,08 8,66 0,91 0,84 0,70 0,91 -1,83 -1,88 -1,28 -0,10 0,54 1,78 0,8815 H10 hsa-miR-223 36,79 32,76 37,45 33,19 15,47 27,05 8,95 7,71 0,96 0,84 0,68 1,00 -2,04 -2,09 -1,28 -0,30 0,76 1,79 0,9486 A11 hsa-miR-623 34,89 27,81 41,90 27,54 18,20 21,55 10,46 7,62 1,01 0,78 0,84 0,84 -1,74 -1,87 -1,20 -0,35 0,54 1,51 0,7498 B11 hsa-miR-1295 36,81 28,91 41,87 28,14 21,04 32,03 10,92 8,14 0,84 0,73 0,68 0,68 -1,75 -1,83 -0,99 0,19 0,76 2,02 0,9731 C11 hsa-miR-1224-5p 38,21 30,13 43,13 29,26 18,85 29,11 11,25 8,61 1,05 0,84 0,85 0,87 -1,76 -1,81 -1,19 -0,01 0,57 1,80 0,8969 D11 hsa-miR-125b 40,54 31,47 46,21 29,96 21,41 29,60 10,88 8,31 1,07 0,84 0,87 0,93 -1,90 -1,92 -1,11 -0,02 0,79 1,90 0,9999 E11 hsa-miR-379 30,17 25,89 31,52 24,82 10,08 17,56 7,95 5,94 0,74 0,66 0,56 0,70 -1,92 -2,12 -1,64 -0,50 0,28 1,63 0,7738 F11 hsa-miR-376b 33,16 29,64 35,20 27,21 15,65 26,13 7,81 5,55 0,68 0,59 0,49 0,63 -2,09 -2,42 -1,17 -0,06 0,92 2,36 0,8333 G11 hsa-miR-602 35,25 31,32 41,68 29,70 17,82 31,80 11,39 10,63 0,97 0,96 0,92 0,92 -1,63 -1,56 -1,23 0,10 0,40 1,66 0,7958 H11 hsa-miR-587 33,97 29,18 38,09 30,56 18,95 28,16 11,10 9,09 1,09 0,86 0,88 0,93 -1,61 -1,68 -1,01 -0,12 0,61 1,57 0,7858 C12 miR-Control 34,05 28,78 NA 28,56 NA 24,34 10,20 8,00 0,93 0,78 NA 0,81 -1,74 -1,85 NA -0,23 NA 1,62 NA D12 miR-149 28,98 26,77 NA 24,31 NA 19,90 10,15 9,02 0,78 0,72 NA 0,68 -1,51 -1,57 NA -0,29 NA 1,28 NA E12 siLacZ 32,19 31,15 NA 26,10 NA 25,97 10,14 11,08 0,82 0,89 NA 0,85 -1,67 -1,49 NA -0,01 NA 1,48 NA F12 siErbB2 28,43 27,85 NA 25,13 NA 11,10 6,75 5,72 0,63 0,68 NA 0,74 -2,07 -2,28 NA -1,18 NA 1,10 NA G12 siErbB3 28,15 31,14 NA 26,43 NA 14,82 7,17 7,20 0,51 0,71 NA 0,62 -1,97 -2,11 NA -0,83 NA 1,28 NA B01 miR-Control 38,39 46,73 35,46 47,33 21,44 27,03 9,52 10,77 1,20 1,45 1,22 1,76 -2,01 -2,12 -0,73 -0,81 1,29 1,31 0,3799 C01 miR-149 33,99 38,39 31,39 38,05 16,24 21,56 9,55 10,90 0,97 1,24 1,12 1,57 -1,83 -1,82 -0,95 -0,82 0,88 1,00 0,1852 D01 siLacZ 40,19 46,58 36,52 44,12 22,99 23,14 11,41 12,54 1,33 1,65 1,46 2,01 -1,82 -1,89 -0,67 -0,93 1,15 0,96 0,4034 E01 siErbB2 32,85 39,40 31,54 38,47 6,24 7,84 6,49 5,52 0,92 1,25 1,14 1,53 -2,34 -2,84 -2,34 -2,29 0,00 0,54 0,3824 F01 siErbB3 36,82 46,37 36,40 40,02 11,30 12,72 7,47 8,12 0,93 1,20 1,11 1,36 -2,30 -2,51 -1,69 -1,65 0,61 0,86 0,3363 A02 hsa-miR-520d-5p 38,54 47,70 37,19 46,20 32,87 34,44 9,98 12,82 1,14 1,41 1,10 1,60 -1,95 -1,90 -0,18 -0,42 1,77 1,47 0,5215 B02 hsa-miR-96 39,65 50,66 33,87 47,48 22,30 29,26 8,98 10,81 1,06 1,30 1,01 1,44 -2,14 -2,23 -0,60 -0,70 1,54 1,53 0,0000 plate 6 plate C02 hsa-miR-202* 40,68 49,22 39,08 46,26 26,82 25,82 11,10 14,94 1,40 1,42 1,36 1,74 -1,87 -1,72 -0,54 -0,84 1,33 0,88 0,6615 D02 hsa-miR-141* 30,86 39,86 28,96 36,25 28,12 28,69 8,74 9,88 0,77 0,89 0,71 1,01 -1,82 -2,01 -0,04 -0,34 1,78 1,68 0,1438 E02 hsa-miR-1284 39,40 47,24 38,45 44,58 22,66 22,86 9,63 12,02 1,57 1,59 1,51 1,85 -2,03 -1,98 -0,76 -0,96 1,27 1,01 0,5555 F02 hsa-miR-107 39,89 47,10 36,54 45,11 36,39 34,63 13,70 16,04 1,31 1,40 1,16 1,63 -1,54 -1,55 -0,01 -0,38 1,54 1,17 0,9831 G02 hsa-miR-106a 37,78 47,23 37,27 42,36 17,14 16,48 7,30 8,26 1,11 1,27 1,21 1,32 -2,37 -2,52 -1,12 -1,36 1,25 1,15 0,3560 H02 hsa-miR-371-3p 38,84 45,14 37,29 42,86 20,19 19,89 9,60 13,40 1,27 1,35 1,29 1,59 -2,02 -1,75 -0,89 -1,11 1,13 0,64 0,5215

117

118

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval A03 hsa-miR-1267 35,98 47,00 36,19 40,16 22,35 22,07 9,32 11,47 1,31 1,80 1,31 1,57 -1,95 -2,03 -0,70 -0,86 1,25 1,17 0,3259 B03 hsa-miR-185 24,70 37,03 25,58 31,45 13,32 13,44 7,11 7,51 0,72 1,11 0,70 1,08 -1,80 -2,30 -0,94 -1,23 0,86 1,08 0,3881 C03 hsa-miR-582-5p 29,07 38,15 29,17 31,69 28,52 24,80 10,61 10,94 1,02 1,26 1,07 1,32 -1,45 -1,80 -0,03 -0,35 1,42 1,45 0,0857 D03 hsa-miR-769-5p 34,07 42,37 31,32 34,49 30,82 27,30 8,79 8,60 0,97 1,16 0,89 1,13 -1,95 -2,30 -0,02 -0,34 1,93 1,96 0,0000 E03 hsa-miR-20a* 42,39 53,10 39,34 48,08 27,65 22,40 7,74 9,59 1,32 1,66 1,26 1,76 -2,45 -2,47 -0,51 -1,10 1,94 1,37 0,6615 F03 hsa-miR-215 32,61 30,92 32,61 37,61 21,00 19,03 8,05 5,64 0,96 0,64 0,91 1,08 -2,02 -2,45 -0,63 -0,98 1,38 1,47 0,4889 G03 hsa-miR-122* 35,59 48,89 37,94 45,70 23,60 24,77 9,82 12,23 1,23 1,67 1,34 1,76 -1,86 -2,00 -0,68 -0,88 1,17 1,12 0,0425 H03 hsa-miR-1292 37,60 48,59 39,94 45,99 26,99 25,51 10,06 12,46 1,24 1,45 1,13 1,58 -1,90 -1,96 -0,57 -0,85 1,34 1,11 0,6555 A04 hsa-miR-1270 34,03 43,11 33,32 41,41 15,99 17,30 7,61 8,01 0,82 0,89 0,82 1,12 -2,16 -2,43 -1,06 -1,26 1,10 1,17 0,0876 B04 hsa-miR-302e 32,15 39,21 30,93 36,40 5,95 7,19 5,01 5,07 1,22 1,32 1,21 1,54 -2,68 -2,95 -2,38 -2,34 0,31 0,61 0,3259 C04 hsa-miR-520h 38,31 47,68 35,92 46,39 25,75 25,28 7,69 8,20 1,25 1,35 1,05 1,64 -2,32 -2,54 -0,48 -0,88 1,84 1,66 0,3261 D04 hsa-miR-151-3p 36,56 45,37 34,85 43,88 24,93 22,72 8,44 9,67 1,28 1,38 1,36 1,81 -2,12 -2,23 -0,48 -0,95 1,63 1,28 0,7583 E04 hsa-miR-490-5p 36,39 49,38 36,13 49,07 20,00 21,49 6,72 8,50 1,16 1,45 1,10 1,78 -2,44 -2,54 -0,85 -1,19 1,58 1,35 0,6660 F04 hsa-miR-29a 36,25 43,58 32,11 43,85 24,26 27,34 12,05 11,08 1,16 1,23 0,98 1,55 -1,59 -1,98 -0,40 -0,68 1,19 1,29 0,4823 G04 hsa-miR-885-3p 32,94 44,03 31,41 44,00 24,38 23,35 7,49 8,93 0,92 1,10 0,81 1,27 -2,14 -2,30 -0,37 -0,91 1,77 1,39 0,6278 H04 hsa-miR-593* 34,88 46,80 36,09 46,89 23,67 23,00 7,27 8,91 0,88 1,22 0,88 1,43 -2,26 -2,39 -0,61 -1,03 1,65 1,37 0,6461 A05 hsa-miR-513b 37,89 49,59 37,75 44,16 21,77 24,32 7,99 10,11 1,16 1,54 1,16 1,54 -2,25 -2,29 -0,79 -0,86 1,45 1,43 0,0319 B05 hsa-miR-1914 36,49 47,87 37,21 44,82 26,33 26,97 11,07 12,97 1,30 1,54 1,36 1,85 -1,72 -1,88 -0,50 -0,73 1,22 1,15 0,1919 C05 hsa-miR-19b 34,86 46,37 34,45 43,79 10,92 15,83 7,72 9,64 1,39 1,59 1,31 1,85 -2,17 -2,27 -1,66 -1,47 0,52 0,80 0,3363 D05 hsa-miR-31 37,58 48,47 37,77 44,72 24,06 30,81 11,29 13,83 0,94 1,26 1,00 1,35 -1,73 -1,81 -0,65 -0,54 1,08 1,27 0,5146 E05 hsa-miR-484 36,57 47,38 35,26 44,22 24,45 27,73 10,08 11,29 1,15 1,50 1,15 1,58 -1,86 -2,07 -0,53 -0,67 1,33 1,40 0,8135 F05 hsa-miR-92b 36,70 50,56 36,33 46,15 32,05 34,98 13,18 14,95 1,29 1,77 1,36 1,83 -1,48 -1,76 -0,18 -0,40 1,30 1,36 0,7858 G05 hsa-miR-143 42,41 51,11 40,28 48,10 20,23 21,11 8,43 11,00 1,24 1,62 1,36 1,73 -2,33 -2,22 -0,99 -1,19 1,34 1,03 0,6615 H05 hsa-miR-1291 41,05 56,96 42,41 53,99 22,02 24,76 8,85 13,44 1,25 1,73 1,12 1,79 -2,21 -2,08 -0,95 -1,12 1,27 0,96 0,5673 A06 hsa-miR-378 43,55 52,17 40,06 47,44 37,02 32,86 13,12 14,51 1,26 1,48 1,26 1,49 -1,73 -1,85 -0,11 -0,53 1,62 1,32 0,7143 B06 hsa-miR-1178 44,17 53,64 40,21 50,38 14,66 18,78 8,82 10,95 1,11 1,33 1,13 1,47 -2,32 -2,29 -1,46 -1,42 0,87 0,87 0,0000 C06 hsa-let-7b 36,40 43,69 34,76 42,43 23,62 23,21 10,92 12,09 1,12 1,21 1,02 1,50 -1,74 -1,85 -0,56 -0,87 1,18 0,98 0,4365 D06 hsa-miR-654-5p 33,53 41,73 31,75 40,06 16,51 19,04 5,13 6,04 0,86 0,90 0,77 1,12 -2,71 -2,79 -0,94 -1,07 1,77 1,72 0,0005 E06 hsa-miR-617 31,50 37,54 30,56 40,09 18,71 19,77 6,13 7,05 0,92 0,94 0,84 1,26 -2,36 -2,41 -0,71 -1,02 1,65 1,39 0,5911 F06 hsa-miR-649 38,59 47,43 37,70 48,41 22,18 27,75 12,18 14,92 1,27 1,49 1,25 1,83 -1,66 -1,67 -0,77 -0,80 0,90 0,87 0,0000 G06 hsa-miR-532-3p 38,45 49,85 37,56 50,39 26,39 25,86 9,04 11,53 1,24 1,48 1,13 1,96 -2,09 -2,11 -0,51 -0,96 1,58 1,15 0,9638 H06 hsa-miR-125b-2* 40,53 47,54 37,84 48,16 21,32 23,10 8,79 10,21 1,19 1,32 0,91 1,61 -2,21 -2,22 -0,83 -1,06 1,38 1,16 0,7324 A07 hsa-miR-452* 31,70 34,98 26,84 13,59 20,56 5,16 6,44 6,25 0,71 0,89 0,69 0,45 -2,30 -2,48 -0,38 -1,40 1,91 1,09 0,8426 B07 hsa-miR-744 32,58 42,38 31,17 38,43 33,42 30,33 5,33 6,93 1,04 1,30 0,92 1,36 -2,61 -2,61 0,10 -0,34 2,71 2,27 0,3363 C07 hsa-miR-1909* 33,34 39,31 25,86 35,65 18,04 24,57 8,99 9,68 1,01 1,12 0,65 1,22 -1,89 -2,02 -0,52 -0,54 1,37 1,48 0,5591 D07 hsa-miR-129-3p 34,81 43,99 34,10 42,60 23,25 23,51 6,88 9,07 0,98 1,25 1,03 1,52 -2,34 -2,28 -0,55 -0,86 1,79 1,42 0,5896 E07 hsa-miR-494 41,30 51,79 40,46 49,78 22,22 22,98 11,05 11,64 1,00 1,34 1,09 1,53 -1,90 -2,15 -0,86 -1,12 1,04 1,04 0,0000 F07 hsa-miR-302b* 37,69 47,33 37,46 45,92 24,21 23,37 10,38 11,21 1,48 1,62 1,44 1,93 -1,86 -2,08 -0,63 -0,97 1,23 1,10 0,3958 G07 hsa-miR-26b* 40,22 53,67 41,68 51,04 24,79 21,55 6,93 9,36 1,24 1,57 1,11 1,68 -2,54 -2,52 -0,75 -1,24 1,79 1,28 0,7305 plate 6 plate H07 hsa-miR-1293 28,47 41,21 29,16 37,55 12,30 18,09 4,27 6,20 0,50 0,77 0,45 0,78 -2,74 -2,73 -1,25 -1,05 1,49 1,68 0,4487 A08 hsa-miR-324-3p 39,92 41,68 36,66 41,03 21,15 19,12 8,95 8,86 1,17 1,33 1,28 1,69 -2,16 -2,23 -0,79 -1,10 1,36 1,13 0,7079 B08 hsa-miR-1274b 38,77 48,49 38,06 46,41 27,25 21,18 6,87 9,12 1,12 1,39 1,11 1,82 -2,50 -2,41 -0,48 -1,13 2,01 1,28 0,7143 C08 hsa-miR-508-3p 39,83 45,73 38,38 43,86 33,42 33,32 8,15 9,72 1,21 1,37 1,21 1,64 -2,29 -2,23 -0,20 -0,40 2,09 1,84 0,3363 D08 hsa-miR-218-2* 35,42 46,13 37,30 46,76 14,66 16,75 5,01 7,12 1,05 1,29 1,26 1,62 -2,82 -2,70 -1,35 -1,48 1,47 1,22 0,9978 E08 hsa-miR-513a-3p 35,54 41,09 34,59 44,72 28,81 28,55 9,65 10,57 1,11 1,18 1,07 1,69 -1,88 -1,96 -0,26 -0,65 1,62 1,31 0,7189 F08 hsa-miR-1226 35,80 43,79 35,89 42,31 29,99 30,78 9,03 10,21 1,05 1,24 1,17 1,56 -1,99 -2,10 -0,26 -0,46 1,73 1,64 0,0962 G08 hsa-miR-30d 39,56 46,03 39,38 45,09 14,72 17,49 9,19 11,74 1,31 1,45 1,38 1,77 -2,11 -1,97 -1,42 -1,37 0,69 0,61 0,0161 H08 hsa-let-7d* 43,12 48,92 41,20 50,32 28,23 30,68 9,97 11,54 1,07 1,35 1,05 1,63 -2,11 -2,08 -0,55 -0,71 1,57 1,37 0,6137 A09 hsa-miR-182 44,75 40,68 40,85 46,04 26,46 24,70 8,39 6,70 1,22 0,85 1,02 1,49 -2,41 -2,60 -0,63 -0,90 1,79 1,70 0,0704 B09 hsa-miR-647 37,28 39,54 34,98 40,81 20,39 18,92 9,34 8,49 1,10 1,02 0,90 1,51 -2,00 -2,22 -0,78 -1,11 1,22 1,11 0,3363 C09 hsa-miR-578 32,65 35,02 30,31 37,72 11,89 14,22 5,77 6,09 0,91 0,80 0,76 1,29 -2,50 -2,52 -1,35 -1,41 1,15 1,12 0,0002 D09 hsa-miR-141 41,78 47,55 41,73 47,42 20,11 23,30 13,35 12,22 1,41 1,46 1,33 1,85 -1,65 -1,96 -1,05 -1,03 0,59 0,93 0,4065 E09 hsa-miR-486-3p 38,51 41,22 37,08 45,12 11,67 15,24 6,12 7,08 1,07 0,91 0,94 1,40 -2,65 -2,54 -1,67 -1,57 0,98 0,97 0,0000 F09 hsa-miR-92a-2* 43,38 47,70 40,91 47,47 22,58 21,88 10,22 10,32 1,46 1,41 1,36 1,72 -2,09 -2,21 -0,86 -1,12 1,23 1,09 0,4090 G09 hsa-miR-518b 34,58 40,57 33,32 40,46 15,74 18,18 8,23 8,79 0,96 1,00 0,99 1,20 -2,07 -2,21 -1,08 -1,15 0,99 1,05 0,0189 H09 hsa-miR-492 45,13 51,45 41,34 50,11 30,60 28,96 10,52 10,24 1,37 1,42 1,13 1,63 -2,10 -2,33 -0,43 -0,79 1,67 1,54 0,3296 A10 hsa-miR-1915* 31,44 35,07 29,28 32,93 12,76 13,73 5,87 7,82 0,95 1,03 0,87 1,24 -2,42 -2,17 -1,20 -1,26 1,22 0,90 0,5297 B10 hsa-miR-562 38,75 46,83 36,89 43,80 24,56 17,44 7,22 8,99 1,07 1,15 0,90 1,41 -2,42 -2,38 -0,59 -1,33 1,84 1,05 0,8998 C10 hsa-miR-631 37,34 43,66 32,67 43,43 23,86 20,89 7,90 8,92 1,22 1,29 0,76 1,74 -2,24 -2,29 -0,45 -1,06 1,79 1,24 0,7714 D10 hsa-miR-297 24,34 27,72 27,23 31,04 16,97 16,06 4,06 5,70 0,61 0,57 0,67 0,92 -2,58 -2,28 -0,68 -0,95 1,90 1,33 0,6857 E10 hsa-miR-521 35,18 44,52 38,79 44,36 23,35 21,55 8,32 9,94 1,18 1,34 1,32 1,70 -2,08 -2,16 -0,73 -1,04 1,35 1,12 0,6726 F10 hsa-miR-150* 39,06 45,62 40,41 46,21 33,46 29,10 8,78 10,37 1,29 1,34 1,36 1,67 -2,15 -2,14 -0,27 -0,67 1,88 1,47 0,5572 G10 hsa-miR-493* 30,64 36,82 31,07 40,05 18,29 20,89 4,78 6,90 0,94 0,98 0,77 1,41 -2,68 -2,42 -0,76 -0,94 1,92 1,48 0,5575 H10 hsa-miR-499-3p 37,50 48,34 39,41 47,27 19,77 19,51 6,27 9,60 0,93 1,22 0,83 1,44 -2,58 -2,33 -1,00 -1,28 1,59 1,06 0,9582 A11 hsa-miR-101 36,46 37,85 33,92 34,66 33,17 27,06 11,25 10,67 1,49 1,21 1,09 1,34 -1,70 -1,83 -0,03 -0,36 1,66 1,47 0,4753 B11 hsa-miR-551b 43,29 42,43 37,58 44,46 33,37 26,80 12,49 10,64 1,72 1,31 1,29 1,77 -1,79 -1,99 -0,17 -0,73 1,62 1,26 0,7858 C11 hsa-miR-1200 42,58 45,89 39,80 44,70 32,40 23,19 10,95 9,65 1,29 1,10 0,96 1,47 -1,96 -2,25 -0,30 -0,95 1,66 1,30 0,7210 D11 hsa-let-7b* 36,01 38,00 37,47 38,59 18,76 16,98 6,91 7,53 1,09 0,86 1,07 1,21 -2,38 -2,33 -1,00 -1,18 1,38 1,15 0,7330 E11 hsa-miR-1277 44,04 45,35 41,05 45,77 33,16 26,43 11,63 10,01 1,72 1,34 1,30 1,82 -1,92 -2,18 -0,31 -0,79 1,61 1,39 0,5908 F11 hsa-miR-1205 27,67 31,42 32,07 34,74 25,19 23,55 10,06 10,45 0,74 0,81 0,87 1,15 -1,46 -1,59 -0,35 -0,56 1,11 1,03 0,1227 G11 hsa-miR-1197 39,96 43,73 40,32 46,85 19,21 18,73 8,44 9,31 1,36 1,20 1,16 1,65 -2,24 -2,23 -1,07 -1,32 1,17 0,91 0,4823 H11 hsa-miR-504 35,11 41,67 37,36 41,94 27,47 25,63 5,97 8,80 0,98 1,27 0,96 1,44 -2,55 -2,24 -0,44 -0,71 2,11 1,53 0,5545 C12 miR-Control 41,89 45,08 37,05 39,49 25,08 21,80 11,73 10,62 1,87 1,37 0,99 1,45 -1,84 -2,09 -0,56 -0,86 1,27 1,23 0,1785 D12 miR-149 36,30 36,95 30,36 33,88 15,12 17,21 11,30 10,90 1,17 1,16 0,83 1,25 -1,68 -1,76 -1,01 -0,98 0,68 0,78 0,0862 E12 siLacZ 38,58 46,03 39,61 40,24 28,11 23,14 11,41 12,10 2,03 1,56 1,28 1,58 -1,76 -1,93 -0,49 -0,80 1,26 1,13 0,4575 F12 siErbB2 35,41 38,77 30,67 37,28 5,34 11,15 5,08 7,49 1,09 1,17 0,78 1,43 -2,80 -2,37 -2,52 -1,74 0,28 0,63 0,3363 G12 siErbB3 25,80 42,15 35,46 42,82 11,30 14,78 4,97 8,42 0,89 1,05 0,81 1,31 -2,38 -2,32 -1,65 -1,53 0,73 0,79 0,0023 B01 miR-Control 35,36 43,52 37,30 44,50 30,13 25,15 9,40 8,03 0,59 0,42 0,47 0,65 -1,91 -2,44 -0,31 -0,82 1,60 1,61 0,0000 C01 miR-149 29,70 36,02 35,05 38,91 28,53 19,30 8,85 7,93 0,44 0,35 0,41 0,50 -1,75 -2,18 -0,30 -1,01 1,45 1,17 0,8998

D01 siLacZ 31,04 43,27 36,78 46,89 33,26 26,20 8,45 9,50 0,66 0,36 0,51 0,76 -1,88 -2,19 -0,15 -0,84 1,73 1,35 0,6697 plate 7 plate E01 siErbB2 27,90 36,97 32,44 38,96 9,10 7,69 4,31 4,37 0,48 0,31 0,38 0,59 -2,69 -3,08 -1,83 -2,34 0,86 0,74 0,1419

118

119

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval F01 siErbB3 32,43 40,31 36,39 45,25 18,42 13,14 6,34 5,51 0,44 0,32 0,39 0,47 -2,35 -2,87 -0,98 -1,78 1,37 1,09 0,7143 A02 hsa-miR-488 28,15 33,92 32,10 37,66 31,58 28,22 5,20 4,94 0,36 0,27 0,30 0,47 -2,44 -2,78 -0,02 -0,42 2,41 2,36 0,0000 B02 hsa-miR-132* 30,68 36,37 34,60 41,77 29,89 25,01 8,39 7,65 0,45 0,36 0,41 0,58 -1,87 -2,25 -0,21 -0,74 1,66 1,51 0,3837 C02 hsa-miR-29b-1* 32,82 40,16 38,53 47,02 34,77 27,34 8,19 6,77 0,53 0,36 0,40 0,55 -2,00 -2,57 -0,15 -0,78 1,85 1,79 0,0125 D02 hsa-miR-186 32,53 39,90 38,05 44,86 36,66 29,42 9,44 7,78 0,52 0,40 0,44 0,61 -1,79 -2,36 -0,05 -0,61 1,73 1,75 0,0000 E02 hsa-miR-1245 28,36 34,60 32,62 41,54 25,85 21,14 6,62 5,94 0,41 0,31 0,34 0,50 -2,10 -2,54 -0,34 -0,97 1,76 1,57 0,3964 F02 hsa-miR-122 36,25 47,02 39,96 56,17 35,18 35,62 5,57 5,14 0,50 0,38 0,44 0,58 -2,70 -3,19 -0,18 -0,66 2,52 2,54 0,0000 G02 hsa-miR-513a-5p 32,56 42,22 38,06 49,40 31,58 27,30 7,38 6,89 0,53 0,37 0,43 0,60 -2,14 -2,61 -0,27 -0,86 1,87 1,76 0,1430 H02 hsa-miR-526b 27,71 35,61 32,90 40,89 20,81 15,44 3,15 3,74 0,34 0,26 0,33 0,37 -3,14 -3,25 -0,66 -1,41 2,48 1,84 0,4678 A03 hsa-miR-191* 27,98 37,33 38,24 38,24 29,65 24,47 7,40 7,41 0,58 0,37 0,60 0,65 -1,92 -2,33 -0,37 -0,64 1,55 1,69 0,3360 B03 hsa-miR-135b* 30,17 34,89 32,25 39,71 31,80 28,78 16,66 11,20 0,40 0,36 0,35 0,48 -0,86 -1,64 -0,02 -0,46 0,84 1,18 0,5071 C03 hsa-miR-99b 31,77 37,39 32,28 40,36 27,09 23,90 11,24 7,52 0,50 0,42 0,39 0,57 -1,50 -2,31 -0,25 -0,76 1,25 1,56 0,8491 D03 hsa-miR-103 34,50 44,81 36,51 46,58 35,74 32,63 12,29 11,60 0,52 0,36 0,35 0,51 -1,49 -1,95 -0,03 -0,51 1,46 1,44 0,0259 E03 hsa-miR-579 30,47 38,12 33,51 41,69 28,38 22,97 4,69 4,06 0,34 0,26 0,26 0,36 -2,70 -3,23 -0,24 -0,86 2,46 2,37 0,0124 F03 hsa-miR-200b* 27,25 37,38 31,33 42,41 26,62 28,22 5,93 5,67 0,45 0,28 0,33 0,45 -2,20 -2,72 -0,24 -0,59 1,97 2,13 0,2146 G03 hsa-miR-574-3p 33,68 44,95 36,84 49,99 30,03 28,18 9,20 7,40 0,56 0,38 0,43 0,56 -1,87 -2,60 -0,30 -0,83 1,58 1,78 0,3932 H03 hsa-miR-29a* 31,85 41,92 36,38 46,59 32,23 30,73 10,57 9,56 0,62 0,44 0,52 0,70 -1,59 -2,13 -0,17 -0,60 1,42 1,53 0,4534 A04 hsa-miR-1304 28,38 34,18 31,21 37,11 31,47 28,90 7,00 6,30 0,43 0,33 0,36 0,50 -2,02 -2,44 0,01 -0,36 2,03 2,08 0,0000 B04 hsa-miR-342-3p 33,74 42,72 38,61 50,40 39,66 37,05 9,73 7,84 0,58 0,48 0,54 0,74 -1,79 -2,45 0,04 -0,44 1,83 2,00 0,2503 C04 hsa-miR-1914* 32,75 41,89 34,95 46,76 33,45 31,79 8,61 8,27 0,57 0,41 0,44 0,63 -1,93 -2,34 -0,06 -0,56 1,86 1,78 0,0358 D04 hsa-miR-1182 33,31 45,79 34,52 48,10 31,06 33,69 11,54 11,40 0,64 0,44 0,38 0,68 -1,53 -2,01 -0,15 -0,51 1,38 1,49 0,5411 E04 hsa-miR-765 26,23 32,60 27,65 34,61 13,73 13,69 3,65 3,75 0,37 0,27 0,26 0,39 -2,85 -3,12 -1,01 -1,34 1,84 1,78 0,0008 F04 hsa-miR-566 36,01 44,71 34,35 53,08 28,47 28,72 9,64 7,93 0,57 0,44 0,34 0,70 -1,90 -2,50 -0,27 -0,89 1,63 1,61 0,0000 G04 hsa-miR-548l 32,83 39,31 31,90 45,95 30,07 32,51 10,84 8,85 0,50 0,37 0,35 0,57 -1,60 -2,15 -0,09 -0,50 1,51 1,65 0,3560 H04 hsa-miR-1975 34,73 45,01 34,19 49,03 19,67 23,09 7,91 7,67 0,71 0,50 0,45 0,80 -2,13 -2,55 -0,80 -1,09 1,34 1,47 0,6990 A05 hsa-miR-1279 34,65 39,98 44,59 42,86 41,53 31,40 10,15 7,79 0,54 0,47 0,67 0,73 -1,77 -2,36 -0,10 -0,45 1,67 1,91 0,3799 B05 hsa-miR-2110 26,16 30,11 34,10 37,93 19,51 16,66 3,39 3,29 0,30 0,26 0,37 0,41 -2,95 -3,19 -0,81 -1,19 2,14 2,01 0,1403 C05 hsa-miR-597 28,83 31,55 29,89 36,84 26,94 28,27 5,09 4,34 0,38 0,33 0,31 0,46 -2,50 -2,86 -0,15 -0,38 2,35 2,48 0,0765 D05 hsa-miR-152 32,60 42,64 34,87 46,88 22,69 17,70 9,31 8,14 0,64 0,42 0,47 0,73 -1,81 -2,39 -0,62 -1,41 1,19 0,98 0,4524 E05 hsa-miR-1269 33,61 41,27 30,69 46,01 24,22 28,61 7,00 6,28 0,44 0,34 0,29 0,50 -2,26 -2,72 -0,34 -0,69 1,92 2,03 0,0876 F05 hsa-miR-7-2* 29,87 33,78 29,38 40,20 21,47 21,00 7,38 6,42 0,55 0,42 0,39 0,62 -2,02 -2,40 -0,45 -0,94 1,57 1,46 0,3560 G05 hsa-miR-103-as 30,76 32,75 27,31 37,28 26,23 27,47 9,09 7,46 0,32 0,29 0,23 0,33 -1,76 -2,13 -0,06 -0,44 1,70 1,69 0,0000 H05 hsa-miR-1208 33,30 40,29 34,45 46,47 27,85 26,10 6,44 5,79 0,49 0,40 0,42 0,56 -2,37 -2,80 -0,31 -0,83 2,06 1,97 0,0562 A06 hsa-miR-920 37,15 41,20 41,53 47,14 29,37 26,70 8,78 6,33 0,50 0,46 0,50 0,66 -2,08 -2,70 -0,50 -0,82 1,58 1,88 0,4612 B06 hsa-let-7a-2* 29,03 34,68 31,27 42,15 24,96 25,89 4,51 4,80 0,35 0,32 0,31 0,47 -2,69 -2,85 -0,33 -0,70 2,36 2,15 0,2311 C06 hsa-miR-100* 36,13 41,54 33,18 48,76 28,13 33,96 11,03 8,84 0,57 0,50 0,38 0,68 -1,71 -2,23 -0,24 -0,52 1,47 1,71 0,4912 D06 hsa-miR-432 39,67 50,15 38,49 55,73 34,69 30,89 11,84 9,62 0,48 0,38 0,35 0,52 -1,74 -2,38 -0,15 -0,85 1,60 1,53 0,0719 E06 hsa-miR-182* 28,91 33,92 27,83 36,19 19,48 20,03 5,20 4,94 0,38 0,32 0,31 0,44 -2,48 -2,78 -0,51 -0,85 1,96 1,92 0,0000 F06 hsa-miR-1229 35,37 40,19 33,08 45,75 27,46 31,83 8,36 7,02 0,54 0,44 0,37 0,59 -2,08 -2,52 -0,27 -0,52 1,81 1,99 0,2773 G06 hsa-miR-1259 37,38 42,67 36,02 47,46 32,70 27,22 8,40 5,89 0,42 0,41 0,36 0,51 -2,15 -2,86 -0,14 -0,80 2,02 2,05 0,0000 H06 hsa-miR-373* 34,20 39,60 38,47 48,33 29,54 27,44 9,49 7,69 0,57 0,46 0,59 0,75 -1,85 -2,36 -0,38 -0,82 1,47 1,55 0,2311 plate 7 plate A07 hsa-miR-550 30,65 35,95 34,38 38,73 26,40 22,06 7,02 6,36 0,49 0,39 0,48 0,59 -2,13 -2,50 -0,38 -0,81 1,74 1,69 0,0038 B07 hsa-miR-657 29,47 36,79 35,22 41,77 37,02 31,32 6,73 6,80 0,51 0,38 0,49 0,59 -2,13 -2,44 0,07 -0,42 2,20 2,02 0,2160 C07 hsa-miR-891b 24,64 28,71 28,11 31,89 22,82 19,21 6,13 6,04 0,34 0,28 0,33 0,40 -2,01 -2,25 -0,30 -0,73 1,71 1,52 0,4209 D07 hsa-miR-199a-3p 32,37 40,38 35,58 45,16 27,93 26,74 7,87 7,39 0,53 0,43 0,43 0,65 -2,04 -2,45 -0,35 -0,76 1,69 1,69 0,0000 E07 hsa-miR-1180 29,49 33,91 30,46 37,51 24,60 23,31 7,65 6,88 0,33 0,29 0,28 0,45 -1,95 -2,30 -0,31 -0,69 1,64 1,62 0,0000 F07 hsa-miR-632 29,57 34,79 33,09 40,24 33,76 31,18 4,79 4,59 0,33 0,26 0,30 0,41 -2,62 -2,92 0,03 -0,37 2,65 2,56 0,0190 G07 hsa-miR-93 33,54 41,78 33,06 44,22 20,41 14,04 6,33 5,71 0,49 0,38 0,34 0,54 -2,40 -2,87 -0,70 -1,65 1,71 1,22 0,8066 H07 hsa-miR-509-3p 32,19 35,60 30,30 40,69 25,12 26,11 5,16 4,56 0,41 0,37 0,30 0,43 -2,64 -2,97 -0,27 -0,64 2,37 2,33 0,0000 A08 hsa-miR-205* 26,16 23,95 31,21 28,45 26,17 18,90 6,57 4,73 0,29 0,31 0,43 0,45 -1,99 -2,34 -0,25 -0,59 1,74 1,75 0,0000 B08 hsa-miR-124* 24,05 26,05 30,79 34,67 29,27 21,99 5,10 5,41 0,32 0,30 0,42 0,49 -2,24 -2,27 -0,07 -0,66 2,16 1,61 0,5143 C08 hsa-miR-609 27,96 37,57 33,88 41,86 28,42 23,14 5,14 5,61 0,35 0,24 0,33 0,39 -2,44 -2,74 -0,25 -0,86 2,19 1,89 0,3494 D08 hsa-miR-491-5p 27,56 31,73 30,80 38,45 18,90 16,86 3,91 4,10 0,34 0,30 0,35 0,43 -2,82 -2,95 -0,70 -1,19 2,11 1,76 0,4065 E08 hsa-miR-369-5p 33,98 41,81 34,08 48,62 30,17 29,16 6,89 6,61 0,44 0,38 0,37 0,55 -2,30 -2,66 -0,18 -0,74 2,13 1,92 0,2706 F08 hsa-miR-330-5p 28,96 34,06 33,96 41,04 21,78 16,37 5,46 5,35 0,33 0,29 0,33 0,42 -2,41 -2,67 -0,64 -1,33 1,77 1,34 0,6730 G08 hsa-miR-1281 32,89 40,84 32,29 48,60 21,66 20,74 7,30 6,85 0,48 0,37 0,34 0,58 -2,17 -2,58 -0,58 -1,23 1,59 1,35 0,6666 H08 hsa-miR-140-5p 32,20 36,32 35,70 41,72 30,24 28,18 7,36 6,40 0,39 0,36 0,39 0,45 -2,13 -2,50 -0,24 -0,57 1,89 1,94 0,0001 A09 hsa-miR-23b 36,43 36,62 36,00 42,26 29,85 23,72 10,50 6,94 0,51 0,51 0,52 0,64 -1,79 -2,40 -0,27 -0,83 1,52 1,57 0,0041 B09 hsa-miR-524-5p 32,63 40,42 37,51 45,21 39,36 31,20 8,17 7,75 0,47 0,40 0,43 0,54 -2,00 -2,38 0,07 -0,54 2,07 1,85 0,3209 C09 hsa-miR-516b 30,85 40,56 33,12 47,24 24,76 20,59 5,52 5,83 0,38 0,29 0,32 0,43 -2,48 -2,80 -0,42 -1,20 2,06 1,60 0,4986 D09 hsa-miR-29b-2* 30,16 37,00 34,58 46,32 31,54 32,92 5,09 5,63 0,35 0,28 0,33 0,44 -2,57 -2,72 -0,13 -0,49 2,43 2,22 0,2160 E09 hsa-miR-654-3p 30,24 33,23 28,96 38,72 34,41 35,10 7,23 6,03 0,26 0,28 0,26 0,32 -2,06 -2,46 0,25 -0,14 2,31 2,32 0,0000 F09 hsa-miR-614 30,88 34,84 31,77 43,17 29,52 25,64 10,39 8,21 0,43 0,40 0,39 0,57 -1,57 -2,08 -0,11 -0,75 1,46 1,33 0,7143 G09 hsa-miR-596 28,40 34,95 29,00 42,11 26,92 25,04 6,62 6,70 0,45 0,35 0,33 0,52 -2,10 -2,38 -0,11 -0,75 1,99 1,63 0,4641 H09 hsa-miR-641 34,14 38,03 34,45 47,91 33,67 30,77 8,64 6,79 0,49 0,47 0,43 0,71 -1,98 -2,49 -0,03 -0,64 1,95 1,85 0,0876 A10 hsa-miR-202 30,66 37,68 35,75 40,64 33,97 25,34 7,09 7,14 0,50 0,34 0,45 0,57 -2,11 -2,40 -0,07 -0,68 2,04 1,72 0,4090 B10 hsa-miR-127-3p 33,76 38,25 36,06 43,76 29,88 24,22 6,93 6,27 0,44 0,39 0,46 0,50 -2,28 -2,61 -0,27 -0,85 2,01 1,75 0,3560 C10 hsa-miR-542-3p 24,71 25,09 26,65 30,74 23,78 21,60 6,01 5,07 0,24 0,24 0,23 0,30 -2,04 -2,31 -0,16 -0,51 1,88 1,80 0,0301 D10 hsa-let-7f-2* 29,72 37,19 33,45 43,71 25,99 21,99 5,85 5,68 0,44 0,36 0,42 0,54 -2,34 -2,71 -0,36 -0,99 1,98 1,72 0,3751 E10 hsa-miR-105* 33,90 42,53 37,66 51,69 38,48 35,72 7,30 7,03 0,45 0,39 0,40 0,58 -2,21 -2,60 0,03 -0,53 2,25 2,06 0,2146 F10 hsa-miR-518e 34,07 43,58 37,63 49,81 28,55 21,67 7,64 7,72 0,53 0,42 0,52 0,60 -2,16 -2,50 -0,40 -1,20 1,76 1,30 0,7189 G10 hsa-miR-101* 25,72 27,49 25,12 38,30 16,51 14,88 4,34 4,14 0,30 0,26 0,22 0,37 -2,57 -2,73 -0,61 -1,36 1,96 1,37 0,6620 H10 hsa-miR-224* 29,91 34,91 28,90 41,05 24,74 20,77 5,57 5,85 0,39 0,37 0,31 0,50 -2,42 -2,58 -0,22 -0,98 2,20 1,59 0,5297 A11 hsa-miR-187* 34,85 43,16 32,67 42,20 29,82 26,26 7,37 8,51 0,63 0,45 0,44 0,61 -2,24 -2,34 -0,13 -0,68 2,11 1,66 0,4823 B11 hsa-miR-21* 32,07 39,67 36,06 43,68 24,16 18,13 7,22 7,70 0,52 0,36 0,44 0,63 -2,15 -2,37 -0,58 -1,27 1,57 1,10 0,9831 C11 hsa-miR-1911 32,79 40,05 32,79 46,82 35,14 33,93 8,52 7,69 0,48 0,39 0,37 0,60 -1,94 -2,38 0,10 -0,46 2,04 1,92 0,1386 D11 hsa-miR-302c* 26,91 37,28 32,24 38,69 29,23 21,31 6,60 8,40 0,58 0,36 0,50 0,57 -2,03 -2,15 -0,14 -0,86 1,89 1,29 0,7143 E11 hsa-miR-1246 35,01 49,01 40,18 52,49 33,12 28,98 6,03 6,90 0,55 0,38 0,42 0,51 -2,54 -2,83 -0,28 -0,86 2,26 1,97 0,3301 F11 hsa-miR-432* 26,64 30,01 28,15 31,28 23,13 16,71 4,59 5,06 0,32 0,27 0,27 0,32 -2,54 -2,57 -0,28 -0,90 2,25 1,66 0,5044 G11 hsa-miR-200b 30,42 36,74 28,89 41,71 20,24 16,76 5,35 5,99 0,53 0,39 0,32 0,56 -2,51 -2,62 -0,51 -1,32 1,99 1,30 0,7037 H11 hsa-miR-1910 36,10 41,18 32,88 50,38 31,51 29,04 7,67 7,90 0,43 0,42 0,34 0,58 -2,23 -2,38 -0,06 -0,79 2,17 1,59 0,5290 119

120

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval C12 miR-Control 32,22 39,20 34,17 42,40 30,13 23,95 7,69 7,59 0,57 0,42 0,41 0,54 -2,07 -2,37 -0,18 -0,82 1,89 1,54 0,4908 D12 miR-149 29,05 32,91 29,59 35,24 27,22 19,30 8,85 7,93 0,46 0,38 0,35 0,44 -1,71 -2,05 -0,12 -0,87 1,59 1,18 0,9138 E12 siLacZ 30,29 36,59 31,63 41,48 30,07 23,94 7,81 7,89 0,61 0,43 0,43 0,54 -1,96 -2,21 -0,07 -0,79 1,88 1,42 0,6053 plate 7 plate F12 siErbB2 25,53 33,46 29,26 34,28 17,77 11,89 4,46 4,98 0,36 0,27 0,32 0,37 -2,52 -2,75 -0,72 -1,53 1,80 1,22 0,7814 G12 siErbB3 31,72 37,17 30,38 44,53 19,96 17,01 6,83 6,10 0,40 0,37 0,31 0,44 -2,22 -2,61 -0,61 -1,39 1,61 1,22 0,8558 B01 miR-Control 31,42 35,05 38,47 41,73 21,27 26,57 8,43 6,72 1,11 1,00 1,36 1,22 -1,90 -2,38 -0,85 -0,65 1,04 1,73 0,9529 C01 miR-149 37,78 30,58 36,14 33,69 21,86 17,13 11,22 6,77 1,26 0,89 1,10 0,91 -1,75 -2,18 -0,73 -0,98 1,03 1,20 0,4311 D01 siLacZ 39,50 33,01 37,19 43,94 25,27 23,21 11,16 7,08 1,41 1,25 1,29 1,48 -1,82 -2,22 -0,56 -0,92 1,27 1,30 0,3218 E01 siErbB2 32,11 28,67 28,92 37,43 5,63 8,39 3,94 2,93 1,05 0,78 0,87 1,08 -3,03 -3,29 -2,36 -2,16 0,67 1,13 0,5165 F01 siErbB3 37,88 35,45 32,98 39,51 10,58 13,09 6,03 4,86 1,04 0,92 0,90 0,82 -2,65 -2,87 -1,64 -1,59 1,01 1,27 0,5575 A02 hsa-miR-377 37,85 31,94 35,71 33,98 22,74 24,28 8,26 5,64 1,37 0,85 1,19 0,70 -2,20 -2,50 -0,65 -0,49 1,54 2,02 0,5261 B02 hsa-miR-1294 39,67 21,83 24,12 22,90 14,39 14,46 4,45 4,43 1,49 0,77 0,98 0,66 -3,15 -2,30 -0,75 -0,66 2,41 1,64 0,5399 C02 hsa-miR-1307 37,27 31,32 33,51 36,45 25,49 25,94 6,07 4,06 1,02 0,70 0,83 0,69 -2,62 -2,95 -0,39 -0,49 2,22 2,46 0,2374 D02 hsa-miR-361-3p 41,45 36,86 39,40 42,83 25,69 27,12 14,16 9,23 1,34 1,06 1,18 1,09 -1,55 -2,00 -0,62 -0,66 0,93 1,34 0,6655 E02 hsa-miR-299-5p 35,22 36,58 34,09 41,27 11,94 14,90 8,24 6,42 1,33 1,10 1,22 1,18 -2,09 -2,51 -1,51 -1,47 0,58 1,04 0,4847 F02 hsa-miR-196b 27,96 29,80 29,28 32,46 26,36 27,47 6,20 4,94 0,83 0,73 0,74 0,62 -2,17 -2,59 -0,15 -0,24 2,02 2,35 0,3363 G02 hsa-miR-558 36,19 40,33 37,68 43,31 32,39 30,44 7,23 6,57 0,73 0,75 0,82 0,66 -2,32 -2,62 -0,22 -0,51 2,10 2,11 0,0000 H02 hsa-miR-449b* 36,95 13,72 38,50 43,72 39,26 34,09 15,93 1,71 1,21 1,16 1,25 1,17 -1,21 -3,01 0,03 -0,36 1,24 2,65 0,7092 A03 hsa-miR-1287 35,66 29,15 32,24 30,92 20,15 18,38 5,33 2,90 1,11 0,69 0,93 0,65 -2,74 -3,33 -0,68 -0,75 2,06 2,58 0,3932 B03 hsa-miR-608 35,81 33,35 36,13 35,09 28,82 24,54 4,24 2,77 0,96 0,67 0,87 0,59 -3,08 -3,59 -0,33 -0,52 2,75 3,08 0,2323 C03 hsa-miR-892a 31,46 30,23 30,21 34,23 24,70 26,91 7,79 5,96 1,07 0,91 1,08 0,99 -2,01 -2,34 -0,29 -0,35 1,72 2,00 0,3799 D03 hsa-miR-548h 36,08 32,72 34,67 35,88 27,00 24,05 12,61 9,26 1,29 0,99 1,20 1,03 -1,52 -1,82 -0,36 -0,58 1,16 1,24 0,3261 E03 hsa-miR-134 26,58 26,84 26,44 29,15 16,69 16,91 6,09 4,65 0,82 0,74 0,81 0,73 -2,13 -2,53 -0,66 -0,79 1,46 1,74 0,5215 F03 hsa-miR-22 28,96 28,89 27,13 33,15 19,36 21,90 10,01 7,16 0,86 0,69 0,85 0,66 -1,53 -2,01 -0,49 -0,60 1,05 1,42 0,7583 G03 hsa-miR-660 38,31 34,86 33,42 40,66 26,38 26,77 9,09 6,44 1,12 0,84 0,90 0,79 -2,08 -2,44 -0,34 -0,60 1,73 1,83 0,1109 H03 hsa-miR-501-3p 36,13 31,24 28,83 40,12 25,49 29,82 8,76 6,03 1,24 0,82 0,78 0,98 -2,04 -2,37 -0,18 -0,43 1,87 1,95 0,0233 A04 hsa-miR-30c-1* 34,85 29,60 30,19 26,19 9,47 8,95 7,03 4,66 1,11 0,77 0,86 0,50 -2,31 -2,67 -1,67 -1,55 0,64 1,12 0,5143 B04 hsa-miR-374b* 40,70 35,03 37,66 35,87 29,55 24,31 9,56 6,45 1,08 0,81 1,00 0,71 -2,09 -2,44 -0,35 -0,56 1,74 1,88 0,2274 C04 hsa-miR-200a 41,63 44,02 40,28 49,95 26,57 26,30 12,83 11,69 1,42 1,45 1,31 1,88 -1,70 -1,91 -0,60 -0,93 1,10 0,99 0,2287 D04 hsa-miR-138 46,33 46,27 39,49 54,51 24,87 27,84 7,68 6,69 1,11 1,28 0,94 1,40 -2,59 -2,79 -0,67 -0,97 1,93 1,82 0,1031 E04 hsa-miR-545* 39,34 40,90 36,42 47,94 30,46 31,96 10,37 8,53 1,55 1,31 1,42 1,57 -1,92 -2,26 -0,26 -0,59 1,67 1,68 0,0000 F04 hsa-miR-203 40,17 34,08 35,87 36,12 25,92 21,18 7,23 5,22 1,24 0,99 1,24 0,81 -2,47 -2,71 -0,47 -0,77 2,00 1,94 0,0061 G04 hsa-miR-612 35,65 35,52 32,46 36,13 26,03 22,41 8,58 7,16 1,12 0,93 0,89 0,68 -2,05 -2,31 -0,32 -0,69 1,74 1,62 0,2274 H04 hsa-miR-767-3p 42,73 40,54 37,55 48,14 18,97 19,19 8,65 8,22 1,20 1,16 1,35 1,32 -2,30 -2,30 -0,98 -1,33 1,32 0,97 0,6408 A05 hsa-miR-422a 42,04 40,91 41,36 42,82 35,68 34,76 10,83 6,84 1,41 1,13 1,21 1,02 -1,96 -2,58 -0,21 -0,30 1,74 2,28 0,4753 B05 hsa-miR-27b* 40,44 40,31 41,37 41,33 25,15 23,53 9,37 6,71 1,37 1,17 1,30 0,90 -2,11 -2,59 -0,72 -0,81 1,39 1,77 0,6248 C05 hsa-miR-523 35,71 39,88 35,63 41,59 24,08 25,51 9,64 8,61 1,49 1,49 1,36 1,42 -1,89 -2,21 -0,57 -0,71 1,32 1,51 0,7189 D05 hsa-miR-548a-5p 35,10 38,40 36,82 45,24 35,00 33,01 13,76 10,56 1,66 1,38 1,41 1,80 -1,35 -1,86 -0,07 -0,45 1,28 1,41 0,9821 E05 hsa-miR-200a* 33,25 36,69 30,47 38,95 29,96 26,98 9,20 7,04 1,12 1,04 0,93 0,94 -1,85 -2,38 -0,02 -0,53 1,83 1,85 0,0000 F05 hsa-miR-29b 33,26 30,92 27,74 40,67 20,38 26,55 9,48 6,74 1,09 0,82 0,93 0,96 -1,81 -2,20 -0,44 -0,62 1,37 1,58 0,6278 G05 hsa-miR-155 32,34 30,66 28,25 36,56 14,46 15,40 9,88 7,25 1,01 0,82 0,77 0,85 -1,71 -2,08 -0,97 -1,25 0,75 0,83 0,0428 H05 hsa-miR-452 36,18 36,04 32,87 43,95 24,16 21,59 7,50 5,06 1,44 1,17 1,20 1,33 -2,27 -2,83 -0,44 -1,03 1,83 1,81 0,0000 A06 hsa-miR-451 34,45 31,20 33,49 34,02 16,28 14,51 7,94 5,18 1,75 1,26 1,57 1,38 -2,12 -2,59 -1,04 -1,23 1,08 1,36 0,6978

B06 hsa-miR-634 24,83 26,76 27,53 26,02 19,57 13,71 3,84 2,66 0,59 0,56 0,74 0,39 -2,69 -3,33 -0,49 -0,92 2,20 2,41 0,2158 plate 8 plate C06 hsa-miR-1265 37,53 38,88 39,06 42,85 36,16 30,40 13,64 9,88 1,28 1,01 1,43 1,27 -1,46 -1,98 -0,11 -0,50 1,35 1,48 0,6615 D06 hsa-miR-591 33,43 33,03 33,68 39,06 18,54 14,28 10,00 4,30 1,19 0,84 1,13 1,05 -1,74 -2,94 -0,86 -1,45 0,88 1,49 0,7873 E06 hsa-miR-875-3p 42,52 40,05 39,45 46,60 25,51 23,24 9,55 6,14 1,48 1,09 1,45 1,39 -2,15 -2,71 -0,63 -1,00 1,53 1,70 0,4034 F06 hsa-miR-588 39,98 36,73 39,64 47,42 19,83 17,83 9,36 7,13 1,42 1,10 1,35 1,37 -2,09 -2,36 -1,00 -1,41 1,10 0,95 0,3217 G06 hsa-miR-219-1-3p 34,85 35,07 34,60 42,75 29,17 23,09 7,37 4,88 0,86 0,67 0,82 0,76 -2,24 -2,85 -0,25 -0,89 1,99 1,96 0,0000 H06 hsa-miR-208a 31,12 34,10 31,81 38,65 29,04 24,80 8,36 6,76 0,95 0,96 1,02 0,96 -1,90 -2,33 -0,13 -0,64 1,76 1,69 0,0252 A07 hsa-miR-205 39,59 34,19 40,61 37,95 26,91 24,24 9,41 6,10 1,21 0,94 1,19 0,95 -2,07 -2,49 -0,59 -0,65 1,48 1,84 0,5379 B07 hsa-miR-1203 37,92 35,06 36,67 38,72 27,24 30,80 9,85 6,68 1,53 1,08 1,44 1,20 -1,95 -2,39 -0,43 -0,33 1,52 2,06 0,5565 C07 hsa-miR-18b* 36,85 33,01 34,60 38,37 21,71 22,81 10,27 6,72 1,36 0,92 1,28 1,11 -1,84 -2,30 -0,67 -0,75 1,17 1,55 0,9731 D07 hsa-miR-548j 34,80 29,07 35,46 37,79 31,83 25,64 12,30 8,03 1,29 0,83 1,30 1,17 -1,50 -1,86 -0,16 -0,56 1,34 1,30 0,6990 E07 hsa-miR-769-3p 33,29 29,94 33,29 34,35 26,43 21,80 6,86 4,58 0,99 0,74 0,89 0,88 -2,28 -2,71 -0,33 -0,66 1,95 2,05 0,0826 F07 hsa-miR-362-5p 37,18 35,18 36,31 38,82 40,25 34,49 9,78 6,66 1,01 0,88 0,95 0,84 -1,93 -2,40 0,15 -0,17 2,08 2,23 0,1639 G07 hsa-miR-1911* 30,90 32,40 34,76 37,45 27,86 15,77 4,95 3,57 0,86 0,79 0,92 0,73 -2,64 -3,18 -0,32 -1,25 2,32 1,93 0,3770 H07 hsa-let-7a 40,10 37,75 37,13 42,22 27,35 24,77 11,93 9,58 1,14 1,08 1,23 1,04 -1,75 -1,98 -0,44 -0,77 1,31 1,21 0,4986 A08 hsa-miR-767-5p 40,01 33,34 38,74 38,05 16,92 19,82 8,41 6,05 1,34 0,92 1,55 1,00 -2,25 -2,46 -1,20 -0,94 1,05 1,52 0,9008 B08 hsa-miR-936 39,88 34,91 40,21 42,61 22,88 23,70 9,45 6,55 1,61 1,11 1,92 1,42 -2,08 -2,41 -0,81 -0,85 1,26 1,57 0,8151 C08 hsa-miR-372 29,34 28,25 32,01 31,33 7,06 7,46 4,70 3,79 1,12 0,95 1,17 1,06 -2,64 -2,90 -2,18 -2,07 0,46 0,83 0,3851 D08 hsa-miR-548m 37,21 35,75 38,18 40,58 28,14 26,44 8,47 6,75 1,25 1,09 1,46 1,20 -2,13 -2,41 -0,44 -0,62 1,69 1,79 0,1004 E08 hsa-miR-129* 34,50 35,30 33,80 37,45 22,57 23,94 7,35 6,42 1,07 1,06 1,18 0,95 -2,23 -2,46 -0,58 -0,65 1,65 1,81 0,3261 F08 hsa-miR-628-3p 44,30 36,29 40,27 43,79 25,57 25,71 11,22 8,55 1,32 1,05 1,44 1,19 -1,98 -2,09 -0,66 -0,77 1,33 1,32 0,6278 G08 hsa-miR-191 39,98 31,00 37,16 41,44 34,88 33,43 13,48 8,60 1,32 0,89 1,26 1,27 -1,57 -1,85 -0,09 -0,31 1,48 1,54 0,1281 H08 hsa-miR-514 41,62 35,33 38,75 42,75 29,16 26,88 10,45 7,76 1,24 1,07 1,48 1,19 -1,99 -2,19 -0,41 -0,67 1,58 1,52 0,0857 A09 hsa-miR-188-3p 37,84 33,07 35,35 41,57 29,26 28,17 9,01 6,31 1,32 0,87 1,13 1,18 -2,07 -2,39 -0,27 -0,56 1,80 1,83 0,0000 B09 hsa-miR-130a* 37,65 33,15 36,28 41,47 25,68 22,91 8,73 6,18 1,44 1,05 1,26 1,28 -2,11 -2,42 -0,50 -0,86 1,61 1,57 0,0009 C09 hsa-miR-222* 34,67 30,14 31,36 39,36 18,73 18,67 7,77 4,58 1,25 0,87 0,90 1,15 -2,16 -2,72 -0,74 -1,08 1,41 1,64 0,5529 D09 hsa-miR-220c 38,98 34,75 37,74 41,89 24,75 18,85 7,27 4,91 1,11 0,81 0,98 0,93 -2,42 -2,82 -0,61 -1,15 1,81 1,67 0,2685 E09 hsa-miR-1257 37,55 33,16 33,69 37,34 27,12 23,44 8,23 5,66 0,98 0,66 0,78 0,77 -2,19 -2,55 -0,31 -0,67 1,88 1,88 0,0000 F09 hsa-miR-517b 42,72 34,10 35,67 43,09 19,67 19,05 7,88 4,94 1,49 0,96 1,24 1,25 -2,44 -2,79 -0,86 -1,18 1,58 1,61 0,0000 G09 hsa-miR-454* 35,92 30,04 33,98 39,38 31,43 22,64 11,79 7,68 1,29 0,87 1,26 1,08 -1,61 -1,97 -0,11 -0,80 1,49 1,17 0,9656 H09 hsa-miR-221 41,38 49,13 39,40 47,09 30,16 26,33 8,87 9,07 1,37 1,66 1,26 1,21 -2,22 -2,44 -0,39 -0,84 1,84 1,60 0,4101 A10 hsa-miR-643 46,84 39,10 35,81 37,82 18,89 21,87 11,39 10,30 1,77 1,35 1,56 1,05 -2,04 -1,92 -0,92 -0,79 1,12 1,13 0,0000 B10 hsa-miR-639 37,51 33,38 36,74 35,75 30,13 26,96 9,63 8,38 1,84 1,10 1,43 1,05 -1,96 -1,99 -0,29 -0,41 1,68 1,59 0,1419 C10 hsa-miR-103-2* 27,96 23,51 29,96 31,90 17,15 14,21 5,52 2,95 0,96 0,56 0,93 0,96 -2,34 -2,99 -0,80 -1,17 1,54 1,83 0,4823 D10 hsa-miR-548k 37,80 31,44 39,74 41,53 38,02 32,28 10,87 9,03 1,44 0,66 1,26 0,94 -1,80 -1,80 -0,06 -0,36 1,73 1,44 0,5555 E10 hsa-miR-1244 34,77 18,97 32,90 27,49 22,76 13,19 8,90 3,41 1,21 0,32 1,06 0,47 -1,97 -2,47 -0,53 -1,06 1,43 1,41 0,1103 F10 hsa-miR-605 39,63 35,61 38,85 43,75 39,22 35,53 9,24 7,54 1,08 0,77 1,04 0,87 -2,10 -2,24 0,01 -0,30 2,11 1,94 0,2290 G10 hsa-miR-520c-3p 33,40 29,17 32,11 36,30 7,89 8,67 5,46 4,16 1,14 0,96 1,21 1,10 -2,61 -2,81 -2,03 -2,07 0,59 0,74 0,1919 120

121

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval H10 hsa-miR-877* 37,45 38,00 41,61 43,39 32,65 31,17 8,44 8,14 0,92 0,86 1,28 0,87 -2,15 -2,22 -0,35 -0,48 1,80 1,75 0,0013 A11 hsa-miR-346 39,51 36,88 34,01 38,48 30,66 29,40 7,61 5,28 1,14 0,97 1,01 0,83 -2,38 -2,80 -0,15 -0,39 2,23 2,42 0,1903 B11 hsa-miR-937 38,67 34,31 33,91 37,62 28,57 26,77 12,10 7,89 1,63 1,17 1,34 1,13 -1,68 -2,12 -0,25 -0,49 1,43 1,63 0,5143 C11 hsa-miR-30d* 33,79 32,82 30,61 39,36 25,28 30,54 9,87 7,12 1,36 1,00 1,40 1,08 -1,78 -2,20 -0,28 -0,37 1,50 1,84 0,5146 D11 hsa-miR-663 42,15 40,24 38,57 44,15 24,56 22,33 10,84 9,28 1,60 1,32 1,60 1,30 -1,96 -2,12 -0,65 -0,98 1,31 1,13 0,5711 E11 hsa-miR-143* 44,20 38,72 38,25 46,55 20,78 19,05 9,90 6,52 1,48 1,07 1,26 1,17 -2,16 -2,57 -0,88 -1,29 1,28 1,28 0,1739 F11 hsa-miR-26a-1* 43,23 38,06 38,03 45,01 27,46 28,12 13,43 9,25 1,65 1,10 1,36 1,25 -1,69 -2,04 -0,47 -0,68 1,22 1,36 0,7189

G11 hsa-miR-125a-5p 49,68 43,16 42,62 49,76 29,97 34,08 10,89 8,11 1,47 1,15 1,44 1,14 -2,19 -2,41 -0,51 -0,55 1,68 1,87 0,3301 plate 8 plate H11 hsa-miR-339-3p 38,18 33,96 35,96 39,84 24,70 22,85 10,97 7,81 1,22 0,87 1,28 0,96 -1,80 -2,12 -0,54 -0,80 1,26 1,32 0,4823 C12 miR-Control 35,00 30,24 38,65 40,58 21,27 21,60 8,43 5,84 1,46 0,81 1,34 1,05 -2,05 -2,37 -0,86 -0,91 1,19 1,46 0,9472 D12 miR-149 37,45 29,22 31,87 34,31 18,21 16,13 10,55 6,56 1,30 0,77 1,45 0,84 -1,83 -2,16 -0,81 -1,09 1,02 1,07 0,0007 E12 siLacZ 41,51 34,82 38,55 43,53 22,78 24,57 10,04 7,71 1,52 1,00 1,47 1,26 -2,05 -2,18 -0,76 -0,83 1,29 1,35 0,7170 F12 siErbB2 32,97 29,53 31,87 37,86 8,53 9,25 6,62 4,00 1,06 0,75 1,13 0,77 -2,32 -2,88 -1,90 -2,03 0,41 0,85 0,4169 G12 siErbB3 40,21 32,54 39,19 41,75 12,64 13,09 7,97 4,86 1,09 0,72 1,16 0,80 -2,33 -2,74 -1,63 -1,67 0,70 1,07 0,4678 B01 miR-Control 34,80 34,72 40,03 34,98 19,87 18,21 7,56 6,78 0,56 1,01 0,64 1,03 -2,20 -2,36 -1,01 -0,94 1,19 1,41 0,8416 C01 miR-149 31,03 31,94 36,33 32,85 20,30 16,14 8,92 6,64 0,47 0,93 0,52 0,95 -1,80 -2,27 -0,84 -1,03 0,96 1,24 0,5305 D01 siLacZ 34,06 38,00 37,91 37,64 18,70 19,50 9,00 8,81 0,60 1,29 0,70 1,35 -1,92 -2,11 -1,02 -0,95 0,90 1,16 0,4678 E01 siErbB2 30,38 33,83 34,54 33,17 10,90 6,55 4,15 3,79 0,46 1,08 0,49 0,92 -2,87 -3,16 -1,66 -2,34 1,21 0,82 0,5422 F01 siErbB3 34,93 38,23 36,01 36,40 14,05 11,14 5,70 5,42 0,45 0,92 0,43 0,92 -2,62 -2,82 -1,36 -1,71 1,26 1,11 0,4678 A02 hsa-miR-598 35,10 36,11 38,91 34,78 22,18 29,71 11,13 10,41 0,62 1,13 0,58 1,07 -1,66 -1,79 -0,81 -0,23 0,85 1,57 0,8400 B02 hsa-miR-582-3p 33,07 33,10 36,88 33,90 23,89 30,74 7,31 6,02 0,47 0,93 0,49 1,01 -2,18 -2,46 -0,63 -0,14 1,55 2,32 0,5673 C02 hsa-miR-1979 33,02 33,61 36,78 31,61 24,11 23,70 9,88 8,80 0,54 1,06 0,51 0,95 -1,74 -1,93 -0,61 -0,42 1,13 1,52 0,9537 D02 hsa-miR-301a 36,53 40,50 39,12 37,01 17,89 21,06 10,57 8,84 0,64 1,26 0,61 1,15 -1,79 -2,20 -1,13 -0,81 0,66 1,38 0,6985 E02 hsa-let-7i* 26,38 27,40 28,61 24,21 10,39 8,11 5,18 3,86 0,62 1,24 0,52 1,02 -2,35 -2,83 -1,46 -1,58 0,89 1,25 0,5620 F02 hsa-let-7c* 36,81 38,76 38,78 36,65 18,61 20,05 6,17 6,12 0,62 1,09 0,58 1,10 -2,58 -2,66 -1,06 -0,87 1,52 1,79 0,4847 G02 hsa-miR-1288 37,00 40,40 36,02 35,15 20,78 26,97 10,12 7,67 0,52 0,94 0,41 0,75 -1,87 -2,40 -0,79 -0,38 1,08 2,01 0,8270 H02 hsa-miR-720 35,73 43,44 39,12 37,72 19,58 21,75 9,19 9,04 0,69 1,34 0,65 1,18 -1,96 -2,26 -1,00 -0,79 0,96 1,47 0,7919 A03 hsa-miR-181b 33,88 36,95 41,57 32,95 29,25 26,79 8,73 7,06 0,52 1,00 0,59 0,84 -1,96 -2,39 -0,51 -0,30 1,45 2,09 0,6053 B03 hsa-miR-1207-3p 38,01 42,54 43,09 35,40 19,19 21,13 10,75 8,42 0,45 0,91 0,56 0,76 -1,82 -2,34 -1,17 -0,74 0,66 1,59 0,8066 C03 hsa-miR-624* 30,95 35,46 32,69 26,24 13,22 11,55 6,34 5,89 0,45 1,11 0,44 0,64 -2,29 -2,59 -1,31 -1,18 0,98 1,41 0,7305 D03 hsa-miR-196b* 29,78 33,24 33,82 28,90 19,91 18,78 8,16 6,64 0,55 1,10 0,55 0,88 -1,87 -2,32 -0,76 -0,62 1,10 1,70 0,9243 E03 hsa-miR-28-3p 29,29 34,94 37,63 28,31 15,65 15,73 5,00 4,57 0,42 0,95 0,52 0,69 -2,55 -2,93 -1,27 -0,85 1,29 2,09 0,7092 F03 hsa-miR-646 24,22 26,62 26,56 24,06 16,76 15,82 3,80 3,53 0,23 0,46 0,25 0,41 -2,67 -2,91 -0,66 -0,60 2,01 2,31 0,3301 G03 hsa-miR-126 29,13 28,54 33,98 22,80 15,81 8,50 5,53 4,47 0,45 0,85 0,52 0,50 -2,40 -2,67 -1,10 -1,42 1,29 1,25 0,3007 H03 hsa-miR-642 33,27 38,69 35,57 34,30 25,62 26,25 13,80 13,08 0,73 1,38 0,66 1,21 -1,27 -1,56 -0,47 -0,39 0,80 1,18 0,5196 A04 hsa-miR-1249 34,44 35,98 38,03 31,13 18,51 20,53 9,08 8,11 0,66 1,40 0,64 1,14 -1,92 -2,15 -1,04 -0,60 0,89 1,55 0,8399 B04 hsa-miR-329 34,32 38,50 35,14 32,52 16,86 18,64 9,17 7,25 0,52 1,13 0,43 0,89 -1,90 -2,41 -1,06 -0,80 0,85 1,61 0,8719 C04 hsa-miR-7 31,83 34,41 33,25 29,70 14,24 14,77 3,72 3,20 0,42 0,87 0,38 0,64 -3,10 -3,43 -1,22 -1,01 1,87 2,42 0,4375 D04 hsa-miR-31* 37,79 44,09 38,89 36,16 19,89 17,28 6,73 5,61 0,54 1,18 0,45 0,86 -2,49 -2,97 -0,97 -1,07 1,52 1,91 0,5146 E04 hsa-miR-577 37,74 45,17 39,18 34,35 24,99 25,52 12,41 10,10 0,73 1,47 0,55 1,04 -1,60 -2,16 -0,65 -0,43 0,96 1,73 0,9993 F04 hsa-miR-376c 36,22 42,26 38,35 34,48 20,96 23,29 11,21 9,90 0,61 1,10 0,49 0,96 -1,69 -2,09 -0,87 -0,57 0,82 1,53 0,8026 G04 hsa-miR-30b 34,64 41,96 36,74 36,48 13,85 15,15 8,95 8,90 0,62 1,34 0,57 1,14 -1,95 -2,24 -1,41 -1,27 0,55 0,97 0,4509 H04 hsa-miR-1255a 30,36 33,06 31,10 32,32 14,00 12,51 7,04 5,16 0,62 1,10 0,52 1,17 -2,11 -2,68 -1,15 -1,37 0,96 1,31 0,6278 A05 hsa-let-7f 34,56 39,18 38,04 32,61 21,03 20,11 9,21 9,20 0,50 1,21 0,48 0,85 -1,91 -2,09 -0,85 -0,70 1,05 1,39 0,7285 B05 hsa-miR-30c-2* 26,08 28,73 27,71 27,00 9,63 9,90 4,87 4,65 0,34 0,76 0,33 0,67 -2,42 -2,63 -1,52 -1,45 0,90 1,18 0,4889 C05 hsa-miR-374a 31,12 33,49 32,97 26,74 17,81 16,02 9,62 8,34 0,58 1,20 0,56 0,86 -1,69 -2,00 -0,89 -0,74 0,81 1,27 0,6002 D05 hsa-miR-1258 32,95 37,64 34,75 32,65 16,76 19,57 9,60 9,28 0,66 1,36 0,60 1,18 -1,78 -2,02 -1,05 -0,74 0,73 1,28 0,6278 E05 hsa-miR-137 26,48 28,38 30,19 22,05 17,58 12,31 5,20 4,86 0,40 0,89 0,37 0,56 -2,35 -2,54 -0,78 -0,84 1,57 1,70 0,3226 plate 9 plate F05 hsa-miR-219-2-3p 30,99 36,09 32,47 28,32 17,07 13,43 5,64 5,79 0,41 0,75 0,37 0,57 -2,46 -2,64 -0,93 -1,08 1,53 1,56 0,0001 G05 hsa-miR-515-5p 27,46 42,65 38,16 39,68 24,85 29,76 3,19 5,06 0,35 1,11 0,50 0,86 -3,11 -3,07 -0,62 -0,41 2,49 2,66 0,1292 H05 hsa-miR-518d-3p 28,16 38,98 33,31 32,41 16,01 14,28 5,68 7,15 0,38 0,94 0,47 0,77 -2,31 -2,45 -1,06 -1,18 1,25 1,26 0,0477 A06 hsa-miR-1185 31,07 32,75 33,77 27,66 9,47 9,51 4,81 3,69 0,48 0,91 0,41 0,65 -2,69 -3,15 -1,83 -1,54 0,86 1,61 0,8778 B06 hsa-miR-17* 32,90 34,65 36,63 28,76 34,85 23,17 10,04 8,89 0,54 1,11 0,52 0,81 -1,71 -1,96 -0,07 -0,31 1,64 1,65 0,0000 C06 hsa-miR-1302 32,34 36,37 34,83 27,56 18,27 14,68 7,72 7,20 0,47 1,00 0,43 0,59 -2,07 -2,34 -0,93 -0,91 1,14 1,43 0,8197 D06 hsa-miR-223* 32,66 36,86 33,49 30,12 27,76 23,83 6,08 5,41 0,38 0,75 0,35 0,55 -2,43 -2,77 -0,27 -0,34 2,16 2,43 0,2893 E06 hsa-miR-519e 33,20 39,51 36,69 30,37 18,10 16,74 9,49 9,64 0,56 1,17 0,53 0,81 -1,81 -2,03 -1,02 -0,86 0,79 1,17 0,5184 F06 hsa-miR-206 32,71 38,24 35,27 29,15 19,55 17,93 5,03 4,97 0,35 0,76 0,35 0,52 -2,70 -2,94 -0,85 -0,70 1,85 2,24 0,3984 G06 hsa-miR-338-3p 32,22 40,34 34,37 34,48 22,76 21,84 6,80 6,91 0,52 1,15 0,52 0,96 -2,25 -2,54 -0,59 -0,66 1,65 1,89 0,3826 H06 hsa-miR-601 31,39 40,97 34,66 35,46 23,26 20,84 7,20 7,61 0,52 1,12 0,56 0,92 -2,13 -2,43 -0,58 -0,77 1,55 1,66 0,2685 A07 hsa-miR-142-3p 30,45 33,69 34,39 25,59 14,98 12,32 4,43 4,20 0,45 1,01 0,41 0,62 -2,78 -3,01 -1,20 -1,05 1,58 1,95 0,4889 B07 hsa-miR-25 31,60 22,87 37,27 28,67 27,38 23,71 10,26 3,84 0,54 0,53 0,54 0,93 -1,62 -2,58 -0,45 -0,27 1,18 2,30 0,7324 C07 hsa-miR-627 35,07 38,84 37,00 34,42 22,05 24,11 8,53 7,63 0,58 1,16 0,53 0,96 -2,04 -2,35 -0,75 -0,51 1,29 1,84 0,7166 D07 hsa-miR-301b 36,25 43,10 38,66 35,84 17,35 21,57 10,03 9,57 0,66 1,40 0,61 0,97 -1,85 -2,17 -1,16 -0,73 0,70 1,44 0,7231 E07 hsa-miR-768-3p 38,55 47,31 42,13 36,91 19,00 20,25 8,05 7,50 0,63 1,40 0,63 0,95 -2,26 -2,66 -1,15 -0,87 1,11 1,79 0,8758 F07 hsa-miR-1234 32,32 42,12 38,90 32,57 19,97 20,37 9,57 12,47 0,51 1,33 0,55 0,99 -1,76 -1,76 -0,96 -0,68 0,79 1,08 0,4365 G07 hsa-miR-516a-5p 31,43 34,66 33,43 30,66 18,88 16,23 6,30 5,56 0,58 1,05 0,57 0,89 -2,32 -2,64 -0,82 -0,92 1,49 1,72 0,4823 H07 hsa-miR-23a* 34,47 41,63 34,78 33,82 19,10 20,39 9,50 9,38 0,80 1,29 0,71 0,99 -1,86 -2,15 -0,87 -0,73 0,99 1,42 0,7512 A08 hsa-miR-425* 32,39 33,38 37,81 27,80 30,26 21,80 8,70 8,46 0,58 1,13 0,56 0,67 -1,90 -1,98 -0,32 -0,35 1,57 1,63 0,0148 B08 hsa-miR-1282 34,71 36,83 37,66 28,73 17,64 16,02 6,87 6,45 0,56 1,10 0,55 0,65 -2,34 -2,51 -1,09 -0,84 1,24 1,67 0,7919 C08 hsa-miR-328 36,18 38,45 39,95 31,61 17,39 14,34 8,44 6,30 0,70 1,10 0,61 0,82 -2,10 -2,61 -1,20 -1,14 0,90 1,47 0,7813 D08 hsa-miR-106a* 39,29 41,59 40,31 33,53 19,82 19,99 12,56 11,35 0,73 1,09 0,64 0,78 -1,64 -1,87 -1,02 -0,75 0,62 1,13 0,5229 E08 hsa-miR-801 38,66 41,06 40,20 35,46 21,82 21,45 10,25 9,11 0,71 1,14 0,63 0,71 -1,91 -2,17 -0,88 -0,73 1,03 1,45 0,7922 F08 hsa-miR-345 33,93 38,96 37,70 28,36 21,85 16,04 7,12 7,25 0,61 1,21 0,54 0,75 -2,25 -2,43 -0,79 -0,82 1,46 1,60 0,4146 G08 hsa-miR-569 32,65 38,55 35,79 27,26 20,88 16,91 7,82 7,69 0,60 1,11 0,61 0,66 -2,06 -2,33 -0,78 -0,69 1,28 1,64 0,7521 H08 hsa-miR-548e 35,83 44,93 40,24 28,33 22,60 17,73 8,64 10,39 0,65 1,30 0,65 0,59 -2,05 -2,11 -0,83 -0,68 1,22 1,44 0,9321 A09 hsa-miR-216a 35,81 37,45 39,78 31,47 27,87 25,35 11,56 9,66 0,46 0,86 0,51 0,57 -1,63 -1,96 -0,51 -0,31 1,12 1,64 0,9499 B09 hsa-miR-195* 34,88 36,23 39,02 28,89 26,25 22,48 11,20 9,46 0,67 1,19 0,69 0,72 -1,64 -1,94 -0,57 -0,36 1,07 1,58 0,9582 C09 hsa-miR-1322 32,98 36,61 36,56 30,91 12,31 13,47 6,82 5,92 0,44 0,88 0,44 0,72 -2,27 -2,63 -1,57 -1,20 0,70 1,43 0,7189 D09 hsa-miR-671-5p 36,03 41,28 41,48 35,53 13,93 16,97 7,61 6,87 0,64 1,14 0,61 0,87 -2,24 -2,59 -1,57 -1,07 0,67 1,52 0,7728 E09 hsa-miR-892b 35,08 39,92 38,51 33,77 17,10 17,55 4,74 4,13 0,39 0,75 0,76 0,56 -2,89 -3,27 -1,17 -0,94 1,72 2,33 0,4913 F09 hsa-miR-16-1* 29,91 29,33 34,78 26,38 18,56 16,42 6,39 5,33 0,49 0,78 0,60 0,57 -2,23 -2,46 -0,91 -0,68 1,32 1,78 0,6990 121

122

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval G09 hsa-miR-221* 34,67 37,43 24,28 37,64 12,03 19,02 5,66 4,68 0,38 0,68 0,43 0,67 -2,61 -3,00 -1,01 -0,98 1,60 2,02 0,4889 H09 hsa-miR-552 28,40 36,69 33,32 38,13 25,44 28,17 4,68 5,15 0,39 0,74 0,43 0,89 -2,60 -2,83 -0,39 -0,44 2,21 2,40 0,1903 A10 hsa-miR-576-5p 33,22 35,43 37,82 30,45 22,79 21,09 8,49 7,83 0,60 1,18 0,66 0,94 -1,97 -2,18 -0,73 -0,53 1,24 1,65 0,8092 B10 hsa-miR-571 31,64 35,05 35,86 30,32 16,91 15,50 5,56 5,15 0,34 0,71 0,44 0,47 -2,51 -2,77 -1,08 -0,97 1,42 1,80 0,5896 C10 hsa-miR-590-3p 33,36 34,86 35,18 30,69 30,60 24,27 9,04 7,40 0,61 1,00 0,63 0,72 -1,88 -2,24 -0,20 -0,34 1,68 1,90 0,3555 D10 hsa-miR-184 33,58 36,64 35,51 35,47 23,82 22,68 8,97 7,58 0,61 1,15 0,57 1,02 -1,90 -2,27 -0,58 -0,65 1,33 1,63 0,6990 E10 hsa-miR-18b 33,51 32,16 32,35 27,36 23,79 18,31 5,81 4,96 0,47 0,81 0,45 0,58 -2,53 -2,70 -0,44 -0,58 2,08 2,12 0,0000 F10 hsa-miR-744* 30,43 31,93 34,74 26,80 16,54 13,04 7,26 7,00 0,52 0,93 0,57 0,64 -2,07 -2,19 -1,07 -1,04 1,00 1,15 0,3560 G10 hsa-miR-30a* 30,62 30,38 36,40 29,27 27,90 23,42 7,68 6,56 0,63 0,93 0,68 0,75 -1,99 -2,21 -0,38 -0,32 1,61 1,89 0,4334 H10 hsa-miR-380 30,75 35,47 34,22 31,45 27,47 24,31 6,73 6,17 0,56 0,98 0,59 0,71 -2,19 -2,52 -0,32 -0,37 1,87 2,15 0,3376 A11 hsa-miR-214 34,02 34,57 38,23 26,65 21,80 14,69 6,58 4,94 0,44 0,77 0,52 0,65 -2,37 -2,81 -0,81 -0,86 1,56 1,95 0,4986 B11 hsa-let-7g 33,72 36,06 36,94 31,80 24,22 21,26 8,45 8,23 0,52 1,06 0,58 0,78 -2,00 -2,13 -0,61 -0,58 1,39 1,55 0,5574 plate 9 plate C11 hsa-miR-302f 27,38 26,56 27,38 22,67 20,17 15,50 6,27 5,18 0,47 0,68 0,47 0,42 -2,13 -2,36 -0,44 -0,55 1,69 1,81 0,2160 D11 hsa-miR-34a* 30,41 28,52 32,95 25,76 22,97 20,01 6,26 5,18 0,59 0,76 0,53 0,61 -2,28 -2,46 -0,52 -0,36 1,76 2,10 0,4034 E11 hsa-miR-27a 32,70 34,59 34,28 26,66 21,56 16,74 6,87 5,87 0,60 1,05 0,60 0,61 -2,25 -2,56 -0,67 -0,67 1,58 1,89 0,4641 F11 hsa-miR-1247 30,77 34,93 33,30 29,86 22,32 17,91 7,21 7,36 0,66 1,27 0,71 0,89 -2,09 -2,25 -0,58 -0,74 1,52 1,51 0,0000 G11 hsa-miR-1261 28,35 31,31 31,05 26,44 21,16 15,19 5,95 5,40 0,42 0,64 0,42 0,44 -2,25 -2,54 -0,55 -0,80 1,70 1,74 0,0000 H11 hsa-miR-1537 32,60 39,20 35,10 31,98 17,97 18,26 7,92 8,20 0,78 1,36 0,78 0,94 -2,04 -2,26 -0,97 -0,81 1,08 1,45 0,8173 C12 miR-Control 32,70 36,29 36,33 30,51 19,87 17,19 7,56 6,40 0,60 1,03 0,62 0,74 -2,11 -2,50 -0,87 -0,83 1,24 1,68 0,7909 D12 miR-149 29,14 33,11 33,55 28,45 23,25 15,64 8,62 7,39 0,53 0,97 0,61 0,67 -1,76 -2,16 -0,53 -0,86 1,23 1,30 0,4184 E12 siLacZ 33,33 36,87 37,69 30,56 23,82 19,50 8,58 7,58 0,68 1,17 0,79 0,84 -1,96 -2,28 -0,66 -0,65 1,30 1,63 0,7324 F12 siErbB2 29,64 32,81 32,00 29,96 7,95 10,25 4,98 4,37 0,52 0,91 0,57 0,75 -2,57 -2,91 -2,01 -1,55 0,56 1,36 0,6822 G12 siErbB3 32,18 36,76 37,13 33,06 12,12 13,62 5,81 5,42 0,52 0,84 0,61 0,71 -2,47 -2,76 -1,62 -1,28 0,85 1,48 0,7813 B01 miR-Control 38,50 28,93 41,41 33,23 25,10 24,60 10,32 9,42 1,25 0,81 1,22 0,86 -1,90 -1,62 -0,72 -0,43 1,18 1,18 0,0000 C01 miR-149 34,22 27,56 35,55 29,95 22,03 23,21 11,41 10,93 1,08 0,74 1,09 0,78 -1,58 -1,33 -0,69 -0,37 0,89 0,97 0,0249 D01 siLacZ 39,10 30,47 40,92 30,45 23,71 25,92 12,46 11,13 1,35 1,00 1,27 0,88 -1,65 -1,45 -0,79 -0,23 0,86 1,22 0,5422 E01 siErbB2 34,67 27,89 33,47 30,48 6,34 10,71 5,96 7,08 1,10 0,79 1,00 0,84 -2,54 -1,98 -2,40 -1,51 0,14 0,47 0,3162 F01 siErbB3 38,13 28,59 37,53 33,14 11,40 19,02 7,79 7,90 0,99 0,65 0,86 0,79 -2,29 -1,86 -1,72 -0,80 0,57 1,05 0,4908 A02 hsa-miR-760 35,57 27,11 37,96 30,64 22,27 26,19 10,35 9,78 1,15 0,76 1,15 0,62 -1,78 -1,47 -0,77 -0,23 1,01 1,24 0,5143 B02 hsa-miR-212 38,79 29,55 41,73 36,12 25,52 25,34 7,95 7,73 1,20 0,96 1,14 0,98 -2,29 -1,93 -0,71 -0,51 1,58 1,42 0,4889 C02 hsa-miR-26a 33,05 24,72 35,37 30,25 23,53 26,88 10,85 8,60 1,00 0,69 1,16 0,90 -1,61 -1,52 -0,59 -0,17 1,02 1,35 0,6816 D02 hsa-let-7i 37,03 30,08 37,14 32,65 24,46 28,40 11,34 11,86 1,09 0,79 0,95 0,90 -1,71 -1,34 -0,60 -0,20 1,11 1,14 0,0003 E02 hsa-miR-92a 34,52 28,63 37,27 33,93 34,26 43,36 13,66 14,07 1,13 1,03 1,12 1,03 -1,34 -1,02 -0,12 0,35 1,22 1,38 0,7714 F02 hsa-miR-520e 31,36 28,23 32,80 31,02 11,28 11,36 4,41 6,66 1,11 0,82 0,94 1,01 -2,83 -2,08 -1,54 -1,45 1,29 0,63 0,6408 G02 hsa-miR-139-5p 39,64 30,26 39,81 34,26 31,19 37,09 10,21 10,13 1,43 1,13 1,26 1,24 -1,96 -1,58 -0,35 0,11 1,61 1,69 0,1263 H02 hsa-miR-519a 34,38 28,46 34,46 32,57 10,81 14,78 6,04 8,09 1,18 0,91 1,00 1,16 -2,51 -1,81 -1,67 -1,14 0,84 0,68 0,2299 A03 hsa-miR-550* 31,34 28,27 35,04 30,83 29,92 32,83 9,93 10,60 0,69 0,76 0,80 0,63 -1,66 -1,42 -0,23 0,09 1,43 1,51 0,3259 B03 hsa-miR-1225-5p 35,14 28,85 38,04 34,53 29,73 34,40 12,69 11,15 1,10 0,85 1,02 1,10 -1,47 -1,37 -0,36 -0,01 1,11 1,37 0,7092 C03 hsa-miR-193a-5p 32,91 30,35 37,00 35,87 29,93 35,70 6,49 9,04 0,76 0,73 0,85 0,85 -2,34 -1,75 -0,31 -0,01 2,04 1,74 0,3867 D03 hsa-miR-181a* 34,43 30,69 40,44 34,16 27,67 32,36 10,30 10,28 1,03 0,82 1,28 1,05 -1,74 -1,58 -0,55 -0,08 1,19 1,50 0,9995 E03 hsa-miR-922 40,53 32,85 41,62 36,34 33,61 34,24 9,94 9,71 1,12 0,89 1,00 0,94 -2,03 -1,76 -0,31 -0,09 1,72 1,67 0,0003 F03 hsa-miR-890 28,75 28,62 29,71 31,80 16,32 29,28 7,34 9,63 0,59 0,68 0,65 0,76 -1,97 -1,57 -0,86 -0,12 1,10 1,45 0,8400 G03 hsa-miR-564 31,88 31,00 35,70 32,78 19,02 21,15 6,51 9,87 0,85 0,96 0,97 1,01 -2,29 -1,65 -0,91 -0,63 1,38 1,02 0,7162 H03 hsa-miR-1243 32,42 31,79 36,37 31,83 30,73 32,80 7,32 10,25 0,74 0,85 0,95 0,69 -2,15 -1,63 -0,24 0,04 1,90 1,68 0,3610 A04 hsa-miR-1321 33,19 27,27 36,19 30,79 21,53 23,91 5,76 6,81 0,81 0,69 0,84 0,63 -2,53 -2,00 -0,75 -0,37 1,78 1,64 0,2862 B04 hsa-miR-616 35,72 26,31 35,29 30,62 29,16 30,58 7,88 7,42 0,92 0,67 0,82 0,84 -2,18 -1,83 -0,28 0,00 1,90 1,82 0,0301 C04 hsa-miR-1469 36,39 30,14 40,11 33,97 26,62 28,86 9,24 9,95 0,98 0,82 1,06 0,87 -1,98 -1,60 -0,59 -0,24 1,39 1,36 0,5896 D04 hsa-miR-613 39,46 30,48 39,31 33,56 28,10 31,66 7,35 7,79 0,89 0,69 0,79 0,70 -2,42 -1,97 -0,48 -0,08 1,94 1,88 0,0005 E04 hsa-miR-520f 35,02 29,27 36,86 32,89 13,70 18,16 7,43 9,12 1,23 0,83 1,16 1,01 -2,24 -1,68 -1,43 -0,86 0,81 0,83 0,0000 F04 hsa-miR-449b 36,68 31,87 42,09 35,32 40,34 42,45 9,19 10,38 0,65 0,53 0,71 0,67 -2,00 -1,62 -0,06 0,27 1,94 1,88 0,0001 G04 hsa-miR-873 36,08 34,93 38,88 36,24 33,22 35,84 7,60 11,63 0,83 1,01 0,85 1,10 -2,25 -1,59 -0,23 -0,02 2,02 1,57 0,5110 H04 hsa-miR-1179 35,68 31,51 40,54 37,36 27,95 34,76 9,39 11,04 0,89 0,78 0,94 1,02 -1,93 -1,51 -0,54 -0,10 1,39 1,41 0,3363 A05 hsa-miR-1206 35,41 28,15 36,83 31,24 16,40 17,23 6,95 7,93 1,03 0,99 1,10 0,75 -2,35 -1,83 -1,17 -0,86 1,18 0,97 0,4524 plate 10 plate B05 hsa-miR-181a 40,08 27,52 34,40 31,24 27,21 35,13 10,30 8,86 1,06 0,65 0,84 0,79 -1,96 -1,64 -0,34 0,17 1,62 1,80 0,3501 C05 hsa-miR-450b-5p 38,07 29,70 31,71 35,16 13,49 22,52 9,07 8,39 1,07 0,75 0,67 0,94 -2,07 -1,82 -1,23 -0,64 0,84 1,18 0,5131 D05 hsa-miR-148a 34,90 28,98 39,38 33,35 16,12 18,54 10,49 10,69 1,08 0,77 1,23 1,08 -1,73 -1,44 -1,29 -0,85 0,45 0,59 0,1403 E05 hsa-miR-93* 33,70 27,03 36,12 32,53 15,44 22,26 7,97 7,91 0,87 0,58 0,86 0,70 -2,08 -1,77 -1,23 -0,55 0,85 1,23 0,5529 F05 hsa-miR-1471 37,14 31,05 39,86 36,23 30,52 36,28 11,66 11,06 1,14 0,87 1,14 1,11 -1,67 -1,49 -0,39 0,00 1,29 1,49 0,8291 G05 hsa-miR-1264 36,76 33,25 38,08 36,78 35,00 42,68 8,30 10,63 0,82 0,71 0,77 0,92 -2,15 -1,65 -0,12 0,21 2,03 1,86 0,2323 H05 hsa-miR-629 30,98 28,84 33,91 34,46 19,57 26,79 6,27 8,64 0,68 0,64 0,71 0,79 -2,31 -1,74 -0,79 -0,36 1,51 1,38 0,5607 A06 hsa-miR-198 37,15 32,63 35,80 31,95 21,47 22,40 6,25 8,09 1,04 0,95 0,81 0,71 -2,57 -2,01 -0,74 -0,51 1,83 1,50 0,5143 B06 hsa-miR-933 35,57 27,49 34,03 32,75 17,03 19,09 9,53 9,42 1,19 0,89 1,01 0,97 -1,90 -1,55 -1,00 -0,78 0,90 0,77 0,1969 C06 hsa-miR-510 34,03 28,25 34,58 31,89 24,62 32,03 12,20 12,34 0,81 0,66 0,74 0,82 -1,48 -1,20 -0,49 0,01 0,99 1,20 0,4678 D06 hsa-miR-934 32,68 29,99 34,97 31,50 29,33 33,37 5,86 7,90 0,63 0,59 0,63 0,58 -2,48 -1,93 -0,25 0,08 2,23 2,01 0,2685 E06 hsa-miR-183* 38,86 32,50 42,12 34,19 23,53 29,36 11,25 12,89 1,00 0,83 1,04 0,89 -1,79 -1,33 -0,84 -0,22 0,95 1,11 0,3555 F06 hsa-miR-181c* 32,28 27,66 34,39 30,66 11,59 14,61 6,16 6,51 0,87 0,67 0,82 0,73 -2,39 -2,09 -1,57 -1,07 0,82 1,02 0,3390 G06 hsa-miR-1273 45,34 38,24 42,64 38,72 31,42 37,29 11,00 12,87 1,21 1,08 0,94 0,99 -2,04 -1,57 -0,44 -0,05 1,60 1,52 0,2009 H06 hsa-miR-1226* 39,93 31,73 44,69 38,97 31,14 37,06 11,47 10,13 1,34 0,87 1,28 1,13 -1,80 -1,65 -0,52 -0,07 1,28 1,58 0,7858 A07 hsa-miR-943 33,57 28,30 31,66 31,35 24,53 28,03 8,42 9,34 0,91 0,83 0,75 0,86 -1,99 -1,60 -0,37 -0,16 1,63 1,44 0,4986 B07 hsa-miR-2052 32,74 30,96 33,07 31,38 19,53 24,45 6,88 9,14 0,85 1,19 0,94 0,97 -2,25 -1,76 -0,76 -0,36 1,49 1,40 0,4390 C07 hsa-miR-26a-2* 34,97 34,01 40,54 35,12 28,83 32,64 10,27 13,09 1,02 1,06 1,17 1,10 -1,77 -1,38 -0,49 -0,11 1,28 1,27 0,1196 D07 hsa-miR-320d 38,61 34,25 42,32 38,18 29,86 35,27 9,63 11,07 0,88 0,90 0,96 1,02 -2,00 -1,63 -0,50 -0,11 1,50 1,51 0,0000 E07 hsa-miR-515-3p 36,78 33,62 36,93 36,18 21,44 26,09 10,60 11,54 1,26 1,02 1,04 1,16 -1,79 -1,54 -0,78 -0,47 1,01 1,07 0,0156 F07 hsa-miR-192* 31,75 28,75 32,68 32,42 23,85 33,10 8,80 10,04 0,91 0,82 0,81 1,16 -1,85 -1,52 -0,45 0,03 1,40 1,55 0,5290 G07 hsa-miR-570 35,52 31,53 35,22 35,79 34,07 43,78 13,36 14,97 0,89 0,84 0,89 1,17 -1,41 -1,07 -0,05 0,29 1,36 1,36 0,7189 H07 hsa-miR-95 35,35 32,18 42,24 36,41 31,34 30,69 9,20 12,02 0,88 0,90 1,12 1,07 -1,94 -1,42 -0,43 -0,25 1,51 1,17 0,9917 A08 hsa-miR-520a-5p 33,81 27,46 33,21 29,98 24,14 24,41 5,65 5,87 0,74 0,64 0,72 0,62 -2,58 -2,23 -0,46 -0,30 2,12 1,93 0,2565 B08 hsa-miR-543 36,57 32,38 34,55 34,02 23,09 29,52 6,71 7,98 0,82 0,84 0,78 0,79 -2,45 -2,02 -0,58 -0,20 1,86 1,82 0,0001 C08 hsa-miR-1909 36,58 31,30 37,88 30,02 23,95 24,92 8,03 8,26 0,79 0,67 0,81 0,56 -2,19 -1,92 -0,66 -0,27 1,53 1,65 0,3346 D08 hsa-miR-411* 33,86 30,66 35,48 32,04 31,30 38,52 9,38 10,69 0,84 0,83 0,92 0,85 -1,85 -1,52 -0,18 0,27 1,67 1,79 0,1919 E08 hsa-miR-1974 27,86 28,86 31,26 30,68 14,64 20,08 5,55 6,65 0,74 0,74 0,79 0,85 -2,33 -2,12 -1,09 -0,61 1,23 1,51 0,9321

122

123

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval F08 hsa-miR-500* 31,46 28,90 31,20 32,44 23,35 33,04 7,56 7,88 0,70 0,65 0,65 0,82 -2,06 -1,87 -0,42 0,03 1,64 1,90 0,4090 G08 hsa-miR-874 38,56 31,58 34,80 34,99 20,22 24,05 9,21 9,80 0,96 0,83 0,81 1,03 -2,07 -1,69 -0,78 -0,54 1,28 1,15 0,4889 H08 hsa-miR-548d-5p 35,30 31,13 40,07 34,64 26,97 32,36 11,79 13,28 1,09 0,93 1,14 0,92 -1,58 -1,23 -0,57 -0,10 1,01 1,13 0,2893 A09 hsa-miR-133a 33,05 24,90 31,93 32,14 21,37 22,64 7,12 6,40 0,99 0,69 0,82 0,80 -2,22 -1,96 -0,58 -0,51 1,64 1,45 0,4823 B09 hsa-miR-23b* 34,15 30,13 31,44 35,64 17,65 25,52 7,46 9,54 0,67 0,72 0,60 0,87 -2,19 -1,66 -0,83 -0,48 1,36 1,18 0,7101 C09 hsa-miR-186* 38,44 32,88 36,43 37,48 25,52 30,79 10,17 11,27 1,11 0,99 0,98 1,19 -1,92 -1,54 -0,51 -0,28 1,41 1,26 0,9284 D09 hsa-miR-544 31,69 28,28 31,01 32,45 27,41 33,87 8,36 8,16 0,77 0,67 0,68 0,79 -1,92 -1,79 -0,18 0,06 1,74 1,85 0,1402 E09 hsa-miR-127-5p 32,49 28,73 33,16 32,70 17,66 22,32 7,09 7,05 0,61 0,81 0,64 0,69 -2,20 -2,03 -0,91 -0,55 1,29 1,48 0,8426 F09 hsa-miR-33b 30,86 29,88 33,07 37,87 22,55 33,23 9,30 11,59 0,82 0,84 0,89 1,24 -1,73 -1,37 -0,55 -0,19 1,18 1,18 0,0000 G09 hsa-miR-454 37,70 32,46 39,15 39,46 21,27 24,02 11,31 11,67 1,10 0,93 1,08 1,28 -1,74 -1,48 -0,88 -0,72 0,86 0,76 0,0767 H09 hsa-miR-573 35,80 31,35 39,76 38,26 26,79 30,83 7,27 7,65 0,90 0,77 1,01 1,00 -2,30 -2,03 -0,57 -0,31 1,73 1,72 0,0000 A10 hsa-miR-424* 35,64 29,67 33,26 31,64 25,90 27,95 11,05 11,36 1,22 1,00 0,89 0,89 -1,69 -1,38 -0,36 -0,18 1,33 1,21 0,5958 B10 hsa-miR-524-3p 44,88 31,83 38,12 36,88 24,80 30,13 10,51 10,27 1,13 0,88 0,79 0,90 -2,09 -1,63 -0,62 -0,29 1,47 1,34 0,6910 C10 hsa-miR-133b 31,70 29,83 31,66 30,56 21,59 24,82 6,88 8,22 0,87 0,99 0,87 0,92 -2,20 -1,86 -0,55 -0,30 1,65 1,56 0,1919 D10 hsa-miR-942 40,02 33,15 36,82 37,21 24,92 33,69 11,02 12,70 1,07 0,97 0,85 1,06 -1,86 -1,38 -0,56 -0,14 1,30 1,24 0,3560 E10 hsa-miR-204 40,78 30,69 34,95 36,12 16,19 26,43 11,14 12,69 1,18 0,91 0,95 1,09 -1,87 -1,27 -1,11 -0,45 0,76 0,82 0,0018 F10 hsa-miR-585 36,04 32,02 35,79 36,26 22,06 29,11 5,94 7,59 0,75 0,76 0,74 0,85 -2,60 -2,08 -0,70 -0,32 1,90 1,76 0,2299 plate 10 plate G10 hsa-miR-148b* 28,70 27,38 29,33 31,15 14,54 21,10 6,43 8,29 0,62 0,75 0,62 0,81 -2,16 -1,72 -1,01 -0,56 1,15 1,16 0,0000 H10 hsa-miR-576-3p 40,54 32,50 41,35 38,71 29,49 34,78 8,31 9,91 1,02 0,95 0,95 0,92 -2,29 -1,71 -0,49 -0,15 1,80 1,56 0,4365 A11 hsa-miR-1826 37,25 27,83 35,92 34,29 23,78 27,92 9,41 8,73 1,00 0,81 0,82 0,82 -1,98 -1,67 -0,60 -0,30 1,39 1,38 0,4875 B11 hsa-miR-572 37,96 30,16 36,10 36,73 24,98 27,39 8,99 10,20 1,29 1,00 0,91 1,04 -2,08 -1,56 -0,53 -0,42 1,55 1,14 0,9962 C11 hsa-miR-511 36,66 31,97 34,91 37,70 31,43 46,63 10,58 10,93 0,84 0,85 0,68 0,91 -1,79 -1,55 -0,15 0,31 1,64 1,85 0,3676 D11 hsa-miR-607 35,49 29,22 37,08 36,46 24,93 33,89 12,30 11,73 1,19 0,92 0,98 1,11 -1,53 -1,32 -0,57 -0,11 0,96 1,21 0,4976 E11 hsa-miR-512-5p 32,53 27,51 32,34 32,55 20,49 32,30 15,25 14,70 0,89 0,76 0,76 0,83 -1,09 -0,90 -0,66 -0,01 0,43 0,89 0,4365 F11 hsa-miR-34b* 39,21 31,87 38,76 39,18 24,44 35,01 8,24 8,19 0,57 0,53 0,56 0,66 -2,25 -1,96 -0,67 -0,16 1,58 1,80 0,4020 G11 hsa-miR-517* 37,97 31,67 35,04 38,80 25,75 35,16 10,39 10,96 1,25 0,93 0,70 1,13 -1,87 -1,53 -0,44 -0,14 1,42 1,39 0,3363 H11 hsa-miR-125a-3p 36,51 27,74 35,14 36,67 21,44 29,50 9,29 8,55 0,93 0,69 0,76 0,92 -1,97 -1,70 -0,71 -0,31 1,26 1,38 0,8426 C12 miR-Control 39,16 31,20 34,71 35,22 19,26 24,60 10,56 9,42 1,11 0,95 0,84 0,79 -1,89 -1,73 -0,85 -0,52 1,04 1,21 0,4359 D12 miR-149 32,04 26,98 33,13 32,88 16,02 21,23 9,75 11,07 0,87 0,84 0,87 0,81 -1,72 -1,29 -1,05 -0,63 0,67 0,65 0,0000 E12 siLacZ 38,91 29,72 41,03 37,36 23,71 28,94 11,87 11,21 1,13 0,97 1,19 1,06 -1,71 -1,41 -0,79 -0,37 0,92 1,04 0,2107 F12 siErbB2 34,36 28,06 33,29 34,79 7,74 10,80 7,29 5,84 0,84 0,79 0,66 0,85 -2,24 -2,26 -2,10 -1,69 0,13 0,58 0,3560 G12 siErbB3 37,11 28,52 38,70 36,68 12,03 15,91 7,79 6,80 0,77 0,68 1,02 0,77 -2,25 -2,07 -1,69 -1,21 0,57 0,86 0,3560 B01 miR-Control 49,55 41,32 47,19 NA 31,55 NA 12,04 9,87 1,51 1,28 1,49 1,11 -2,04 -2,07 -0,58 NA 1,46 NA NA C01 miR-149 43,26 40,16 42,02 NA 23,00 NA 13,11 10,55 1,29 1,28 1,28 1,09 -1,72 -1,93 -0,87 NA 0,85 NA NA D01 siLacZ 51,21 39,78 46,47 NA 30,35 NA 14,20 9,20 1,68 1,21 1,57 1,01 -1,85 -2,11 -0,61 NA 1,24 NA NA E01 siErbB2 42,89 NA 39,65 NA 8,02 NA 5,13 NA 1,27 NA 1,23 1,11 -3,06 NA -2,31 NA 0,76 NA NA F01 siErbB3 46,45 NA 44,63 NA 14,65 NA 7,12 NA 1,06 NA 1,12 0,85 -2,71 NA -1,61 NA 1,10 NA NA A02 hsa-miR-199b-5p 46,39 38,78 45,55 39,12 39,84 30,22 12,43 10,99 1,54 1,30 1,61 1,36 -1,90 -1,82 -0,19 -0,37 1,71 1,45 0,5275 B02 hsa-miR-219-5p 47,43 38,90 48,06 35,91 45,28 28,29 10,87 10,04 1,28 0,99 1,45 0,91 -2,13 -1,95 -0,09 -0,34 2,04 1,61 0,4889 C02 hsa-miR-1202 47,39 37,33 46,82 36,08 24,43 17,99 13,17 10,27 1,48 1,12 1,58 1,10 -1,85 -1,86 -0,94 -1,00 0,91 0,86 0,0003 D02 hsa-miR-1301 46,61 35,71 46,14 34,02 22,69 17,16 12,05 9,06 1,35 0,89 1,46 0,90 -1,95 -1,98 -1,02 -0,99 0,93 0,99 0,0116 E02 hsa-miR-330-3p 47,26 38,05 47,41 36,11 46,35 31,43 18,38 14,25 1,33 0,98 1,48 0,91 -1,36 -1,42 -0,03 -0,20 1,33 1,22 0,5911 F02 hsa-miR-455-3p 49,99 44,02 49,71 35,58 35,76 23,08 10,75 9,58 1,37 1,20 1,59 0,94 -2,22 -2,20 -0,48 -0,62 1,74 1,58 0,3555 G02 hsa-miR-675* 38,83 35,87 37,29 28,85 29,40 18,66 5,42 5,60 0,82 0,72 0,85 0,49 -2,84 -2,68 -0,34 -0,63 2,50 2,05 0,3726 H02 hsa-miR-25* 37,95 35,38 37,74 33,12 23,28 17,15 3,76 3,93 0,77 0,68 0,80 0,61 -3,34 -3,17 -0,70 -0,95 2,64 2,22 0,3363 A03 hsa-miR-584 52,33 43,41 47,61 42,73 17,89 14,61 5,14 5,09 1,12 0,89 0,97 0,88 -3,35 -3,09 -1,41 -1,55 1,94 1,54 0,5078 B03 hsa-miR-365* 38,06 30,78 34,41 28,13 22,23 13,85 8,07 5,94 1,15 0,91 1,09 0,75 -2,24 -2,37 -0,63 -1,02 1,61 1,35 0,6621 C03 hsa-miR-10a* 46,93 36,27 43,90 33,73 35,65 23,83 12,65 8,81 1,30 0,86 1,24 0,81 -1,89 -2,04 -0,30 -0,50 1,59 1,54 0,0131 D03 hsa-let-7e 49,44 37,96 45,12 37,33 35,06 23,70 17,14 11,66 1,46 1,00 1,35 1,03 -1,53 -1,70 -0,36 -0,66 1,16 1,05 0,3173 E03 hsa-miR-19b-1* 41,39 33,87 40,12 32,97 23,87 15,93 8,59 7,09 1,05 0,75 1,04 0,76 -2,27 -2,26 -0,75 -1,05 1,52 1,21 0,9545 F03 hsa-miR-1181 50,02 42,59 47,67 38,34 33,43 25,38 13,99 12,80 1,61 1,24 1,56 1,12 -1,84 -1,73 -0,51 -0,59 1,33 1,14 0,6236 G03 hsa-miR-361-5p 38,81 36,75 37,86 31,34 32,04 21,54 6,67 6,27 0,94 0,72 0,94 0,62 -2,54 -2,55 -0,24 -0,54 2,30 2,01 0,3261 H03 hsa-miR-139-3p 50,82 45,05 49,76 40,80 33,36 24,02 13,22 10,83 1,45 1,18 1,51 1,06 -1,94 -2,06 -0,58 -0,76 1,37 1,29 0,8291 A04 hsa-miR-590-5p 45,15 40,36 39,75 36,86 36,12 32,32 12,29 10,23 1,33 1,15 1,09 0,95 -1,88 -1,98 -0,14 -0,19 1,74 1,79 0,0006 B04 hsa-miR-628-5p 43,91 34,58 34,85 35,52 12,19 14,90 10,64 7,87 1,27 0,93 0,93 1,08 -2,04 -2,14 -1,51 -1,25 0,53 0,88 0,3942 C04 hsa-miR-600 41,97 38,11 39,71 35,42 35,63 30,11 12,68 9,35 1,02 0,94 1,06 0,85 -1,73 -2,03 -0,16 -0,23 1,57 1,79 0,4169 D04 hsa-miR-520b 38,71 36,24 35,70 33,81 6,80 8,21 4,10 4,37 1,25 0,95 1,25 1,01 -3,24 -3,05 -2,39 -2,04 0,85 1,01 0,3079

plate 11 plate E04 hsa-miR-2053 48,09 41,67 46,70 38,17 32,50 27,60 10,05 8,75 1,25 0,91 1,27 0,90 -2,26 -2,25 -0,52 -0,47 1,74 1,78 0,0003 F04 hsa-miR-574-5p 47,90 39,07 45,65 37,40 38,00 32,40 8,14 6,88 1,31 0,87 1,32 0,92 -2,56 -2,51 -0,26 -0,21 2,29 2,30 0,0000 G04 hsa-miR-135a* 40,48 34,69 39,60 32,26 14,04 10,99 6,74 5,91 1,05 0,78 1,15 0,74 -2,59 -2,55 -1,50 -1,55 1,09 1,00 0,1402 H04 hsa-miR-491-3p 48,14 40,75 46,65 43,56 28,39 27,50 9,05 6,37 0,94 0,58 1,06 0,85 -2,41 -2,68 -0,72 -0,66 1,69 2,01 0,4169 A05 hsa-miR-520d-3p 37,78 33,85 34,59 33,61 7,73 7,55 4,36 4,11 1,16 1,03 1,07 1,03 -3,11 -3,04 -2,16 -2,15 0,95 0,89 0,0115 B05 hsa-miR-619 49,54 41,99 43,75 41,59 44,01 39,33 16,19 11,41 1,28 0,92 1,17 1,07 -1,61 -1,88 0,01 -0,08 1,62 1,80 0,3416 C05 hsa-miR-138-2* 44,69 40,49 38,71 40,05 26,61 23,01 9,51 7,19 0,89 0,74 0,75 0,78 -2,23 -2,49 -0,54 -0,80 1,69 1,69 0,0000 D05 hsa-miR-498 45,02 38,35 44,42 39,33 22,47 20,61 12,73 9,12 1,39 0,98 1,37 1,04 -1,82 -2,07 -0,98 -0,93 0,84 1,14 0,4785 E05 hsa-miR-505 45,10 40,70 45,54 36,50 37,22 24,92 6,94 5,91 1,16 0,99 1,22 0,88 -2,70 -2,78 -0,29 -0,55 2,41 2,23 0,1711 F05 hsa-miR-766 33,26 28,96 32,99 28,33 21,31 15,94 5,85 4,66 0,89 0,65 0,95 0,69 -2,51 -2,64 -0,63 -0,83 1,88 1,81 0,0132 G05 hsa-miR-150 47,72 37,73 47,98 40,71 32,58 31,58 12,98 9,05 1,54 0,99 1,75 1,25 -1,88 -2,06 -0,56 -0,37 1,32 1,69 0,7074 H05 hsa-miR-581 45,80 42,24 48,39 42,71 32,90 28,00 12,03 8,63 1,35 1,10 1,59 1,13 -1,93 -2,29 -0,56 -0,61 1,37 1,68 0,6397 A06 hsa-miR-1296 41,18 34,81 39,29 33,44 30,38 22,77 8,16 6,16 0,99 0,86 1,04 0,77 -2,34 -2,50 -0,37 -0,55 1,96 1,94 0,0000 B06 hsa-miR-146a 45,63 37,48 42,01 39,27 36,44 30,93 6,97 4,91 1,19 0,86 1,05 0,87 -2,71 -2,93 -0,21 -0,34 2,51 2,59 0,0060 C06 hsa-miR-603 45,66 41,20 47,45 40,73 23,37 20,43 8,01 6,99 0,95 0,89 1,16 0,92 -2,51 -2,56 -1,02 -1,00 1,49 1,56 0,1775 D06 hsa-miR-27b 43,83 38,06 44,81 37,22 28,45 22,64 8,63 6,76 1,35 0,87 1,40 0,96 -2,34 -2,49 -0,66 -0,72 1,69 1,78 0,0828 E06 hsa-miR-1908 45,26 40,11 46,96 41,17 27,09 28,04 6,97 5,30 1,27 0,86 1,35 0,88 -2,70 -2,92 -0,79 -0,55 1,91 2,37 0,4090 F06 hsa-miR-938 49,93 40,15 48,42 39,40 21,52 19,25 10,54 7,66 1,54 0,63 1,52 1,09 -2,24 -2,39 -1,17 -1,03 1,07 1,36 0,6890 G06 hsa-miR-142-5p 47,61 42,20 49,92 37,30 35,58 23,92 12,06 9,05 1,38 1,05 1,55 0,91 -1,98 -2,22 -0,49 -0,64 1,49 1,58 0,2414 H06 hsa-miR-1183 47,89 40,31 48,22 39,67 41,26 33,10 16,16 10,55 1,30 0,99 1,39 0,97 -1,57 -1,93 -0,22 -0,26 1,34 1,67 0,6778 A07 hsa-miR-16 35,82 27,70 35,14 31,18 33,44 28,24 8,97 5,71 0,69 0,50 0,74 0,48 -2,00 -2,28 -0,07 -0,14 1,93 2,14 0,2822 B07 hsa-miR-1300 37,31 29,15 37,35 30,90 20,87 16,38 9,97 6,27 0,71 0,58 0,78 0,59 -1,90 -2,22 -0,84 -0,92 1,06 1,30 0,5896 C07 hsa-miR-567 40,11 36,88 40,21 34,25 30,60 25,59 8,93 7,40 0,79 0,76 0,88 0,69 -2,17 -2,32 -0,39 -0,42 1,77 1,90 0,1737 D07 hsa-miR-211 47,26 40,98 45,96 41,25 22,33 23,78 13,26 10,20 1,42 1,12 1,41 1,06 -1,83 -2,01 -1,04 -0,79 0,79 1,21 0,5533

123

124

ΔAkt_1 ΔAkt_2 Akt_B2 Akt_H1 Akt_H2 pAkt_B1 pAkt_B2 pAkt_H1 pAkt_H2 CV_B1 CV_B2 CV_H1 CV_H2 pAkt/Akt_B1 pAkt/Akt_B2 pAkt/Akt_H1 pAkt/Akt_H2 well ID Akt_B1 qval E07 hsa-miR-323-5p 37,74 32,07 37,13 30,27 32,25 25,37 5,04 3,01 0,70 0,47 0,67 0,49 -2,90 -3,41 -0,20 -0,25 2,70 3,16 0,3079 F07 hsa-miR-147 35,96 30,69 33,12 31,59 17,31 20,47 5,14 3,63 0,80 0,50 0,65 0,62 -2,81 -3,08 -0,94 -0,63 1,87 2,45 0,4524 G07 hsa-miR-889 42,11 37,84 38,93 37,79 30,88 31,45 11,23 8,62 1,37 1,06 1,19 1,13 -1,91 -2,13 -0,33 -0,26 1,57 1,87 0,4641 H07 hsa-miR-190b 45,91 39,78 43,39 44,74 31,24 28,61 10,06 7,44 1,36 0,92 1,24 1,30 -2,19 -2,42 -0,47 -0,64 1,72 1,77 0,0034 A08 hsa-miR-28-5p 36,12 32,48 37,19 36,33 22,98 20,95 6,29 4,33 0,72 0,70 0,89 0,78 -2,52 -2,91 -0,69 -0,79 1,83 2,11 0,3555 B08 hsa-miR-144* 41,03 34,96 39,52 36,68 36,19 32,80 12,62 10,06 0,92 0,80 1,04 0,81 -1,70 -1,80 -0,13 -0,16 1,57 1,64 0,0309 C08 hsa-miR-30c 48,71 40,28 43,90 42,32 17,67 15,59 10,24 8,54 1,32 1,08 1,24 1,16 -2,25 -2,24 -1,31 -1,44 0,94 0,80 0,2242 D08 hsa-miR-1272 43,93 39,05 45,46 43,04 25,20 26,66 7,84 5,64 1,10 0,77 1,10 0,99 -2,49 -2,79 -0,85 -0,69 1,64 2,10 0,4889 E08 hsa-miR-489 39,00 32,22 36,90 35,14 12,12 11,65 7,07 4,35 1,03 0,74 0,98 0,87 -2,46 -2,89 -1,61 -1,59 0,86 1,30 0,6278 F08 hsa-miR-423-5p 41,39 32,64 38,23 35,37 25,77 26,67 8,95 6,10 1,33 0,94 1,26 1,13 -2,21 -2,42 -0,57 -0,41 1,64 2,01 0,4641 G08 hsa-miR-421 43,75 33,61 41,05 39,91 35,12 37,73 9,16 5,37 1,21 0,84 1,09 1,07 -2,26 -2,65 -0,23 -0,08 2,03 2,56 0,4034 H08 hsa-miR-449a 53,12 43,27 46,83 48,69 39,94 47,59 12,37 8,19 0,98 0,65 0,86 0,85 -2,10 -2,40 -0,23 -0,03 1,87 2,37 0,4306 A09 hsa-miR-487a 42,36 37,04 45,00 44,10 35,18 31,73 9,86 6,79 0,97 0,83 1,16 1,26 -2,10 -2,45 -0,36 -0,47 1,75 1,97 0,3363 B09 hsa-miR-483-5p 42,36 32,39 40,75 37,02 16,83 14,31 8,48 4,79 0,96 0,67 1,02 0,89 -2,32 -2,76 -1,28 -1,37 1,05 1,39 0,7189 C09 hsa-miR-1266 43,11 36,57 42,43 41,99 25,82 24,02 10,35 6,70 1,02 0,82 1,12 1,00 -2,06 -2,45 -0,72 -0,81 1,34 1,64 0,6778 D09 hsa-miR-130a 48,41 39,92 45,78 45,41 23,05 21,96 14,20 9,58 1,43 1,04 1,45 1,33 -1,77 -2,06 -0,99 -1,05 0,78 1,01 0,3632 E09 hsa-let-7f-1* 40,61 27,88 39,71 34,35 19,53 17,04 9,09 4,12 0,94 0,44 0,95 0,69 -2,16 -2,76 -1,02 -1,01 1,14 1,75 0,8742 F09 hsa-miR-1252 46,21 37,58 46,77 43,74 41,94 37,52 9,10 5,31 1,28 0,79 1,26 1,04 -2,34 -2,82 -0,16 -0,22 2,19 2,60 0,3390 G09 hsa-miR-888* 49,73 42,48 48,01 48,01 20,46 17,99 8,26 5,18 1,13 0,79 1,13 1,02 -2,59 -3,04 -1,23 -1,42 1,36 1,62 0,6523 H09 hsa-miR-9* 47,12 35,55 45,02 42,07 30,58 25,88 9,11 4,52 1,07 0,56 1,02 0,84 -2,37 -2,98 -0,56 -0,70 1,81 2,27 0,4338 A10 hsa-miR-378* 46,57 34,32 45,23 43,82 18,63 18,48 8,33 4,56 0,89 0,63 1,04 0,93 -2,48 -2,91 -1,28 -1,25 1,20 1,67 0,8422 plate 11 plate B10 hsa-miR-1233 40,79 34,42 39,05 35,90 34,00 29,17 8,66 5,14 0,90 0,77 0,97 0,77 -2,24 -2,74 -0,20 -0,30 2,04 2,44 0,3574 C10 hsa-miR-218-1* 38,06 32,06 35,86 31,48 21,33 17,55 6,87 4,38 0,76 0,76 0,80 0,60 -2,47 -2,87 -0,75 -0,84 1,72 2,03 0,4034 D10 hsa-miR-885-5p 44,98 38,23 41,29 38,25 31,82 25,96 14,61 9,24 1,49 1,15 1,33 1,16 -1,62 -2,05 -0,38 -0,56 1,25 1,49 0,9284 E10 hsa-miR-324-5p 47,47 39,48 44,44 40,86 44,39 39,18 8,81 5,37 1,17 0,90 1,10 0,89 -2,43 -2,88 0,00 -0,06 2,43 2,82 0,3154 F10 hsa-miR-1278 50,07 42,95 46,46 40,40 28,40 26,99 14,25 8,40 1,69 1,31 1,62 1,15 -1,81 -2,35 -0,71 -0,58 1,10 1,77 0,8929 G10 hsa-miR-10b* 45,77 40,60 45,72 41,92 29,59 25,36 9,72 6,62 1,12 0,83 1,13 0,84 -2,23 -2,62 -0,63 -0,73 1,61 1,89 0,4365 H10 hsa-miR-129-5p 49,56 43,33 47,19 44,89 47,06 40,68 11,43 6,90 1,06 0,79 0,98 0,76 -2,12 -2,65 0,00 -0,14 2,11 2,51 0,3467 A11 hsa-miR-183 37,57 34,90 32,67 42,66 16,54 16,65 7,04 3,75 0,78 0,71 0,64 0,88 -2,42 -3,22 -0,98 -1,36 1,43 1,86 0,5896 B11 hsa-miR-1912 45,82 40,00 34,74 43,79 25,46 25,80 10,38 6,46 0,88 0,81 0,55 0,85 -2,14 -2,63 -0,45 -0,76 1,69 1,87 0,3218 C11 hsa-miR-335 49,10 40,75 39,82 45,81 36,24 33,85 12,69 7,46 1,31 1,06 0,89 1,10 -1,95 -2,45 -0,14 -0,44 1,82 2,01 0,3029 D11 hsa-miR-300 49,64 38,45 39,86 42,70 30,99 31,56 15,62 9,07 1,56 1,10 1,18 1,19 -1,67 -2,08 -0,36 -0,44 1,30 1,65 0,7203 E11 hsa-miR-338-5p 42,20 35,77 37,34 42,76 31,36 33,30 12,56 6,61 1,06 0,79 0,86 0,98 -1,75 -2,44 -0,25 -0,36 1,50 2,08 0,5698 F11 hsa-miR-652 48,89 42,61 48,56 45,76 30,17 28,05 13,49 8,26 1,36 1,13 1,38 1,21 -1,86 -2,37 -0,69 -0,71 1,17 1,66 0,8874 G11 hsa-miR-302a 38,93 35,56 37,74 36,49 8,90 8,35 6,60 4,04 1,11 1,05 1,28 1,12 -2,56 -3,14 -2,08 -2,13 0,48 1,01 0,4889 C12 miR-Control 44,53 37,93 38,52 43,28 25,30 21,69 11,39 6,76 1,11 1,13 0,89 1,06 -1,97 -2,49 -0,61 -1,00 1,36 1,49 0,6126 D12 miR-149 40,78 36,82 35,88 38,88 20,42 19,90 13,11 7,58 1,10 1,13 0,96 0,99 -1,64 -2,28 -0,81 -0,97 0,82 1,31 0,6503 E12 siLacZ 45,61 40,01 41,74 45,45 30,35 29,50 12,98 8,18 1,26 1,20 1,26 1,16 -1,81 -2,29 -0,46 -0,62 1,35 1,67 0,6622 F12 siErbB2 40,49 35,85 39,00 37,99 11,29 9,96 7,96 4,55 1,06 0,90 1,16 0,89 -2,35 -2,98 -1,79 -1,93 0,56 1,05 0,4894 G12 siErbB3 43,06 40,68 44,80 41,89 17,37 15,09 8,94 5,49 0,82 0,86 1,07 0,78 -2,27 -2,89 -1,37 -1,47 0,90 1,42 0,7285

6.3 Lists of computationally predicted miRNA targets

MicroCosm Targets release v5 (Griffiths-Jones et al., 2008), miRDB v4.0 (Wang, 2008) and microRNA.org August 2010 release (Betel et al., 2008) were for target prediction of the 43 miRNA screen hits.

Table 26: miRNA target list predicted by microRNA.org. gene miRNAs targeting the particular gene PDE4D miR-193b miR-302c miR-382 miR-34c-5p miR-181d miR-539 miR-19a miR-148b miR-520a-3p miR-30d miR-520d-3p miR-149 miR-155 miR-18b miR-204 MYLK miR-193b miR-302c miR-34c-5p miR-539 miR-520a-3p miR-30d miR-488 miR-122 miR-155 miR-18b miR-146a miR-149 miR-204 miR-520d-3p RAP1A miR-302c miR-382 miR-181d miR-539 miR-19a miR-148b miR-520a-3p miR-30d miR-488 miR-155 miR-520d-3p miR-149 miR-18b TAB2 miR-193b miR-382 miR-34c-5p miR-181d miR-539 miR-210 miR-19a miR-30d miR-488 miR-155 miR-146a miR-149 SOS1 miR-193b miR-302c miR-181d miR-539 miR-19a miR-326 miR-148b miR-520a-3p miR-30d miR-18b miR-204 miR-520d-3p CALD1 miR-302c miR-181d miR-539 miR-19a miR-148b miR-520a-3p miR-30d miR-18b miR-204 miR-520d-3p miR-146a miR-149 ADAM12 miR-302c miR-34c-5p miR-181d miR-19a miR-520a-3p miR-30d miR-488 miR-155 miR-204 miR-520d-3p miR-146a miR-149 CALM1 miR-193b miR-302c miR-382 miR-181d miR-539 miR-19a miR-148b miR-520a-3p miR-488 miR-155 miR-520d-3p ERBB2IP miR-193b miR-302c miR-382 miR-181d miR-19a miR-326 miR-148b miR-520a-3p miR-488 miR-204 miR-520d-3p MYH11 miR-193b miR-34c-5p miR-181d miR-210 miR-19a miR-148b miR-30d miR-488 miR-520d-3p miR-146a miR-149 PTEN miR-193b miR-302c miR-382 miR-181d miR-539 miR-19a miR-148b miR-30d miR-155 miR-18b miR-146a PRKACB miR-193b miR-302c miR-181d miR-19a miR-520a-3p miR-30d miR-155 miR-18b miR-204 miR-520d-3p miR-146a PPIP5K2 miR-302c miR-382 miR-181d miR-539 miR-148b miR-520a-3p miR-30d miR-18b miR-204 miR-520d-3p miR-146a PHLPP2 miR-302c miR-34c-5p miR-181d miR-19a miR-326 miR-520a-3p miR-122 miR-155 miR-18b miR-520d-3p miR-149 EGFR miR-302c miR-539 miR-148b miR-520a-3p miR-488 miR-122 miR-155 miR-18b miR-204 miR-520d-3p miR-149 FRS2 miR-302c miR-382 miR-539 miR-19a miR-520a-3p miR-30d miR-488 miR-155 miR-18b miR-204 miR-520d-3p CUL5 miR-302c miR-382 miR-181d miR-326 miR-148b miR-520a-3p miR-30d miR-488 miR-155 miR-204 miR-520d-3p CDKN1B miR-302c miR-34c-5p miR-181d miR-539 miR-148b miR-520a-3p miR-488 miR-122 miR-155 miR-520d-3p miR-149 NEDD4 miR-302c miR-382 miR-181d miR-539 miR-520a-3p miR-30d miR-122 miR-18b miR-204 miR-520d-3p ERBB3 miR-302c miR-19a miR-326 miR-148b miR-520a-3p miR-122 miR-155 miR-204 miR-520d-3p miR-149 CDK1 miR-302c miR-382 miR-181d miR-539 miR-148b miR-520a-3p miR-155 miR-204 miR-520d-3p miR-146a

124

125

gene miRNAs targeting the particular gene ADAM17 miR-302c miR-539 miR-326 miR-148b miR-520a-3p miR-30d miR-122 miR-204 miR-520d-3p miR-149 PRKCZ miR-193b miR-302c miR-382 miR-148b miR-520a-3p miR-122 miR-155 miR-204 miR-520d-3p RPS6KA3 miR-302c miR-382 miR-181d miR-539 miR-326 miR-520a-3p miR-488 miR-155 miR-520d-3p MAP3K7 miR-302c miR-382 miR-181d miR-539 miR-520a-3p miR-30d miR-488 miR-520d-3p miR-149 GAB1 miR-302c miR-34c-5p miR-181d miR-539 miR-326 miR-520a-3p miR-30d miR-18b miR-520d-3p HPGD miR-302c miR-382 miR-539 miR-520a-3p miR-488 miR-122 miR-204 miR-520d-3p miR-146a RPS6KA5 miR-302c miR-539 miR-19a miR-148b miR-520a-3p miR-30d miR-18b miR-204 miR-520d-3p AQP4 miR-302c miR-382 miR-210 miR-19a miR-326 miR-520a-3p miR-488 miR-204 miR-520d-3p RICTOR miR-382 miR-181d miR-539 miR-19a miR-326 miR-148b miR-488 miR-155 miR-204 STAM2 miR-382 miR-539 miR-19a miR-326 miR-30d miR-155 miR-18b miR-204 miR-146a ADCY6 miR-193b miR-302c miR-34c-5p miR-520a-3p miR-122 miR-204 miR-520d-3p miR-149 KRAS miR-193b miR-302c miR-181d miR-19a miR-326 miR-30d miR-155 miR-204 SYNJ1 miR-193b miR-34c-5p miR-539 miR-148b miR-488 miR-18b miR-204 miR-146a AKT2 miR-193b miR-302c miR-181d miR-326 miR-520a-3p miR-155 miR-520d-3p miR-149 ESR1 miR-193b miR-302c miR-181d miR-19a miR-148b miR-520a-3p miR-18b miR-520d-3p SP1 miR-302c miR-34c-5p miR-539 miR-520a-3p miR-155 miR-204 miR-520d-3p miR-149 ITGB3 miR-302c miR-520a-3p miR-30d miR-155 miR-204 miR-520d-3p miR-146a miR-149 OCRL miR-302c miR-19a miR-520a-3p miR-30d miR-488 miR-122 miR-18b miR-520d-3p RAB11A miR-302c miR-34c-5p miR-181d miR-539 miR-19a miR-520a-3p miR-30d miR-520d-3p CYP2U1 miR-302c miR-382 miR-539 miR-19a miR-520a-3p miR-30d miR-155 miR-520d-3p APBB1IP miR-302c miR-382 miR-181d miR-539 miR-520a-3p miR-30d miR-155 miR-520d-3p SKP1 miR-382 miR-34c-5p miR-181d miR-148b miR-30d miR-488 miR-18b miR-204 RAB11FIP2 miR-382 miR-34c-5p miR-181d miR-539 miR-19a miR-30d miR-155 miR-18b EPS15 miR-382 miR-181d miR-19a miR-326 miR-148b miR-488 miR-18b miR-204 IKBKB miR-34c-5p miR-19a miR-326 miR-148b miR-122 miR-155 miR-146a miR-149 MED1 miR-539 miR-19a miR-148b miR-520a-3p miR-488 miR-520d-3p miR-146a miR-149 GNAO1 miR-193b miR-34c-5p miR-181d miR-539 miR-326 miR-30d miR-488 AQP2 miR-193b miR-539 miR-19a miR-326 miR-148b miR-155 miR-146a ITPR2 miR-193b miR-181d miR-539 miR-326 miR-148b miR-488 miR-146a MME miR-302c miR-181d miR-539 miR-520a-3p miR-204 miR-520d-3p miR-149 CPA3 miR-302c miR-148b miR-520a-3p miR-488 miR-155 miR-520d-3p miR-146a MYO5B miR-302c miR-181d miR-19a miR-148b miR-520a-3p miR-155 miR-520d-3p MYL12B miR-302c miR-181d miR-539 miR-326 miR-520a-3p miR-30d miR-520d-3p MINPP1 miR-302c miR-181d miR-520a-3p miR-30d miR-18b miR-520d-3p miR-146a MALT1 miR-302c miR-181d miR-539 miR-19a miR-520a-3p miR-520d-3p miR-146a TRPC1 miR-302c miR-181d miR-30d miR-488 miR-155 miR-204 miR-520d-3p BCL10 miR-302c miR-520a-3p miR-30d miR-488 miR-155 miR-18b miR-520d-3p RAP1B miR-382 miR-181d miR-19a miR-30d miR-488 miR-155 miR-149 ATP6AP2 miR-382 miR-181d miR-148b miR-488 miR-122 miR-155 miR-204 IP6K2 miR-382 miR-539 miR-326 miR-30d miR-122 miR-155 miR-149 HMGCS1 miR-34c-5p miR-181d miR-210 miR-19a miR-155 miR-18b miR-146a PDE4B miR-34c-5p miR-181d miR-539 miR-148b miR-488 miR-155 miR-204 MAPK1 miR-34c-5p miR-181d miR-539 miR-210 miR-19a miR-488 miR-155 SH3GL2 miR-539 miR-19a miR-30d miR-488 miR-122 miR-155 miR-146a PTK2 miR-193b miR-302c miR-181d miR-539 miR-520a-3p miR-520d-3p TBL1XR1 miR-193b miR-34c-5p miR-181d miR-326 miR-148b miR-18b IRS2 miR-193b miR-382 miR-181d miR-539 miR-30d miR-155 PER2 miR-193b miR-181d miR-30d miR-155 miR-204 miR-149 RALGDS miR-302c miR-34c-5p miR-520a-3p miR-30d miR-520d-3p miR-146a PTGS1 miR-302c miR-382 miR-539 miR-148b miR-30d miR-204 TBXAS1 miR-302c miR-34c-5p miR-148b miR-520a-3p miR-488 miR-520d-3p NFYB miR-302c miR-181d miR-520a-3p miR-30d miR-488 miR-520d-3p ABCC1 miR-302c miR-326 miR-488 miR-204 miR-520d-3p miR-149 ENPEP miR-302c miR-539 miR-148b miR-520a-3p miR-488 miR-520d-3p PIK3CA miR-302c miR-19a miR-148b miR-520a-3p miR-155 miR-520d-3p NFYA miR-302c miR-19a miR-148b miR-520a-3p miR-155 miR-520d-3p IPPK miR-302c miR-382 miR-181d miR-520a-3p miR-155 miR-520d-3p TPM3 miR-302c miR-181d miR-326 miR-488 miR-18b miR-204 NRAS miR-382 miR-181d miR-210 miR-148b miR-520d-3p miR-146a SYK miR-382 miR-181d miR-148b miR-488 miR-146a miR-149 USP8 miR-382 miR-34c-5p miR-326 miR-30d miR-122 miR-155 STAM miR-382 miR-181d miR-539 miR-30d miR-488 miR-122 INPP4A miR-34c-5p miR-181d miR-30d miR-155 miR-204 miR-146a SHC1 miR-34c-5p miR-19a miR-326 miR-148b miR-18b miR-204 CREBBP miR-181d miR-539 miR-326 miR-30d miR-488 miR-204 SH3KBP1 miR-181d miR-539 miR-19a miR-148b miR-30d miR-18b CHD9 miR-181d miR-539 miR-148b miR-30d miR-155 miR-146a NUDT4 miR-181d miR-539 miR-520a-3p miR-488 miR-18b miR-520d-3p YWHAB miR-181d miR-539 miR-148b miR-488 miR-18b miR-146a PTGS2 miR-181d miR-539 miR-148b miR-488 miR-155 miR-146a CDC42 miR-539 miR-19a miR-30d miR-488 miR-18b miR-204 PDPK1 miR-193b miR-382 miR-181d miR-155 miR-146a TPM2 miR-193b miR-302c miR-520a-3p miR-520d-3p miR-149 ITGA1 miR-193b miR-539 miR-326 miR-30d miR-488 RPS6KA1 miR-193b miR-302c miR-326 miR-520a-3p miR-520d-3p JAK2 miR-193b miR-181d miR-30d miR-155 miR-204 INPP5B miR-193b miR-382 miR-34c-5p miR-148b miR-488 EPS15L1 miR-193b miR-34c-5p miR-181d miR-488 miR-122 TLN1 miR-193b miR-302c miR-181d miR-326 miR-146a FOXO3 miR-302c miR-539 miR-30d miR-155 miR-149 AKT1 miR-302c miR-382 miR-539 miR-520a-3p miR-520d-3p PRKCE miR-302c miR-34c-5p miR-181d miR-326 miR-146a INPP4B miR-382 miR-34c-5p miR-181d miR-30d miR-488 MAP3K8 miR-382 miR-181d miR-539 miR-488 miR-155 VCL miR-382 miR-34c-5p miR-181d miR-30d miR-488 YES1 miR-382 miR-30d miR-155 miR-520d-3p miR-146a LRIG1 miR-34c-5p miR-181d miR-19a miR-326 miR-488 CRY2 miR-34c-5p miR-181d miR-326 miR-148b miR-18b NFYC miR-34c-5p miR-181d miR-539 miR-326 miR-155 GNAI1 miR-34c-5p miR-539 miR-148b miR-30d miR-488 CREB1 miR-34c-5p miR-181d miR-30d miR-122 miR-204

125

126

gene miRNAs targeting the particular gene ADCY2 miR-181d miR-148b miR-155 miR-204 miR-146a TPM1 miR-181d miR-148b miR-155 miR-146a miR-149 WWP1 miR-181d miR-19a miR-326 miR-30d miR-146a FABP4 miR-539 miR-19a miR-155 miR-204 miR-146a PPIP5K1 miR-539 miR-155 miR-204 miR-146a miR-149 IP6K3 miR-210 miR-30d miR-18b miR-204 miR-146a SPRY2 miR-19a miR-326 miR-148b miR-30d miR-122 ACE2 miR-326 miR-520a-3p miR-122 miR-520d-3p miR-149 PIK3R1 miR-148b miR-488 miR-155 miR-204 miR-149 IKBKG miR-193b miR-34c-5p miR-122 miR-149 BTRC miR-193b miR-181d miR-204 miR-149 NCOR1 miR-193b miR-34c-5p miR-204 miR-149 LTA4H miR-302c miR-539 miR-520a-3p miR-520d-3p CUL1 miR-302c miR-539 miR-520a-3p miR-520d-3p STAT5B miR-302c miR-181d miR-520a-3p miR-520d-3p HSP90AA1 miR-302c miR-148b miR-520a-3p miR-520d-3p PPARGC1B miR-302c miR-34c-5p miR-326 miR-30d RPS27A miR-302c miR-181d miR-520a-3p miR-122 RASGRP1 miR-382 miR-539 miR-148b miR-146a MAPK14 miR-382 miR-539 miR-19a miR-148b SREBF2 miR-382 miR-326 miR-148b miR-149 PTPN11 miR-382 miR-34c-5p miR-539 miR-155 PRLR miR-34c-5p miR-181d miR-19a miR-204 MYL6 miR-34c-5p miR-181d miR-326 miR-149 VAMP2 miR-34c-5p miR-19a miR-326 miR-149 ADAM10 miR-34c-5p miR-30d miR-122 miR-149 ATF1 miR-34c-5p miR-181d miR-19a miR-30d MAPK13 miR-34c-5p miR-326 miR-488 miR-149 MAP2K1 miR-34c-5p miR-181d miR-148b miR-30d PTGIS miR-34c-5p miR-326 miR-30d miR-149 CASP9 miR-181d miR-30d miR-155 miR-204 STAT3 miR-181d miR-210 miR-204 miR-149 MAPKAPK3 miR-181d miR-539 miR-19a miR-18b INPP5A miR-181d miR-210 miR-155 miR-149 IRS1 miR-181d miR-539 miR-148b miR-30d PRKCB miR-181d miR-326 miR-30d miR-155 CARD11 miR-181d miR-539 miR-155 miR-149 IP6K1 miR-539 miR-210 miR-19a miR-204 SORBS1 miR-210 miR-30d miR-204 miR-149 SORBS3 miR-210 miR-326 miR-488 miR-18b RAF1 miR-19a miR-488 miR-18b miR-149 CYP1B1 miR-30d miR-488 miR-204 miR-146a MDM2 miR-193b miR-302c miR-181d ALOX5 miR-193b miR-34c-5p miR-181d CARM1 miR-193b miR-181d miR-19a PRKCA miR-302c miR-520a-3p miR-520d-3p ADCY5 miR-302c miR-520a-3p miR-520d-3p STIM1 miR-302c miR-520a-3p miR-204 SMARCD3 miR-302c miR-520a-3p miR-520d-3p PLA2G4A miR-382 miR-181d miR-539 ITCH miR-382 miR-539 miR-146a ATF2 miR-382 miR-181d miR-204 ADCY3 miR-382 miR-539 miR-488 FOXO1 miR-382 miR-539 miR-204 MAPK7 miR-34c-5p miR-148b miR-488 SRC miR-34c-5p miR-19a miR-488 AGT miR-34c-5p miR-181d miR-539 ESRRA miR-34c-5p miR-326 miR-149 PLCG1 miR-34c-5p miR-181d miR-204 PTGR1 miR-34c-5p miR-122 miR-204 PIK3R2 miR-34c-5p miR-148b miR-30d NCOA2 miR-181d miR-30d miR-18b EGF miR-181d miR-539 miR-488 LMOD1 miR-181d miR-326 miR-149 EPHX2 miR-539 miR-326 miR-146a PDE4A miR-539 miR-19a miR-204 CYP4A11 miR-539 miR-210 miR-488 AKT1S1 miR-539 miR-488 miR-146a ADCY7 miR-539 miR-19a miR-30d PTGES3 miR-19a miR-148b miR-18b CRY1 miR-19a miR-148b miR-146a ERBB2 miR-326 miR-488 miR-18b CSK miR-148b miR-30d miR-488 TRIB3 miR-30d miR-488 miR-204 ACTG2 miR-193b miR-488 F9 miR-193b miR-326 ADCY9 miR-193b miR-181d PROS1 miR-382 miR-204 CHUK miR-382 miR-148b CYP2C8 miR-382 miR-181d GHR miR-382 miR-19a DPEP2 miR-382 miR-148b FDFT1 miR-382 miR-181d RNF41 miR-34c-5p miR-149 SPRY1 miR-34c-5p miR-149 PER1 miR-34c-5p miR-520a-3p CDC37 miR-34c-5p miR-155 MAPKAPK2 miR-34c-5p miR-539 GFAP miR-34c-5p miR-204 CSNK1D miR-34c-5p miR-204 NRF1 miR-181d miR-146a

126

127

gene miRNAs targeting the particular gene TBL1X miR-181d miR-30d NCOA6 miR-181d miR-539 STAT5A miR-181d miR-204 PPARA miR-181d miR-155 FYN miR-539 miR-155 F7 miR-539 miR-210 CSNK1E miR-210 miR-18b RPS6KA2 miR-19a miR-30d F10 miR-19a miR-148b BAD miR-326 miR-122 ITPK1 miR-148b miR-30d NOS3 miR-30d miR-155 UBA52 miR-488 miR-146a AQP3 miR-488 miR-18b PTGES miR-122 miR-155 PTPN1 miR-204 miR-146a CYP2J2 miR-204 miR-146a RPS6KB2 miR-146a miR-149 SYT5 miR-382 ERBB4 miR-382 GGCX miR-382 UBB miR-382 INPP5J miR-34c-5p RAP1GAP miR-34c-5p GH2 miR-34c-5p TGS1 miR-34c-5p SIPA1 miR-34c-5p ACTA2 miR-181d ADRBK1 miR-181d PRKCD miR-181d ALOX12 miR-539 ADCY8 miR-539 PROZ miR-210 FURIN miR-19a MLXIPL miR-326 PRKACG miR-326 PRKCG miR-326 MYL9 miR-326 PHLPP1 miR-326 MGLL miR-148b GNAI2 miR-30d CAMK4 miR-30d ITPR3 miR-30d UBC miR-488 ITGB5 miR-122 CYP2C9 miR-155 S100B miR-155 RXRA miR-155 IPMK miR-18b ALOX15 miR-18b CYP1A2 miR-18b ADCY1 miR-204 PXN miR-204 PROC miR-204 MYL6B miR-204 ALOX5AP miR-146a CYP1A1 miR-149 ANPEP miR-149 Table 27: miRNA target list predicted by MicroCosm. gene miRNAs targeting the particular gene ORAI1 miR-548c-3p miR-886-3p miR-181d miR-519c-3p miR-210 miR-486-3p miR-155 miR-520f miR-574-5p miR-520d-3p MYL12B miR-548c-3p miR-382 miR-34c-5p miR-19a miR-148b miR-520a-3p miR-520d-3p SYT5 miR-382 miR-148b miR-486-3p miR-122 miR-509-3p miR-558 miR-574-5p CPA3 miR-519c-3p miR-19a miR-30d miR-488 miR-579 miR-155 miR-520f TPM3 miR-363* miR-519c-3p miR-649 miR-486-3p miR-122 miR-18b BAD miR-363* miR-302c miR-520a-3p miR-520f miR-520d-3p miR-149 LIPE miR-193b miR-302c miR-34c-5p miR-210 miR-509-3p miR-18b PIK3CA miR-302c miR-19a miR-148b miR-520a-3p miR-155 miR-520d-3p PTPN6 miR-302c miR-520a-3p miR-632 miR-654-3p miR-520f miR-520d-3p MAPK13 miR-34c-5p miR-708* miR-488 miR-155 miR-520d-3p miR-149 MAP3K8 miR-181d miR-579 miR-509-3p miR-654-3p miR-520f miR-520d-3p APBB1IP miR-181d miR-326 miR-649 miR-579 miR-18b miR-204 CARD11 miR-181d miR-539 miR-486-3p miR-632 miR-654-3p miR-574-5p EGFR miR-548c-3p miR-382 miR-539 miR-519c-3p miR-146a MDM2 miR-363* miR-640 miR-520a-3p miR-520f miR-520d-3p PLA2G4A miR-302c miR-181d miR-148b miR-579 miR-509-3p IPPK miR-382 miR-181d miR-649 miR-122 miR-574-5p PRLR miR-640 miR-34c-5p miR-181d miR-122 miR-574-5p EPN1 miR-886-3p miR-486-3p miR-155 miR-204 miR-574-5p INPP5J miR-886-3p miR-539 miR-486-3p miR-509-3p miR-146a EPHX2 miR-539 miR-19a miR-654-3p miR-574-5p miR-146a EPS15L1 miR-548c-3p miR-34c-5p miR-122 miR-574-5p CRY1 miR-548c-3p miR-539 miR-19a miR-146a IKBKG miR-363* miR-34c-5p miR-210 miR-18b INPP5B miR-193b miR-708* miR-509-3p miR-574-5p PER1 miR-640 miR-519c-3p miR-326 miR-486-3p TBXAS1 miR-34c-5p miR-181d miR-519c-3p miR-148b IP6K2 miR-886-3p miR-210 miR-122 miR-149

127

128

gene miRNAs targeting the particular gene IP6K3 miR-210 miR-30d miR-520f miR-149 FYN miR-326 miR-148b miR-486-3p miR-520f CYP2C19 miR-486-3p miR-558 miR-155 miR-520f TPM1 miR-924 miR-519c-3p miR-558 RAP1B miR-924 miR-649 miR-155 TPM2 miR-363* miR-193b miR-632 AQP3 miR-363* miR-34c-5p miR-326 RPS6KB2 miR-193b miR-886-3p miR-486-3p RAP1GAP miR-302c miR-148b miR-204 MAPK7 miR-640 miR-649 miR-488 PROZ miR-34c-5p miR-886-3p miR-30d MLST8 miR-34c-5p miR-486-3p miR-122 ITPR3 miR-34c-5p miR-326 miR-520f PRKACG miR-181d miR-326 miR-30d CYP4F2 miR-181d miR-148b miR-579 INPP4B miR-181d miR-488 miR-509-3p GAB1 miR-519c-3p miR-509-3p miR-18b UBC miR-519c-3p miR-488 miR-122 GAS6 miR-210 miR-520f miR-574-5p MYH11 miR-210 miR-19a miR-122 NCOA6 miR-19a miR-148b miR-520a-3p FRS2 miR-19a miR-148b miR-18b FOXO3 miR-520a-3p miR-520f miR-520d-3p RAF1 miR-649 miR-486-3p miR-654-3p MYLK miR-509-3p miR-155 miR-18b EGF miR-548c-3p miR-632 PDE4D miR-548c-3p miR-148b CASP9 miR-548c-3p miR-193b AGT miR-548c-3p miR-18b FDFT1 miR-548c-3p miR-181d DPEP1 miR-924 miR-193b MME miR-924 miR-520d-3p ALOX5 miR-193b miR-34c-5p BCAR1 miR-193b miR-326 USP8 miR-382 miR-155 TRPC1 miR-382 miR-146a ATP6AP2 miR-382 miR-148b CYP4A11 miR-640 miR-34c-5p IKBKB miR-640 miR-148b STUB1 miR-34c-5p miR-326 CDC37 miR-34c-5p miR-155 ALOX12 miR-34c-5p miR-181d S100B miR-34c-5p miR-632 MYL9 miR-886-3p miR-326 CYP2C8 miR-886-3p miR-181d PROC miR-886-3p miR-204 CSK miR-886-3p miR-181d PPARGC1B miR-886-3p miR-30d NOS3 miR-886-3p miR-155 INS miR-886-3p miR-632 ACTA2 miR-181d miR-146a REN miR-181d miR-326 INPP5A miR-708* miR-18b SORBS1 miR-708* miR-509-3p ANPEP miR-708* miR-149 INPP1 miR-539 miR-520d-3p CHD9 miR-519c-3p miR-148b F7 miR-210 miR-632 DPEP2 miR-210 miR-632 SH3KBP1 miR-210 miR-19a RAP1A miR-19a miR-558 RPS6KA5 miR-19a miR-649 TLN1 miR-326 miR-558 ESRRA miR-326 miR-486-3p PRKCZ miR-148b miR-486-3p SYNJ1 miR-148b miR-520f RALGDS miR-520a-3p miR-520f MAP3K7 miR-520a-3p miR-520d-3p ACTG2 miR-649 miR-509-3p TRIB3 miR-488 miR-574-5p ADAM12 miR-488 miR-155 ATF1 miR-488 miR-509-3p CSNK1D miR-632 miR-574-5p FAM213B miR-509-3p miR-18b ATF2 miR-558 miR-204 CYP2C9 miR-155 miR-520f PLCG1 miR-204 miR-149 PPIP5K2 miR-548c-3p SPRY2 miR-924 CYP1A2 miR-363* GHR miR-363* PFKFB1 miR-363* NCOA2 miR-363* ADCY5 miR-302c TBL1X miR-382 PDE4B miR-382 SMARCD3 miR-640 ADCY6 miR-640 PRKCE miR-34c-5p PIK3R2 miR-34c-5p

128

129

gene miRNAs targeting the particular gene SKP1 miR-34c-5p F10 miR-886-3p ADCY4 miR-886-3p ITPK1 miR-886-3p TBL1XR1 miR-181d NRF1 miR-181d ADAM17 miR-708* NCOR1 miR-708* WWP1 miR-708* RPS6KA2 miR-539 LTA4H miR-539 ALOX5AP miR-519c-3p ITPR2 miR-519c-3p ADCY7 miR-210 EPS15 miR-210 PDE4A miR-19a CHUK miR-148b ENPEP miR-520a-3p OCRL miR-520a-3p ADCY8 miR-520a-3p MTOR miR-649 THEM4 miR-649 CDKN1B miR-649 GNAO1 miR-30d ERBB4 miR-30d IRS1 miR-30d GNAI2 miR-30d MYL6 miR-30d CMA1 miR-30d PTGDS miR-486-3p GSK3A miR-486-3p MAP2K2 miR-486-3p LTC4S miR-486-3p MAPKAPK3 miR-486-3p STIM1 miR-486-3p NFYC miR-122 STAM miR-579 PRKCB miR-579 PIK3R1 miR-579 RBX1 miR-579 CARM1 miR-632 AQP4 miR-632 AKT1 miR-632 PHLPP2 miR-509-3p VKORC1 miR-509-3p AKT1S1 miR-509-3p CAMK4 miR-509-3p F2 miR-509-3p AKR1C3 miR-654-3p MINPP1 miR-558 GFAP miR-558 JAK2 miR-155 MYL6B miR-520f LMOD1 miR-204 ADCY9 miR-574-5p AKT2 miR-574-5p NR4A1 miR-574-5p MAPK12 miR-520d-3p PIK3CB miR-146a MAPK11 miR-149 SORBS3 miR-149 Table 28: miRNA target list predicted by miRDB. target mirs PAG1 miR-924 miR-181d miR-519c-3p miR-520a-3p miR-579 miR-520f miR-520d-3p TBL1XR1 miR-34c-5p miR-181d miR-326 miR-1178 miR-579 miR-632 miR-1301 GAB1 miR-548c-3p miR-181d miR-519c-3p miR-520a-3p miR-579 miR-520d-3p SOS1 miR-181d miR-519c-3p miR-520a-3p miR-520f miR-1202 miR-520d-3p ESR1 miR-548c-3p miR-181d miR-519c-3p miR-520a-3p miR-520d-3p PPARA miR-548c-3p miR-181d miR-520a-3p miR-520d-3p PDE4D miR-548c-3p miR-520a-3p miR-579 miR-520d-3p RAB11A miR-548c-3p miR-181d miR-520a-3p miR-520d-3p CREB1 miR-548c-3p miR-181d miR-519c-3p miR-520f RPS6KA3 miR-548c-3p miR-520a-3p miR-520f miR-520d-3p NFYB miR-548c-3p miR-181d miR-520a-3p miR-520d-3p PHLPP2 miR-548c-3p miR-181d miR-509-3p miR-1301 RPS6KA5 miR-519c-3p miR-520a-3p miR-520f miR-520d-3p GGCX miR-520a-3p miR-579 miR-654-3p miR-520d-3p PRLR miR-548c-3p miR-181d miR-579 PTGS2 miR-548c-3p miR-181d miR-579 RAP1B miR-548c-3p miR-181d miR-649 SORBS1 miR-548c-3p miR-632 miR-654-3p PIK3R1 miR-548c-3p miR-579 miR-1301 RNF41 miR-548c-3p miR-181d miR-486-3p STAT3 miR-548c-3p miR-519c-3p miR-1301 STAM miR-548c-3p miR-649 miR-579 NCOA2 miR-548c-3p miR-181d miR-632 VAMP2 miR-548c-3p miR-34c-5p miR-486-3p

129

130

target mirs RICTOR miR-548c-3p miR-520f miR-1301 CYP2U1 miR-548c-3p miR-520f miR-520d-3p MME miR-924 miR-181d miR-520f PTGIS miR-34c-5p miR-486-3p miR-1202 TBL1X miR-181d miR-632 miR-654-3p CALM1 miR-181d miR-579 miR-1202 HPGD miR-519c-3p miR-579 miR-654-3p PRKCB miR-326 miR-579 miR-520f CYP1B1 miR-548c-3p miR-1301 ERBB2IP miR-548c-3p miR-519c-3p RPS6KA2 miR-548c-3p miR-1301 SH3KBP1 miR-548c-3p miR-486-3p ERBB4 miR-548c-3p miR-579 SYK miR-548c-3p miR-649 PPARGC1B miR-548c-3p miR-34c-5p GNAI1 miR-548c-3p miR-579 NRAS miR-548c-3p miR-181d MAP3K7 miR-548c-3p miR-640 BCL10 miR-548c-3p miR-520a-3p CDKN1B miR-548c-3p miR-520f KRAS miR-548c-3p miR-181d ABCC1 miR-548c-3p miR-326 ATF1 miR-548c-3p miR-181d EGFR miR-548c-3p miR-579 PRKCE miR-548c-3p miR-181d PPIP5K2 miR-548c-3p miR-181d NUDT4 miR-548c-3p miR-181d ITCH miR-548c-3p miR-558 TPM3 miR-548c-3p miR-649 ITGA1 miR-548c-3p miR-579 NFYA miR-924 miR-520f MAP3K8 miR-181d miR-509-3p INPP5A miR-181d miR-1301 IPMK miR-181d miR-649 PRKCA miR-326 miR-1178 ERBB3 miR-520a-3p miR-520d-3p PIK3CA miR-520a-3p miR-520d-3p STIM1 miR-649 miR-486-3p RAP1A miR-579 miR-520f FYN miR-509-3p miR-654-3p GHR miR-548c-3p PROS1 miR-548c-3p CYP4F3 miR-548c-3p FRS2 miR-548c-3p CSK miR-548c-3p ALOX15 miR-548c-3p EPS15 miR-548c-3p MINPP1 miR-548c-3p EGF miR-548c-3p NCOR1 miR-548c-3p TRPC1 miR-548c-3p ENPEP miR-548c-3p FOXO1 miR-548c-3p MDM2 miR-548c-3p SH3GL2 miR-548c-3p FDFT1 miR-548c-3p PTGES miR-548c-3p CBL miR-548c-3p INPP5B miR-548c-3p IRS1 miR-548c-3p STAM2 miR-548c-3p RAB11FIP2 miR-548c-3p ITGB3 miR-1225-3p RAP1GAP2 miR-1225-3p PRKACA miR-1225-3p PRKACG miR-1225-3p CALD1 miR-640 EPS15L1 miR-34c-5p AGT miR-181d INPP4A miR-181d ADRBK1 miR-181d MAPK1 miR-181d MAP2K1 miR-181d IRS2 miR-181d PRKCD miR-181d SKP1 miR-181d PTEN miR-519c-3p TBXAS1 miR-519c-3p CRY2 miR-519c-3p CPA3 miR-519c-3p LRIG1 miR-519c-3p CHD9 miR-519c-3p ADAM17 miR-326 TLN1 miR-326 LMOD1 miR-326 MYO5B miR-1178 MAPK3 miR-486-3p FAM213B miR-486-3p PDPK1 miR-486-3p PRKCG miR-486-3p

130

131

target mirs SRC miR-486-3p CDC42 miR-579 PRKACB miR-579 FOXO3 miR-579 MALT1 miR-579 F7 miR-632 MYH11 miR-632 ADAM10 miR-632 S100B miR-632 ACE2 miR-632 CSNK1D miR-632 MGLL miR-654-3p UBA52 miR-654-3p ADCY1 miR-654-3p TPM1 miR-558 SYT5 miR-558 ADAM12 miR-558 OCRL miR-520f SYNJ1 miR-520f SP1 miR-520f ADCY2 miR-520f CYP1A2 miR-1202 PTK2 miR-1301 STAT5A miR-1301 CUL5 miR-574-5p ADCY3 miR-574-5p AKT1 miR-520d-3p

131

132

133

Acknowledgements

First of all, I would like to express my deepest thanks to my supervisor, Professor Dr. Monilola Olayioye. Her enthusiasm, persuasive power and excellent scientific guidance served as the key motivation throughout my PhD. By offering me the opportunity to partici- pate in diverse projects, she enabled me to accumulate broad scientific knowledge and a variety of experimental techniques. I especially value her effort to always respond to my indivual competences and to support me to further strengthen and improve my skills. Apart from the scientific world, she was also interested in creating an excellent working atmosphere and promoting team spirit by organizing culinary evenings and adventure trips.

I would also like to thank Professor Dr Klaus Pfizenmaier for the opportunity to perform my research at the IZI and also for taking over the second opinion of this thesis.

I want to thank Michaela Bayerlova and Tim Beisbard for the bioinformatical analysis of the screen data. A special thanks goes to Michaela Strobek for the inspiring scientific discus- sions. Further thanks goes to Bettina Huck, Simone Schmid and Bettina Keller for the experimental support.

Thanks to all members of the MoLab and all the other IZI members for the nice time inside and outside the lab.

I would also like to thank Anne Schützler for proofreading this thesis and teaching me how to use commas in English, although I turned out to be immune to advice.

Finally, I would like to thank my friends for providing me a non-scientific but entertaining environment. Further, I owe a debt of gratitude to my family for their life-time support.

Thank you

133

134

135

Curriculum vitae

Personal Details Date of Birth 14 January, 1985

Place of Birth Ochsenfurt, Germany

Education and training 2010 – 2014 PhD program at the Institute of Cell Biology and Immunology, Universi- ty of Stuttgart, Germany

2009 – 2009 Research associate at the Institute for Medical Physics and Biophysics, University of Leipzig, Germany

2006 – 2009 University of Leipzig, Germany, Student of biochemistry, completion of diploma courses

2004 – 2006 University of Bayreuth, Germany, Student of biochemistry, pre-diploma program

2002 – 2004 Siebold-Gymnasium, Würzburg, degree: A level

1995 – 2002 Gymnasium Marktbreit, Marktbreit, Germany

1991 – 1995 Primary School, Grundschule Marktsteft, Germany

Research activities and professional experience 2010 – 2014 Institute of Cell Biology and Immunology, University of Stuttgart, Ger- many, Scientific work in miRNA function in breast cancer (PhD thesis)

title: miRNAs in control of oncogenic signaling in breast cancer cells

2011 Participated in a training for GMP in the biopharmaceutical industry (certificate, no. 129.269)

2011 Attended a confocal microscopy course at the University of York

2009 Research associate at the Institute for Medical Physics and Biophysics University of Leipzig, Germany

2009 Diploma thesis at the Institute for Medical Physics and Biophysics, Uni- versity of Leipzig, Germany

title: Einfluss der Sauerstoffkonzentration und der Medienzusammen- setzung auf das Wachstumsverhalten von Stammzellen (influence of oxygen concentration and medium composition on the growth capacity of stem cells) 2008 Student research project at the Institute for Molecular biological- biochemical Processing Technology, University of Leipzig, Germany

135

136

title: Etablierung eines 2D und 3D human smooth muscle (HSMC) Modellsystems für das Impedanzbasierte Wirkstoffscreening (Establish- ing an impedance-based a 2D and 3D human smooth muscle cell model for testing therapeutic components)

2008 Student assistant at the Max Planck Institute for Evolutionary Anthro- pology, Leipzig

Publications Bischoff A, Bayerlová M, Strotbek M, Schmid S, Beissbarth T, Olayioye M. A global mi- croRNA screen identifies regulators of the ErbB receptor signaling network (in preparation)

Bischoff A, Huck B, Keller B, Strotbek M, Schmid S, Boerries M, Busch H, Müller D, Olayioye M. miR-149 functions as a tumor suppressor by controlling breast epithelial cell migration and invasion. Cancer Res. (under revision)

Holeiter G, Bischoff A, Braun A, Huck B, Erlmann P, Schmid S, Herr R, Brummer T, Olayioye, M (2012). The RhoGAP protein Deleted in Liver Cancer 3 (DLC3) is essential for adherens junctions integrity. Oncogenesis 1, e13; doi:10.1038/oncsis.2012.13.

Heering J, Weis N, Holeiter M, Neugart F, Staebler A, Fehm TN, Bischoff A, Schiller J, Duss S, Schmid S, Korte T, Herrmann A, Olayioye MA. (2012) Loss of the ceramide transfer protein augments EGF receptor signaling in breast cancer. Cancer Res. 72(11):2855-66.

Bischoff A, Eibisch M, Fuchs B, Süß R, Schürenberg M, Suckau D, Schiller J.A simple TLC/MALDI Method to monitor Oxidation Products of Phosphatidylcholines and - ethanolamines. Acta Chromatogr. 23: 365-375.

Fuchs B, Bischoff A, Süss R, Teuber K, Schürenberg M, Suckau D, Schiller J (2009). Phosphatidylcholines and -ethanolamines can be easily mistaken in phospholipid mixtures: a negative ion MALDI-TOF MS study with 9-aminoacridine as matrix and egg yolk as selected example. Anal Bioanal Chem. 395(8):2479-87.

136