DOCSLIB.ORG

B Cells +CD5 + CD23 Acute and Chronic Lymphocytic Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
B Cells +CD5 + CD23 Acute and Chronic Lymphocytic Leukemia CXC Chemokine Ligand 13 and CC Chemokine Ligand 19 Cooperatively Render Resistance to Apoptosis in B Cell Lineage Acute and Chronic Lymphocytic Leukemia This information is current as CD23+CD5+ B Cells of September 28, 2021. Hu Chunsong, He Yuling, Wang Li, Xiong Jie, Zhou Gang, Zhang Qiuping, Gao Qingping, Zhang Kejian, Qiao Li, Alfred E. Chang, Jin Youxin and Tan Jinquan J Immunol 2006; 177:6713-6722; ; Downloaded from doi: 10.4049/jimmunol.177.10.6713 http://www.jimmunol.org/content/177/10/6713 http://www.jimmunol.org/ References This article cites 54 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/177/10/6713.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 28, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology CXC Chemokine Ligand 13 and CC Chemokine Ligand 19 Cooperatively Render Resistance to Apoptosis in B Cell Lineage Acute and Chronic Lymphocytic Leukemia CD23؉CD5؉ B Cells1 Hu Chunsong,2*† He Yuling,2† Wang Li,2† Xiong Jie,†‡ Zhou Gang,† Zhang Qiuping,† Gao Qingping,§ Zhang Kejian,§ Qiao Li,†¶ Alfred E. Chang,¶ Jin Youxin,‡ and Tan Jinquan3*† CXCL13/CXCR5 and CCL19/CCR7 play a quite important role in normal physiological conditions, but the functions of both chemokine/receptor pairs in pathophysiological events are not well-investigated. We have investigated expression and functions of CXCL13/CXCR5 and CCL19/CCR7 in CD23؉CD5؉ and CD23؉CD5؊ B cells from cord blood (CB) and patients with B cell lineage acute or chronic lymphocytic leukemia (B-ALL or B-CLL). CXCR5 and CCR7 are selectively expressed on B-ALL, ؉ ؉ ؉ ؊ B-CLL, and CB CD23 CD5 B cells at high frequency, but not on CD23 CD5 B cells. Although no significant chemotactic Downloaded from responsiveness was observed, CXCL13 and CCL19 cooperatively induce significant resistance to TNF-␣-mediated apoptosis in B-ALL and B-CLL CD23؉CD5؉ B cells, but not in the cells from CB. B-ALL and B-CLL CD23؉CD5؉ B cells express elevated levels of paternally expressed gene 10 (PEG10). CXCL13 and CCL19 together significantly up-regulate PEG10 expression in the same cells. We have found that CXCL13 and CCL19 together by means of activation of CXCR5 and CCR7 up-regulate PEG10 expression and function, subsequently stabilize caspase-3 and caspase-8 in B-ALL and B-CLL CD23؉CD5؉ B cells, and further rescue the cells from TNF-␣-mediated apoptosis. Therefore, we suggest that normal lymphocytes, especially naive B and T cells, http://www.jimmunol.org/ use CXCL13/CXCR5 and CCL19/CCR7 for migration, homing, maturation, and cell homeostasis as well as secondary lymphoid tissues organogenesis. In addition, certain malignant cells take advantages of CXCL13/CXCR5 and CCL19/CCR7 for infiltration, resistance to apoptosis, and inappropriate proliferation. The Journal of Immunology, 2006, 177: 6713–6722. lthough they decrease with age, CD5ϩ B cells are the and CD5ϩ B cells are indicated as a self-replenishing subpopula- major population in fetal life Most human IgMϩ cord tion, showing an increased propensity to malignant transformation A blood (CB)4 B cells express CD5; however, in the adult, (1). CD23ϩCD5ϩ B cells comprise the largest group of the ma- they represent 10–25% of B cells in blood and ϳ15–30% in tonsil, lignant cells in B cell chronic lymphocytic leukemia (B-CLL) and an important component in B cell lineage acute (B-ALL). by guest on September 28, 2021 CCL19 (EBV-induced gene-1 ligand chemokine (ELC)) and *Department of Immunology, School of Basic Medical Sciences, Anhui Medical CCL21 (secondary lymphoid tissue chemokine/6Ckine) are li- University, Hefei, China; †Department of Immunology, and Laboratory of Allergy and Clinical Immunology, Institute of Allergy and Immune-Related Diseases and gands for the chemokine receptor CCR7 (Burkitt lymphoma re- Center for Medical Research, Wuhan University School of Medicine, Wuhan, China; ceptor-2), whereas CXCL13 (B cell-attracting chemokine 1 (BCA- ‡The State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Science, 1)) is the only ligand for CXCR5 (Burkitt lymphoma receptor-1) Shanghai, China; §Department of Hematology, The Renmin and Zongnan University (2). Homeostatic chemokines, such as CXCL13, CCL21, and ¶ Hospital, Wuhan University, Wuhan, China; and Department of Surgery, University CCL19, as well as their corresponding receptors, CXCR5 and of Michigan Medical Center, Ann Arbor, MI 48109 CCR7, have been shown to closely cooperate in the development Received for publication April 6, 2006. Accepted for publication August 22, 2006. of lymphoid organs and the maintenance of lymphoid tissue mi- The costs of publication of this article were defrayed in part by the payment of page croarchitecture (2). Expression of CXCR5 can be detected on ma- charges. This article must therefore be hereby marked advertisement in accordance ϩ with 18 U.S.C. Section 1734 solely to indicate this fact. ture recirculating B cells, small subsets of normal CD4 and ϩ 1 This work was supported by the National Key Basic Research Program of China CD8 T cells, and skin-derived migratory dendritic cells (3–6). from the Ministry of Science and Technology of People’s Republic of China (Nos. CXCR5 is essentially responsible for guiding B cells into the B 2001CB510004 and 2001CB510008), and by the National Natural Science Founda- cell zones of secondary lymphoid organs (7–9). However, the ex- tion of China (Nos. 39870674, 30572119, 30030130, and 30471509), Science Foun- dation of Anhui Province, China (No. 98436630), and Education and Research Foun- pression of CXCR5 on a subset of T cells strongly suggests an dation of Anhui Province, China (No. 98JL063) and Research Foundation from additional role for this receptor in T cell migration (9, 10). CCR7 Health Department of Hubei Provincial Government, China (No. 301140344), and a special grant from the Personnel Department of Wuhan University, China. T.J. is a is highly expressed on naive T cells, but expressed at lower levels Chang Jiang Scholar supported by Chang Jiang Scholars Program from Ministry of on peripheral B cells. T cells and B cells show a transient increase Education, People’s Republic of China and Li Ka Shing Foundation, Hong Kong, in receptor expression following their activation (11), whereas T People’s Republic of China. cell differentiation toward effector cells is accompanied by a down- 2 H.C., H.Y., and W.L. contributed equally to this work. regulation of CCR7 on the cell surface (12–14). 3 Address correspondence and reprint requests to Dr. Tan Jinquan, Department of The synergy of CXCL13/CXCR5 and CCL19/CCR7 has been Immunology, School of Basic Medical Sciences, Anhui Medical University, 230032 Hefei, China or Department of Immunology, Wuhan University School of Medicine, shown in both physiological and pathological situations. CXCR5 Wuhan University, Dong Hu Road 115, 430071 Wuchang, Wuhan, People’s Republic cooperated with CCR7 control T cells and dendritic cell homing to of China. E-mail address: [email protected] 4 Abbreviations used in this paper: CB, cord blood; B-CLL, B cell chronic lympho- cytic leukemia; B-ALL, B cell lineage acute; ELC, EBV-induced gene-1 ligand che- apoptosis protein; MCNC, migrating cells on negative control; sh, short hairpin; PKC, mokine; BCA, B cell-attracting chemokine; PEG10, paternally expressed gene 10; protein kinase C; CI, chemotactic index; SIAH1, human homolog of Drosophila HCC, human hepatocellular carcinoma; PI, propidium iodide; IAP, inhibitor of seven in absenia. Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 6714 APOPTOTIC RESISTANCE BY CXCL13 AND CCL19 secondary lymphoid organs (12–14). The balanced expression of Real-time quantitative RT-PCR CCR7 and CXCR5 determines the positioning and proper function All real-time quantitative RT-PCR were performed as described elsewhere of follicular Th cells (11). CXCR5 and CCR7 double-deficient (28, 31). Briefly, the real-time quantitative PCR was performed in special mice lack lymphoid follicles due to an impaired migration of B optical tubes in a 96-well microtiter plate (Applied Biosystems) with an cells (15). Overexpression of CXCR5 and CCR7 on tumor lym- ABI PRISM 7700 Sequence Detector Systems (Applied Biosystems). By phocytes closely related to cells apoptosis as well as their migra- using the SYBR Green PCR Core Reagents kit, fluorescence signals were generated during each PCR cycle via the 5Ј to 3Ј endonuclease activity of tion and infiltration (16–19). The coexpression of CXCR5 and AmpliTaq Gold to provide real-time quantitative PCR information. The CCR7 were also found in B cell leukemia. However, the functional sequences of the specific primers are: CXCR5 sense, 5Ј-GGTCTTCATCT importance of CXCR5-CXCL13/BCA-1 and CCR7-CCL19/ELC TGCCCTTTG-3Ј; CXCR5 antisense, 5Ј-ATGCGTTTCTGCTTGGTTCT- receptor-ligand pairs in the pathophysiological events of malignant 3Ј; CCR7 sense, 5Ј-GCTCCAGGCACGCAACTTT-3Ј; CCR7 antisense, 5Ј-ACCACGACCACAGCGATGA-3Ј; PEG10 sense, 5Ј-ATGATGACAT B cells trafficking, homing, and survival is not fully understood. CGAGCTCCG-3Ј; PEG10 antisense, 5Ј-GCTGGGTAGTTGTGCATCA-3Ј. A novel paternally expressed imprinted gene, paternally ex- All unknown cDNAs were diluted to contain equal amounts of ␤-actin pressed gene 10 (PEG10), is identified as a paternally expressed cDNA.
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-Lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity
    cancers Article CD19 Chimeric Antigen Receptor-Exosome Targets CD19 Positive B-lineage Acute Lymphocytic Leukemia and Induces Cytotoxicity Shabirul Haque 1,2,* and Sarah R. Vaiselbuh 1,2,3 1 Feinstein Institute for Medical Research, Northwell Health, 350 Community Drive, Manhasset, NY 11030, USA; [email protected] 2 Department of Pediatrics, Staten Island University Hospital, Northwell Health, 475 Seaview Ave, Staten Island, NY 10305, USA 3 Monsey Health Center, 40 Robert Pitt Drive, Monsey, NY 10952, USA * Correspondence: [email protected] Simple Summary: Our research describes our designer exosomes express CD19 Chimeric Antigen Receptor (Exo-CD19 CAR). This novel Exo-CD19 CAR is cytotoxic for CD19-positive leukemia B-cells without interfering with cytotoxicity in CD19-negative cells. This innovation can be translated into broader clinical applications as CD19 CAR exosome-based nano-immunotherapy for B-cell leukemia instead of whole CD19 CAR T-cell immunotherapy. Abstract: CAR-T cell therapy is not without some clinical adverse effects, namely cytokine storms, due to a massive release of cytokines when CAR-T cells multiply in the body. Our goal was to develop exosomes expressing CD19 CAR to treat CD19-positive B-cell malignancies, instead of using whole CD19 CAR-T cells, thereby reducing the clinical risk of uncontrolled cytokine storms. Exosomes are Citation: Haque, S.; Vaiselbuh, S.R. extracellular nanovesicles (30–150 nm), composed of lipids, proteins, and nucleic acids, that carry the CD19 Chimeric Antigen fingerprint of their parent cells. Exosomes are a preferred delivery system in nano-immunotherapy. Receptor-Exosome Targets CD19 Here, HEK293T parent cells were transduced with CD19 CAR plasmids and cellular CD19 CAR Positive B-lineage Acute Lymphocytic expression was confirmed.
    [Show full text]
  • ORIGINAL ARTICLE Flow Cytometric Protein Expression Profiling As a Systematic Approach for Developing Disease-Specific Assays
    Leukemia (2006) 20, 2102–2110 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Flow cytometric protein expression profiling as a systematic approach for developing disease-specific assays: identification of a chronic lymphocytic leukaemia-specific assay for use in rituximab-containing regimens AC Rawstron, R de Tute, AS Jack and P Hillmen Haematological Malignancy Diagnostic Service (HMDS), Leeds Teaching Hospitals, Leeds, UK Depletion of disease below the levels detected by sensitive sustained remissions only occur in patients achieving an MRD- minimal residual disease (MRD) assays is associated with negative complete response.12 Therefore MRD is increasingly prolonged survival in chronic lymphocytic leukaemia (CLL). being used as an end point for therapeutic trials, and several Flow cytometric MRD assays are now sufficiently sensitive and rapid to guide the duration of therapy in CLL, but generally rely studies are now using the assessment of MRD to define the on assessment of CD20 expression, which cannot be accurately duration of therapy. measured during and after therapeutic approaches containing Approaches using allele-specific oligonucleotide polymerase rituximab. The aim of this study was to use analytical software chain reaction (ASO-PCR) to the immunoglobulin gene of the developed for microarray analysis to provide a systematic B-CLL cell are generally accepted to show the highest sensitivity approach for MRD flow assay development. Samples from CLL for MRD detection. However, more recent four-colour ap- patients (n ¼ 49), normal controls (n ¼ 21) and other B-lympho- proaches show sensitivities nearing that of ASO-PCR6,11,13 with proliferative disorders (n ¼ 12) were assessed with a panel of 66 antibodies.
    [Show full text]
  • New Advances in Leukaemia Immunotherapy by the Use of Chimeric Artificial Antigen Receptors
    Biagi et al. Italian Journal of Pediatrics 2011, 37:46 http://www.ijponline.net/content/37/1/46 ITALIAN JOURNAL OF PEDIATRICS REVIEW Open Access New advances in leukaemia immunotherapy by the use of Chimeric Artificial Antigen Receptors (CARs): state of the art and perspectives for the near future Ettore Biagi*, Virna Marin, Greta Maria Paola Giordano Attianese, Irene Pizzitola, Sarah Tettamanti, Elisabetta Cribioli and Andrea Biondi Abstract Leukaemia immunotherapy represents a fascinating and promising field of translational research, particularly as an integrative approach of bone marrow transplantation. Adoptive immunotherapy by the use of donor-derived expanded leukaemia-specific T cells has showed some kind of clinical response, but the major advance is nowadays represented by gene manipulation of donor immune cells, so that they acquire strict specificity towards the tumour target and potent lytic activity, followed by significant proliferation, increased survival and possibly anti- tumour memory state. This is achieved by gene insertion of Chimeric T-cell Antigen Receptors (CARs), which are artificial molecules containing antibody-derived fragments (to bind the specific target), joined with potent signalling T-Cell Receptor (TCR)-derived domains that activate the manipulated cells. This review will discuss the main application of this approach particularly focusing on the paediatric setting, raising advantages and disadvantages and discussing relevant perspectives of use in the nearest future. Keywords: Leukaemia immunotherapy,
    [Show full text]
  • Point Mutation in CD19 Facilitates Immune Escape of B Cell Lymphoma from CAR-­T Cell Therapy
    Open access Original research J Immunother Cancer: first published as 10.1136/jitc-2020-001150 on 6 October 2020. Downloaded from Point mutation in CD19 facilitates immune escape of B cell lymphoma from CAR- T cell therapy 1 1 1 1 1 1 Zhen Zhang, Xinfeng Chen, Yonggui Tian, Feng Li , Xuan Zhao, Jinyan Liu, 1 1,2,3,4 Chang Yao, Yi Zhang To cite: Zhang Z, Chen X, ABSTRACT relapses after CD19 CAR-T cell therapy are Tian Y, et al. Point mutation Background Tumor relapse due to mutation in CD19 can attributed to the antigen loss, indicating an in CD19 facilitates immune hinder the efficacy of chimeric antigen receptor (CAR)- T urgent need for investigating the mechanisms escape of B cell lymphoma from cell therapy. Herein, we focused on lymphoma patients CAR- T cell therapy. Journal underlying recurrence and for improving whose B cells exhibited a point mutation in CD19 of B cells 4 5 for ImmunoTherapy of Cancer the efficacy of CAR- T cell therapy. Inter- 2020; :e001150. doi:10.1136/ after CAR-T cell infusion. 8 + estingly, one of the specific mechanisms jitc-2020-001150 Methods The CAR- T and CD19 B cells from peripheral blood or bone marrow were assessed using flow of tumor escape that has been reported cytometry. Genome sequencing was conducted to identify suggests that exon mutations affecting the ► Additional material is + published online only. To view, the molecular characteristics of CAR- T and CD19 B cells CD19 gene and its splicing isoforms, leading please visit the journal online from pre-rela pse and postrelapse samples.
    [Show full text]
  • Identification of 18 Immune Cell Subsets Using 13-Color Panel
    Immunophenotyping Identification of 18 immune cell subsets in human blood using a 13-color panel Background Cell type Function Phenotype Flow cytometry has become the method of choice for Eosinophils Parasitic immunity CD45+, SSCmid/hi, CD14 –, CD16 –, CD19– immunophenotyping and identifying specific cellular + mid/hi subsets. Within seconds, it provides a thorough overview of Neutrophils Innate Immunity CD45 , SSC , CD14 –, CD16+, CD19– the major cell types that constitute a sample. Using multiple + mid markers simultaneously increases the number of parameters Classical Phagocytosis of CD45 , SSC , monocytes pathogens and CD14+, CD16– that can be analyzed per run and decreases the amount of antigen presentation starting material required to perform an assay. This can be Intermediate Phagocytosis of CD45+, SSCmid, critical for precious sample material and long-term immune- monocytes pathogens and CD14+, CD16mid monitoring studies. In this application note, we demonstrate antigen presentation 13-color immunophenotyping of human peripheral blood Non-classical Phagocytosis of CD45+, SSCmid, + + mononuclear cells (PBMCs) using the MACSQuant® Analyzer 16, monocytes pathogens and CD14 , CD16 antigen presentation a compact and reliable benchtop flow cytometer equipped + low + with three lasers. The markers selected allow for the Class-switched Adaptive immunity CD45 , SSC , CD19 , memory B cells CD27+, IgD–, CD14– simultaneous identification and analysis of 18 different cell Non-switched Adaptive immunity CD45+, SSClow, CD19+, populations, thus maximizing the amount of information that memory B cells CD27+, IgD+, CD14– can be retrieved from the sample material analyzed. This is Naive B cells Adaptive immunity – CD45+, SSClow, CD19+, critical when input material is limited, as is often the case for non-antigen CD27–, IgD+, CD14– pediatric or disease studies.
    [Show full text]
  • Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-Cell Lymphoma: a Nordic Lymphoma Group Study1
    722 Vol. 9, 722–728, February 2003 Clinical Cancer Research Immunohistochemical Expression of CD23 and CD40 May Identify Prognostically Favorable Subgroups of Diffuse Large B-cell Lymphoma: A Nordic Lymphoma Group Study1 Johan Linderoth,2 Mats Jerkeman, to a germinal center origin or attributable to increased Eva Cavallin-Ståhl, Stein Kvaløy, and apoptosis via induction of bax and/or enhanced T-cell inter- Emina Torlakovic action, resulting in improved autologous tumor response. Confirmatory studies are necessary. Department of Oncology, Lund University Hospital, 221 85 Lund, Sweden [J. L., M. J., E. C-S.]; Department of Oncology, the Norwegian Radium Hospital, Oslo, Norway [S. K.]; and Department INTRODUCTION of Pathology, The Norwegian Radium Hospital, Oslo, Norway [E. T.] DLBCL3 is the most frequent lymphoma subtype and en- compasses the majority, ϳ60–70%, of the aggressive lympho- mas. Biologically and clinically, it shows considerable hetero- ABSTRACT geneity. Eventually, 30–40% of the patients with advanced Purpose: In search for subgroups of diffuse large B-cell stage DLBCL who are treated with current therapies will be lymphoma (DLBCL) with different histogenetic origin and long-time survivors, whereas the rest will succumb to the dis- prognosis, as has been described by gene expression profil- ease. There is an obvious need for prognostic information to ing, we examined tumor specimens from 125 patients with design a more risk-adapted primary therapy. The IPI is one DLBCL, uniformly treated by either cyclophosphamide- available, validated tool, based on clinical features (age, stage, Adriamycin-vincristine-prednisone or methotrexate, doxo- level of lactate dehydrogenase, performance status, and number rubicin, cyclophosphamide, vincristine, prednisone, and of extranodal sites; Ref.
    [Show full text]
  • Optimal Minimal Panels of Immunohistochemistry for Diagnosis of B-Cell Lymphoma for Application in Countries with Limited Resources and for Triaging Cases Before
    AJCP /ORIGINAL ARTICLE Optimal Minimal Panels of Immunohistochemistry for Diagnosis of B-Cell Lymphoma for Application in Countries With Limited Resources and for Triaging Cases Before Referral to Specialist Centers Downloaded from https://academic.oup.com/ajcp/article-abstract/145/5/687/2195691 by World Health Organization user on 09 January 2019 Maria Giulia Disanto, MD,1 Maria Raffaella Ambrosio, MD, PhD,2 Bruno Jim Rocca, MD, PhD,2 Hazem A. H. Ibrahim, FRCPath, PhD,1,3 Lorenzo Leoncini, MD, PhD,2 and Kikkeri N. Naresh, MD, FRCPath1 From the 1Department of Histopathology, Imperial College Healthcare NHS Trust & Imperial College, London, United Kingdom; 2Department of Medical Biotechnologies, Section of Pathology, University of Siena, Siena, Italy; and 3Department of Histopathology, Faculty of Medicine, Mansoura University, Mansoura, Egypt. Key Words: Lymphoma; B-cell lymphoma; Immunohistochemistry; Diagnosis; Classification; Developing countries Am J Clin Pathol May 2016;145:687-695 DOI: 10.1093/AJCP/AQW060 ABSTRACT Lymphomas are a collection of different malignancies “arising” from lymphoid cells. They include about 49 entities, Objectives: Establish and validate optimal minimal and over 19 provisional entities and subsets.1 About 85% of immunohistochemistry panels for usage in a staged lymphomas are of B-cell origin. Precision in lymphoma diag- algorithmic manner for precise diagnosis of B-cell nosis requires expertise and infrastructure. The entities are lymphomas in countries with limited resources. Suggest defined based on morphology, immunohistochemistry (on short panels of immunostains to be used in referring units some occasions in situ hybridization), cytogenetics/fluores- that refer suspected lymphomas to specialist diagnostic cent in situ hybridization (FISH), molecular genetics and clin- centers in resourceful countries.
    [Show full text]
  • Genetic Modification of Human T Lymphocytes for the Treatment of Hematologic Malignancies
    REVIEW ARTICLE Genetic modification of human T lymphocytes for the treatment of hematologic malignancies Valentina Hoyos, 1,2 Barbara Savoldo, 1,2 and Gianpietro Dotti 1,2,4 1Center for Cell and Gene Therapy, Baylor College of Medicine, Houston; 2Department of Medicine, Baylor College of Medicine, Houston; 3Department of Pediatrics, Texas Children’s Hospital, Houston; and 4Department of Immunology, Baylor College of Medicine, Houston, USA ABSTRACT Modern chemotherapy regimens and supportive care have post-transplant lymphomas and Hodgkin’s lymphomas. produced remarkable improvements in the overall survival of Because of this compelling clinical evidence and the con - patients with hematologic malignancies. However, the comitant development of methodologies for robust gene development of targeted small molecules, monoclonal anti - transfer to human T lymphocytes, the field has rapidly bodies, and biological therapies that demonstrate greater evolved, offering new opportunities to extend T-cell based efficacy and lower toxicity remains highly desirable in hema - therapies. This review summarizes the most recent biologi - tology, and oncology in general. In the context of biological cal and clinical developments using genetically manipulated therapies, T-lymphocyte based treatments have enormous T cells for the treatment of hematologic malignancies. potential. Donor lymphocyte infusion in patients relapsed after allogeneic hematopoietic stem cell transplant pioneered Key words: immunotherapy, cytotoxic T lymphocytes, gene the concept that T lymphocytes can effectively control transfer, chimeric antigen receptor, suicide gene. tumor growth, and this was then followed by the develop - ment of cell culture strategies to generate T lymphocytes Citation: Hoyos V, Savoldo B, and Dotti G. Genetic modification of with selective activity against tumor cells.
    [Show full text]