Iranian Journal of Basic Medical Sciences ijbms.mums.ac.ir

Bdellovibrio bacteriovorus from Iran and its potential lytic activity against principalCharacterization pathogenic of Enterobacteriaceae the first highly predatory Salman Odooli 1, Rasoul Roghanian 1*, Giti Emtiazi 1, Milad Mohkam 2, Younes Ghasemi 2, 3 1 Department of Cell and Molecular Biology and Microbiology, Faculty of Biological Sciences and Technology, University of Isfahan, Isfahan, Iran 2 Pharmaceutical Sciences Research Center, Shiraz University of Medical Sciences, Shiraz, Iran 3 Department of Pharmaceutical Biotechnology, School of Pharmacy, Shiraz University of Medical Sciences, Shiraz, Iran

-A R T I C L E I N F O A B S T R A C T Article type: Objective(s): Bdellovibrio-and-like organisms (BALOs) are predatory prokaryotes that attack and Original article kill other Gram-negative for growth and reproduction. This study describes the isolation, Bdellovibrio bacteriovorus Article history: with a broad prey range from Iran. Received: Sep 15, 2019 Accepted: Aug 11, 2020 Materialsidentification, and biologicalMethods: properties,One BALO and strain bacteriolytic with high activity predatory of the potency first was isolated from the rhizosphere soil using Enteropathogenic Escherichia coli Keywords: Bdellovibrio bacteriovorus strain SOIR-1 through plaque assays, transmission electron microscopy (TEM), Bdellovibrio as prey. It was identified and designated as Bacteriolytic activity and analysis of bacteriolytic activity were also performed. 16SBdellovibrio rRNA Analysis Results: TEM and Bdellovibrio-specific PCRs, and 16S rRNA gene sequence analysis. Biological characterization Enterobacteriaceae Bdellovibrio Iran strains of Bdellovibrio bacteriovorus-specific. The PCRs strain confirmed SOIR-1 grew that within the strain the temperature SOIR-1 belongs range to of the 25–37 genus °C Isolation and the pH range. Analysis of 6.0–8.0, of the 16S with rRNA the optimal gene sequence predatory revealed activity its at close 30 °C phylogenetic and pH 7.4. Itrelationship had the highest with Predation and lowest bacteriolytic activity toward Shigella dysenteriae and Pseudomonas aeruginosa with a Transmission electron- killing rate of 89.66% and 74.83%, respectively. microscopy Conclusion: contributes to a deeper understanding of their diversity, their ecological roles, and their promising potential as livingConsidering antibiotics the hypothesis or biocontrol of bdellovibriosagents. Bdellovibrios heterogeneity, with broad identification bacteriolytic of new nature isolates has

potential of native B. bacteriovorus strain SOIR-1 in the control and treatment of diseases caused by notpathogenic previously Enterobacteriaceae been reported in. sufficient detail from Iran. The results of this study showed the great ►Please cite this article as: Bdellovibrio bacteriovorus from Iran Enterobacteriaceae. Iran J Basic Med Sci 2020; 23:1275-1285. doi: 10.22038/ ijbms.2020.43159.10146Odooli S, Roghanian R, Emtiazi G, Mohkam M, Ghasemi Y. Characterization of the first highly predatory and its potential lytic activity against principal pathogenic Introduction of the interactions between the predator and prey. There is an increasing concern about the emergence Myxococcus and Lysobacter employ the wolf-pack or of drug resistance within bacterial communities group predation approach in which numerous predator following the extensive use and abuse of antimicrobial cells produce and secrete a variety of hydrolytic agents. Distribution of genetic determinants associated enzymes for degrading the encircled bacterial prey cell, with antibiotic resistance among bacterial communities without any physical attachment to the prey cells. In the has led to the development of multidrug-resistant epibiotic predation scenario, Vampirococcus attaches to the outer surface of the Chromatium prey cell and begins antimicrobial agents, and the gradual disarmament to degrade and assimilate host molecules through (MDR)of humans pathogenic against bacteria,bacterial the infections inefficiency (1-3). of Anotherexisting specialized structures between the predator and its prey. Daptobacter uses the endobiotic predation mechanism times more resistant to antimicrobial agents than their in which the predator cell enters into the prey cytoplasm, challengeplanktonic iscounterparts, bacterial biofilms even without that aregenetic up tomarkers 1000 degrades and consumes the prey components, and then required for antimicrobial resistance (4-6). Predatory lyses the prey cell. Almost all Bdellovibrio-and-like prokaryotes have recently been suggested as one of the organisms (BALOs) predate through the periplasmic alternative therapeutic strategies (7-9). They are smaller invasion approach in which the predator cell exclusively than their prey and exist as a living organism compared invades and enters the periplasmic space of Gram- with other predatory microorganisms (protists and negative prey bacterium, where it grows at the expense bacteriophages). Predatory bacteria acquire their of the prey macromolecules. It seems that only wild-type required biosynthetic materials and energy from other BALOs are obligate predators. Other predatory bacteria live bacterial cells as prey (8, 10, 11). can grow heterotrophically and multiply in the absence The predatory mechanisms of predatory bacteria are of prey cells (8, 11). divided into four main categories based on the nature BALOs taxonomically belong to the class

*Corresponding author: Rasoul Roghanian. Department of Cell and Molecular Biology and Microbiology, Faculty of Biological Sciences and Technology, University of Isfahan, Isfahan, Iran. Tel/ Fax: +98-3117932456; Email: [email protected] Odooli et al. An extremely bacteriolytic Bdellovibrio from Iran

δ- and order , and hit (host interaction) that encodes proteins necessary are grouped into three families; Bdellovibrionaceae for attachment and invasion of the prey cell. Some (terrestrial bdellovibrios), Bacteriovoraceae (marine Bdellovibrio derivatives have been developed through halophilic ), and Peridibacteraceae (12, very-low-frequency mutations in the hit locus. These 13). BALOs are ubiquitous in natural ecosystems and prey (host)-independent derivatives can grow on the have been isolated from biotic and abiotic niches (10, 12, nutrient-rich media in the absence of live prey cells. They 14-16). Bdellovibrio bacteriovorus, the most well-known also have different morphological and physiological BALOs, was accidentally discovered by Stolp and Petzold properties (especially predatory potency) compared in 1962 during the isolation of soil bacteriophages for with wild-type prey (host)-dependent bdellovibrios biocontrol of phytopathogenic Pseudomonas syringae pv. (13, 22, 23). phaseolicola. Bdellovibrios are The interaction between bdellovibrios and their prey cells can be considered a parasite-host relationship, i.e., small (about 0.2-0.5 μm invading a substrate cell for reproduction. However, wide(9, 10, and 17, 0.5-2.5 18). The μm genome long) vibrio-shaped and proteome Gram-negative composition this interaction can be a predator-prey relationship cells,of B. bacteriovoruswith a single sheathedwere determined polar waveform and analyzed flagellum by because bdellovibrios do not use the prey’s metabolic Rendulic et al. and Pan et al. (19, 20). It’s not strange machinery but directly digest the prey cell as a substrate for an obligate predator like B. bacteriovorus to have too to provide their required monomers (10). Bdellovibrios many potential genes encoding molecular arsenals and are also capable of penetrating and predating inside hydrolytic enzymes. Although the mechanism of action of these enzymes is not yet fully known, their study against the human, animal, plant, and aquatic Gram- helps to understand the predation mechanism. Some of biofilms.negative pathogens The bacteriolytic regardless nature of their of metabolic bdellovibrios and these enzymes can also be used as the foundation for the antimicrobial resistance status, make them attractive development of future therapeutic agents (11, 17). candidates as potential living antibiotic and biocontrol The life cycle of B. bacteriovorus is biphasic (Figure agents (7, 9, 16, 17, 24-29). 1A). Bdellovibrio searches for prey in the free-swimming attack phase, attaches to the outer membrane of the documentation on the andIn biological this study, characterization we presented of a thehighly first bacteriolytic complete prey’s periplasmic space using a set of hydrolytic Bdellovibrio strain fromisolation, Shiraz molecular city in Southwesternidentification, preyenzymes. cell, The detaches prey cell its flagellum,metabolism and is penetratesdeactivated thein the early intraperiplasmic growth phase. The infected detail in this country before. This study will potentially prey cell is transformed into a globular structure Iran,add to which the existing has not database been fully on bdellovibrios reported in sufficientand will called “bdelloplast”, where the invading Bdellovibrio inserts hydrolytic enzymes into the prey’s cytoplasm on BALOs in other countries. The presented data could and utilizes prey macromolecules as a source of help to bridge the gap between the research findings nutrients and energy for reproduction. The progenies of Bdellovibrio strain as a living antibiotic against principal Bdellovibrio alsopathogenic confirm Enterobacteriaceae the possible potential. of the isolated and nonseptated structure, which eventually divides are synthesized in the form of a filamentous Materials and Methods depletion of prey’s cytoplasm. Finally, the bdelloplast Prey preparation intois lysed, individual and mature flagellated attack motilephase Bdellovibrio progeny cells cells upon are The bacterial strains used in this study are listed in released to resume new life cycles (13, 17, 20-22). Table 1. Enteropathogenic Escherichia coli (PTCC 1270) Bdellovibrios possess a unique genetic locus called was used as prey for preliminary isolation of BALOs. All

Table 1. The bacterial strains used in this study and their sensitivity to the predation by isolated Bdellovibrio bacteriovorus strain SOIR-1

Species/strains Strain information Source (a) Lysis (b) by strain SOIR-1

Escherichia coli Enteropathogenic E. coli O111: K58 PTCC 1270 Yes

Klebsiella pneumoniae Capsular serotype 3, isolated from human pneumonia PTCC 1290 (NCTC 5056) Yes

Pseudomonas aeruginosa Isolated from wound PTCC 1310 (CIP A22) Yes

Shigella dysenteriae Serotype 6 PTCC 1188 Yes

Salmonella typhi ----- PTCC 1609 Yes

Proteus vulgaris ----- PTCC 1079 Yes

Staphylococcus aureus subsp. aureus Rosenbach PTCC 1337 (ATCC 29737) No

Staphylococcus saprophyticus subsp. saprophyticus Type strain, isolated from urine PTCC 1440 (ATCC 15305) (DSM 20229) No

Bacillus subtilis subsp. subtilis Type strain, Marburg strain PTCC 1720 (ATCC 6051) (DSM 10) No

All heat-killed prey inoculated with strain SOIR-1 ------No

All prey inoculated with 0.22 µm filtered strain SOIR-1 ------No

(a) Collection of Type Cultures for bacteria, Central Public Laboratory Service, London, UK), CIP (Collection of Institute Pasteur, Paris, France), DSM (Deutsche PTCC (Persian Sammlung Type von Culture Mikroorganismen, Collection, Tehran, Braunschweig, Iran), ATCC Germany) (American Type Culture Collection, Manassas, Virginia, USA), NCTC (National (b) Indicated by plaque formation through double-layer agar plating technique

1276 Iran J Basic Med Sci, Vol. 23, No. 10, Oct 2020

2

An extremely bacteriolytic Bdellovibrio from Iran Odooli et al. bacterial strains were cultured overnight in the Tryptic then spread over the HM bottom agar plates (25 mM soy broth (Merck, Darmstadt, Germany) supplemented HM buffer amended with 3 mM CaCl2, 2 mM MgCl2, by 0.2% yeast extract (HiMedia, Mumbai, India) at 37 °C with shaking at 160 rpm until the end of exponential 30 °C, and plaque formation was monitored for 10 days. to early stationary phase. The prey cells were then 1.5%Small agar,and finalclear pH lytic 7.4). regions The plates that weredeveloped incubated within at harvested by centrifugation (6500 ×g for 15 min at 4 24 hr but did not expand further were considered as °C), and the resultant pellets were washed twice and re- probable bacteriophages. The potential BALOs plaques suspended in the sterile HM buffer containing 25 mM were screened through the following features: round HEPES (4-[2-hydroxyethyl]-1-piperazineethanesulfonic and regular with sharp boundaries, no colonies at their centers, development after 3-5 days, and progressive increase in size. Such plaques were lifted from the plate, acid) (Fisher Scientific, Fair Lawn, New Jersey,2,2H2O and USA) 2 re-suspended in 4 ml HM buffer, and checked for small mMsupplemented MgCl2,6H2 by 0.22-μm pore size filter-sterilized comma-shaped cells with high motility using phase- were(JET-BIOFIL, then adjusted Guangzhou, to an China) optical 3 densitymM CaCl of 2.0 at 600 contrast microscopy. One of the best plaque suspensions 9 nm (OD600) [~10O, final colony pH 7.4. forming The prey units cell per suspensions ml (CFU/ ml)] using a spectrophotometer apparatus (Eppendorf, Hamburg, Germany). wasagar plating selected, procedures, passed three as described times through above. a 0.45-μm filter, and purified using three successive double-layer Sample collection, processing, and enrichment for Preparation and storage of attack-phase BALO BALOs A plug of fresh BALO plaque and the surrounding prey The rhizosphere soil sample was collected from was lifted from the double-layer agar plate and inoculated agricultural land (located in the School of Pharmacy, into 25 ml of washed E. coli prey cell suspension (~109 S CFU/ml). The co-culture was incubated at 30 °C with using a clean hand shovel and after removing about shaking at 200 rpm and monitored for lysis of prey cells 10hiraz, cm Iran;of top longitude soil. The 52°33’temperature E, latitude of rhizosphere 29°41’ N) (clearing the prey suspension and reduction of initial soil was determined in situ using a portable digital OD600) within 72 hr (stock lysate). The remaining prey thermometer. The sample was poured into a sterile cells were eliminated by centrifugation (5000 ×g for polythene bag and transferred immediately to the 20 min at 4 ° laboratory for subsequent analysis. Five scoops of attack-phase BALOC) and was filtration concentrated of resultant by centrifugation supernatant soft soil, and the mixture was stirred for 20 sec. The (0.45-μm)at 27000 ×g (filtrate for 20 min lysate). at 4 °C. Filtrate The resultant lysate containingpellet was sterilesoil pH distilled was measured water were after added 15 min to usingthe five a digitalscoops pH of then re-suspended in HM buffer and adjusted to ~109 meter. A slurry mixture was prepared in a sterile 1000 plaque-forming units per ml (PFU/ml) through optical 9 density measurement (10 PFU/ml gave OD600 nm ca. soil sample in 350 ml sterile HM buffer. The mixture was 0.15). The isolated BALO was stored as pure plaques mlagitated Erlenmeyer on an orbital flask byshaker suspending (200 rpm 35 for g 1 rhizosphere hr at room or stock lysates for up to 1 month at 4 °C. For long-term temperature) to ensure the loosening of soil clumps and storage, aliquots of fresh stock lysate were mixed with the uniform distribution of organisms. Afterward, the slurry mixture was enriched by 30 ml of washed E. coli mixtures were quickly frozen in liquid nitrogen and prey cell suspension (prepared as described above) and 80%stored glycerol up to 4 to years a final at -80concentration °C. of 20% (v/v). The incubated for 72 hr at 30 °C on an orbital shaker at 200 rpm. BALO identification Transmission electron microscopy (TEM) BALO isolation One drop of freshly prepared attack-phase BALO The slurry mixture was subjected to the sequential suspension was placed on a Formvar carbon-coated centrifugation at 800 ×g, 1800 ×g, and 4500 ×g for 300-mesh copper microscope grid for 5 min at room 15 min at 4 °C to remove large particles and most temperature. The grid was then lifted gently with a pair of forceps, and the excess liquid was removed. The sample was then counterstained with 1% (w/v) solution microorganisms. The resultant supernatant was filtered of uranyl acetate (pH 4.0) for 10 min and examined three times through a 0.45-μm pore size syringe with a Philips CM10 transmission electron microscope filterwas centrifuged (Orange scientific, at 27000 Braine-l’Alleud,×g for 20 min at Belgium) 4 °C, which for at an accelerating voltage of 100 kV (Laboratory of trapping the remaining bacteria and debris. The filtrate transmission electron microscopy, School of Veterinary pellet and eliminates potential bacteriophages in the Medicine, Shiraz University, Shiraz, Iran). Small and efficientlysupernatant. concentrates The resultant the possiblepellet was BALOs washed cells and in there- suspended in 2 ml HM buffer and then serially diluted 10-fold up to 10 with HM buffer. These dilutions were vibrioid-shapedare considered as cells potential (0.25 attack-phaseto 0.40 μm in BALOs. width, 1 to 2 checked for viable−10 BALOs using the double-layer agar μm in length) with one long sheathed polar flagellum Analysis of partial 16S rRNA gene prey cell suspension (platingE. coli, technique~109 CFU/ml) as follows: in 6 ml 300of molten μl of eachHM top dilution agar ~109 was(25 mMmixed HM with buffer 900 amended μl of washed with 3 mM CaCl2, 2 mM KitGenomic for Gram-negative DNA of attack-phase bacteria (SinaClon, BALO (filtrate Tehran, lysate,Iran), MgCl2 and its PFU/ml) concentration was extracted was adjusted using theto 20 CinnaPure-DNA ng/µl using a

, 0.7% agar, final pH 7.4), and the mixture was Iran J Basic Med Sci, Vol. 23, No.10, Oct 2020 1277 Odooli et al. An extremely bacteriolytic Bdellovibrio from Iran

Table 2

. The PCR oligonucleotide primers used in this study for molecular identification of isolated BALO Primer name Primer sequence (5 to 3 ) Target Specificity Amplicon size (base pair)

Forward: 63F CAGGCCTAACACATGCAAGTCʹ ʹ 16S rRNA gene Universal (bacteria) ~1300 (bp) Reverse: 1378R CGGTGTGTACAAGGCCCGGGAACG

Forward: Bd529F GGTAAGACGAGGGATCCT 16S rRNA gene Bdellovibrio-specific ~480 (bp) Reverse: Bd1007R TCTTCCAGTACATGTCAAG

Forward: Hit-FW GACAGATGGGATTACTGTCTTCC hit locus Bdellovibrio-specific ~910 (bp) Reverse: Hit-RW GTGTGATGACGACTGTGAACGG

Pico200 picodrop spectrophotometer (Picodrop Ltd, coli Hinxton, United Kingdom). For phylogenetic analysis, genomic DNA served as the negative control in the primers (Table 2) (30) in a total reaction volume of 40 specificand visualized PCR reactions, using the and GelDoc the successful apparatus. amplifications the 16S rRNA gene was PCR amplified using the universal were confirmed by agarose gel electrophoresis (1.8%) 2X (Ampliqon, Odense, Denmark), 1 µl of each primer Characterization of Bdellovibrio bacteriovorus strain μl containing: 20 µl Taq DNA polymerase master mix red SOIR-1 bacteriolytic activity Two separate methods evaluated the lytic activity (20 µM), 3 µl template DNA, and 15 µl sterile deionized of strain SOIR-1 against several prey bacteria (Table distilledwith the water.following Amplifications PCR conditions: were performedInitial template using 1). First, the formation of clear lytic plaques on the adenaturation DNA thermo-cycler step at 94 °C (BIO-RAD, for 4 min, followed Hercules, by CA, 35 cycles USA) lawn of prey cells using the double-layer agar plating of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 technique. Second, lysis analysis in the broth co-cultures ° min, elongation at 72 followed by the reduction of OD600 and CFU/ml of prey step at 72 ° cell suspensions and mutual increase in the cell density C for 1 min, and the final extension (PFU/ml) of strain SOIR-1. In the plaque formation assay, on 1.8% Tris-Borate-EDTAC for 5 min. Successful (TBE) amplifications agarose gel wereand confirmed through electrophoresis of PCR products (~109 PFU/ml) was serially diluted 10-fold, and 300 µl Cambridge, United Kingdom). The desired amplicon theof each fresh dilution filtrate was lysate mixed of with attack-phase 900 µl of straineach washed SOIR-1 visualized using a U:Genius3 GelDoc system (SYNGENE, prey cell suspension (~109 CFU/ml) in 6 ml of molten HM top agar. The mixture was immediately spread (∼1300sent for bp)bidirectional was extracted sequencing and purified (Macrogen, using Seoul, a Gel over the surface of HM bottom agar, and the plates Purification Kit (Bioneer, Daejeon, South Korea) and were incubated for 10 days at 30 °C. For lysis analysis using BioEdit (version 7.1.9) and Chromas Pro (version in the broth co-culture, 25 ml of each washed prey cell South Korea). The obtained sequences were modified suspension (~109 CFU/ml) was inoculated with 400 µl of

2.1.3) programs. The final 16S rRNA gene sequence was of ~104 PFU/ml). The co-cultures were incubated for thenof the searched representative for similarity strains in the (Supplementary NCBI databases usingTable pure7 days strain at 30 SOIR-1 °C with in theshaking attack-phase at 200 rpm. (final The cell CFU/mldensity the1) were BLAST-N retrieved search from tool. the The GenBank 16S rRNA and gene then sequences aligned (using standard spread-plate count), PFU/ml (through using the MUSCLE program, which is implemented in described double-layer agar plating method), and OD600 the MEGA software package. A phylogenetic tree was parameters were monitored at 24 hr intervals. The non-inoculated prey cell suspensions, heat-killed (95 (p-distance model) using MEGA software version 7.0.26 °C, 15 min) prey cell suspensions inoculated with strain constructedwith a bootstrap through analysis the of Neighbour-Joining 1000 replicates (31). algorithm 3 Bdellovibrio-specific PCR reactions SOIR-1,cell suspension prey cell without suspensions any prey inoculated served withas negative filtered

strain SOIR-1 (0.22-μm pore size),600 were and straincalculated SOIR-1 for using the Bdellovibrio each prey through the following formulas: (TableSpecific 2) under16S rRNA the genefollowing amplification PCR conditions: was performed initial controls. Killing rate (%) and ΔOD template denaturation-specific step at 95 16S °C rRNAfor 5 min, primers followed (14) by 25 cycles of denaturation at 95 °C for 1 min, annealing ° ° 600 600 600 at 53 C for 1 min, and elongation at 72 C for 1 min. The ΔOD = OD (s) − OD (e) °  C. The hit locus 0 i N − N Killing rate = [ 0 ] 100 N (Tablefinal extension 2) under step the was following 10 min PCR at 72 conditions: initial where OD600 (s) and OD600 (e) are the OD600 at the templatewas also amplifieddenaturation using step the at specific 95 °C for primer 5 min, pairs followed (32) starting day and day e (evaluation day), respectively. ° by 20 cycles of denaturation at 95 C for 1 min, annealing 0 i are the numbers of bacterial prey at 60 °C for 1 min, and elongation at 72 °C for 1 min. cells at day 0 (starting day) and day i (evaluation day), °C. The E. Similarly,respectively. N and N

The final extension step was 10 min at 72 1278 Iran J Basic Med Sci, Vol. 23, No. 10, Oct 2020 An extremely bacteriolytic Bdellovibrio from Iran Odooli et al.

Effects of temperature and pH on the predation by Bdellovibrio bacteriovorus strain SOIR-1 visible after 72 hr of incubation at 30 °C (Figure 1B). The evaluation of temperature effect was achieved by TheFollowing size of three plaques purification depended steps, on the this concentration plaque became of inoculating 25 ml of washed E. coli prey cell suspensions the BALO inoculated into the bottom agar plates and (~109 CFU/ml, pH 7.4) with 400 µl of strain SOIR-1 in reached 4.0–9.0 mm after 10 days of incubation at 30 4 PFU/ml). °C (Supplementary Figure 1). These plaques expanded The co-cultures were incubated for 7 days at 200 rpm, upon more incubation time and eventually covered withthe attack-phase temperatures (final set at cell 25, density30, 35, 37, of ~10and 42 °C. The almost the entire lawn of E. coli prey in double-layer changes in the cell number of strain SOIR-1 (PFU/ml) agar plates (Supplementary Figure 1). The growth of and E. coli prey (OD600 and CFU/ml) in the co-cultures plaques is due to the movement of the predator within were monitored at 24 hr intervals. The non-inoculated the soft (top) agar. This is a prominent feature of BALOs prey cell suspensions served as negative controls. The and distinguishes them from bacteriophages (18, 33). pH effect was examined at 30 °C using HM buffers with Phase-contrast microscopy revealed that the isolated different pH (5.5, 6.0, 6.5, 7.0, 7.4, 8.0, and 8.5) in the predators were small comma-shaped cells with high same way as mentioned for temperature effect. predator presumably belongs to the BALOs. Statistical analysis motility. All of these findings confirm that the isolated All experiments were carried out in triplicate, and BALO identification and phylogenetic analysis each experiment was repeated three times. The results Transmission electron microscopy (TEM) revealed were presented as the mean±standard deviation (SD) that the isolated BALO was a small vibrioid-shaped Post hoc Tukey’s test were used for multiple comparisons error.between The groups analysis (GraphPad of variance Prism (ANOVA) v 6.07 for and Windows, cell(Figure about 1C). 0.8 These μm longmorphological and 0.25 μmcharacteristics wide, which were had astriking single and polar distinctive sheathed features flagellum of of bdellovibrios 2.1 µm in length (12, P GraphPadlevel. The drawing Software, of graphs La Jolla, and diagrams California, was USA).done Differencesby the GraphPad were consideredPrism v 6.07 significant software at and -value≤0.05 Microsoft 18).(63F-1378R), For further and identification,the obtained amplicon the 16S (~1300 rRNA gene bp, © tools, 2013 (Microsoft, Redmond, wasFigure amplified 2A) was using sequenced PCR with bidirectionally. the universal One primers contig Washington, USA). Other mathematical and statistical Officeanalyses for wereWindows performed using Microsoft Excel© for complementation of the two obtained sequences. Windows©. (1192 bp) was generated through the modification and BALO had 98-99% similarity (Query Covers of 100%) Results to Thethe BLAST-Nstrains of searchB. bacteriovorus indicated , thatincluding the isolatedDM7C, BALO isolation The rhizosphere soil sample had a moist dark-brown loamy texture with a temperature of 28 °C and pH 7.1. HD100,EU884925.1, JSF1, SRE7,AF263832.1, angelus, and SSB218315GQ427200.1, (GenBank and It was initially enriched with E. coli to saturate the accessionKT807464.1, numbers respectively). of KU973530.1, The isolated BALO NR_027553.1, showed potential BALOs for easier observation by subsequent the minimum similarity (92%, Query Covers of 100%) plaque-based assays. Several lytic regions were Bdellovibrio exovorus developed on the lawn of E. coli prey cells in double-layer (GenBank accession numbers of KP272154.1 and agar plates after 5 days of incubation at 30 °C. One of the to the FFRS-5 and JSS strains of largest plaques was selected for subsequent analysis Accordingly, the isolated BALO was considered a strain and considered as a potential BALO through plaque NR_102876.1,of B. bacteriovorus respectively) and designated (Supplementary as strain SOIR-1 Table. The 1). properties and phase-contrast microscopic verifications. 16S rRNA gene sequence obtained in this study (1192

Figure 1. (A) The predatory life cycle of Bdellovibrio bacteriovorus. (B) Typical lytic plaques developed by B. bacteriovorus strain SOIR-1 on the lawn of Escherichia coli B. bacteriovorus strain SOIR-1 in the attack phase using a transmission

prey cells. (C) Microscopic identification of isolated electron microscope (TEM). The approximate body size is 0.8 μm in length, 0.25 μm in width, and the flagellum length is 2.1 μm. The scale bar represents 0.5 μm Iran J Basic Med Sci, Vol. 23, No.10, Oct 2020 1279

Odooli et al. An extremely bacteriolytic Bdellovibrio from Iran

Figure 2. L2; Distilled water negative control, L3; Escherichia coli Bdellovibrio bacteriovorus electrophoresis (A) Agarose of PCR gelassay electrophoresis using Bdellovibrio of PCR assay using universal 16S rRNA gene primers (63F-1378R). L1; DNA ladder marker (1k bp), well, L3; B. bacteriovorus genomic DNA, L4; E. coli strain SOIR-1 genomic DNA. (B) Agarose gel of PCR assay using Bdellovibrio hit locus-specific primers 16S (Hit rRNA FW-Hit gene RW). primers L1; E. (Bd529F-Bd1007R).coli L1; DNA ladder marker (100 bp), L2; Empty strain SOIR-1 genomicB. bacteriovorus DNA, L4; Distilled water negative control, L5; genomic DNA. (C) Agarose gel electrophoresis -specific genomic DNA, L2; Distilled water negative control, L3; Empty well, L4; DNA ladder marker (1k bp), L5; strain SOIR-1 genomic DNA bp) was deposited in the GenBank database under the accession number of MG230309.1 for B. bacteriovorus strain SOIR-1. Two distinct Bdellovibrio hit locus (Figure 2C) were also performed-specific PCR to strengthen amplification the

assaysresults. targeting The expected the 16S PCR rRNA products gene were (Figure generated 2B) and only

hit locus further when the genomic DNA of strain SOIR-1 served as the B.template. bacteriovorus Successful since amplification it has been proposed of that the hit confirmslocus is restricted that the toisolated B. bacteriovorus strain SOIR-1 (15). belongs to the The phylogenetic tree constructed based on the 16S

rRNAindependent gene sequences branch and (Figure then 3)clustered showed withthat thethe strainother SOIR-1group of could soil-associated be a new strainstrains since of bdellovibrios. it first formed The an marine and terrestrial BALOs were initially grouped as family Bdellovibrionaceae. They were then divided into two distinct families based on the G+C content, Figure 3. prey preference, and response to salinity. There is a The phylogenetic tree based on the 16S rRNA gene separate phylogenic relationship between the marine sequencescalculated fromof BALOs. 1000 The replicates. tree was The constructed Escherichia using coli the Neighbour- (family Bacteriovoraceae) and terrestrial (family sequenceJoining algorithm was used and as thean external p-distance group model. Bootstrap confidence was Bdellovibrionaceae) BALOs (16, 34). This concept is 16S rRNA gene quite evident in the phylogenetic tree of strain SOIR-1. inability of bdellovibrios to pass through the 0.22-µm

Bacteriolytic potency of Bdellovibrio bacteriovorus Furthermore, there was no live host cell to support the strain SOIR-1 poregrowth size of filter strain distinguishes SOIR in the treatments them from containingbacteriophages. heat- The bacteriolytic ability was investigated through killed prey. So, the strain SOIR-1 is a prey-dependent the plaque formation assay (Table 1) and monitoring (wild-type) Bdellovibrio. of lysis parameters (OD600, CFU/ml, and PFU/ml) in regarding the mentioned negative controls. the broth co-cultures. The strain SOIR-1 was able In the co-cultures of Nolive plaque Gram-negative was also developed preys, at to lyse all live Gram-negative prey (Supplementary the same time as the number of prey cells (CFU/ml)

600 and CFU/ P ml occurred in the co-cultures of live Gram-negative preysFigure inoculated 2). A significant with strain decrease SOIR-1 in OD(P decreased(P significantly ( -value≤0.05), the cell density

However, OD600 and CFU/ml did not change remarkably ofThe strainstrain SOIR-1 SOIR-1 failed (PFU/ml) to lyse increasedGram-positive significantly bacteria. in the case of non-inoculated preys with strain-value≤0.05). SOIR-1, There-value≤0.05) was no considerable(insets in Supplementary change in OD Figures600, CFU/ml, 2A-F). and PFU/ml parameters regarding the co-cultures of and heat-killed preys inoculated with strain SOIR-1 Gram-positive preys (P-value>0.05) (Supplementary preys(P-value>0.05) inoculated (Supplementary with filtered strain Figures SOIR-1 2A-F). (0.22-µm), The

1280 Figure 3). All these specificationsIran J Basic Med Sci, were Vol. 23, matched No. 10, Oct with 2020 An extremely bacteriolytic Bdellovibrio from Iran Odooli et al.

Figure 4. OD600 (A), CFU/ml (B), and PFU/ml (C) parameters in the broth co-cultures of susceptible preys with Bdellovibrio bacteriovorus strain SOIR-1 the characteristics of bdellovibrios. Furthermore, the dysenteriae (89.66%), E. coli (87.5%), Proteus vulgaris (84.66%), Klebsiella pneumonia (84.33%), Salmonella SOIR-1 belongs to bdellovibrios since bdellovibrios have typhi (83%), and P. aeruginosa (74.83%) (Figure 5B). preya broader range prey analysis range reaffirmsthan bacteriophages. that the isolated strain These results indicated that the strain SOIR-1 had

The sharpest changes in OD600, CFU/ml, and PFU/ml the highest and lowest predatory activity against S. P dysenteriae and P. aeruginosa, respectively. then the intensity and slope of these changes became occurredmilder (P -value>0.05)within the first (Figures 24-48 4A-C). hr ( -value≤0.05), and Factors involved in the predation by Bdellovibrio The OD600 600) of Shigella bacteriovorus strain SOIR-1 dysenteriae was higher than other preys, and The strain SOIR-1 had the predatory activity at 25, ° Pseudomonas aeruginosareduction had rate the lowest (ΔOD OD600 reduction 30, 35, and 37 C. There was little difference in the

° hr, the reduction rate in OD600 of S. dysenteriae and P. PFU/ml) at 30, 35, and 37 C (9.38±0.14, 9.17±0.08, aeruginosarate throughout were the1.38±0.03 7 days and of analysis. 0.76±0.2, In respectively. the first 24 andfinal 8.92±0.07,number of respectively)produced strain (P SOIR-1 progenies (log At the end of the evaluation period (day 7), the highest intense growth rate of strain SOIR-1 at 30, 35, and 37 ° ° OD600 reduction rate was observed for S. dysenteriae C occurred within one day (P-value˃0.05). The mostC, (1.8±0.02), and P. aeruginosa had the lowest one however, the strain SOIR-1 required 2 days to reach the (1.5±0.02) (Figure 5A). Mutually, the highest and lowest most intense growth rate. It means-value˃0.05). that the growth At 25 of reduction in log CFU/ml was observed for S. dysenteriae strain SOIR-1 at 25 °C was slower than 30, 35, and 37 and P. aeruginosa, respectively (Supplementary Figure °C (P E. coli prey cell, the number 4A). The highest reproduction rate of strain SOIR-1 (PFU/ of strain SOIR-1 cells gradually decreased at 42 °C ml) was associated with the most considerable reduction (P -value≤0.05). Unlike in the number of prey cells (CFU/ml) (Supplementary at 42 °C, and no lytic activity was observed at this

Figure 4B). The killing rate (%) of strain SOIR-1 toward temperature-value≤0.05). (Figure In other 6A). words, The growth strain SOIR-1 of strain was SOIR-1 dying susceptible preys at the end of the assessment period was directly related to the decrease in the prey number (day 7) was as follows (from the highest to lowest): S. (P

-value≤0.05). The most intense reduction rate in

Figure 5. and killing rate parameters in the broth co-cultures of Bdellovibrio bacteriovorus strain SOIR-1 with preys 600

ΔOD Iran J Basic Med Sci, Vol. 23, No.10, Oct 2020 1281

Odooli et al. An extremely bacteriolytic Bdellovibrio from Iran

Figure 6. The effect of temperature on the growth and lytic activity of Bdellovibrio bacteriovorus strain SOIR-1 indicated by changes in the PFU/ml

(A), CFU/ml (B), and OD600 (C) parameters in the broth co-cultures (pH 7.4)

° OD600 (and consequently CFU/ml) of prey occurred (24), strain SOIR-1 grew between 25-37 C and pH 6.0- within one day at 30, 35, and 37 °C (P 8.0, with the highest predatory activity at 30 °C and pH took 2 days at 25 °C to reach the same reduction rate. 7.4. On the last day of evaluation (day 7), the -value˃0.05).reduction rates It ° in OD600 of prey suspension at 30, 35, and 37 C were Discussion The most complete data on the isolation of

600 of prey was observed at bdellovibrios from Iran were presented in this 1.75±0.08,42 °C (P-value>0.05) 1.63±0.05, due and to 1.64±0.06, the death of respectively. strain SOIR-1 No study through the plaque-based assays (Figure 1B, significant(Figures 6B-C). decrease in OD Supplementary Figure 1), transmission electron The predatory activity of strain SOIR-1 was recorded microscopy (TEM) (Figure 1C), Bdellovibrio at pH range of 6.0, 6.5, 7.0, 7.4, and 8.0. The strain hit locus (Figure SOIR-1 gained its highest growth rate at pH 7.4 within -specific one day, while more days were required to reach its PCRs3). The targeting results the indicated 16S rRNA that gene the and isolated BALO was maximum growth rate at other pH points. On the last 2),a strain and phylogenetic of B. bacteriovorus analysis, ofand 16S we rRNA designated gene (Figure it as day of evaluation (day 7), the maximum number of B. bacteriovorus strain SOIR-1. We did not examine produced strain SOIR-1 progenies (log PFU/ml) was the predatory mechanism of strain SOIR-1. However, 6.1±0.1 (pH 6), 8.2±0.06 (pH 6.5), 8.91±0.06 (pH 7.0), since the strain SOIR-1 had a close phylogenetic 9.38±0.14 (pH 7.4), and 8.71±0.1 (pH 8.0) (Figure 7A). relationship with other B. bacteriovorus strains (Figure Compared with other pH points, the most reduction in 3), we conclude that the strain SOIR-1 would also the CFU/ml and OD600 of prey suspension occurred at predate through the periplasmic invasion approach. pH 7.4 (P Furthermore, the genus Bdellovibrio comprises two observed for strain SOIR-1 at pH 5.5 and 8.5. The OD600 B. exovorus and B. bacteriovorus. and CFU/ml-value≤0.05) of prey suspension (Figures were 7B-C). almost No growth unchanged was B. exovorus preys on Caulobacter crescentus through (P-value>0.05) at pH 5.5 and 8.5, indicating that the identifiedthe epibiotic species; mechanism of predation, without any prey cells were able to survive under these conditions. periplasmic growth phase (35). The strain SOIR-1 had no close phylogenetic relationship with strains of B. number of strain SOIR-1 cells (PFU/ml) showed their exovorus (Figure 3). However,sensitivity the and gradual death at and pH significant5.5 and 8.5 decrease (P in the The isolation of new B. bacteriovorus strain from (Figures 7A-C). In agreement with the other reports the rhizosphere soil sample in Iran agrees with the -value≤0.05)

Figure 7. The effect of pH on the growth and lytic activity of Bdellovibrio bacteriovorus strain SOIR-1 indicated by changes in PFU/ml (A), CFU/ml ° (B), and OD600 (C) parameters in the broth co-cultures (30 C).

1282 Iran J Basic Med Sci, Vol. 23, No. 10, Oct 2020 An extremely bacteriolytic Bdellovibrio from Iran Odooli et al. other reports that bdellovibrios are present in diverse for bdellovibrios to use just a simple receptor which can terrestrial and aquatic habitats (10). The population easily lead to prey cell resistance by mutations, unless levels of B. bacteriovorus follow the Lotka-Volterra it is essential for the viability of prey cells. In terms of prey-predator oscillation, where a reversible plastic receptor accessibility, it has been reported that S-layers phenotypic resistance in the prey cells balances the protect prey cells from predation by bdellovibrios. B. bacteriovorus expansions. Therefore, although S-layers may block the access of bdellovibrios to bdellovibrios are present in almost all environmental the potential receptors located in the prey cell wall. ecosystems and constitute about 80% of the soil BALOs However, bacterial capsules are not protective barriers community, they rarely form numerically dominant against bdellovibrios predation (44, 45). In this study, populations (32, 36, 37). It has been suggested that BALOs strain SOIR-1 was also able to lyse K. pneumoniae, a have an ecological balancer role in biological ecosystems bacterium with a typical capsule. (8, 12). Recently, bdellovibrios have been considered as The broad bacteriolytic spectrum of B. bacteriovorus living antibiotics or a source of new antimicrobial agents strain (11, 17, 38). However, their successful isolation from pathogenic Enterobacteriaceae as a living antibiotic (FigureSOIR-1 5). Furthermore, reflects its high bdellovibrios potential for may controlling act as of the isolation procedures on the appropriate prey and environmentalthe physicochemical samples conditions. is difficult due to the dependence have recently been isolated from the guts of mammals Plaque-based assays (Figure 1B, Supplementary probiotics(15, 32). The to stabilize predatory intestinal ability microfloraof strain SOIR-1 because at they 25- Figure 1), as well as monitoring of lysis parameters 37 °

(OD600, CFU/ml, and PFU/ml) in the broth co-cultures proper potential for environmental purposes such as in (Figure 4, Supplementary Figure 2), were used for situ Cbiocontrol (Figure 6) of and zoonotic pH 6.0–8.0 or phytopathogenic (Figure 7) reflects Gram- its evaluation of the bacteriolytic activity of strain SOIR- negative bacteria. The lytic activity at 37 °C, as well as 1. Strain SOIR-1 showed different killing rates toward in a wide range of pH, are two important advantages various prey (Figure 5). This behavior of bdellovibrios in the potential clinical use of strain SOIR-1 as a living antibiotic. B. bacteriovorus was found in the gut of healthy isbdellovibrios called preferential has also been predation, documented which before. reflects A study their individuals, and this is the most reliable evidence predationshowed that efficiency.the predation Preferential by B. bacteriovorus predation by supporting its safety and putative probiotic role in not random, but it infects and kills different prey in a humans (32). There are also no reported incidents for preferential manner. They suggested that predation109J is the invasion of mammalian cells by bdellovibrios (17, 20, 46). Furthermore, bdellovibrios have a unique lipid A Li et al. stated that BALOs have a prey preference structure in their LPS, which is much less immunogenic towardefficiency prey is athat function were ofused attachment for their efficiencyisolation (39).(40). than other bacterial LPS and exhibits lower binding However, this hypothesis was ruled out in this study since we used E. coli as prey for isolating the strain affinity to the LPS receptors presented in the surface S. dysenteriae (Figure 5). Although the wide prey range ofand human injection cells of (47).B. bacteriovorus No deleterious into sidevertebrates effects have(11, SOIR-1,toward Gram-negativebut its highest predationbacteria is efficiency a common was feature toward of been identified following topical application, ingestion, B. bacteriovorus strains, it has been shown that even support the hypothesis that predatory bacteria, closely related strains of B. bacteriovorus have different 48-50).especially These bdellovibrios, findings aremight promising be part signs of future which therapeutic strategies as probiotic, biocontrol agents, and closely related strains of the same species can be or living antimicrobials, especially in the age of growing predationdifferentially efficiencies preyed upon against by the the same same B. bacteriovorus prey strain, antibiotics resistance (7, 17, 27, 28, 32, 51, 52). strain (16, 41, 42). These observations indicate that the The term “amphibiotic” represents the dual probiotic interaction between bdellovibrios and prey is not just and antibiotic nature of bdellovibrios. (11). However, an ordinary random collision event, and some complex there are still some challenges regarding the use of and unknown mechanisms are likely involved in the bdellovibrios as amphibiotic that need to be further attachment of bdellovibrios to their preys. addressed. Firstly, predation by bdellovibrios does not completely eradicate the prey population, i.e., there surface and their accessibility are likely involved in the are still some prey cells that have not been invaded. attachmentThe potential and preferential specific receptors predation on by thebdellovibrios. prey cell Such transient resistance results from the dynamic parameters of prey and predator and is due to a plastic there is evidence that they are presumably located in the phenotype rather than a permanently genetically Althoughcore portion these of lipopolysaccharide receptors are not (LPS) yet fullywithin identified, the prey encoded one. So, the resistance to the bdellovibrios cell wall (43). The wide prey range of B. bacteriovorus is lost quickly (36). This means that bdellovibrios presumably employ a prey’s cellular component in bdellovibrios can recognize diverse receptors on the their predation process which is essential for the prey’s strainssurface canof various be due prey to two cells; hypothetical these receptors factors; may firstly, have viability, and the prey will always be prone to predation. Furthermore, the remaining un-predated cells might recognize a common motif on the surface of different be controllable by other complementary management differentprey cells bindingas the receptor affinities. which Secondly, is essential bdellovibrios for the strategies as adjuvants such as antibiotics, enzymes, and viability of prey cells (21, 38). The latter hypothesis bacteriophages (53, 54). Moreover, the quorum-sensing expresses a kind of survival strategy, i.e., it is not rational networks between pathogenic bacterial cells may

Iran J Basic Med Sci, Vol. 23, No.10, Oct 2020 1283 Odooli et al. An extremely bacteriolytic Bdellovibrio from Iran play an important role in their pathogenesis. We have crisis. Infect Drug Resist 2018; 11:1645-1658. this hypothesis that bdellovibrios can also indirectly suppress the pathogenesis of target bacteria through for effective antimicrobial therapy. Curr Pharm Des 2010; disrupting quorum sensing networks by killing at least 16:2279-2295.4. Cos P, Tote K, Horemans T, Maes L. Biofilms: an extra hurdle

Secondly, compared with bacteriophages, bdellovibrios Microbiol5. Hall-Stoodley 2004; L, 2:95-108. Costerton JW, Stoodley P. Bacterial biofilms: a significant part of the pathogenic population cells. from the natural environment to infectious diseases. Nat Rev showglance, broad this can and be non-specific a useful feature prey whenrange mixed and can bacterial attack 35:322-332.6. Høiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. Antibiotic Gram-negativespecies cause the bacteria infections. from However, different their genera. effects At first on 7.resistance Kadouri of DE, bacterial To K, Shanksbiofilms. RM, Int DoiJ Antimicrob Y. Predatory Agents bacteria: 2010; a potential ally against multidrug-resistant Gram-negative consideration (11). pathogens. PLoS One 2013; 8:e63397. the beneficial microbiota should be taken into more 8. Martin MO. Predatory prokaryotes: an emerging research Conclusion Bdellovibrio with on the isolation of one Bdellovibrio strain with broad opportunity. J Mol Microbiol Biotechnol 2002; 4:467-478. andTo high the bacteriolyticbest of our knowledge, activity from this Iran. is the The first biological report 9.213:428-431. Markelova NY. Predacious bacteria, characterization of isolated native strain (SOIR-1) was potential for biocontrol. Int J Hyg Environ Health 2010; ecology and diversity of Bdellovibrio and like organisms, and their10. Yair dynamics S, Yaacov in D,predator-prey Susan K, Jurkevitch interactions. E. Small Agronomie eats big: performedbacteriolytic using activity. electron The isolated microscopy, strain specific SOIR-1 PCR-had 2003; 23:433-439. basedthe most assays, predatory 16S rRNA activity gene at sequence30 °C and analysis,pH 7.4. The and successful lysis of pathogenic and antibiotic nature of Bdellovibrio bacteriovorus. BMB Rep Enterobacteriaceae 2012;11. Dwidar 45:71-78. M, Monnappa AK, Mitchell RJ. The dual probiotic nominates strain SOIR-1 as a promising bio-agent for the control and treatment of infections caused by these Bdellovibrio pathogens. Differential predation by bdellovibrios is Bacteriovorax12. Davidov Y,starrii Jurkevitch as Peredibacter E. Diversity starrii and gen. evolution nov., comb. of a phenomenon that was also shown in this study and nov., and description-and-like of organisms the Bacteriovorax (BALOs),– Peredibacter reclassification clade of indicates that the interactions between bdellovibrios as Bacteriovoracaceae and prey are not just an ordinary random collision 54:1439-1452. or completely receptor-based, but can involve very 13. Strauch E, Schwudkefam. nov. D, Int JLinscheid Syst Evol MicrobiolM. Predatory 2004; complicated procedures. The results of this research mechanisms of Bdellovibrio and like organisms. Future Microbiol 2007; 2:63-73. rejectused forthe theirprevious isolation. findings Due claiming to the that heterogeneity bdellovibrios of of a soil community of predatory bacteria using culture‐ havebdellovibrios, the highest further predation isolation and efficiency characterization toward prey are dependent14. Davidov Y,and Friedjung culture A,‐independent Jurkevitch E. methods Structure analysisreveals necessary to expand the BALOs database. Given the lack a hitherto undetected diversity of Bdellovibrio‐and‐like organisms. Environ Microbiol 2006; 8:1667-1673. of bdellovibrios from Iran, this study is a pioneer in 15. Schwudke D, Strauch E, Krueger M, Appel B. Taxonomic ofitself complete and pursues and sufficient the ultimate information goal of onusing the themisolation for analysis, ribotyping and the hit locus and characterization therapeutic purposes. ofstudies isolates of from predatory the gut of bdellovibrios animals. Syst based Appl Microbiol on 16S 2001; rRNA 24:385-394. Acknowledgments The results presented in this paper were part of characterization, ribotyping, and diversity of soil and S. Odooli’s Ph.D. thesis supported by a grant from the rhizosphere16. Jurkevitch Bdellovibrio E, Minz D,spp. Ramati isolated B, Barelon phytopathogenic G. Prey range Vice-Chancellor of Research and Technology, Shiraz bacteria. Appl Environ Microbiol 2000; 66:2365-2371. University of Medical Sciences, Shiraz, Iran, and the 17. Sockett RE, Lambert C. Bdellovibrio as therapeutic agents:

University of Isfahan, Isfahan, Iran. The authors are 18. Stolp H, Starr M. Bdellovibrio bacteriovorus gen. et sp. n., Officesincerely of Vice-Chancellorthankful to the forauthorities Research of and the Technology, University a predatorypredatory, renaissance? ectoparasitic, Nat and Rev bacteriolytic Microbiol 2004; microorganism. 2:669-675. of Isfahan, Isfahan, Iran, and Pharmaceutical Sciences Antonie Van Leeuwenhoek 1963; 29:217-248. Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. and proteome composition of Bdellovibrio bacteriovorus: indication19. Pan A, for Chanda recent I, Chakrabartiprey-derived J.horizontal Analysis ofgene the transfer. genome Conflicts of Interest Genomics 2011; 98:213-222. The authors have no competing interests. Lanz C, et al. A predator unmasked: life cycle of Bdellovibrio bacteriovorus20. Rendulic S,from Jagtap a genomic P, Rosinus perspective. A, Eppinger Science M, Baar 2004; C, References 303:689-692. 21. Lambert C, Morehouse KA, Chang C-Y, Sockett RE. resistance. Microbiol Mol Biol Rev 2010; 74:417-433. : growth and development during the predatory 1. Davies J, Davies D. Origins and evolution of antibiotic Bdellovibrio resistant gram-negative bacilli in the United States. Infect cycle. Curr Opin Microbiol 2006; 9:639-644. 2.Control Kallen Hosp AJ, Srinivasan Epidemiol A. 2010; Current 31:S51-S54. epidemiology of multidrug- 22. Sockett RE. Predatory lifestyle of Bdellovibrio bacteriovorus. 3. Aslam B, Wang W, Arshad MI, Khurshid M, Muzammil S, Annu Rev Microbiol 2009; 63:523-539. Rasool MH, et al. Antibiotic resistance: a rundown of a global 23. Dashiff A, Kadouri DE. A new method for isolating host-

1284 Iran J Basic Med Sci, Vol. 23, No. 10, Oct 2020 An extremely bacteriolytic Bdellovibrio from Iran Odooli et al. independent variants of Bdellovibrio bacteriovorus using E. coli 39. Rogosky AM, Moak PL, Emmert EA. Differential predation by Bdellovibrio bacteriovorus 24. Chu WH, Zhu W. Isolation of Bdellovibrio as biological 52:81-85. therapeuticauxotrophs. Openagents Microbiol used for J 2009; the 3:87–91.treatment of Aeromonas 109J. Curr Microbiol 2006; hydrophila of two marine Bdellovibrio-and-like organisms isolated from 57:258-264. 40.Daya Li H,bay Liu of C, Shenzhen,Chen L, Zhang China X, Cai and J. Biological their application characterization in the infection in fish. Zoonoses Public Health 2010; elimination of Vibrio parahaemolyticus human pathogens by the predatory bacteria Micavibrio Microbiol 2011; 151:36-43. aeruginosavorus25. Dashiff A, Junka and R, Bdellovibrio Libera M, Kadouri bacteriovorus DE. Predation of in oyster. Int J Food Microbiol 2011; 110:431-444. Potential control of potato soft rot disease by the obligate . J Appl 41.predators Youdkes Bdellovibrio D, Helman Y,and Burdman like organisms. S, Matan O,Appl Jurkevitch Environ E. Bdellovibrio bacteriovorus attack. Appl Environ Microbiol Microbiol 2020; 86:e02543-19. 26.2005; Kadouri 71:4044-4051. DE, O’Toole GA. Susceptibility of biofilms to Biocontrol of Burkholderia cepacia complex bacteria and Bdellovibrio bacteriovorus inhibits Staphylococcus aureus 42.bacterial McNeely phytopathogens D, Chanyi RM, by Bdellovibrio Dooley JS, Moorebacteriovorus JE, Koval SF. 27. Monnappa AK, Dwidar M, Seo JK, Hur J-H, Mitchell RJ. Microbiol 2017; 63:350-358. Rep 2014; 4:1-8. 43. Varon M, Shilo M. Attachment of Bdellovibrio bacteriovorus. Can J biofilm28. Shanks formation RM, Kadouri and invasion DE. Predatory into human prokaryotes epithelial wage cells. war Sci to cell wall mutants of Salmonella spp. and Escherichia coli against eye infections. Future Microbiol 2014; 9:429-432. Bacteriol 1969; 97:977-979. 44. Koval SF, Hynes SH. Effect of paracrystalline protein surface. J , et al. Killing of anaerobic pathogens by predatory layers on predation by Bdellovibrio bacteriovorus 29.bacteria. Van Essche Mol Oral M, Microbiol Quirynen 2011; M, Sliepen 26:52-61. I, Loozen G, Boon N, 1991; 173:2244-2249. Van Eldere J 45. Koval SF, Bayer ME. Bacterial capsules: no barrier. J Bacteriol against H. Hydrolase activities, microbial biomass and bacterial Bdellovibrio. Microbiology 1997; 143:749-753. 30.community Ros M, in Pascuala soil after JA, long-term Garcia C, amendment Hernandez with MT, different Insam 46. Gupta S, Tang C, Tran M, Kadouri DE. Effect of predatory composts. Soil Biol Biochem 2006; 38:3443-3452. bacteria on human cell lines. PLoS One 2016; 11:e0161242. 31. Kumar S, Stecher G, Tamura K. MEGA7: 47. Schwudke D, Linscheid M, Strauch E, Appel B, Zähringer U, molecularevolutionary genetics analysis version 7.0 for bigger Moll H, et al. The obligate predatory Bdellovibrio bacteriovorus datasets. Mol Biol Evol 2016; 33:1870-1874. possesses a neutral lipid A containing alpha-D-Mannoses that replace phosphate residues: similarities and differences Biase RV, et al. Higher prevalence and abundance of Bdellovibrio between the lipid As and the lipopolysaccharides of the wild 32.bacteriovorus Iebba V, Santangelo in the human F, Totino gut of V, healthyNicoletti subjects. M, Gagliardi PLoS A, One De type strain B. bacteriovorus HD100 and its host-independent 2013:e61608. 33. Feng S, Tan CH, Cohen Y, Rice SA. Isolation of Bdellovibrio bacteriovorus from a tropical wastewater treatment plant and derivativeLerner TR HI100., et al. JEffects Biol Chem of orally 2003; administered278:27502-27512. Bdellovibrio bacteriovorus48. Atterbury on RJ, the Hobley well-being L, Till and R, Lambert Salmonella C, Capeness colonization MJ, community members. Environ Microbiol 2016; 18:3923-3931. of young chicks. Appl Environ Microbiol 2011; 77:5794-5803. predation of mixed species biofilms assembled by the native 49. Shatzkes K, Chae R, Tang C, Ramirez GC, Mukherjee S, Bdellovibrio stolpii and Tsenova L, et al. Examining the safety of respiratory and Bdellovibrio34. Baer ML, starrii Ravel into J, a Chunnew genus, J, Hill Bacteriovorax RT, Williams gen. HN. nov. A intravenous inoculation of Bdellovibrio bacteriovorus and proposalas Bacteriovorax for the stolpii reclassification comb. nov. of and Bacteriovorax starrii Micavibrio aeruginosavorus in a mouse model. Sci Rep 2015; 5:12899. 224. 50. Shatzkes K, Singleton E, Tang C, Zuena M, Shukla S, Gupta comb.35. Koval nov., SF, respectively. Hynes SH, FlannaganInt J Syst Evol RS, Microbiol Pasternak 2000; Z, Davidov 50:219- Y, S, et al. Predatory bacteria attenuate Klebsiella pneumoniae Bdellovibrio exovorus sp. nov., a novel predator of burden in rat lungs. mBio 2016; 7:e01847-16. Caulobacter crescentus Jurkevitch151. E. Weinberger M, et al. In and out: an analysis of epibiotic vs . Int J Syst Evol Microbiol 2013; 63:146- 51. Pasternak Z, Njagi M, Shani Y, Chanyi R, Rotem O, Lurie- predation by Bdellovibrio and like organisms in bacterial prey. 36.Environ Shemesh Microbiol Y, Jurkevitch 2004; 6:12-18. E. Plastic phenotypic resistance to periplasmicof Bdellovibrio bacterial bacteriovorus predators. on ISME multidrug-resistant J 2014; 8:625-635. clinical 52. Sun Y, Ye J, Hou Y, Chen H, Cao J, Zhou T. Predation efficacy Rodriguez O, Guo X, Mendoza‐Villa MA, et al. Isolation of 2017; 70:485-489. 37.Bdellovibrio Oyedara sp. OO, from Luna soil ‐samplesSantillana in Mexico D, de and Jesus their E, potential Olguin‐ pathogens53. Chen H,and Williams their corresponding H. Sharing of biofilms. prey: coinfection Jpn J Infect of Dis a applications in control of pathogens. Microbiologyopen 2016; bacterium by a virus and a prokaryotic predator. mBio 2012; 5:992-1002. 3:e00051-12. 38. Strauch E, Beck S, Appel B. Bdellovibrio and like organisms: potential sources for new biochemicals and therapeutic , et al. Dual predation by bacteriophage and Bdellovibrio54. Hobley bacteriovorus L, Summers can JK, eradicate Till R, Milner Escherichia DS, Atterbury coli prey Biology, Ecology and Evolution. vol 4. 1st ed: Springer; 2006. RJ, Stroud A agents?p. 131-152. In: Jurkevitch E, editor. Predatory Prokaryotes- 202:e00629-19. in situations where single predation cannot. J Bacteriol 2020;

Iran J Basic Med Sci, Vol. 23, No.10, Oct 2020 1285