9348–9360 Nucleic Acids Research, 2017, Vol. 45, No. 16 Published online 20 June 2017 doi: 10.1093/nar/gkx550 Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency Zheng Zhang1,†, Bryan C. Nikolai1,†, Leah A. Gates1, Sung Yun Jung2, Edward B. Siwak3, Bin He1,4, Andrew P. Rice3, Bert W. O’Malley1 and Qin Feng1,* 1Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA, 2Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX, USA, 3Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, TX, USA and 4Department of Medicine-Hematology & Oncology, Baylor College of Medicine, Houston, TX, USA Received February 06, 2017; Revised May 25, 2017; Editorial Decision June 13, 2017; Accepted June 15, 2017 ABSTRACT INTRODUCTION In eukaryotic cells, the gene expression status Human immunodeficiency virus (HIV) is a retrovirus that is strictly controlled by epigenetic modifications causes acquired immunodeficiency syndrome. HIV infec- on chromatin. The repressive status of chromatin tion of CD4+ helper T lymphocytes is a multistep process, largely contributes to HIV latency. Studies have involving fusion and entry through interaction with CD4 re- shown that modification of histone H3K27 acts as ceptor and CCR5 co-receptor, reverse transcription of HIV viral RNA into double-stranded viral DNA, and integra- a key molecular switch for activation or suppression tion of viral DNA into the host cell genome. Combination of many cellular genes. In this study, we found that Antiretroviral Therapy (cART), also known as highly ac- K27-acetylated histone H3 specifically recruited Su- tive antiretroviral therapy (HAART), employs the use of per Elongation Complex (SEC), the transcriptional three or more antiretroviral drugs to inhibit the key steps of elongation complex essential for HIV-1 long terminal HIV infection, and has been very effective in HIV-infected repeat (LTR)-mediated and general cellular transcrip- patients by suppressing HIV replication and maintaining tion. Interestingly, H3K27 acetylation further stim- the virus at undetectable levels. However, although continu- ulates H3R26 methylation, which subsequently ab- ous cART is life-prolonging, it never eradicates HIV infec- rogates the recruitment of SEC, forming a negative tion or cures this disease. Interruption of treatment quickly feedback regulatory loop. Importantly, by inhibiting results in virus replication and recurrence of the disease methyltransferase activity of CARM1, the enzyme re- (1). Therefore, HIV-infected patients must receive lifelong cART treatment, which presents economic and therapeutic sponsible for H3R26 methylation, HIV-1 transcription burdens. is reactivated in several HIV latency cell models, in- The principal impediment to eradication of HIV infec- cluding a primary resting CD4+ T cell model. When tion is the latent reservoir of HIV provirus. HIV provirus combined with other latency disrupting compounds persists in multiple tissues and cells, particularly the long- such as JQ1 or vorinostat/SAHA, the CARM1 in- lasting, resting CD4+ T cells. Reversing proviral latency is hibitor achieved synergistic effects on HIV-1 activa- believed to be a major challenge for strategies to eradicate tion. This study suggests that coordinated and dy- HIV from an individual and achieve a functional cure. To namic modifications at histone H3K27 and H3R26 or- this end, recently discussed and tested approaches to tar- chestrate HIV-1 LTR-mediated transcription, and po- get latency involve ‘shock and kill’ strategies, which pro- tentially opens a new avenue to disrupt latent HIV-1 pose to reactivate (‘shock’) latent HIV in the presence of infection by targeting specific epigenetic enzymes. cART and apply immune-based therapy to purge (‘kill’) these reservoirs (2,3). Mechanistically, epigenetic transcrip- tional processes drive HIV latency in T cells, as the repres- sive status of chromatin largely contributes to HIV latency (4). In order to reactivate the latent virus, it is essential to *To whom correspondence should be addressed. Tel: +1 713 798 6247; Fax: +1 713 790 1275; Email: [email protected] †These authors contributed equally to this work as first authors. Present address: Zheng Zhang, Department of Lymphoma and Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX, USA. C The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2017, Vol. 45, No. 16 9349 ‘open’ the repressive structure of chromatin that harbors In this study, the Super Elongation Complex (SEC) was the provirus. For instance, it is generally accepted that hi- identified as an H3K27ac-associated complex based ona stone deacetylases (HDACs) are involved in maintenance peptide pull-down/mass spectrum analysis. Interestingly, of repressive chromatin status on the HIV-1 promoter, and the consequent H3R26 methylation event abrogated SEC restoration of histone acetylation by an HDAC inhibitor recruitment, suggesting that H3K27ac is a positive regu- treatment loosens the repressive chromatin structure and re- lator of HIV transcription, whereas H3R26me is a nega- activates latent HIV (5–7). However, the molecular mecha- tive regulator. Consistent with this observation, a CARM1- nism of how site-specific histone acetylation contributes to specific small molecule inhibitor functions as a potent la- transcriptional reactivation on HIV proviral regulatory se- tency reversing agent (LRA) in both cell line and primary quences remains elusive. CD4+ T cell models of HIV latency. When combined with Lysine 27 (K27) on the histone H3 tail is subject to two other latency disrupting compounds, the CARM1 inhibitor covalent modifications: methylation and acetylation. Tri- achieved synergistic effects on HIV-1 reactivation. methylation of H3K27 (H3K27me3) is a transcriptional repression ‘mark’, and its function has been well docu- MATERIALS AND METHODS mented (8–10). The responsible methyltransferase EZH2 (Enhancer of Zeste 2) is an essential component of the In vitro histone methylation assays PRC2 (Polycomb repressive complex 2), and is involved in The in vitro methylation assays were performed as described silencing many important genes during development and previously (25). Briefly, 100 ng of histone methyltransferase cell differentiation (11–13). Interestingly, EZH2 was found enzymes were incubated with substrates (recombinant his- to participate in silencing HIV-1 by methylation of histones tones or histone peptides) in the presence of 20 mM Tris– located at the HIV-1 LTR region (14). A histone lysine HCl (pH 8.0), 4 mM EDTA, 1 mM phenylmethylsulfonyl methyltransferase (HKMT) inhibitor that targets EZH2, 3- fluoride, 0.5 mM dithiothreitol, and 1 ␮lof[3H]AdoMet deazaneplanocin A, can reactivate silenced proviruses (15). (13.3 Ci/mM; PerkinElmer Life Sciences). The reactions / Similarly, GSK343, a specific EZH2 EZH1 inhibitor, has were incubated at 30◦C for 1 h before the proteins were sep- been reported to sensitize the latent HIV to reactivation ef- arated in a 4–15% SDS-polyacrylamide gel (or 10–20% Tris- fect of the HDAC inhibitor vorinostat (16). Tricine gel for methylation of histone peptides). After fixa- In contrast to H3K27 methylation, acetylation at H3K27 tion in a mixture containing 50% methanol and 10% acetic (H3K27ac) is a key epigenetic mark that correlates with acid for 20 min, the gels were treated with autoradiography gene transcriptional activation (17,18). Because methyla- Amplify reagent (Amersham Biosciences) for 20 min, dried, tion and acetylation occur on the same residue and have op- and exposed to X-ray films. Recombinant EZH2 protein posite functions, it is anticipated that there is an antagonis- complex, wildtype, K27-acetylated, and K27-trimethylated tic switch between methylation and acetylation on H3K27. histone H3 proteins were purchased from Active Motif. Re- Indeed, knockout of EZH2 or Suz12 (another integral com- combinant CARM1 protein was obtained from Millipore, ponent in PRC2) abrogates H3K27me3, and meanwhile and p300 protein was generated from the baculoviral system greatly enhances the level of H3K27ac in mouse ES cells as previously described (33). (19). Similarly, histone deacetylase inhibitors LBH589 and LAQ824 increase histone acetylation levels, and simultane- ously decrease H3K27 methylation levels in primary human Plasmid DNA acute leukemia cells (20). Therefore, it is expected that en- Histone H3 K27M mutant and its corresponding wildtype hancing H3K27ac levels could contribute to re-activation H3 were constructed in a pET16b expression vector. The of silenced HIV provirus. K27M mutation was generated by PCR-based site-directed In this study, we investigated how H3K27 acetylation mutagenesis. The sequences of the PCR primers are: regulates HIV-1 transcription. We found that H3K27ac is 5GCTACAAAAGCCGCTCGCATGAGTGCGCCC a preferable substrate for H3R26 methylation catalyzed TCTACTGG-3 (forward); 5-CCAGTAGAGGGCGC by a transcriptional coregulator protein termed CARM1 ACTCATGCGAGCGGCTTTTGTAGC-3