Crosstalk Between Histone Modifications Indicates That

Total Page:16

File Type:pdf, Size:1020Kb

Load more

9348–9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 Published online 20 June 2017 doi: 10.1093/nar/gkx550 Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency Zheng Zhang1,†, Bryan C. Nikolai1,†, Leah A. Gates1, Sung Yun Jung2, Edward B. Siwak3, Bin He1,4, Andrew P. Rice3, Bert W. O’Malley1 and Qin Feng1,* 1Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA, 2Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX, USA, 3Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, TX, USA and 4Department of Medicine-Hematology & Oncology, Baylor College of Medicine, Houston, TX, USA Received February 06, 2017; Revised May 25, 2017; Editorial Decision June 13, 2017; Accepted June 15, 2017 ABSTRACT INTRODUCTION In eukaryotic cells, the gene expression status Human immunodeficiency virus (HIV) is a retrovirus that is strictly controlled by epigenetic modifications causes acquired immunodeficiency syndrome. HIV infec- on chromatin. The repressive status of chromatin tion of CD4+ helper T lymphocytes is a multistep process, largely contributes to HIV latency. Studies have involving fusion and entry through interaction with CD4 re- shown that modification of histone H3K27 acts as ceptor and CCR5 co-receptor, reverse transcription of HIV viral RNA into double-stranded viral DNA, and integra- a key molecular switch for activation or suppression tion of viral DNA into the host cell genome. Combination of many cellular genes. In this study, we found that Antiretroviral Therapy (cART), also known as highly ac- K27-acetylated histone H3 specifically recruited Su- tive antiretroviral therapy (HAART), employs the use of per Elongation Complex (SEC), the transcriptional three or more antiretroviral drugs to inhibit the key steps of elongation complex essential for HIV-1 long terminal HIV infection, and has been very effective in HIV-infected repeat (LTR)-mediated and general cellular transcrip- patients by suppressing HIV replication and maintaining tion. Interestingly, H3K27 acetylation further stim- the virus at undetectable levels. However, although continu- ulates H3R26 methylation, which subsequently ab- ous cART is life-prolonging, it never eradicates HIV infec- rogates the recruitment of SEC, forming a negative tion or cures this disease. Interruption of treatment quickly feedback regulatory loop. Importantly, by inhibiting results in virus replication and recurrence of the disease methyltransferase activity of CARM1, the enzyme re- (1). Therefore, HIV-infected patients must receive lifelong cART treatment, which presents economic and therapeutic sponsible for H3R26 methylation, HIV-1 transcription burdens. is reactivated in several HIV latency cell models, in- The principal impediment to eradication of HIV infec- cluding a primary resting CD4+ T cell model. When tion is the latent reservoir of HIV provirus. HIV provirus combined with other latency disrupting compounds persists in multiple tissues and cells, particularly the long- such as JQ1 or vorinostat/SAHA, the CARM1 in- lasting, resting CD4+ T cells. Reversing proviral latency is hibitor achieved synergistic effects on HIV-1 activa- believed to be a major challenge for strategies to eradicate tion. This study suggests that coordinated and dy- HIV from an individual and achieve a functional cure. To namic modifications at histone H3K27 and H3R26 or- this end, recently discussed and tested approaches to tar- chestrate HIV-1 LTR-mediated transcription, and po- get latency involve ‘shock and kill’ strategies, which pro- tentially opens a new avenue to disrupt latent HIV-1 pose to reactivate (‘shock’) latent HIV in the presence of infection by targeting specific epigenetic enzymes. cART and apply immune-based therapy to purge (‘kill’) these reservoirs (2,3). Mechanistically, epigenetic transcrip- tional processes drive HIV latency in T cells, as the repres- sive status of chromatin largely contributes to HIV latency (4). In order to reactivate the latent virus, it is essential to *To whom correspondence should be addressed. Tel: +1 713 798 6247; Fax: +1 713 790 1275; Email: [email protected] †These authors contributed equally to this work as first authors. Present address: Zheng Zhang, Department of Lymphoma and Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX, USA. C The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2017, Vol. 45, No. 16 9349 ‘open’ the repressive structure of chromatin that harbors In this study, the Super Elongation Complex (SEC) was the provirus. For instance, it is generally accepted that hi- identified as an H3K27ac-associated complex based ona stone deacetylases (HDACs) are involved in maintenance peptide pull-down/mass spectrum analysis. Interestingly, of repressive chromatin status on the HIV-1 promoter, and the consequent H3R26 methylation event abrogated SEC restoration of histone acetylation by an HDAC inhibitor recruitment, suggesting that H3K27ac is a positive regu- treatment loosens the repressive chromatin structure and re- lator of HIV transcription, whereas H3R26me is a nega- activates latent HIV (5–7). However, the molecular mecha- tive regulator. Consistent with this observation, a CARM1- nism of how site-specific histone acetylation contributes to specific small molecule inhibitor functions as a potent la- transcriptional reactivation on HIV proviral regulatory se- tency reversing agent (LRA) in both cell line and primary quences remains elusive. CD4+ T cell models of HIV latency. When combined with Lysine 27 (K27) on the histone H3 tail is subject to two other latency disrupting compounds, the CARM1 inhibitor covalent modifications: methylation and acetylation. Tri- achieved synergistic effects on HIV-1 reactivation. methylation of H3K27 (H3K27me3) is a transcriptional repression ‘mark’, and its function has been well docu- MATERIALS AND METHODS mented (8–10). The responsible methyltransferase EZH2 (Enhancer of Zeste 2) is an essential component of the In vitro histone methylation assays PRC2 (Polycomb repressive complex 2), and is involved in The in vitro methylation assays were performed as described silencing many important genes during development and previously (25). Briefly, 100 ng of histone methyltransferase cell differentiation (11–13). Interestingly, EZH2 was found enzymes were incubated with substrates (recombinant his- to participate in silencing HIV-1 by methylation of histones tones or histone peptides) in the presence of 20 mM Tris– located at the HIV-1 LTR region (14). A histone lysine HCl (pH 8.0), 4 mM EDTA, 1 mM phenylmethylsulfonyl methyltransferase (HKMT) inhibitor that targets EZH2, 3- fluoride, 0.5 mM dithiothreitol, and 1 ␮lof[3H]AdoMet deazaneplanocin A, can reactivate silenced proviruses (15). (13.3 Ci/mM; PerkinElmer Life Sciences). The reactions / Similarly, GSK343, a specific EZH2 EZH1 inhibitor, has were incubated at 30◦C for 1 h before the proteins were sep- been reported to sensitize the latent HIV to reactivation ef- arated in a 4–15% SDS-polyacrylamide gel (or 10–20% Tris- fect of the HDAC inhibitor vorinostat (16). Tricine gel for methylation of histone peptides). After fixa- In contrast to H3K27 methylation, acetylation at H3K27 tion in a mixture containing 50% methanol and 10% acetic (H3K27ac) is a key epigenetic mark that correlates with acid for 20 min, the gels were treated with autoradiography gene transcriptional activation (17,18). Because methyla- Amplify reagent (Amersham Biosciences) for 20 min, dried, tion and acetylation occur on the same residue and have op- and exposed to X-ray films. Recombinant EZH2 protein posite functions, it is anticipated that there is an antagonis- complex, wildtype, K27-acetylated, and K27-trimethylated tic switch between methylation and acetylation on H3K27. histone H3 proteins were purchased from Active Motif. Re- Indeed, knockout of EZH2 or Suz12 (another integral com- combinant CARM1 protein was obtained from Millipore, ponent in PRC2) abrogates H3K27me3, and meanwhile and p300 protein was generated from the baculoviral system greatly enhances the level of H3K27ac in mouse ES cells as previously described (33). (19). Similarly, histone deacetylase inhibitors LBH589 and LAQ824 increase histone acetylation levels, and simultane- ously decrease H3K27 methylation levels in primary human Plasmid DNA acute leukemia cells (20). Therefore, it is expected that en- Histone H3 K27M mutant and its corresponding wildtype hancing H3K27ac levels could contribute to re-activation H3 were constructed in a pET16b expression vector. The of silenced HIV provirus. K27M mutation was generated by PCR-based site-directed In this study, we investigated how H3K27 acetylation mutagenesis. The sequences of the PCR primers are: regulates HIV-1 transcription. We found that H3K27ac is 5GCTACAAAAGCCGCTCGCATGAGTGCGCCC a preferable substrate for H3R26 methylation catalyzed TCTACTGG-3 (forward); 5-CCAGTAGAGGGCGC by a transcriptional coregulator protein termed CARM1 ACTCATGCGAGCGGCTTTTGTAGC-3
Recommended publications
  • Searching for Inhibitors of the Protein Arginine Methyl Transferases: Synthesis and Characterisation of Peptidomimetic Ligands

    Searching for Inhibitors of the Protein Arginine Methyl Transferases: Synthesis and Characterisation of Peptidomimetic Ligands

    SEARCHING FOR INHIBITORS OF THE PROTEIN ARGININE METHYL TRANSFERASES: SYNTHESIS AND CHARACTERISATION OF PEPTIDOMIMETIC LIGANDS by ASTRID KNUHTSEN B. Sc., Aarhus University, 2009 M. Sc., Aarhus University, 2012 A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Pharmaceutical Sciences) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) March 2016 © Astrid Knuhtsen, 2016 UNIVERSITY OF COPENH AGEN FACULTY OF HEALTH A ND MEDICAL SCIENCES PhD Thesis Astrid Knuhtsen Searching for Inhibitors of the Protein Arginine Methyl Transferases: Synthesis and Characterisation of Peptidomimetic Ligands December 2015 This thesis has been submitted to the Graduate School of The Faculty of Health and Medical Sciences, University of Copenhagen ii Thesis submission: 18th of December 2015 PhD defense: 11th of March 2016 Astrid Knuhtsen Department of Drug Design and Pharmacology Faculty of Health and Medical Sciences University of Copenhagen Universitetsparken 2 DK-2100 Copenhagen Denmark and Faculty of Pharmaceutical Sciences University of British Columbia 2405 Wesbrook Mall BC V6T 1Z3, Vancouver Canada Supervisors: Principal Supervisor: Associate Professor Jesper Langgaard Kristensen Department of Drug Design and Pharmacology, University of Copenhagen, Denmark Co-Supervisor: Associate Professor Daniel Sejer Pedersen Department of Drug Design and Pharmacology, University of Copenhagen, Denmark Co-Supervisor: Assistant Professor Adam Frankel Faculty of Pharmaceutical
  • Asymmetric Expression of Lincget Biases Cell Fate in Two-Cell Mouse Embryos

    Asymmetric Expression of Lincget Biases Cell Fate in Two-Cell Mouse Embryos

    UC Riverside UC Riverside Previously Published Works Title Asymmetric Expression of LincGET Biases Cell Fate in Two-Cell Mouse Embryos. Permalink https://escholarship.org/uc/item/3100h0cm Journal Cell, 175(7) ISSN 0092-8674 Authors Wang, Jiaqiang Wang, Leyun Feng, Guihai et al. Publication Date 2018-12-01 DOI 10.1016/j.cell.2018.11.039 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Article Asymmetric Expression of LincGET Biases Cell Fate in Two-Cell Mouse Embryos Graphical Abstract Authors Jiaqiang Wang, Leyun Wang, Guihai Feng, ..., Zhonghua Liu, Wei Li, Qi Zhou Correspondence [email protected] (W.L.), [email protected] (Q.Z.) In Brief An endogenous retrovirus-associated nuclear long noncoding RNA biases cell fate in mouse two-cell embryos. Highlights Data Resources d LincGET is asymmetrically expressed in the nucleus of two- GSE110419 to four-cell mouse embryos d LincGET overexpression biases blastomere fate toward inner cell mass (ICM) d LincGET physically binds to CARM1 d LincGET/CARM1 activates ICM-specific genes Wang et al., 2018, Cell 175, 1887–1901 December 13, 2018 ª 2018 Elsevier Inc. https://doi.org/10.1016/j.cell.2018.11.039 Article Asymmetric Expression of LincGET Biases Cell Fate in Two-Cell Mouse Embryos Jiaqiang Wang,1,2,3,4,8 Leyun Wang,1,8 Guihai Feng,1,8 Yukai Wang,1,8 Yufei Li,1,2 Xin Li,5,6 Chao Liu,1,2 Guanyi Jiao,1,2 Cheng Huang,1,2 Junchao Shi,7 Tong Zhou,7 Qi Chen,7 Zhonghua Liu,4 Wei Li,1,2,3,* and Qi Zhou1,2,3,9,* 1State Key Laboratory of Stem Cell and Reproductive
  • Establishment and Optimization of the Chrop Approach, Combining Chip and MS-Based Proteomics

    Establishment and Optimization of the Chrop Approach, Combining Chip and MS-Based Proteomics

    PhD degree in Molecular Medicine European School of Molecular Medicine (SEMM), University of Milan and University of Naples “Federico II” Faculty of Medicine Settore disciplinare: BIO/10 Establishment and optimization of the ChroP approach, combining ChIP and MS-based proteomics, for the characterization of the chromatome at distinct functional domains Monica Soldi IFOM-IEO Campus, Milan Matricola n. R08407 Supervisor: Dr. Tiziana Bonaldi IFOM-IEO Campus, Milan Added co-Supervisor: Dr. Gioacchino Natoli IFOM-IEO Campus, Milan Anno accademico 2011-2012 To my family: Andrea and Paolo! 1 TABLE OF CONTENT FIGURE AND TABLE INDEX ....................................................................................... 5 LIST OF ABBREVIATIONS ....................................................................................... 8 1. ABSTRACT .............................................................................................................. 10 2. INTRODUCTION .................................................................................................... 13 2.1. Chromatin, epigenetics and histone post-translational modifications ............... 13 2.2. Mass Spectrometry analysis and MS-based proteomics ...................................... 17 2.2.1. Basic concepts of Mass Spectrometry........................................................... 19 2.2.2. Different MS approaches for hPTMs analysis: from “Bottom Up” to “Top Down”, via “Middle Down” .................................................................................. 25
  • Supporting Information

    Supporting Information

    Supporting Information Chu et al. 10.1073/pnas.1323226111 SI Materials and Methods phenylcarbamate, O-GlcNAz, and phosphine-FLAG were pur- Cell Culture. Human breast cancer cell line MCF7 was cultured in chased from Sigma. DMEM/F12 containing 10% (vol/vol) FBS (Sigma), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco). Human kidney Plasmids. Human full-length OGT (NP_858058.1) was cloned fibroblast HEK 293T and breast cancer cell line MDA-MB-231 from 293T cDNA into pcDNA3.1-V5-HIS (Invitrogen). Human were cultured in DMEM (Gibco) containing 10% (vol/vol) FBS full-length EZH2 (NP_001190176.1) was cloned from 293T (Sigma), 100 U/mL penicillin, and 100 μg/mL streptomycin cDNA into pcDNA3-FLAG. Resistant OGT and EZH2-S75A were constructed using a site-directed mutagenesis method as (Gibco). All cells were cultured at 37 °C with 5% (vol/vol) CO2. described by the manufacturer (Finnzyme). The primers used for Knockdown by siRNA. Briefly, cells at 10% confluence in six-well construction of the resistant OGT plasmid against siOGT siRNA plates were transfected with 20 nM of siRNA by Lipofectamine are as follows: forward primer, 5′-CTA TGA ATA CTA TTG 2000 (Invitrogen) for 3 d. Cells were then harvested for further CGG AGG CGG TGA TCG AGA TGA TCA ACC GAG GAC use. The siRNAs used are Scramble siRNA (Invitrogen), siOGT#1 AGA T-3′ and reverse primer, 5′-ATC TGT CCT CGG TTG (sense, 5′-UAAUCAUUUCAAUAACUGCUUCUGC-3′,and ATC ATC TCG ATC ACC GCC TCC GCA ATA GTA TTC antisense, 5′-GCAGAAGCAGUUAUUGAAAUGAUUA-3′)and ATA G-3′.
  • Histone Arginine Methylation Regulates Pluripotency in the Early

    Histone Arginine Methylation Regulates Pluripotency in the Early

    doi: 10.1038/nature05458 SUPPLEMENTARY INFORMATION a e Distribution of H3R26me in disaggregated late 4- cell stage embryos m 6 2 100 R 3 H 80 60 40 A N D 20 Relative fluorescence intensity 0 b Distribution of H3R26me in late 4-cell stage DNA H3R26me embryos from superovulation 100 80 * 60 40 20 0 Relative fluorescence intensity DNA H3R26me c Distribution of H3R26me at the late 4-cell stage after natural mating 100 80 60 * 40 20 Relative fluorescence intensity 0 Figure S1. Levels of H3R26me are different in the blastomeres of the 4-cell stage embryo. (a)Differences in the levels of H3R26me are not an artifact linked to differential scanning caused by embryo shape. Freshly collected late four cell stage embryos were processed for immunostaining with an H3R26me antibody. The cells of individual embryos were then disaggregated and scanned under confocal microscopy separately. Shown are projections of the 4 nuclei of a representative embryo (n=9) . Sections were taken every 0.8 µm. Fluorescence levels were quantified using the Volocity software and normalised against the blastomere showing the highest level which was set at 100%. Decreasing values of fluorescence were calculated, normalised in each embryo and averaged accordingly (n=9). Each bar represents the relative fluorescence level of each of the 4-cell stage blastomeres. Scale bar 10 µm. (b-c) The variations in the distribution of H3R26me levels at the late 4-cell stage are similar whether they are obtained following hormonally induced superovulation (b; n=18) or derive from natural matings (c; n=14).
  • Epigenetic Regulation of Mouse Preimplantation Embryo Development

    Epigenetic Regulation of Mouse Preimplantation Embryo Development

    Available online at www.sciencedirect.com ScienceDirect Epigenetic regulation of mouse preimplantation embryo development 1,2,3,6 1,2,3,6 1,2,3,4,5 Xudong Fu , Chunxia Zhang and Yi Zhang After fertilization, mouse embryos go through preimplantation major waves. While the minor ZGA occurs in zygotes and development to give rise to blastocyst. Two key molecular early two-cell embryos where about one hundred of events, zygotic genome activation (ZGA) and the first cell zygotic genes are transcribed [2], the major ZGA mainly lineage specification, are essential for the process. Recent takes place in late two-cell embryos with thousands of advances in low-input epigenomics profiling techniques allow genes are actively transcribed [3]. After ZGA, the the analysis of these events at a molecular level, which revealed embryos go through a few cell cleavages before the first a critical role of epigenetic and chromatin reprogramming in cell lineage specification to generate trophectoderm (TE) ZGA and the first cell lineage specification. Additionally, the and inner cell mass (ICM). During the past several years, establishment of an in vitro embryonic stem cell (ESC) to two- great progress has been made in understanding the cell embryo-like conversion system have also contributed to molecular events, particularly in ZGA and the first cell the molecular understanding of preimplantation development. lineage specification, thanks to the development of low- In this review, we summarize recent advances in epigenetic input epigenomic profiling techniques as well as the regulation of mouse preimplantation development, point out establishment of an in vitro cell fate conversion model the remaining questions, and propose strategies to tackle for early embryos.
  • PRDM14 Is a Unique Epigenetic Regulator Stabilizing Transcriptional Networks for Pluripotency

    PRDM14 Is a Unique Epigenetic Regulator Stabilizing Transcriptional Networks for Pluripotency

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Kwansei Gakuin University Repository PRDM14 Is a Unique Epigenetic Regulator Stabilizing Transcriptional Networks for Pluripotency journal or Frontiers in Cell and Developmental Biology publication title volume 6 page range 1-5 year 2018-02-13 URL http://hdl.handle.net/10236/00026967 MINI REVIEW published: 13 February 2018 doi: 10.3389/fcell.2018.00012 PRDM14 Is a Unique Epigenetic Regulator Stabilizing Transcriptional Networks for Pluripotency Yoshiyuki Seki* Department of Biomedical Chemistry, School of Science and Technology, Kwansei Gakuin University, Hyogo, Japan PR-domain containing protein 14 (PRDM14) is a site-specific DNA-binding protein and is required for establishment of pluripotency in embryonic stem cells (ESCs) and primordial germ cells (PGCs) in mice. DNA methylation status is regulated by the balance between de novo methylation and passive/active demethylation, and global DNA hypomethylation is closely associated with cellular pluripotency and totipotency. PRDM14 ensures hypomethylation in mouse ESCs and PGCs through two distinct layers, transcriptional repression of the DNA methyltransferases Dnmt3a/b/l and active demethylation by recruitment of TET proteins. However, the function of PRDM14 remains unclear in other species including humans. Hence, here we focus on the unique characteristics of mouse PRDM14 in the epigenetic regulation of pluripotent cells and primordial germ cells. In addition, we discuss the expression regulation and function of PRDM14 in other species Edited by: Alexey Ruzov, compared with those in mice. University of Nottingham, United Kingdom Keywords: Prdm14, epigenetics, embryonic stem cells (ESCs), primordial germ cells, DNA Methylation Reviewed by: Ian C.
  • DNA Methylation Targeting: the DNMT/HMT Crosstalk Challenge

    DNA Methylation Targeting: the DNMT/HMT Crosstalk Challenge

    biomolecules Review DNA Methylation Targeting: The DNMT/HMT Crosstalk Challenge Omar Castillo-Aguilera 1, Patrick Depreux 1, Ludovic Halby 2, Paola B. Arimondo 2,3,* and Laurence Goossens 1,* 1 Univ. Lille, ICPAL, EA 7365—GRITA—Groupe de Recherche sur les formes Injectables et les Technologies Associées, 3 rue du Pr. Laguesse, F-59000 Lille, France; [email protected] (O.C.-A.); [email protected] (P.D.) 2 FRE3600 Epigenetic Targeting of Cancer, CNRS, 31035 Toulouse, France; [email protected] 3 Churchill College, Cambridge CB3 0DS, UK * Correspondence: [email protected] (P.B.A.); [email protected] (L.G.); Tel.: +33-5-61335919 (P.B.A.); +33-3-20-96-47-02 (L.G.) Academic Editors: Gerda Egger and Melanie R. Hassler Received: 15 November 2016; Accepted: 12 December 2016; Published: 5 January 2017 Abstract: Chromatin can adopt a decondensed state linked to gene transcription (euchromatin) and a condensed state linked to transcriptional repression (heterochromatin). These states are controlled by epigenetic modulators that are active on either the DNA or the histones and are tightly associated to each other. Methylation of both DNA and histones is involved in either the activation or silencing of genes and their crosstalk. Since DNA/histone methylation patterns are altered in cancers, molecules that target these modifications are interesting therapeutic tools. We present herein a vast panel of DNA methyltransferase inhibitors classified according to their mechanism, as well as selected histone methyltransferase inhibitors sharing a common mode of action. Keywords: DNA methylation; histone methylation; DNMT/HMT crosstalk; DNMT inhibitors; HMT inhibitors 1.
  • Systems Level Analysis of Histone H3 Post-Translational Modifications (Ptms) Reveals Features of PTM Crosstalk in Chromatin Regulation

    University of Southern Denmark Systems Level Analysis of Histone H3 Post-translational Modifications (PTMs) Reveals Features of PTM Crosstalk in Chromatin Regulation Schwämmle, Veit; Sidoli, Simone; Ruminowicz, Chrystian; Wu, Xudong; Lee, Chung-Fan; Helin, Kristian; Jensen, Ole Nørregaard Published in: Molecular and Cellular Proteomics DOI: 10.1074/mcp.M115.054460 Publication date: 2016 Document version: Final published version Citation for pulished version (APA): Schwämmle, V., Sidoli, S., Ruminowicz, C., Wu, X., Lee, C-F., Helin, K., & Jensen, O. N. (2016). Systems Level Analysis of Histone H3 Post-translational Modifications (PTMs) Reveals Features of PTM Crosstalk in Chromatin Regulation. Molecular and Cellular Proteomics, 15(8), 2715-2729. https://doi.org/10.1074/mcp.M115.054460 Go to publication entry in University of Southern Denmark's Research Portal Terms of use This work is brought to you by the University of Southern Denmark. Unless otherwise specified it has been shared according to the terms for self-archiving. If no other license is stated, these terms apply: • You may download this work for personal use only. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying this open access version If you believe that this document breaches copyright please contact us providing details and we will investigate your claim. Please direct all enquiries to [email protected] Download date: 09. Oct. 2021 crossmark Research © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. This paper is available on line at http://www.mcponline.org Systems Level Analysis of Histone H3 Post- translational Modifications (PTMs) Reveals Features of PTM Crosstalk in Chromatin Regulation*□S Veit Schwa¨mmle‡ʈ**, Simone Sidoli‡§§**, Chrystian Ruminowicz‡, Xudong Wu§‡‡, Chung-Fan Lee§, Kristian Helin§¶, and Ole N.
  • Symmetric-Di-Methyl-Histone H3 (Arg17) Rabbit Pab

    Symmetric-Di-Methyl-Histone H3 (Arg17) Rabbit Pab

    Symmetric-Di-methyl-Histone H3 (Arg17) rabbit pAb (H3R17me2(sy) pAb) www.ptm-biolab.com.cn Cat#: PTM-679 [email protected] Species: Rabbit 0571-2883 3567 Size: 100 μl Form: supplied in liquid form Recommend Species Swissprot Molecular Application Immunogen dilution Reactivity ID Weight H3R17me2(sy) WB, Dot, ELISA 1:2000 for WB H, M, R P68431 17 KDa -KLH **Species reactivity is determined by WB. Kept at -20oC after reconstituted. *** Anti-rabbit secondary antibodies must be used to detect this antibody. Source/Purification: This product is produced by immunizing rabbits with a synthetic di-methyl(sy) peptide corresponding to residues surrounding Arg17 of human histone H3. Antibodies are purified by protein A-conjugated agarose followed by di-methylated(sy) histone H3 (Arg17) peptide affinity chromatography. Recommended Applications: ELISA, Dot blot, Western blot. Recommended antibody dilution: WB: 1:2000 NOTE: For WB, incubate membrane with diluted antibody in 5% nonfat milk, 1 x TBS, 0.1% Tween- 20 for two hours at room temperature with gentle shaking. Prepare working dilution immediately before use. Use at an assay dependent concentration. Optimal dilutions/concentrations should be determined by the end user. Not yet tested in other applications Scientific Description: Protein post-translational Modification (PTM) is an important reversible event controlling protein activity. The amino-terminal tails of core histones undergo multiple modifications in multiple sites, termed as “histone code” or “epigenetic code”. Arginine methylation in core histones is a major determinant for the formation of active and inactive regions of the genome and therefore plays vital roles in multiple cellular events.
  • Anti-Mono-Methyl-Histone H3 (Arg42) Rabbit Pab

    Anti-Mono-Methyl-Histone H3 (Arg42) Rabbit Pab

    Anti-Mono-Methyl-Histone H3 (Arg42) Rabbit pAb Catalog # PTM-610 General Information Images Host species Rabbit Dot Blot Clonality Polyclonal Blocking buffer: 5% NFDM/TBST Primary ab dilution: 1:2000 Clone number / Primary ab incubation condition: 2 hours at room temperature Synonym H3R42me1 Secondary ab: Goat Anti-Rabbit IgG H&L (HRP) Immunogen UniProt MW (kDa) Applications Immunogen peptide quantity: 1 ng, 4 ng, 16 ng species Exposure time: 60 s Human P68431 15 WB The list of peptides is included in the table below: No. Peptide No. Peptide Product Usage Information Lane 1 H3R42me1 Lane 2 H3R17me1 Lane 3 H3R17me2 (sy) Lane 4 H3R17me2 (asy) Application Dilution Recommended species Lane 5 H3R17cit Lane 6 H3R26me1 WB 1:500-1:2000 Human, Mouse, Rat Lane 7 H3R26me2 (sy) Lane 8 H3R26me2 (asy) Lane 9 H3R26cit Lane 10 H3R42me2 (asy) Properties Lane 11 H3R42un Storage Store at -20 °C. Avoid freeze / thaw cycles. WB Stability Stable for 12 months from date of receipt / reconstitution Blocking buffer: 5% NFDM/TBST Primary ab dilution: 1:2000 Constituents PBS, Glycerol, BSA Primary ab incubation condition: 2 hours at Purity Antibodies are purified by Protein A conjugated agarose room temperature followed by Mono-methylated H3 (Arg42) peptide affinity Secondary ab: Goat Anti-Rabbit IgG H&L (HRP) Lysate: MCF-7, C2C12, N2a chromatography. Protein loading quantity: 20 μg Exposure time: 60 s Isotype IgG Predicted MW: 15 kDa Observed MW: 15 kDa Target Information Function Histone post-translational modifications (PTMs) are key Blocking buffer: 5% NFDM/TBST mechanisms of epigenetics that modulate chromatin Primary ab dilution: 1:2000 structures, termed as “histone code”.
  • Molecular Marks for Epigenetic Identification of Developmental and Cancer Stem Cells

    Molecular Marks for Epigenetic Identification of Developmental and Cancer Stem Cells

    Clin Epigenet (2011) 2:27–53 DOI 10.1007/s13148-010-0016-0 REVIEW Molecular marks for epigenetic identification of developmental and cancer stem cells Samir Kumar Patra & Moonmoon Deb & Aditi Patra Received: 1 August 2010 /Accepted: 24 November 2010 /Published online: 17 December 2010 # Springer-Verlag 2010 Abstract Epigenetic regulations of genes by reversible through retroviral techniques. In this contribution, we will methylation of DNA (at the carbon-5 of cytosine) and discuss some of the major discoveries on epigenetic mod- numerous reversible modifications of histones play important ifications within the chromatin of various genes associated roles in normal physiology and development, and epigenetic with cancer progression and cancer stem cells in comparison deregulations are associated with developmental disorders and to normal development of stem cell. These modifications may various disease states, including cancer. Stem cells have the be considered as molecular signatures for predicting disorders capacity to self-renew indefinitely. Similar to stem cells, some of development and for identifying disease states. malignant cells have the capacity to divide indefinitely and are referred to as cancer stem cells. In recent times, direct Keywords Cancer . Development . DNA-methylation . correlation between epigenetic modifications and reprogram- Histone modification . Epigenetics . Cancer Stem cell ming of stem cell and cancer stem cell is emerging. Major discoveries were made with investigations on reprogramming gene products, also known as master regulators of totipotency Introduction and inducer of pluoripotency, namely, OCT4, NANOG, cMYC, SOX2, Klf4, and LIN28. The challenge to induce Defining the growth requirements for the maintenance pluripotency is the insertion of four reprogramming genes and differentiation of developmental and cancer cells, (Oct4, Sox2, Klf4, and c-Myc) into the genome.