Cent. Eur. J. Chem. • 12(12) • 2014 • 1271-1279 DOI: 10.2478/s11532-014-0550-2

Central European Journal of Chemistry

New genetic insights to consider coffee waste as feedstock for fuel, feed, and chemicals1

Research Article Ryan M. Summers1,2, Sridhar Gopishetty1, Sujit K. Mohanty1,2, Mani Subramanian1,2*

1Center for Biocatalysis and Bioprocessing, The University of Iowa, Coralville, IA 52241, USA

2Department of Chemical and Biochemical Engineering, The University of Iowa, Coralville, IA 52241, USA

Received 23 October 2013; Accepted 27 February 2014

Abstract: Caffeine is a natural plant product found in many drinks, including coffee, tea, soft and energy drinks. Due to caffeine’s presence in the environment, microorganisms have evolved two different mechanisms to live on caffeine. The genetic maps of the caffeine N-demethylation pathway and C-8 oxidation pathway have been discovered in Pseudomonas putida CBB5 and Pseudomonas sp. CBB1, respectively. These genes are the only characterized bacterial caffeine-degrading genes, and may be of great value in producing fine chemicals, biofuels, and animal feed from coffee and tea waste. Here, we present preliminary results for production of theobromine and 7-methylxanthine from caffeine and theobromine, respectively, by two strains of metabolically engineered E. coli. We also demonstrate complete decaffeination of tea extract by an immobilized mixed culture of Klebsiella and Rhodococcus cells. These processes provide a first level demonstration of biotechnological utilization of coffee and tea waste. Keywords: Caffeine • Coffee waste • Pseudomonas putida CBB5 • Pseudomonas sp. CBB1 • N-demethylase © Versita Sp. z o.o.

1. Introduction pulp, coffee husk and spent coffee grounds. Coffee pulp and coffee husk are the solids such as outer skin Coffee is a major worldwide agricultural commodity, and attached residual pulp obtained after de-hulling with over 8.1 million metric tons produced in 2012 [1]. coffee cherries by wet and dry processing methods, Coffee is also the top agricultural commodity imported respectively [10]. In contrast, spent coffee grounds are into the United States, with over $7 billion worth of produced after brewing of roasted and ground coffee coffee imported in 2012 [2], and an annual per capita beans for consumption. consumption of approximately 4.24 kg [3]. Due to the Both coffee pulp and coffee husk are rich in high production and consumption of coffee, millions of carbohydrates (45-60% dry weight), proteins (9-12% metric tons of waste are generated each year. Only dry weight), fats (2% dry weight), and fiber (20% dry 18% of the coffee cherry is composed of the green weight) [5,11,12]. Spent coffee grounds also contain coffee bean, with the remaining 82% removed as waste many nutrients, including fiber (35-44% dry weight), [4]. Liquid wastes contain an extremely high biological protein (10-12% dry weight), and oil (11-20% dry weight) oxygen demand and must first be oxygenated prior to [6]. All of these components make for a useful animal release into environmental waters [4]. Solid wastes supplement. However, a caffeine concentration of 1.3% are typically burned, composted, ensilaged, or used (dry weight) in the coffee waste leads to a reduction in as garden fertilizer [4-6]. The caffeine in these coffee feed intake, protein digestibility, and retention of nitrogen waste products can have adverse environmental effects, when given to cattle. Therefore, removal of caffeine is including autotoxic effects on plants, inhibition of seed key for use of coffee waste as a suitable animal feed. germination [7] and toxicity to insects and bacteria [8,9]. Because caffeine is so widespread in the environment, There are three main types of coffee waste: coffee spreading through both natural plant production and

* E-mail: [email protected] 1Results from this paper have been presented at the conference: Catalysis for Renewable Sources: Fuel, Energy, Chemicals held in Lund, Sweden, 1271 on July 22-28, 2013. New genetic insights to consider coffee waste as feedstock for fuel, feed, and chemicals

Table 1. Compilation of bacteria capable of degrading caffeine and their attributes.

Organism Pathway Enzymes Genes Reference

monooxygenases Pseudomonas putida CBB5 N-demethylation ndmABCDE [13-16] NdmABCDE Dehydrogenase, Cdh, cdhABC, tmuM, tmuH, Pseudomonas sp. CBB1 C-8 oxidation [17,18] monooxygenase, TmuM tmuD, orf1 Pseudomonas fluorescens N-demethylation N.D.* N.D. [19]

Pseudomonas putida N-demethylation N.D. N.D. [20] Pseudomonas putida No. N-demethylation Theobromine demethylase N.D. [21] 352 Pseudomonas putida WS N-demethylation Heteroxanthine demethylase N.D. [22]

Pseudomonas putida N-demethylation Caffeine demethylase complex N.D. [23] Pseudomonas putida C N.D. N.D. N.D. [24] 3024 Pseudomonas putida L N-demethylation N.D. N.D. [25]

Pseudomonas putida C1 N-demethylation Caffeine demethylase N.D. [26]

Serratia marcescens N-demethylation N.D. N.D. [27]

Klebsiella and Rhodococcus C-8 oxidation Caffeine oxidase N.D. [28,29]

Alcaligenes sp. C-8 oxidation Caffeine oxidase N.D. [30] Pseudomonas alcaligenes N.D. N.D. N.D. [31] CFR 1708 Pseudomonas putida NCIM N-demethylation Demethylases N.D. [32] 5235

*N.D.; Not determined.

human waste, it is not surprising that bacteria have the enzymes trimethyl-HIU hydrolase, trimethyl-OHCU evolved the ability to degrade caffeine (see Table 1). The decarboxylase and trimethylallantoinase, respectively, majority of these bacteria belong to the Pseudomonas which are responsible for conversion of TM-HIU to genera. In addition, a strain of Serratia marcescens and 3,6,8-trimethylallantoin (TMA), likely S-(+)-TMA, via a mixed culture of Rhodococcus sp. and Klebsiella sp. TM-OHCU (see Fig. 1). While absolute configuration have also been shown to metabolize caffeine. of TMA has not been established, it has been shown Bacteria metabolize caffeine by one of two routes, that one of the enantiomers is enriched over the other sequential N-demethylation or C-8 oxidation, in order to at a ratio of 97:3 [34]. Spontaneous conversion of

break the molecule down into CO2 and NH3 for growth TM-HIU to racemic TMA has also been observed due and energy [13-18]. Although some research has been to instability of TM-HIU [18,34]. Further, based on performed to characterize bacterial caffeine-degrading previous reports on C-8 oxidation pathway in a mixed enzymes, the genes responsible for caffeine metabolism culture consortium of Klebsiella and Rhodococcus [28], in bacteria were unknown unknown until recently. We TMA is proposed to be further hydrolyzed to TMAA and have isolated two bacterial strains capable of growth on completely mineralized to glyoxylate, dimethylurea, and caffeine as the sole source of carbon and nitrogen and monomethylurea. The enzymes and genes involved characterized their caffeine-degrading genes (Table 1). beyond TMA have not been fully characterized. In Pseudomonas sp. CBB1, C-8 oxidation of Pseudomonas putida CBB5 utilizes five novel caffeine to 1,3,7-trimethyluricacid (TMU) is catalyzed genes, ndmABCDE, to metabolize caffeine to xanthine by a novel heterotrimeric caffeine dehydrogenase via N-demethylation [13-16]. Xanthine is then oxidized (Cdh) encoded by genes cdhABC (Fig. 1) [17]. TMU at the C-8 position to form uric acid, which enters the is further degraded in a pathway homologous to normal purine catabolic pathway [33]. The ndmAB genes the uric acid metabolic pathway [18,34]. First, TMU encode Rieske oxygenases (ROs) which carry out the is converted to 1,3,7-trimethyl-5-hydroxyisourate first two steps of caffeine N-demethylation, resulting (TM-HIU) by a 43-kDa NADH-dependent TMU in formation of 7-methylxanthine (Fig. 1). NdmA and monooxygenase (TmuM) [18]. Three additional genes, NdmB are absolutely dependent on a reductase, NdmD, tmuH, tmuD, and orf1 have been proposed to encode for transfer of electrons from NADH. NdmD itself is a

1272 R. M. Summers et al.

Figure 1. Caffeine degradation in Pseudomonas putida CBB5 (A) and Pseudomonas sp. CBB1 (B) with appropriate gene assignments. new type of RO reductase, as it contains an additional through the C-8 oxidation pathway. The immobilized Rieske [2Fe-2S] cluster at its N-terminus. The third and mixed culture decaffeinated tea extract under both final step in the N-demethylation pathway, conversion batch and continuous processing methods. This work of 7-methylxanthine to xanthine, is catalyzed by an demonstrates the potential to derive fuel, animal feed, unusually large protein complex, NdmCDE. In this and alkylxanthines from tea and coffee waste. protein complex, NdmC contains the non-heme iron as the only redox site, unlike NdmA and NdmB which have both Rieske [2Fe-2S] and non-heme iron. NdmE 2. Experimental procedures is a glutathione-S-transferase homolog that has been proposed to serve a structural role in the complexation 2.1. Chemicals of NdmCDE [16]. This is the first report of a glutathione- Unless otherwise noted, chemicals were obtained from like protein involved in an oxygenase reaction. The Sigma-Aldrich (St. Louis, MO). Tryptone, yeast extract, overall scheme for the N-demethylation by NdmA, and agar were purchased from Becton, Dickinson and NdmB, and NdmCDE complex is shown in Fig. 2 with Company (Sparks, MD). Restriction enzymes and appropriate redox groups involved in catalysis. Phusion high-fidelity DNA polymerase (used for all PCR In the present work, we report preliminary studies reactions) were purchased from New England Bio-Labs. for the microbial decaffeination of tea and coffee waste. Two strains of metabolically engineered Escherichia 2.2. Molecular biology procedures coli were created to decaffeinate coffee waste via ndmA and ndmD were cloned into the pET32a(+) vector N-demethylation. Strain RMS001 converted caffeine as a bicistronic insert with a synthetic ribosomal binding to theobromine, while strain RMS002 converted site (rbsAD1) between the genes using the method theobromine to 7-methylxanthine. Both strains showed of Link et al. [35]. Genomic DNA (gDNA, 500 ng) of good activity, with 100% conversion of caffeine to Pseudomonas putida CBB5 was used as template for theobromine by RMS001 in 1 h and 94% conversion of PCR amplification of ndmA and ndmD. ndmA was theobromine to 7-methylxanthine in 4 h. Also, a mixed amplified using primer ndmA-F-NdeI (5′-GCACGGCA culture of Klebsiella and Rhodococcus cells immobilized TATGGAGCAGGCGATCATCAATGATGA-3′, 10 μM) in alginate beads completely decaffeinated tea extract and primer ADpoly-R (5′-GGTTGACGTCAAGTTTGTT

1273 New genetic insights to consider coffee waste as feedstock for fuel, feed, and chemicals

Figure 2. Proposed electron transfer scheme showing redox groups involved in the complete N-demethylation of caffeine to xanthine. (A) N1-

demethylation of caffeine to theobromine by NdmA and NdmD. (B) N3-demethylation of theobromine to 7-methylxanthine by NdmB and

NdmD. (C) N7-demethylation of 7-methylxanthine to xanthine by the NdmCDE complex. Redox groups in blue belong to NdmD, while those in red belong to the oxygenase subunits (NdmA, NdmB, and NdmC).

CATCCCCCTCCTCCTTATATGTAGCTCCTATCGC-3′, 10 min (PCR program 2). The 2.9-kb band produced 1 μM), while ndmD was amplified with DApoly-F (5′-GC in this second round of PCR was gel-purified and GATAGGAGCTACATATAAGGAGGAGGGGGATGAAC digested with NdeI and BamHI restriction enzymes. AAACTTGACGTCAACC-3′, 1 μM primer) and ndmD- The restriction digested PCR product was ligated into R-BamHI (5′-GGGACGGGGATCCTCACAGATCGAG pET32a(+) which had been pre-digested with NdeI AACGATTTTTTTGGA-3′, 10 μM primer). Both genes and BamHI, forming plasmid pAD1. DNA sequencing were amplified using a thermal profile of (1) 1 cycle confirmed successful cloning of both genes and rbsAD1 of 98°C for 30 s; (2) 35 cycles of 98°C for 10 s, 55°C without mutations due to cloning procedures. for 30 s, and 72°C for 60 s; (3) 72°C for 10 min (PCR ndmB and ndmD were also cloned together into program 1). Reaction mixtures containing amplifiedndmA pET32a(+) with a synthetic rbs (rbsBD1) between the and ndmD were mixed 1:1 (v/v) and used as template two genes as above. A primary round of PCR was (8 μL mixture per 100 μL reaction) in a second round of carried out with PCR program 1 using CBB5 gDNA PCR amplification with primers ndmA-F-NdeI (10 μM) (500 ng) and either primer ndmB-F-AseI (5′-GCCCGGA and ndmD-R-BamHI (10 μM) and a thermal profile of TTAATGAAAGAACAGCTCAAGCCGCTGCTAGAA-3′, (1) 1 cycle of 98°C for 30 s; (2) 35 cycles of 98°C for 10 μM) and primer BDpoly-R (`-GGTTGACGTCAAGT 10 s, 58°C for 30 s, and 72°C for 90 s; (3) 72°C for TTGTTCATGGTACCGGGCCCGGACTTACTGTTCT

1274 R. M. Summers et al.

TCTTCAATAACA-3′, 1 μM) or DBpoly-F (5′-TTATTGA beads had formed, they were aged for 1 h in the calcium AGAAGAACAGTAAGTCCGGGCCCGGTACCATGA chloride solution. The beads were removed by filtration, ACAAACTTGACGTCAACCAG-3′, 1 μM) and primer washed with sodium phosphate buffer (10 mM, pH 7.2), ndmD-R-BamHI (10 μM) for amplification of ndmB and and stored at 4oC until further use. ndmD, respectively. PCR reaction mixtures containing ndmB and ndmD were mixed 1:1 (v/v), diluted ten-fold 2.4. Tea decaffeination by immobilized mixed with water, and used as template for a second round culture of PCR (8 μL 10-1 diluted mixture per 100 μL reaction). Tea extract was prepared by boiling black tea powder PCR program 2 was used with ndmB-F-AseI (10 μM) (25 g) in deionized water (50 mL) for 10 min. After and ndmD-R-BamHI (10 μM) to amplify both genes in boiling, the solids were allowed to settle and the tea a single PCR fragment. The 2.9-kb PCR product was extract was filtered through Whatman filter paper. Clear gel-purified and digested with AseI (because ndmB has supernatant obtained was subjected to HPLC analysis an internal NdeI site) and BamHI restriction enzymes. [28] to determine caffeine concentration. Tea extract Following digestion, the PCR product was ligated into (25 mL) was added to sodium phosphate buffer (25 mL, pET32a(+) which was pre-digested with NdeI and 10 mM, pH 7.2), and alginate beads (12 g, equivalent BamHI, forming plasmid pBD1. DNA sequencing to 500 mg wet cell weight) containing the immobilized confirmed successful cloning of both genes and rbsBD1 mixed culture were added. The suspension was without mutations due to cloning procedures. incubated at 30°C on a rotary shaker at 220 rpm, and E. coli BL21(DE3) chemical competent cells were samples were taken at regular intervals to monitor prepared after the method of Chung et al. [36]. Plasmids disappearance of caffeine by HPLC. pAD1 or pBD1 (100 ng each) were transformed into Decaffeination of tea extract was also carried out chemical competent BL21(DE3) cells (100 μL), resulting in a continuous manner with alginate beads (25 g) in E. coli strains RMS001 and RMS002, respectively. containing immobilized mixed culture packed in a column Transformants were obtained by overnight incubation (20 mm diameter and 20 cm length). The column was on LB agar plates containing ampicillin (100 µg mL-1). initially equilibrated in sodium phosphate buffer (10 mM, A single colony of each strain was selected for activity pH 7.2). Then, tea extract (50 mL) was fed through analysis. the inlet using a peristaltic pump with a flow rate of Methods for growing cells, inducing protein 25 mL h-1 at room temperature. The tea extract was expression, performing resting cell assays, and analyzing recycled through the column until decaffeination was assays by high pressure liquid chromatography (HPLC) complete, as monitored by HPLC. have been described previously [13-16]. The HPLC used in these experiments was a Shimadzu LC-20AT HPLC system equipped with a SPD-M20A photodiode 3. Results array detector and a Hypersil BDS C18 column (4.6 by 125 mm). 3.1. Metabolic engineering of E. coli for alkylxanthine biotransformation 2.3. Immobilization of mixed Klebsiella and Two new strains of E. coli were engineered using Rhodococcus culture the ndm genes from P. putida CBB5; strain RMS001 Mixed culture consisting of organisms belonging to contained ndmA and ndmD, while strain RMS002 the genera Klebsiella and Rhodococcus were used in contained ndmB and ndmD. RMS001 resting cells this study. The mixed culture was grown in modified (OD600 = 10.0) stoichiometrically converted caffeine Seubert’s medium (30 flasks, 100 mL each) [37], (754 μM) to theobromine in 45 min (Fig. 3A). Similarly, containing glucose (0.1%) and caffeine (0.04%) at resting cells of RMS002 (OD600 = 10.0) stoichiometrically 30oC and 220 rpm. After 36 h growth, the culture was converted theobromine (706 μM) to 7-methylxanthine in centrifuged at 4,500 × g for 15 minutes. The resulting 4 h (Fig. 3B). cell paste (4.0 g WCW) was suspended in 30-mL of 10 mM sodium phosphate buffer (30 mL, 10 mM, 3.2. Decaffeination of tea extract by immobilized pH 7.2), after which 30-mL of 2% sodium alginate mixed culture- batch and continuous (30 mL, 2%) was added and thoroughly mixed. The processes homogenous cell suspension was added drop-wise into A mixed culture composed of Klebsiella and a chilled calcium chloride solution (300 mL, 0.2 M) using Rhodococcus cells immobilized in alginate beads was a syringe (10 mL) fitted with a needle (18 mm). After the tested for decaffeination of tea extract. The alginate

1275 New genetic insights to consider coffee waste as feedstock for fuel, feed, and chemicals

Figure 3. Methylxanthine biotransformation by resting cells of metabolically engineered E. coli. (A) Conversion of 754 μM caffeine ( ) to theobromine ( ) by E. coli RMS001. (B) Conversion of 706 μM theobromine ( ) to 7-methylxanthine ( ) over 240 min by E. coli RMS002.

Figure 4. HPLC profile of decaffeination of tea extract by immobilized mixed culture of Klebsiella and Rhodococcus cells. Caffeine eluted from the column in 4.2 min.

beads were added to tea extract diluted 1:1 in sodium 4. Discussion phosphate buffer (10 mM, pH 7.2) and incubated at 30°C with rotary shaking. Caffeine (8.2 mM) was consumed CBB5 has been used to completely decaffeinate coffee from the tea extract by the immobilized mixed culture, and tea extracts with caffeine concentrations of 18 mM with complete decaffeination occurring within 21 h and 8.3 mM, respectively (Table 2) [38]. Similarly, CBB1 (Fig. 4). cells degraded caffeine in tea extract, although at a Immobilized beads were also packed into a column slower rate than CBB5 (Table 2) [38]. Mazzafera [39] with tea extract flowing through the column in continuous reported that a Pseudomonas putida strain achieved up mode at room temperature. Under these conditions, to 80% decaffeination of coffee husk. To our knowledge, the tea extract was completely decaffeinated in 48 h these are currently the only reports on the decaffeination (Table 2). The immobilized mixed culture degraded of coffee, tea, or coffee wastes by bacteria. caffeine in tea extract slower than cells of P. putida Although use of microbes for decaffeination has CBB5 suspended in either tea or coffee extract been previously investigated, most attempts have (Table 2). In the mixed culture, it is not clear which been performed with fungi. Penicillium verrucosum, organism does what or if both organisms are required. Aspergillus tamari V12A25, and Aspergillus sp. have The mixed culture degrades caffeine via C-8 oxidation, all been used in solid-state fermentation to decaffeinate which could be a reason for the slower process. coffee husk, coffee pulp and husk [40-42]. Rhizopus Likewise, CBB1, which is well characterized with respect delemar has also been used to decaffeinate coffee to C-8 oxidation, is also slower compared to CBB5. husk in a packed bed column reactor [43]. Other strains There is a large difference in caffeine degradation rates belonging to the Rhizopus, Phanerochaete, Aspergillus, between CBB1 and CBB5 cells; the latter is extremely and Penicillium genera have also been shown to grow well characterized with respect to the N-demethylation on and decaffeinate coffee waste [42,44]. It is worth pathway (Fig. 1). noting here that enzymes or genes from the above

1276 R. M. Summers et al.

Table 2. Comparison of decaffeination of coffee or tea extracts by various bacteria.

[Caffeine] (μM) Organism(s) Method Extract Initial Final Total time Reference Used (h)

Klebsiella and Rhodococcus Immobilized Cells- Batch Te a 8.2 0 21 This study Immobilized Cells- Klebsiella and Rhodococcus Te a 8.2 0 48 This study Continuous

Pseudomonas sp. CBB1 Whole cells (OD600 = 20) Te a 8.3 5 4 [38]

Pseudomonas putida CBB5 Whole cells (OD600 = 20) Te a 8.3 0 1 [38]

Pseudomonas putida CBB5 Whole cells (OD600 = 40) Coffee 18 0 4 [38]

Pseudomonas putida CBB5 Whole cells (OD600 = 20) Coffee 9.3 0 2 [38]

Pseudomonas putida CBB5 Whole cells (OD600 = 4) Coffee 1 0 1 [38] organisms are not characterized. Thus, manipulation of a feedstock for biofuels. Coffee waste contains 45-60% the ndmABCDE genes for better decaffeination process (dry weight) carbohydrates, which could be fermented may prove to be a better solution. to biofuels, such as ethanol or butanol. However, Here, we have presented a preliminary work on the prevailing levels of caffeine in waste can be toxic to decaffeination of tea extract by an immobilized mixed yeast. Therefore, decaffeination may be an important bacterial culture. The goal of this work was to determine first step in utilization of coffee waste as a biofuels whether the immobilized mixed culture cells could be feedstock. Use of coffee waste as a feedstock for used for the purpose of decaffeination. Preliminary biofuels has been considered previously; spent coffee studies carried out using the tea extract clearly indicated grounds have been used to produce biodiesel [45]. that the immobilized mixed culture can be easily used Until now, microbial decaffeination has consisted for the purpose of decaffeination of tea. This method, of completely degrading caffeine. The discovery from an environmental perspective, appears to be far and characterization of bacterial caffeine-degrading superior to the existing methods where organic solvents genes, however, also allows for use of recombinant are used to remove caffeine. The microbial process organisms to produce high-value methylxanthines needs to be scaled up to determine the economics of from coffee waste. This can be a powerful tool to decaffeination. increase the value of coffee waste. We have shown Several chemical engineering aspects must also the utility of recombinant N-demethylase genes be addressed before exploiting the immobilized mixed expressed in E. coli to convert a cheap feedstock culture system for a commercial purpose. One factor to like caffeine to theobromine and theobromine to high study is whether the cells degrade some of the important value 7-methylxanthine. The engineered E. coli flavor constituents of tea extract. It is important that the strains described here may be of use in producing decaffeination process not degrade flavor components 7-methylxanthine from caffeine in coffee and tea of tea. Tea extract contains several constituents, and extract, coffee pulp and husk, and other caffeinated some of them play an important role in providing flavor waste products. Similarly, other combinations of and fragrance to the tea extract. From this preliminary ndm genes may be of use in producing other high- study, it is not possible to comment whether these value methylxanthines, such as paraxanthine, important constituents are further metabolized by the 1-methylxanthine, and 3-methylxanthine. immobilized cells. At this time, we have focused work on recombinant In addition to decaffeination of tea and coffee, expression of ndmABD for production of methylxanthines. immobilized mixed culture may also be used in The methyluric acids produced by Cdh in CBB1 from decaffeinating coffee waste. The decaffeinated coffee methylxanthines have antioxidant properties [46,47] and waste may serve as an animal feed due to its nutrient may also be of interest. Unfortunately, Cdh has resisted content [5,11,12]. Decaffeinated coffee waste may all attempts at soluble expression in E. coli. also be more readily used as potting soil for various Recombinant enzymes may also be used to ornamentals. While coffee waste has been used completely decaffeinate coffee waste. The guanine in domestic gardening, the levels of caffeine in the auxotroph E. coli ΔguaB containing ndmABCD and waste are inhibitory to seeds and seedlings. Finally, an ndmE homolog, gst9 from Janthinobacterium sp. decaffeinated coffee waste may have great potential as Marseille, was able to grow by completely converting

1277 New genetic insights to consider coffee waste as feedstock for fuel, feed, and chemicals

caffeine to xanthine [48]. Use of these genes in a waterways. Use of microorganisms to decaffeinate yeast cell, such as Saccharomyces cerevisiae or the coffee waste prior to disposal may prevent the Pichia pastoris could lead to an integrated process of caffeine from contaminating the environment. Here, decaffeination of coffee waste, followed by fermentation we have demonstrated two methods that may be of to ethanol. The biomass produced in the process (yeast use in treating coffee waste. Immobilized cultures, cells) could also serve as animal feed. whether natural or recombinant organisms, may be of use in large-scale reactions to completely decaffeinate coffee waste. Alternatively, the caffeine present may be 5. Conclusions converted to high-value methylxanthines or methyluric acids by recombinant organisms containing specific The worldwide coffee industry generates millions of caffeine-degrading genes. Finally, decaffeinated coffee metric tons of waste annually, which could in turn waste may be more suitable for use as a feedstock in lead to caffeine pollution in environmental soils and biofuel production or as an animal feed. References

[1] Statistics on Coffee, Historical Data, All exporting S. Gopishetty, M. Subramanian, J. Bacteriol. 191, countries total production crop years 2010/11 to 4624 (2009) 2012/13 (International Coffee Organization, London, [14] R.M. Summers, T.M. Louie, C.L. Yu, UK, 2013) http://www.ico.org/historical/2010-19/ M. Subramanian, Microbiology 157, 583 (2011) PDF/ TOTPRODUCTION.pdf [15] R.M. Summers, T.M. Louie, C.L. Yu, L. Gakhar, [2] Top 25 agricultural import commodities, with level K.C. Louie, M. Subramanian, J. Bacteriol. 194, of processing, by calendar year (United States 2041 (2012) Department of Agriculture, Washington D.C., USA, [16] R.M. Summers, J.L. Seffernick, E.M. Quandt, 2013) 1 C.L. Yu, J.E. Barrick, M.V. Subramanian, [3] Data for calendar year commencing: 2011, data J. Bacteriol. 195, 3933 (2013) sheet (International Coffee Organization, USA, [17] C.L. Yu, Y. Kale, S. Gopishetty, T.M. Louie, 2011) http://www.ico.org/countries/usa.pdf. M. Subramanian, J. Bacteriol. 190, 772 (2008) [4] M.R. Adams, J. Dougan, In: R.J. Clarke, [18] S.K. Mohanty, C.L. Yu, S. Das, T.M. Louie, R. Macrae, (Eds.), Waste Products, Coffee: Volume L. Gakhar, M. Subramanian, J. Bacteriol. 194, 3872 2. Technology (Elsevier Applied Science Publishers, (2012) Ltd, Essex, England, 1987) 257-291 [19] C.A. Woolfolk, J. Bacteriol. 123, 1088 (1975) [5] A. Pandey, C.R. Soccol, P. Nigam, D. Brand, [20] R. Blecher, F. Lingens, Hoppe-Seyler’s Z. Physiol. R. Mohan, S. Roussos, Biochem. Eng. J. 6, 153 Chem. 358, 807 (1977) (2000) [21] Y. Asano, T. Komeda, H. Yamada, Biosci., [6] N. Kondamudi, S.K. Mohapatra, M. Misra, J. Agric. Biotechnol., Biochem. 58, 2303 (1993) Food Chem. 56, 11757 (2008) [22] M. Glück, F. Lingens, Appl. Microbiol. Biotechnol. [7] G.R. Waller, Biologia Plantarum 31, 418 (1989) 28, 59 (1988) [8] R.G. Hollingsworth, J.W. Amrstrong, E. Campbell, [23] O.F.P. Sideso, A.C. Marvier, N.A. Katerelos, Nature 361, 1763 (1980) P.W. Goodenough, Int. J. Food Sci. Tech. 36, 693 [9] J.A. Nathanson, Science 226, 184 (1984) (2001) [10] A.S. Franca, L.S. Oliveira, In: G.S. Ashworth, [24] W.J. Middelhoven, C.M. Bakker, Eur. J. Appl. P. Azevedo (Eds.), Agricultural Wastes, Coffee Microbial. Biotechnol. 15, 214 (1982) processing solid wastes: Current uses and future [25] D.M. Yamaoka-Yano, P. Mazzafera, Rev. Microbiol. perspectives (Nova Science Publishers, Inc., New 30, 62 (1999) York, U. S. A., 2009) 171-189 [26] W. Hohnloser, B. Osswal, F. Lingens, Hoppe- [11] R. Bressani, in: J.E. Braham, R. Bressani (Eds.), Seyler’s Z. Physiol. Chem. 361, 1763 (1980) Coffee Pulp: Composition, Technology, and [27] P. Mazzafera, O. Olsson, G. Sandberg, Microb. Utilization, Potential uses of coffee-berry by- Ecol. 31, 199 (1996) products (International Development Research [28] K.M. Madyastha, G.R. Sridhar, Biochem. Biophys. Centre, Ottawa, Ontario, Canada, 1979) 17-24 Res. Commun. 249, 178 (1998) [12] C. Porres, D. Alvarez, J. Calzada, Biotechnol. Adv. [29] K.M. Madyastha, G.R. Sridhar, B.B. Vadiraja, 11, 519 (1993) Y.S. Madhavi, Biochem. Biophys. Res. Commun. [13] C.L. Yu, T.M. Louie, R. Summers, Y. Kale, 263, 460 (1999)

1278 R. M. Summers et al.

[30] B.R. Mohapatra, N. Harris, R. Nordin, A. Mazumder, Applications (Narosa Publishing House Pvt, Ltd, J. Biotechnol. 125, 319 (2006) New Delhi, India, 2012) 44–67 [31] V.R. Sarath Babu, S. Patra, M.S. Thakur, [39] P. Mazzafera, Scientia Agricola 59, 815 (2002) N.G. Karanth, M.C. Varadaraj, Enzyme Microb. [40] S. Roussos, L. Hannibal, M.A. Aquiahuatl, Technol. 37, 617 (2005) M.R.T. Hernandes, S. Marakis, J. Food Sci. Technol. [32] S.S. Dash, S.N. Gummadi, J. Basic Microbiol. 48, 31, 316 (1994) 227 (2008) [41] M. Hakil, F. Voisinet, G.V. Gonzalez, C. Augur, [33] C.A. Woolfolk, J.S. Downard, J. Bacteriol. 130, Process Biochem. 35, 103 (1999) 1175 (1977) [42] D. Brand, A. Pandey, S. Roussos, C.R. Soccol, [34] S.K. Mohanty, A. Genetic characterization of the Enzyme Microb. Technol. 27, 127 (2000) caffeine C-8 oxidation pathway in Pseudomonas [43] C.V. Tagliari, R.K. Sanson, A. Zanette, R. Teixeira sp. CBB1. B. Validation of caffeine dehydrogenase Franco, C.R. Soccol, Braz. J. Microbiol. 34, 102 as a suitable enzyme for a rapid caffeine diagnostic (2003) test, PhD thesis (University of Iowa, Iowa City, [44] S.N. Gummadi, B. Bhavya, N. Ashok, Appl. Iowa, U.S.A., 2013) Microbiol. Biotechnol. 93, 545 (2012) [35] A.J. Link, D. Phillips, G.M. Church, J. Bacteriol. [45] K. Narasimharao, S. Mohapatra, M. Misra, J. Agric. 179, 6228 (1997) Food Chem. 56, 11757 (2008) [36] C.T. Chung, S.L. Niemela, R.H. Miller, Proc. Natl. [46] Y. Nishida, J. Pharm. Pharmacol. 43, 885 (1991) Acad. Sci. U. S. A. 86, 2172 (1989) [47] V. Schlotte, A. Sevanian, P. Hochstein, [37] W. Seubert, J. Bacteriol. 79, 426 (1960) K.U. Weithmann, Free Radical Biol. Med. 25, 839 [38] S.R. Gopishetty, T.M. Louie, C.L. Yu, (1998) M.V. Subramanian, In: H.N. Thatoi, B.B. Mishra [48] E.M. Quandt, M.J. Hammerling, R.M. Summers, (Eds.), Microbial degradation of caffeine, P.B. Otoupal, B. Slater, R.N. Alnahhas, A. Dasgupta, methylxanthines, and its biotechnological J.L. Bachman, M.V. Subramanian, J.E. Barrick, applications, Microbial Biotechnology: Methods and ACS Synth. Biol. 2, 301 (2013)

1279