<<

Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

2006 Effect of porcine type 2 on porcine cell populations Shan Yu Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Animal Sciences Commons, Microbiology Commons, Physiology Commons, and the Veterinary Physiology Commons

Recommended Citation Yu, Shan, "Effect of type 2 on porcine cell populations " (2006). Retrospective Theses and Dissertations. 1318. https://lib.dr.iastate.edu/rtd/1318

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Effect of porcine circovirus type 2 on porcine cell populations

by

Shan Yu

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Veterinary Microbiology

Program of Study Committee: Eileen L. Thacker, Major Professor Patrick G. Halbur F. Chris Minion Michael Wannemuehler Brad J. Thacker

Iowa State University

Ames, Iowa

2006 UMI Number: 3217332

INFORMATION TO USERS

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

UMI

UMI Microform 3217332 Copyright 2006 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.

ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 ii

Graduate College Iowa State University

This is to certify that the doctoral dissertation of

Shan Yu has met the dissertation requirements of Iowa State University

Signature was redacted for privacy.

Major Professor

Signature was redacted for privacy.

For the Major Program Ill

TABLE OF CONTENTS

LIST OF FIGURES v

LIST OF TABLES vii

LIST OF ABBREVIATIONS viii

CHAPTER 1. GENERAL INTRODUCTION 1 Introduction 1 Dissertation Organization 5 Literature Review 6 PCV1 and PCV2 6 PMWS and PCV2 15 Other PCV2 associated diseases 29

CHAPTER 2. DEVELOPMENT OF A REVERSE TRANSCRIPTION-PCR 35 ASSAY TO DETECT PORCINE CIRCOVIRUS TYPE 2 TRANSCRIPTION AS A MEASURE OF REPLICATION Abstract 35 Text 36 Acknowledgements 41 References 42

CHAPTER 3. DETECTION OF PCV2 TRANSCRIPT IN PERIPHERAL 48 BLOOD MONONUCLEAR CELLS (PBMCS) INFECTED IN VITRO Abstract 48 Introduction 49 Materials and Methods 51 Results 56 Discussion 58 Acknowledgements 62 References 63

CHAPTER 4. PORCINE CIRCOVIRUS TYPE2 (PCV2) DISTRIBUTION AND 69 REPLICATION IN TISSUES AND IMMUNE CELLS IN EARLY INFECTED Abstract 69 Introduction 70 Materials and Methods 71 Results 78 Discussion 84 Acknowledgements 91 References 91 iv

CHAPTER 5. THE EFFECTS OF PCV2 INFECTION AND REPLICATION ON 104 ACTIVATED PORCINE PERIPHERAL BLOOD MONONUCLEAR CELLS IN VITRO AND THE RELATIONSHIP BETWEEN PCV2 REPLICATION AND CELLULAR PROLIFERATION Abstract 104 Introduction 105 Materials and Methods 107 Results 111 Discussion 113 Acknowledgements 118 References 119

CHAPTER 6. GENERAL CONCLUSIONS 128

REFERENCES CITED 13 3

ACKNOWLEDGEMENTS 148 V

LIST OF FIGURES

CHAPTER 2

Fig. 1. Strategy for design of oligonucleotide primers to detect 594 bp spliced 44 Cap mRNA and 984 bp genomic DNA of PCV2. Fig. 2. Amplification of PCV2 DNA, but not mRNA from stock. 44 Fig. 3. Kinetics of PCV2 spliced Cap mRNA synthesis in infected PK-15 cells. 45 Fig. 4. Amplification products from total RNA extracted from infected PK-15 46 cells with and without DNase treatment. Fig. 5. Sensitivity of the RT-PCR on DNase-treated total RNA extractions from 47 10-fold dilution of 1><104PCY2 infected PK-15 cells.

CHAPTER 3

Fig. l.A standard curve derived from the amplification of a dilution series 66 containing 5><102 to 5><107 copies/ reaction of the RNA standard for PCV2 spliced capsid mRNA. Fig. 2A. Quantification of PCV2 spliced capsid mRNA in infected peripheral 67 blood mononuclear cell populations with concanavalin A stimulation for 3 days. Fig. 2B. Quantification of PCV2 DNA in infected peripheral blood mononuclear 67 cell populations with concanavalin A stimulation for 3 days.

CHAPTER 4

Fig. 1A. Quantification of PCV2 spliced capsid mRNA in tissue samples from 98 infected pigs at 3, 7, 14 and 21 days post-infection (DPI). Fig. IB. Quantification of PCV2 DNA in tissue samples from infected pigs at 3, 98 7, 14 and 21 days post-infection (DPI). Fig. 2. Quantification of PCV2 DNA in cell-free bronchoalveolar lavage (BAL) 99 fluid or BAL cells, and PCV2 spliced capsid mRNA in BAL cells. Fig. 3. Quantification of PCV2 DNA in serum or peripheral blood mononuclear 100 cells (PBMCs), and PCV2 spliced capsid mRNA in PBMCs. Fig. 4. Quantification of PCV2 spliced capsid mRNA and viral DNA in purified 101 cell populations from peripheral blood mononuclear cells (PBMCs) from infected pigs at 13 days post-infection (DPI). Fig. 5A. Quantification of PCV2 spliced capsid mRNA in purified cell 102 populations from bronchial lymph node mononuclear cells from infected pigs. vi

Fig. 5B. Quantification of PCV2 DNA in purified cell populations from 102 bronchial lymph node mononuclear cells from infected pigs. Fig. 6. Comparison of PCV2 specific IgM antibody levels in bronchoalveolar 103 lavage fluid from PCV2 infected and non-infected groups. Fig. 7. Comparison of PCV2 specific IgA antibody levels in bronchoalveolar 103 lavage fluid from PCV2 infected and non-infected groups.

CHAPTER 5

Fig. 1. Quantification of PCV2 spliced capsid mRNA in PCV2 infected 126 peripheral blood mononuclear cells which are proliferated and non- proliferated. Fig. 2A. Apoptotic index of PCV2 infected peripheral blood mononuclear cells 127 (PBMCs) at 3 days post-infection. Fig. 2B. Apoptotic index of PCV2 infected peripheral blood mononuclear cells 127 (PBMCs) at 5 days post-infection. vii

LIST OF TABLES

CHAPTER 3

Table 1. In vitro kinetics of PCV2 replication in resting or concanavalin A (ConA)- 68 stimulated peripheral blood mononuclear cells (PBMCs).

CHAPTER 4

Table 1. Microscopic lesions of tissue samples in PCV2 infected pigs at 3, 7, 14 and 96 21 days post-infection (DPI). Table 2. Immunohistochemical analysis of tissue samples from infected pigs for the 97 presence of PCV2 antigen.

CHAPTER 5

Table 1. Quantification of PCV2 spliced capsid mRNA in infected peripheral blood 123 mononuclear cells with concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation. Table 2. The stimulation index of PCV2 infected peripheral blood mononuclear cells 124 with or without concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation. Table 3. The viability of PCV2 infected peripheral blood mononuclear cells with 125 concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation. viii

LIST OF ABBREVIATIONS

7AAD 7-amino-actinomycin D AI apoptotic index AN Annexin V ANOVA Analysis of variance BAL bronchoalveolar lavage BFDV beak and feather disease virus BHQ 1 Black Hole Quencher 1 BLN bronchial lymph nodes BSA bovine serum albumin CaCV canary circovirus Cap capsid protein Cap mRNA spliced capsid mRNA CAV chicken anaemia virus CCasp3 cleaved caspase-3 CD25 IL-2 R alpha CFSE 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester CoCV/PiCV pigeon or columbid circovirus ConA concanavalin A CPE cytopathic effect CT congenital tremors CT threshold cycle DCs dendritic cells DEX dexamethasone DPI days post-infection DuCV duck circovirus ELI SA enzyme-linked immunosorbent assay FAM 6-carboxyfluorescein FBS fetal bovine serum FCM fetal cardiomyocytes FITC fluorescein isothiocyanate GoCV goose circovirus HIV human immunodeficiency virus HPI hours post-infection IF A immunofluorescence assay IFN IHC immunohistochemistry IL interleukin ILN superficial inguinal lymph nodes IPMA immunoperoxidase monolayer assay ISH in situ hybridization IX

KLH keyhole limpet hemocyanin MCP-1 monocyte chemoattractant protein-1 MIP-1 inflammatory protein-1 MOI multiplicity of infection NS non-structure OD optical density ORF2 open reading frame 2 ORFs open-reading frames PAMs pulmonary alveolar PBMCs peripheral blood mononuclear cells PBS phosphate-buffered saline PBS-T Tween 20 in PBS PCR polymerase chain reaction PCV procine circovirus PCV1 PCV type 1 PCV2 PCV type 2 PONS porcine dermatitis and nephropathy syndrome PHA phytohemagglutinin PI propidium iodide PK-15 porcine kidney cell line PMWS postweaning multisystemic wasting syndrome PPV porcine parvovirus PRDC porcine respiratory disease complex PRRSV porcine reproductive and respiratory syndrome virus PWM pokeweed mitogen Rep replication-associated protein RF replication form r2 coefficients of correlation RT reverse transcriptase RT-PCR reverse transcription polymerase chain reaction SEW segregated early weaned SIV swine influenza virus S/P ratio sample-to-positive ratio ss single-stranded TCID50 50% tissue culture infective dose TdT terminal deoxynucleotidyl transferase TNF tumor necrosis factor TTV TT virus TUNEL terminal deoxynucleotidyl transferase-mediated dUTP-nick end labeling 1

CHAPTER 1. GENERAL INTRODUCTION

Introduction

The porcine circovirus (PCV) is a small, non-enveloped, single-stranded (ss), closed circular DNA virus. Two genotypes of PCV have been identified. PCV type 1 (PCV1) was first detected as a contaminant of the porcine kidney cell line (PK-15) (CCL-33) (Tischer et al., 1974). In 1991, a new disease named postweaning multisystemic wasting syndrome

(PMWS) was identified in a swine herd in Canada (Clark, 1997; Harding, 1996). The cause of this disease was attributed to a new PCV variant, PCV type 2 (PCV2). Since 1991, PMWS has been reported in many countries (Allan and Ellis, 2000). The overall DNA sequence identity within PCV1 or PCV2 isolates is greater than 90%, while the identity between PCV1 and PCV2 isolates is 68-76% (Fenaux et al., 2000; Hamel et al., 1998). The organization of PCV 1 and PCV2 consists of two major open-reading frames (ORFs), ORF1 and ORF2. ORF1 encodes the replication-associated protein (Rep) and ORF2 encodes the major capsid protein (Cap) (Liu et al., 2001; Nawagitgul et al., 2000). The Rep genes of

PCV1 and PCV2 are highly conserved, with 83% identity at the nucleotide sequence level, whereas the Cap genes share only 67% identity (Mankertz et al., 1998a).

Depletion of in the lymphoid follicles and their replacement by macrophages in conjunction with the presence of PCV2 viral antigen is a consistent finding associated with PMWS (Allan et al., 1999b; Meehan et al., 1998). Alteration in the populations of the macrophages and lymphocytes in the lymphoid tissues of infected pigs indicates that the virus may infect and has an impact on these immune cells. Although PCV2 has primarily been associated with PMWS, it has also been implicated in a number of disease syndromes including porcine dermatitis and nephropathy syndrome (PONS), porcine 2 respiratory disease complex (PRDC), enteritis, reproductive failure, and congenital tremors

(CT) type All (Allan and Ellis, 2000; Segales et al., 2004b). Preventing and controlling these

disease syndromes makes it important to understand the pathogenesis of PCV2 in infected

pigs. The objectives in the studies described herein were threefold: 1) to evaluate PCV2

replication in populations of immune cells in vitro and in vivo; 2) investigate the effects of

PCV2 replication on activated immune cells in vitro and; 3) investigate the relationship

between PCV2 replication and cellular proliferation.

Several methods such as virus isolation, indirect immnofluorescence, in situ

hybridization (ISH), immunohistochemistry (IHC) and polymerase chain reaction (PCR)

have been used to detect PCV2 in tissues or serum samples (Allan et al., 1998b; Choi et al.,

2000; Ellis et al., 1998; McNeilly et al., 1999; Quintana et al., 2001; Rosell et al., 1999;

Tischer et al., 1987). However, these assays lack of sensitivity, time-consuming, or unable to

discriminate between the PCV2 virons and replicating virus. Transcriptional analysis of

PCV2 identified one capsid mRNA and a cluster of five Rep-associated RNAs, which

increase in a time-dependent manner during PCV2 replication in PK-15 cells (Cheung,

2003c). The capsid mRNA contains a splice junction at nucleotides 361 and 1737 (Cheung,

2003c). In our first study, primers were designed to amplify across the capsid mRNA splice

junction and a PCV2-specific reverse transcription polymerase chain reaction (RT-PCR)

assay able to differentiate between PCV2 replication products and virus DNA in PK-15 cells

was developed (Yu et al., 2005). Because this assay did not allow us to quantify the viral

product, a quantitative real-time RT-PCR assay to detect the spliced capsid mRNA (Cap

mRNA) was developed in the second study. It has been shown that the viremia caused by

PCV2 is both cell-free and cell-associated, but the cell-associated form appears to be more 3 apparent and long-lasting (Pensaert et al., 2004). However, it is unknown whether the PCV2 associated with monocytes isolated from peripheral blood mononuclear cells (PBMCs) was the result of PCV2 active replication within the different cell populations or was due to non- replicating virus that had either adsorbed to or been endocytosed by the cells. Moreover, it has been reported that general stimulation of the immune system could increase PCV2 replication and predispose pigs to PMWS (Grasland et al., 2005; Krakowka et al., 2001 ;

Kyriakis et al., 2002). Therefore, in the second study, we assessed PCV2 replication in

cultured PBMCs with or without mitogen stimulation at different time points. To further

identify the specific PBMC populations in which PCV2 replicates, stimulated and infected

PBMCs were sorted by flow cytometry into CD3+( T lymphocytes), SWC3+( monocytes) and

SWC3" (PBMCs with monocytes removed) cell populations. The various populations were

evaluated for PCV2 Cap mRNA and viral DNA to ascertain the capability of these cell

populations to support PCV2 replication.

Even though PCV2 antigen and DNA have been detected from multiple organs and

multiple cell types in infected pigs (Chae, 2004; Chianini et al., 2003; Choi and Chae, 1999;

Hamel et al., 2000), it remains unclear which tissue or cell type is the primary site of virus

infection and replication. Therefore, the aim of our third study was to understand the

replication kinetics of PCV2 in vivo. In this study, the levels of PCV2 Cap mRNA and viral

DNA was assessed in PBMCs, bronchoalveolar lavage (BAL) cells and tissue samples

including bronchial lymph nodes (BLN), superficial inguinal lymph nodes (ILN), lung,

tonsil, thymus, spleen, liver and kidney from pigs at early stage of PCV2 infection. Viral

loads in serum/BAL cell-free fluid, microscopic lesions and PCV2 antigen in tested tissues,

PCV2 antibody levels in serum/BAL samples were also investigated using real-time PCR, 4 histopathology, IHC and ELISA assays, respectively. In addition, PCV2 infection and replication in different immune cell populations isolated from peripheral blood or BLN mononuclear cells from infected pigs were separated by magnetic cell sorting (AutoMACS) and the Cap mRNA and viral DNA levels were determined. The findings from this study identified the cell populations in which PCV2 infects and replicates in pigs at early stage of

PCV2 infection, thus, increasing the knowledge of the kinetics of PCV2 replication in infected pigs.

Lymphocyte depletion of follicular and interfollicular areas together with macrophage infiltration of lymphoid tissues is the hallmark lesion associated with PMWS in PCV2 infected pigs (Allan and Ellis, 2000). These findings are highly correlated with a decrease in circulating B and T lymphocytes and reduced numbers of these cells in lymphoid organs

(Darwich et al., 2002; Segales et al., 2001). Moreover, previous studies have observed a strong correlation between the amount of PCV2 nucleic acid or antigen and the severity of

lymphoid depletion and granulomatous changes in lymphoid tissues (Segales and Domingo,

2002). Though it has been suggested that PCV2 induces that results in B

depletion (Shibahara et al., 2000), recent research comparing cell populations in

ILN from normal pigs and pigs with lesions consistent with PMWS found decreased cell

proliferation in the absence of increased apoptosis suggesting that apoptosis was not an

important mechanism leading to cell depletion (Mandrioli et al., 2004). However, this study

was based on tissues diagnosed as PMWS under field conditions, which may caused by

multiple pathogens not by PCV2 alone. In contrast to the theory of reduced proliferation in

response to PCV2 infection, research has also suggested that vaccination and stimulation of

an immune response may enhance the replication of PCV2 and predispose pigs to PMWS 5

(Grasland et al., 2005; Krakowka et al., 2001; Kyriakis et al., 2002). Lymphocytes proliferate when activated by antigens or adjuvants and results in an increase of PCV2 replication in them as they divide. Thus, conflicting theories are existent regarding the pathogenesis of the

lymphoid depletion associated with PCV2 infection. To date, the mechanism responsible for

lymphoid depletion remains unknown. Therefore, the objective of the fourth study was to

evaluate the effects of PCV2 infection and replication on activated PBMCs in vitro as well as

the relationship between PCV2 replication and cellular proliferation. Viral replication was

assessed in infected PBMCs in the presence of the mitogens, concanavalin A (ConA) or

pokeweed mitogen (PWM). ConA and PWM have been reported to stimulate different

subpopulation of T lymphocytes. In addition, PWM was used to stimulate porcine B

lymphocytes (Dorn et al., 2002; Williams, 1993). We also measured lymphocyte

proliferation using 5-(and-6)-carboxyfluorescein diacetate, succinimidyl ester (CFSE)

labeling and determined the apoptotic index by Annexin V (AN) and 7-amino-actinomycin D

(7AAD) staining using flow cytometric analysis. To further study whether the proliferation

of PBMCs facilitate PCV2 replication, the levels of PCV2 Cap mRNA was assessed in

PBMCs that had been stimulated with ConA for 12, 36, and 72 hours prior to inoculation of

PCV2 for 24 hours. In addition, the level of PCV2 Cap mRNA in proliferated and non-

proliferated PBMCs with ConA or PWM stimulation was also evaluated. Determination of

the apoptotic and proliferation indices on PCV2 infection and replication in the immune cells

should further increase our understanding of the pathogenesis of PCV2-associated diseases.

Dissertation Organization

This dissertation is comprised of six chapters in the alternative format. Chapter 1 is a

general introduction containing the introduction, dissertation organization and literature 6 review. Chapter 2 describes the development of a reverse transcription-PCR assay to detect porcine circovirus type 2 transcription as a measure of replication. This chapter was published as a short communication in the Journal of Virological Methods. Chapters 3 through 5 are the author's research, in manuscript format prepared for publication. The sixth

Chapter presents the general conclusions of the entire research. The citations from the

introduction, literature review, and general conclusion sections are compiled in the reference

list at the end of this dissertation.

Literature Review

PCV1 and PCV2

Background of PCV

Porcine circovirus (PCV) was first detected as a contaminant of a continuous porcine

kidney cell line (PK-15) (Tischer et al., 1974). This cell culture isolate was shown to possess

a circular single-stranded DNA genome of 1.76 kb (Tischer et al., 1982; Buhk et al., 1985;

Meehan et al., 1997). In 1997, the presence of PCV antigen was demonstrated in lesions of

pigs with a clinical disorder called postweaning multisystemic wasting syndrome (PMWS)

(Clark, 1997). Nucleotide sequence analysis of PCV associated with PMWS revealed

important differences compared to the previously known PCV isolated from PK-15 cells

(ATCC CCL-33) (Hamel et al., 1998), and it was decided that the would be identified

as PCV type 1 (PCV1) for the original PCV contaminant of PK-15 cells, and PCV type 2

(PCV2) for the virus associated with the new disease syndrome, PMWS (Allan et al., 1999b;

Meehan et al., 1998).

On the basis of their morphology and circular ssDNA genome, PCV1 and PCV2 were

classified in the family which comprises two genera Circovirus and Gyrovirus 7

(Todd et al., 2001; Pringle, 1999). The genus Circovirus include PCV1 and PCV2, beak and feather disease virus (BFDV), pigeon or columbid circovirus (CoCV/PiCV), duck circovirus

(DuCV), goose circovirus (GoCV), and canary circovirus (CaCV) (Ritchie et al., 1989; Todd et al., 1991; Woods et al., 1993; Todd et al., 2001; Phénix et al., 2001). All members of this

genus have the typical ambisense genomic structure of a circovirus. The genus Gyrovirus

consists only of chicken anaemia virus (CAV) (Pringle, 1999). Studies showed that PCVs are

closely related to plant , now renamed nanoviruses (Meehan et al., 1997). It has

been suggested that the PCV genome is an intermediate between plant geminivirus and

nanovirus (Niagro et al., 1998) and that PCV may be the result of a recombination event

between a nanovirus and an animal picorna-like RNA virus (Gibbs and Weiller, 1999).

Biological and physicochemical properties

It is known that PCV1 has a buoyant density of 1.37 g/cc in CsCl, is not able to

haemagglutinate erythrocytes from a wide range of species, is resistant to inactivation at

pH-3 and by chloroform, and is stable at temperatures of 56 °C to 70 °C for at least 15 min

(Allan et al., 1994c). The biological and physicochemical characteristics of PCV2 are similar

to those of PCV1. Both PCV1 and PCV2 are highly resistant to inactivation by common

detergents and disinfectants (Allan et al., 1994b; Royer R.L., 2001).

PK-15 cells are the most commonly used cell line for propagating PCV. As might be

expected, the PK-15 cell-derived PCV1 replicates more efficiently in PK-15 cells than does

PCV2 (Fenaux et al., 2003). The replication kinetics of different PCV2 strains has been

compared in PK-15 cells, and it was shown that the abortion-associated PCV2 strains have

different replication kinetics than viruses isolated from cases of PMWS or porcine dermatitis

and nephropathy syndrome (PONS) (Meerts et al., 2005). 8

A cytopathic effect (CPE) induced by PCV infection has not been reported, and as a result, cell infection is normally monitored by immunofluorescent or immunoperoxidase staining of infected cell cultures (Allan et al., 1994a; Tischer et al., 1987). Investigation of

PCV1 replication in porcine, bovine, ovine, avian or human cell cultures showed that all

porcine derived cell cultures were susceptible to infection with PCV1 (Allan et al., 1994c).

Primary, semi-continuous and continuous cultures derived from the other species tested in

the study were found to be also susceptible to infection, with the exception of avian cell

cultures. Moreover, viral antigen was detected in the cytoplasm of many susceptible cells

while nuclear staining was detected in only a very few cells in porcine-derived cell or Vero

cell cultures (Allan et al., 1994c). The results of infectivity titrations following passage of

cell lysates indicate that production of infectious virus in inoculated cell cultures was

confined to porcine-derived and Vero cultures (Allan et al., 1994c). In addition, the

replication of PCV1 in porcine and bovine monocyte/macrophage culture has been reported

(Allan et al., 1994b). PCV1 DNA replication has been shown to be dependent on cellular

enzymes expressed during of growth and in the natural multiplication cycle in vitro,

PCV DNA replication begins only when cells have passed mitosis (Tischer et al., 1987).

Recently, a study investigated the susceptibility of human cells to PCV in vitro

(Hattermann et al., 2004). Nine adherent human cell lines, Chang liver, FL, 293, Hep2, RH,

CaCo, HeLa, Ma23, and Rd, were either transfected with religated DNA of PCV1 or PCV2

or infected with the viruses. After transaction, Chang liver, 293, Hep2, HeLa, and RH cells

maintained PCV1 and PCV2 DNA and expressed the viral antigen as well. PCV2 DNA was

lost after 2 weeks, while PCV1 persisted in all cells until the end of the 6-week experimental

period. Expression rates of viral proteins were comparable with those observed in PK-15 9 cells after transfection of the PCV genome. A CPE was observed in the PCV2-transfected human cells, but not in PCV1-infected cells. In contrast to the results obtained by transfecting cells with PCV-DNA, infection with PCV1 was observed in Chang liver, 293, and Hep2

cells, while Rd cells were found to be susceptible to PCV2 (Hattermann et al., 2004). In vivo,

PCV is often found in cells of the macrophage/monocyte lineage. Therefore, eight human

suspension cell lines Wil2, THP1, Jurkat, Molt4, C8166, CEM, U937, H9 and human

PBMCs with PCV1 and PCV2 infection were further evaluated. While viral antigen was

observed in the positive control of the porcine lymphoblast cell line, L23, no PCV DNA or

antigen was observed in tested cell lines, indicating that they are non-permissive for PCV

replication (Hattermann et al., 2004). In addition, four animal cell lines (simian Vero cells,

murine cell lines RAT-2 and CTL, and feline cell line PG4) were infected with PCV and

investigated for expression of viral proteins in immunofluorescence assay (IFA).

Fluorescence signal was observed in Vero cells, while the murine cell lines, RAT-2 and CTL,

remained negative, as well as feline cell line, PG4. Subcellular localization of the Cap protein

was observed by IFA and confocal microscopy in PCV-infected cells. The fluorescence was

observed in PCV-permissive PK-15 cells with fluorescence in the nucleus, in the nucleus

with nucleoli spared, or restricted to the cytoplasm. In contrast, PCV-infected human cells

had Cap protein accumulated punctiformly in the nucleus, suggesting that protein transport or

virus assembly may be perturbed in these cells (Hattermann et al., 2004). Overall, these

studies of PCV infection and replication in different cell lines from different species

demonstrated that PCV1 can be better propagated those cell lines than PCV2. However, most

cell lines are not permissive for PCV. Serological studies

Serum antibodies to PCV1 have been demonstrated in pigs in Germany (Tischer et al., 1995), Canada (Dulac and Afshar, 1989), Great Britain (Edwards and Sands, 1994), and

Northern Ireland (Allan et al., 1994c) suggesting PCV1 infection of pigs is ubiquitous throughout the world. An absence of serum antibodies to PCV1 in cattle, sheep, chickens, turkeys, goats, mice, rabbits, or humans has also been reported (Allan et al., 1994b).

However, in contrast, serum antibodies to PCV1 were detected in humans, mice and cattle in

Germany, using a combination of indirect immunofluoresence and enzyme-linked

immunosorbent assay (ELISA) procedures (Tischer et al., 1995). Shortly after the isolation of

PCV2 in Canada, almost identical viruses were isolated from diseased pigs in North America

(Allan et al., 1998a; Larochelle et al., 1999b), Europe (Allan et al., 1999b; Kennedy et al.,

1998)), and Asia (Kim and Chae, 2001b). Using monoclonal and polyclonal antisera, these

isolated PCV2 have been shown to be antigenically distinct from PCV1 (Allan et al., 1998b;

Ellis et al., 1998).

Serological surveys for PCV2 antibodies were undertaken and a significant number of

pigs were found to be seropositive, with most of them showing no clinical signs compatible

with PMWS (Labarque et al., 2000; Magar et al., 2000a; Magar et al., 2000b; Rodriguez-

Arrioja et al., 2000; Sibila et al., 2004). Retrospective studies show that antibodies that react

with PCV2 have been widespread in the population since at least 1969, indicating that

PCV2 is not a new virus (Walker et al., 2000). The presence of PCV2 antibodies in European

wild boars has been reported (Vicente et al., 2004). Because of a slight degree of antigenic

cross-reactivity between PCV1 and PCV2 isolates (Allan et al., 1998b), it is possible that the 11 high seroprevalence rate of antibodies reported to PCV 1 may be due to antibodies cross- reactive with PCV2.

PCV2 seroconversion shows a pattern that consists of declining of colostral

antibodies during the lactation and nursery periods, with the lowest levels typically occurring

at the end of the nursery period, and active seroconversion of most pigs occurring during the

grower period as determined by an immunoperoxidase monolayer assay (IP MA) or ELISA

tests (Rodriguez-Arrioja et al., 2002). It has been reported that following experimental

infection of the piglets with a cell culture isolate of PCV2, the piglets with passively derived

maternal antibodies from sows with high levels of PCV2 antibodies performed significantly

better in terms of weight gain, clinical scores and disease compared to piglets derived from

sows with low PCV2 antibodies, indicating maternal antibody plays an important role in

protecting piglets from developing PMWS (Allan G.M., 2002).

Previous studies demonstrated that the genome organization of PCVI and PCV2

consists of two major open reading frames (ORFs), ORF1 and ORF2. ORF1 encodes the

replication associated protein (Rep) and ORF2 encodes the major capsid protein (Cap) (Liu

et al., 2001; Nawagitgul et al., 2000). Recently, several studies have suggested that the PCV2

Cap is the major immunogenic protein of the virus and the principal bearer of type-specific

epitopes (Blanchard et al., 2003a; Liu et al., 2001). In contrast, the Rep appears to be only

weakly immunogenic (Blanchard et al., 2003a)

Pathological studies

PCV1 is generally accepted to be a non-pathogenic virus (Allan et al., 1995; Tischer

et al., 1986). Experimental infection of pigs with PCV1 at various times after birth did not

produce clinical disease (Allan et al., 1995; Tischer et al., 1986). In contrast, PCV2 has been 12 directly associated with a number of clinical conditions including PMWS, porcine dermatitis and nephropathy syndrome (PDNS), porcine respiratory disease complex (PRDC), enteritis,

reproductive failure, and congenital tremor type All (Allan and Ellis, 2000; Segales et al.,

2004b).

Viremia caused by PCV2 appears to be both cell-free and cell-associated, but the cell-

associated form is much more apparent and long-lasting (Pensaert et al., 2004). It is of

interest that the cell-associated viremia is present concomitantly with IPMA antibodies

(Pensaert et al., 2004). In addition, the presence of PCV2 DNA in tissues from

experimentally infected pigs at 125 days post-inoculation has been demonstrated, suggesting

that there is a persistent infection by PCV2 (Bolin et al., 2001).

PCV2 has been shown to be transmissible by co-mingling animals from affected

herds and naive animals (Balasch et al., 1999). Studies have shown that PCV2 can be

detected by PCR in nasal, tonsillar, bronchial, urinary and fecal samples in a large proportion

of pigs with and without PMWS (Calsamiglia et al., 2002; Shibata et al., 2003; Yang et al.,

2003). Based on these studies, the potential route of exposure of young swine to PCV2

appears to be by either oronasal direct contact exposure or through fecal-oral transmission of

PCV2 in feces. Viral transmission may also occur vertically, or by sexual contact because

PCV2 has been detected in fetuses (O'Connor et al., 2001; West et al., 1999) and in semen

(Larochelle et al., 2000). There has been no report of PCV2 infection from shared needles.

However, several studies have demonstrated that PCV2 genomic DNA was infectious when

injected intramuscularly into pigs (Fenaux et al., 2004a; Grasland et al., 2005; Roca et al.,

2004), suggesting that blood transmission might be possible. 13

Recently, several studies were conducted to investigate PCV2 infection on other species. Data indicates that PCV2 can infect and cause PMWS at a higher incidence in

European wild boar (Sus scrofa) subspecies compared to domestic swine (Ellis et al., 2003;

Schulze et al., 2004). More recently, the detection of PCV1 and PCV2 DNA from porcine-

derived commercial pepsin has been reported (Fenaux et al., 2004c). Though the PCV-

contaminated pepsin lacks infectivity in PK-15 cells or in vivo, this finding raises the concern

for potential human infection through xenotransplantation (Fenaux et al., 2004c).

Genomic studies

The genome sequences of a number of PCV 1 (1759 bases) and PCV2 (1768 bases)

isolates have been determined (Fenaux et al., 2000; Hamel et al., 1998; Meehan et al., 1998;

Nayar et al., 1997). The overall DNA sequence identity within PCV1 or PCV2 isolates is

greater than 90% (de Boisseson et al., 2004; Grierson et al., 2004; Larochelle et al., 2003;

Mankertz et al., 2000; Meehan et al., 1998), while the identity between PCV1 and PCV2

isolates is 68%-76% (Fenaux et al., 2000; Hamel et al., 1998; Meehan et al., 1998; Nayar et

al., 1997).

The Rep genes of PCV1 and PCV2 are highly conserved with 83% identity at the

nucleotide sequence level and 86% at the protein level. In contrast, the Cap genes share only

67% identity at the nucleotide sequence level and 66% at protein level (Mankertz et al.,

1998a; Mankertz et al., 1998b; Meehan et al., 1997). It has recently been reported that two

amino acid mutations within the PCV2 capsid protein at passage 120 are responsible for the

increased growth rate in vitro and for attenuation of the virus in vivo (Fenaux et al., 2004b).

PCV has an ambisense circular genome that encodes proteins by the encapsidated

viral DNA, and by the complementary DNA of the replication intermediate synthesized in 14 the host (Tischer et al., 1982). The encapsidated viral DNA codes for the Rep-associated and

non-structure (NS)-associated proteins while the complementary strand synthesized in the

host codes for the Cap (Cheung, 2003a; Cheung, 2003c; Cheung and Bolin, 2002; Mankertz

and Hillenbrand, 2001; Mankertz and Hillenbrand, 2002; Mankertz et al., 1998a; Mankertz et

al., 1998b; Nawagitgul et al., 2000). A nuclear localization signal for the Cap has been

identified (Liu et al., 2001). In order to express the Cap, it is believed that the complementary

strand has to be synthesized through the intermediate double-stranded replication form (RF)

(Tischer and Buhk, 1988).

During PCV1 replication in PK-15 cells, twelve virus-specific RNAs are synthesized.

They include one capsid protein RNA, eight Rep-associated RNAs (rep, rep', rep3a, rep3b,

rep3c-l, rep3c-2, rep3c-3 and rep3c-4), and three NS-associated RNAs (Cheung, 2004). Nine

RNAs were synthesized during productive PCV2 infection in PK-15 cells. They include the

viral capsid protein RNA, a cluster of five Rep-associated RNAs (rep, rep', rep3a, rep3b, and

rep3c), and three NS-associated RNA (Cheung, 2003c). Corroborating earlier observations in

PCV1 (Mankertz and Hillenbrand, 2001), the simultaneous expression of rep and rep'

proteins is essential for initiation of replication of PCV2 (Cheung, 2003b).

When the ratio of the two transcripts, rep and rep', was measured following

transfection of PK-15 cells with an infectious PCV1 clone, the amount of rep' and rep were

similar at the beginning of infection. Later, rep' number increased and decreased again,

indicating a delicately balanced regulation of rep gene expression (Mankertz et al., 1998a). It

was shown that the rep/rep' protein of PCV2 initiated replication of PCV1, as did the

reciprocal combination, indicating that the cis- and trans-acting replication factors of the two

viruses are functionally interchangeable (Mankertz et al., 2003). 15

PMWS and PCV2

Background of PMWS

PMWS was initially described in Saskatchewan, Canada in 1991 (Clark, 1997;

Harding, 1996). The initial outbreaks of PMWS were in herds with high health status.

Subsequently the syndrome was reported around the world, including; Europe, North

America and Asia (Allan et al., 1999b; Allan et al., 1998b; Choi et al., 2000; Kiupel et al.,

1998; Onuki et al., 1999; Saoulidis et al., 2002; Trujano et al., 2001). Affected herds are

typically farrow-to finish operations. However, PMWS has been described in almost all types

of farms and farm size has ranged from 30- to 10,000-sow herds. The expression of the

disease on an individual basis appears to be a key point in the clinical syndrome. PMWS

affected pigs tend to die or to develop marked wasting within a few days of infection

(Segales and Domingo, 2002). Morbidity and mortality associated with PMWS can be 4 to

10% and 70 to 80%, respectively, depending on the stage of the outbreak and the

management style within the affected units (Segales and Domingo, 2002). In North America,

PMWS usually results in low grade but persistent death losses. On rare occasions, epidemics

resulting in a 3 to 4-fold increase in post-weaning mortality rates have been reported (Madec,

2000). Persistent, high mortality appears to be more common in several European countries,

and may be associated with an epidemic form of PCV, co-existing diseases, factors of unique

regional procedures (Madec, 2000). Environmental factors such as air drafts, overcrowding,

poor air quality, co-mingling of age groups and other stressors may exacerbate the severity of

the disease (Harding, 1998). 16

Clinical signs and pathology

The primary clinical signs of PMWS in affected pigs include wasting, dyspnea, and pallor. Other clinical signs including diarrhea, jaundice, coughing, pyrexia, central nervous signs and sudden death have also been reported (Allan and Ellis, 2000; Ellis et al., 1998).

Macroscopic lesions associated with PMWS are nonspecific and include enlarged

lymph nodes such as the mesenteric, inguinal, and tracheobronchial lymph nodes. Non-

collapsing, tan-mottled lungs, sometimes with marked interstitial edema has typically been

associated with bronchopneumonia and has been associated with PMWS (Allan and Ellis,

2000; Rosell et al., 1999). PMWS affected animals may also have atrophic discolored livers,

and/or multifocal white foci in the kidney's cortices. Gastric ulceration of the pars

oesophages can also be seen in PMWS affected pigs (Allan and Ellis, 2000; Rosell et al.,

1999).

Microscopically, varying degrees lymphoid depletion together with histiocytic and/or

multinucleate giant cell infiltration of lymphoid tissues is a unique lesion that characterizes

PMWS. In a number of cases, basophilic intracytoplasmatic inclusion bodies containing

PCV2 antigen or nucleic acid can be found in cells of the histiocytic lineage (Rosell et al.,

1999). Sporadically, multifocal coagulative necrosis may be observed (Segales and

Domingo, 2002). Other microscopic changes include multifocal lymphohistiocytic interstitial

pneumonia, variable degrees of hepatitis, lymphocytic or lymphohistiocytic infiltration in the

renal interstitium, and intestinal villous atrophy with variable sloughing and/or regeneration

of glandular and cryptal epithelial cells (Allan and Ellis, 2000; Rosell et al., 2000a; Rosell et

al., 1999). 17

Mild to moderate PMWS-like lesions can be observed in clinically normal pigs

(Quintana et al., 2001), indicating that subclinical PCV2 infection occurs frequently in both

PMWS and non-PMWS -affected farms (Rodriguez-Arrioja et al., 2000). Several studies have demonstrated a correlation between the amount of viral antigen or genetic material detected in the tissue and the severity of the lymphoid depletion. However, no correlation has been found between the severity of PMWS lymphoid lesions and the severity of lesions in other tissues such as lung, liver or kidney (Chianini et al., 2003; Darwich et al., 2002; Rosell et al.,

1999).

Experimental reproduction of PMWS

Experimental studies with PCV2 have primarily focused on reproducing PMWS.

Initial experimental trials using tissue homogenates or PCV2 isolated and propagated in cell culture, reproduced PMWS-like lesions of slight to moderate intensity (Allan et al., 1999a;

Balasch et al., 1999; Ellis et al., 1999; Kennedy et al., 2000; Krakowka et al., 2000; Magar et al., 2000a; Pogranichnyy et al., 2000). However, no clinical wasting occurred. Later on, reproduction of the full spectrum of PMWS clinical and pathological outcome using PCV2 alone have been reported (Allan et al., 2002; Bolin et al., 2001; Harms et al., 2001). The infection of conventional segregated early weaned (SEW) pigs with an infectious DNA clone of PCV2, resulting in the hallmark lesions consistent with PMWS, further established PCV2 as the cause of PMWS (Pénaux et al., 2002).

Although severe PMWS has been reported to be induced with PCV2 alone, severe clinical PMWS has been more reliably reproduced in pigs co-infected with porcine

parvovirus (PPV) (Kennedy et al., 2000; Krakowka et al., 2000), porcine reproductive and

respiratory syndrome virus (PRRSV) (Harms et al., 2001; Rovira et al., 2002), Mycoplasma 18 hyopneumoniae (Opriessnig et al., 2004), or with the use of immunostimulating factors, such as keyhole limpet hemocyanin (KLH) emulsified in incomplete Freund's adjuvant, vaccines,

or non-specific immunomodulating drugs (Baypamun, Bayer, Leverkusen, Germany) (Allan

et al., 2000; Krakowka et al., 2001; Kyriakis et al., 2002; Opriessnig et al., 2003). The use of

these co-factors suggests that multiple factors may be needed to reproduce the full spectrum

of clinical PWMS.

However, contradictory results from several studies on immunostimulation and the

induction of PMWS have been reported (Ladekjaer-Mikkelsen et al., 2002; Resendes et al.,

2004a). One study found that using KLH emulsified in incomplete Freund's adjuvant in 3

week old conventional PCV2 infected pigs did not always result in clinical disease, though

PMWS was produced in several pigs (Ladekjaer-Mikkelsen et al., 2002). A second study

found that the use of a commercial adjuvant did not result in the development of PMWS in

conventional pigs experimentally infected with PCV2, suggesting that not all conditions or

adjuvants used in commercial vaccines are capable of triggering PMWS (Resendes et al.,

2004a). Moreover, an investigation of the effect of immunosuppression on PCV2 infections

using an immunosuppressive drug, dexamethasone (DEX) showed that a reduced number of

CD4+ T cells in DEX-treated piglets (with or without PCV2 infection) and PCV2 associated

lesions and antigen was present in lymphoid tissues from the PCV2 and DEX treated group.

These results again conflict with the hypothesis that immune stimulation may predispose pigs

to PMWS and suggest that suppression of cell-mediated immunity may play a role in the

etiology of PMWS (Kawashima et al., 2003). 19

Field observations

In addition to recognizing PCV2 as the cause of PMWS, studies have documented that PMWS-affected pigs in the field are typically concomitantly infected with other

pathogens including PRRSV, PPV, swine influenza virus (SIV), pseudorabies virus (Ellis et

al., 2000; Quintana et al., 2001; Rodriguez-Arrioja et al., 1999; Rosell et al., 1999; Segales et

al., 2000), Mycoplasma hyopneumoniae and a variety of other bacterial pathogens, notably

Streptococcus suis, Bordetella bronchiseptica Pasteurella multocida, Actinobacillus

pleuropneumoniae, and Staphylococcus sp. (Kim and Chae, 2004a; Madec, 2000; Pallares et

al., 2002; Pogranichniy et al., 2002; Quintana et al., 2001; Rodriguez-Arrioj a et al., 1999;

Segales et al., 2002). The presence of these secondary pathogens suggests that they may play

an important role in inducing PCV2 infection to progress to PMWS (Segales and Domingo,

2002).

However, a comparative serological and virological study was performed in pigs from

herds with and without PMWS in Quebec (Larochelle et al., 2003). The serum was evaluated

for the presence of antibodies to PCV2 and PRRSV by IF A and ELISA, respectively. A PGR

assay was used to detect the nucleic acid of PCV2, PRRSV, and PPV. The PCV2 strains

detected in the herds with or without PMWS were sequenced and their compared.

The results of this study demonstrated that the development of PMWS could not be linked to

co-infection with either PRRSV or PPV or to particular genomic differences between PCV2

strains (Larochelle et al., 2003). These results further complicate our understanding of the

pathogenesis of PCV2 infection and PMWS under field conditions. 20

Immunological aspects

The lack of response to antibiotic therapy in systemic and/or pulmonary bacterial infections in PMWS affected farms (Segales et al., 2004a; Segales et al., 1997) as well as infections with unusual swine pathogens, such as Pneumocystis carinii, Chlamydia spp.,

Aspergillus spp and Cryptosporidium parvum, suggests an immunosuppressive feature associated with PMWS (Carrasco et al., 2000; Clark, 1997; Darwich et al., 2004; Ellis et al.,

1998; Nunez et al., 2003; Segales et al., 2004a). Furthermore, pathologie, immunohistologic and flow cytometric studies also suggest that pigs with PMWS are immunosuppressed.

Lymphocyte depletion of follicular and interfollicular areas together with macrophage infiltration of lymphoid tissues is a unique feature of lesions observed in pigs with PMWS

(Clark, 1997; Darwich et al., 2002; Quintana et al., 2001; Rosell et al., 1999; Sarli et al.,

2001). These findings are highly correlated with a decrease in circulating B and T cells

(Darwich et al., 2002; Nielsen et al., 2003; Segales et al., 2000) as well as a reduction in these cell types in lymphoid tissues (Chianini et al., 2003; Sarli et al., 2001; Shibahara et al.,

2000). Concurrently, an increase of macrophages/monocytes occurs in both the peripheral blood and lymphoid tissues (Segales et al., 2001). These changes have been observed in pigs both naturally and experimentally infected with PCV2 exhibiting PMWS. The altered populations of cells associated with the immune system response both in blood and tissues suggests that actively infected pigs have a transient inability to mount effective immune responses.

To understand the mechanism of lymphoid depletion in association with PCV2

infection and PMWS, the role of immune cell proliferation and apoptosis has been assessed

in diseased pigs. A high number of apoptotic B lymphocytes and a decrease in the number of B lymphocytes with the confinement of PCV2 antigen and virions in the apoptotic bodies phagocytosed by macrophpages was observed in the lymphoid tissues of pigs manifesting clinical signs of PMWS, suggesting that PCV2 induced apoptosis and resulted in B lymphocyte depletion (Shibahara et al., 2000). However, recent studies appear to contradict these earlier results. One study found that reduced levels of apoptosis were in the B cell areas

of lymphoid tissues of PMWS affected pigs compared to healthy non-PCV2 infected pigs

(Resendes et al., 2004b). Another study detected PCV2 and apoptotic cells in PMWS

affected pigs with differing severity of lesions using in situ hybridization (ISH) and cleaved

caspase-3 (CCasp3) immunohistochemical assay (Resendes et al., 2004c). Results from this

study found that the apoptotic rate in lymphoid tissues was correlated inversely with the viral

load in serum and the severity of lesions, indicating that apoptosis is not a significant feature

in PMWS lymphoid lesion development (Resendes et al., 2004c). The third study evaluated

the proliferative activity and apoptosis of lymphocytes to determine potential mechanisms for

the pathogenesis of cell depletion in lymph nodes in spontaneous cases of PMWS. The

apoptotic and proliferative activity were investigated (Mandrioli et al., 2004). The results of

this study suggested that decreased cell proliferation and not increased apoptosis seemed to

be the most important variable leading to cell depletion in PMWS lymphoid tissues

(Mandrioli et al., 2004). The fourth study examined the colocalization of PCV nucleocapsid

and terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-nick end labeling (TUNEL)

in lymphoid tissues and livers of gnotobiotic pigs with PMWS (Krakowka et al., 2004). The

data from this study also suggested that apoptosis is not the primary mechanism of lymphoid

depletion and hepatocyte loss in PMWS. Apoptosis associated with systemic viral diseases

may be attributable to pyrexia rather than direct or indirect effects of PCV2 on target cells 22

(Krakowka et al., 2004). However, all these findings are based on the studies of PMWS affected pigs. The effect of PCV2 on the immune cell proliferation and apoptosis at early stage of infection remains unknown.

The changes of RNA and protein expression were assessed to study the pathogenesis of PCV2 infection and PMWS. A study demonstrated that pigs with PMWS have altered cytokine mRNA expression patterns in affected lymphoid tissues (Darwich et

al., 2003b). These alterations consist of an over expression of interleukin (IL)-10 mRNA in

thymus and of interferon (IFN)-gamma mRNA in tonsils. The IL-10 mRNA over expression

has been associated with thymic depletion and atrophy in the diseased animals (Darwich et

al., 2003b). Reduced levels of IL-2 mRNA expression in the spleen, IL-4 in tonsils and

lymph nodes, IL-12p40 in both spleen and inguinal lymph nodes and IFN-gamma and IL-10

in inguinal lymph nodes have also been reported (Darwich et al., 2003b). Another study

investigated the systemic expression of relevant at both the mRNA and protein

levels in PBMCs of pigs suffering from natural PMWS and in clinically healthy pen-mates

(Sipos et al., 2004). Results of this study indicated that IL-1 alpha and IL-10 mRNA levels

were notably increased in the affected pigs, whereas IL-2 and IL-2 R alpha (CD25) mRNA

levels tended to be down-regulated. In addition, IL-8, tumor necrosis factor (TNF)-alpha and

IFN-gamma mRNA expressions appeared to be slightly increased. Moreover, the detection of

intracellular cytokines at the protein level revealed an increase in levels of IL-1 beta, IL-2,

and IL-6, while IL-12 and TNF-alpha expressions were not affected, and IFN-gamma levels

were slightly decreased in the diseased animals (Sipos et al., 2004).

The in vitro study of PCV2 infection of PBMCs from healthy and diseased pigs

revealed substantial and specific affects on the function of PBMCs from PMWS pigs in terms 23 of cytokine release (Darwich et al., 2003a). By testing the supernatants from cell cultures

using capture ELISAs, this study found that mononuclear cells from pigs with PMWS were

less able to produce IFN-gamma when superantigens were added to the cultures, and IL-2,

IL-4 when a T-cell mitogen, phytohemagglutinin (PHA) or superantigens were added to the

cultures. However, in contrast to PBMCs from healthy pig, cells from PMWS affected pigs

produced some IFN-gamma or IL-10 when recall PCV2 antigens were added for 24 hours

(Darwich et al., 2003a). Furthermore, PCV2 alone appears to alter the cytokine secretion of

PBMCs from healthy and diseased pigs by showing a decrease in IL-2 secretion and IFN-

gamma when PBMCs exposed to the virus and then challenged with PHA (Darwich et al.,

2003a). Although these studies showed the alteration of cytokine profile in PBMCs and

lymphoid tissues from PMWS affected pigs in vivo or in vitro, there is still lack of study on

the changes of cytokine RNA and protein expression within specific immune cell

populations.

Granulomatous infiltration of lymphoid tissues is one of the characteristics for

PMWS (Rosell et al., 1999). Since the recruitment of monocytes into an area of inflammation

by the secretion of chemokines is an important step in this process, the correlation of

chemokine expression and PCV2 infection has also been studied. The chemokine family can

be divided into two major classes, CC and CXC, on the basis of differences in the position of

cysteines within a conserved four-cysteine motif (Oppenheim et al., 1991; Rollins, 1997).

The CC chemokines, such as monocyte chemoattractant protein-1 (MCP-1) and macrophage

inflammatory protein-1 (MIP-1) have powerful chemoattractant and activator proprieties for

monocytes (Oppenheim et al., 1991; Rollins, 1997; Wolpe et al., 1988), whereas the CXC

chemokines, such as IL-8, are more important in the attraction of neutrophils (Oppenheim et 24 al., 1991; Rollins, 1997). A positive correlation between PCV2 and MCP-1 and MIP-1 expression in serial sections from the lymph nodes of piglets inoculated intranasally with

PCV2 was demonstrated, suggesting an up regulation of MCP-1 and MIP-1 expression by mononuclear cells in response to PCV2 (Kim and Chae, 2003; Kim and Chae, 2004b). It has also been reported that IL-8 mRNA levels are increased in tissues with slight or moderate

lesions and small amounts of virus while it is reduced in tissues with severe lesions (Darwich

et al., 2003b). However, this is in contrast to other investigations which did not find altered

levels of IL-8 mRNA in granulomatous lesions of lymph nodes from pigs with naturally

occurring PMWS, but found high levels of MCP-1 (Kim and Chae, 2003).

PCV2 infection and replication

Studies consistently demonstrate that PCV2 nucleic acid or antigen in PMWS-

affected pigs is primarily in the cytoplasm of histiocytes, multinucleate giant cells and other

monocyte/macrophage lineage cells such as alveolar macrophages, Kupffer cells and

follicular dendritic cells of lymphoid tissues by ISH and IHC (Allan and Ellis, 2000; Chianini

et al., 2003; Ellis et al., 1998; Gilpin et al., 2003; Rosell et al., 1999) . Therefore, the

monocyte/macrophage lineage cells were thought to be the primary cell type for PCV2

replication. It is has also been reported that PCV2 is sporadically detected in the cytoplasm of

renal and respiratory epithelial cells, vascular endothelium cells, lymphocytes, pancreatic

acinar and ductular cells and in the nuclei of monocyte/macrophage cells, smooth muscle

cells, hepatocytes and enterocytes (Allan et al., 1999a; Ellis et al., 2000; Kennedy et al.,

2000; Krakowka et al., 2000; McNeilly et al., 1999; Rosell et al., 2000a; Rosell et al., 1999;

Sanchez et al., 2004; Shibahara et al., 2000; Sirinarumitr et al., 2000). 25

The replication of PCV2, as for other circoviruses, depends on the cellular polymerases present in the nucleus of actively dividing cells because PCV2 does not encode its own polymerase (Tischer et al., 1987). Although macrophages do not divide, it has been shown that they can express high DNA polymerase activity in response to damage to their

DNA (Terai et al., 1991; Williams et al., 2002), an event which might be misused by PCV2

to complete its replication in these cells (Meerts et al., 2005). However, several in vitro

studies have not found evidence of PCV2 replication in monocyte/macrophage lineage cells.

In one in vitro study, PCV2 antigen was detected in the cytoplasm of monocytes, pulmonary

alveolar macrophages (PAMs) and monocyte-derived macrophages but the virus did not

replicate in PAMs, which suggested that in vivo, monocytic cells may not the primary cells

that support PCV2 replication (Gilpin et al., 2003). Another study found no evidence for

PCV2 replication in dendritic cells (DCs), but the virus appeared to persist in them without

loss of infectivity nor the induction of cell death, demonstrating that PCV2 can persist in DCs

in the absence of virus replication or degradation (Vincent et al., 2003). Moreover, there was

no modulation of DC surface markers including the major histocompatibility complex class I

and class II, CD80/86, CD25, CD16, or CD14. Infected DCs did not transmit virus to

syngeneic T lymphocytes, even when the latter were activated (Vincent et al., 2003).

Recently, the replication kinetics of PCV2 in PAM and fetal cardiomyocytes (FCM), two

target cells in vivo, was compared with replication in PK-15 cells (Meerts et al., 2005).

Results from this study showed that PCV2 replicates in PK-15 cells, but not in either the

PAM or FCM cultures (Meerts et al., 2005). Viral proteins were visualized in the nucleus of

FCM and PAM later (48 hours post-infection (HPI)) than in PK-15 cells (between 12 and 24

HPI) and in a lower percentage of cells. In PAMs, two out of five tested pigs had no apparent 26 nuclear localized antigens, whereas in the other three pigs viral antigens were observed in up to 20% of the cells, suggesting clear differences in susceptibility of PAM from different pigs.

Modification of PCV2 target cells during fetal to postnatal development in pigs has

been examined (Sanchez et al., 2003). PCV2 inoculation was performed in fetuses in utero at

various days of gestation and in piglets at 1 day of age. The study revealed that PCV2 target

cells change from cardiomyocytes, hepatocytes and macrophages during fetal life to only

macrophages postnatally (Sanchez et al., 2003). In addition, less than 5% of any of the cell

types contained PCV2 genome in the nucleus (Sanchez et al., 2003). An apparent

hepatotropism for PCV2 has also been observed with cyclosporine immunosuppressed

PCV2-infected gnotobiotic piglets (Krakowka et al., 2002). To date, the cell tropism for

PCV2 infection and replication remains unknown. In our studies, we assessed PCV2

replication in immune cell populations during virus active replication stage in vitro and in

vivo. We demonstrated that lymphocytes are the important cells for PCV2 replication

compared to monocytes.

Diagnosis

The diagnosis of PMWS must meet three criteria: (i) the presence of compatible

clinical signs, (ii) the presence of characteristic microscopic lesions, and (iii) the presence of

PCV2 antigen or nucleic acids within the lesions. The three criteria considered separately are

not diagnostic of PMWS (Allan and Ellis, 2000; Chae, 2004).

Several methods such as virus isolation, IFA, ISH, IHC and PCR have been

developed to detect PCV2 in tissues or serum samples (Allan et al., 1998b; Choi et al., 2000;

Ellis et al., 1998; McNeilly et al., 1999; Quintana et al., 2001; Rosell et al., 1999; Tischer et

al., 1987). Among them, ISH and IHC are the tests most routinely performed and are 27 typically considered the gold standard to establish a PMWS diagnosis (Choi et al., 2000; Ellis et al., 1998; McNeilly et al., 1999; Rosell et al., 1999). It has been reported that not all monoclonal and polyclonal antibodies to PCV2 are suitable for use in IHC due to the cross- linking effects of formalin fixation that renders certain epitopes undetectable (Haines and

Chelack, 1991). In contrast, ISH is less susceptible to structural alteration from formalin

fixation (Choi and Chae, 1999; Kim and Chae, 2001a) and allows the differentiation between

PCV1 and PCV2 in formalin-fixed, paraffin-wax-embedded tissues with a nonradioactive

digoxigenin-labeled probe (Kim and Chae, 2001a; Kim and Chae, 2002). A strong

correlation has been observed between the amount of PCV2 nucleic acid or antigen, the

severity of microscopic lymphoid lesions and the clinical outcome (Kennedy et al., 2000;

Quintana et al., 2001).

PCR has been shown to be the most sensitive technique to detect PCV2 and a useful

technique to test potential routes of viral excretion (Allan et al., 1999b; Calsamiglia et al.,

2002; Choi et al., 2000; Kim and Chae, 2001b; Kim et al., 2001; Larochelle et al., 1999a;

Mankertz et al., 2000; Quintana et al., 2001; Shibata et al., 2003; West et al., 1999).

However, as PCV2 is so common within the swine population, its detection by PCR in serum

or inguinal lymph node has a lower correlation with the typical microscopic lesions of the

syndrome (Calsamiglia et al., 2002). As a result, it is felt that qualitative PCR is not suited

for PMWS diagnosis (Chae, 2004).

In addition to qualitative PCR assays, quantitative real-time PCR assay has been

described and mostly applied to serum samples (Ladekjaer-Mikkelsen et al., 2002; Olvera et

al., 2004; Rovira et al., 2002). Due to the correlation between PCV2 levels and the severity

of clinical disease, a quantitative PCR represents a useful (but expensive) technique for use 28 to diagnos PMWS (Liu et al., 2000; Rovira et al., 2002). Recently, a TaqMan-based real-time

PCR for quantitation of PCV2 in tissue and plasma/serum samples has been established

(Brunborg et al., 2004). In supporting previous findings that the PCV2 load in the animal is

correlated with disease, a significant difference in estimated viral load between healthy (less

than 106 PCV2 genome copies per ml serum or 500 ng tissue sample) and PMWS pigs

(above 107 PCV2 genome copies per ml serum or 500 ng tissue sample) was found in

samples from mesenteric lymph nodes as well as serum/plasma (Brunborg et al., 2004).

Furthermore, the estimated viral load in tissue samples from PMWS pigs was related to the

IHC results, with lymph nodes, ileum, and tonsil giving both high levels of virus and a high

amount of staining by IHC (Brunborg et al., 2004). Interestingly, it was found that for most

tissues an estimated minimum viral level of 108 PCV2 genome copies per 500 ng DNA was

required in order to give a visible staining by IHC. Even with viral load as high as 108 PCV2

genome copies per 500 ng DNA, no visible viral antigen staining was observed in the

kidneys and myocardium of PMWS pigs (Brunborg et al., 2004). In agreement with this

finding, with similar levels of PCV2 DNA detected by real-time PCR, we observed PCV2

antigen in lymph nodes, spleen, tonsil, thymus, liver and lung from infected pigs but not in

kidney by IHC in our study of PCV2 distribution and replication in tissues and immune cells

in early infected pigs.

Several serological techniques such as IFA, IPMA, competitive ELISA and indirect

ELISA assays have been used to detect antibodies to PCV2 (Allan et al., 1998b; Blanchard et

al., 2003b; Ellis et al., 1998; Liu et al., 2004; Nawagitgul et al., 2002; Rodriguez-Arrioja et

al., 2002; Walker et al., 2000). Because PCV2 is ubiquitous within the swine population and 29 the seroconversion pattern is relatively similar between PMWS affected and non-affected farms, serological techniques cannot be used to diagnose disease.

Prevention and control

Treatment and control of PMWS has primarily been focused on providing good production practices and eliminating potential triggering factors that induce the immune stimulation suspected to cause disease. Although little research has been undertaken in this area, maintaining ideal pen density, age segregation and all-in-all-out pig flow with the timely removal of sick animals has been widely recommended (Allan and Ellis, 2000;

Segales and Domingo, 2002). A sero-therapy technique has been used with success in

Europe, but has not been widely accepted in other parts of the world (Ferreira D., 2001).

Several commercial vaccines for sows and pigs are currently in the licensing phase in the United States and Europe. Although no PCV2 vaccine is currently available, an

ORF1 /ORF2-DNA vaccine and an ORF l/ORF2-subunit vaccine have been developed and tested experimentally (Blanchard et al., 2003a; Kamstrup et al., 2004; Truong et al., 2001).

ORF2-based vaccine candidates have been shown to induce specific antibody responses and good protection when comparing vaccinated and non-vaccinated piglets following experimental PCV2 challenge (Blanchard et al., 2003a; Kamstrup et al., 2004). A chimeric

PCVl-2 live virus (with the immunogenic capsid gene of PCV2 cloned into the backbone of

PCV1) as well as the chimeric PCVl-2 infectious DNA clone has also been suggested as a

potential vaccine (Fenaux et al., 2004a)

Other PCV2 associated diseases

Although PCV2 has primarily been associated with PMWS, it has also been

implicated in a number of disease syndromes including PDNS, PRDC, enteritis, reproductive 30 failure, and congenital tremors type All (Allan and Ellis, 2000; Segales et al., 2004b).

However, the role of PCV2 in these conditions has not been fully elucidated and in some of these conditions its role in disease remains controversial (Kennedy et al., 2003).

Porcine dermatitis and nephropathy syndrome

Porcine dermatitis and nephropathy syndrome (PDNS) associated with PCV2

infection was originally described in the UK (Smith et al., 1993). Affected pigs were in both

the nursery and grow-finish stages and its appearance within a herd has been generally

sporadic (Gresham et al., 2000; Rosell et al., 2000b; Thomson et al., 2000). The mortality

associated with PDNS ranges from 10 to 25% in Europe, whereas it is still infrequently

recognized in North America, where typically less that 0.5% of pigs are affected (Meehan et

al., 1998; Rosell et al., 2000b). PDNS-affected pigs demonstrate anorexia, depression,

prostration, a stiff-gait or reluctance to move, and occasionally mild pyrexia. The most

common clinical signs are the development of round or irregular shaped, red to purple skin

lesions that coalesce to form larger patches and plaques. These lesions are located primarily

on the hind limbs and in the perineal area (Helie et al., 1995; Segales et al., 1998). At post­

mortem, the kidneys are enlarged, pale and often covered with petechial hemorrhages.

However, not all affected pigs show macroscopic kidney or skin lesions (Segales et al.,

2004b). Major histopathological findings include necrotizing and fibrinous

glomerulonephritis and systemic necrotizing vasculitis (Segales et al., 1998; Thibault et al.,

1998). Recently, it was demonstrated that PDNS affected pigs had higher mean PCV2 serum

antibody titers than the antibody titers in pigs without clinical signs of PDNS, suggesting the

causative physiological basis for PDNS may be the excessive levels of PCV2 antibodies

(Wellenberg et al., 2004). These microscopic features, together with the presence of immunoglobulin and complement components in the damaged vessels and glomeruli, suggest a type III hypersensitivity reaction as a possible mechanism for disease (CO. Duran, 1997;

Helie et al., 1995; M.A. Sierra, 1997; R. Drolet, 1999; Wellenberg et al., 2004). PCV2

antigens and/or nucleic acids have been found in the tissues of pigs with PDNS (Rosell et al.,

2000b). However, evidence suggests that other pathogens such as P. multocida (Lainson et

al., 2002; Thomson et al., 2001), or PRRSV (Choi and Chae, 2001; Rosell et al., 2000b;

Thibault et al., 1998) may also be the potential antigen that results in PDNS. Many herds in

Europe report the simultaneous or closely timed occurrence of PMWS and PDNS (Rosell et

al., 2000b; Segales et al., 1998). Unlike PMWS, however, PDNS has not been experimentally

reproduced so the etiology of PDNS remains in question.

Porcine respiratory disease complex

Porcine respiratory disease complex (PRDC) is characterized by slow and uneven

growth, reduced feed intake, higher feed to gain conversion rates, cough and clinical

pneumonia (Halbur PG, 1998; Thacker, 2001). This condition often occurs when pigs are 16-

20 weeks of age. Major pathogens involved in PRDC include PRRSV and M.

hyopneumoniae. However, a number of other bacterial and viral pathogens have also been

detected in PRDC outbreaks (Thacker, 2001). Studies using IHC have been conducted on

diagnostic submissions of cases of PRDC in the midwestern United States and have

documented a high prevalence of co-infection with PRRSV in cases of PCV2-associated

pneumonia, with a predominance of PCV2 antigen in the dually infected lungs (Harms et al.,

2001). Co-infection of PCV2 with SIV and M. hyopneumoniae was also reported in those

studies. In many of the cases, no clear-cut clinical differences exist between PRDC and

PMWS cases. Macroscopic lung lesions caused by PCV2 are virtually indistinguishable from 32 those induced by PRRSV or even systemic bacterial infections such as salmonellosis (Harms,

2000). The microscopic lesions of PCV2-infected pigs in the lung (interstitial pneumonia) are not specific for the organism. However, the presence of airway epithelial sloughing and mucosal or submucosal replacement by fibroplasia and lympho-histiocytic cell infiltrations throughout all lung lobes are considered characteristic of PCV2 infection (Clark, 1997).

Although it is not clear whether PCV2 plays the role of a primary, synergistic, secondary, or opportunistic pathogen, demonstration of unique lung lesions associated with PCV2 antigen suggests that PCV2 is playing an important role in PRDC in the U.S.

Enteritis

The presence of PCV2-associated enteritis has been reported in pigs with a history of diarrhea with or without wasting. The lesions consist of granulomatous inflammation affecting Peyer's patches, characterized by infiltration of epithelioid macrophages and giant multinucleated cells. Large, multiple, basophilic or amphophilic, grape-like intracytoplasmic inclusion bodies are often observed in the cytoplasm of histiocytic cells and giant multinucleated cells. In addition, PCV2 nucleic acid is present in the cytoplasm of histiocytes and giant multinucleated cells in the Peyer's patches. The presence of diarrhea and granulomatous enteritis, and abundant PCV2 DNA associated with the microscopic lesions is suggestive of PCV2-associated enteritis. This finding suggests that PCV2-associated enteritis may be a distinct clinical manifestation of PCV2 infection (Kim et al., 2004a).

Reproductive failure

There have been a number of reports of PCV2-associated reproductive failure (Kim et al., 2004b; Ladekjaer-Mikkelsen et al., 2001; O'Connor et al., 2001; West et al., 1999).

Consistent clinical signs on infected farms include abortions and elevated rates of stillbirth 33 and fetal mummification. The predominant lesion is a non-suppurative to necrotizing or fibrosing myocarditis in the fetuses. Variable amounts of PCV2 antigen are present in fetal tissues, and in the cardiac lesions of affected piglets. Studies in experimentally infected

pregnant sows have shown that PCV2 infection alone can produce severe myocardial lesions

in infected pig fetuses (Sanchez, 2001). The examination of stillborn fetuses collected from

farms with prolonged histories of reproductive problems confirms previous findings that

transplacental infection of PCV2 occurs in the field (Farnham et al., 2003). Recently, direct

intra-fetal inoculation of PCV2 at different stages of gestation and collection of fetuses 21

days later showed that the virus replicates in fetal tissues, particularly in the heart. Fetuses

inoculated at 57 days of gestation had the highest virus titers and no antibodies while

antibodies and lower virus titers were detected in fetuses inoculated at 75 and 92 days of

gestation. Inoculation at 57 and 75 days of gestation and collection of the piglets at the end of

pregnancy demonstrated that intrauterine spread had occurred to fetuses adjacent to the

inoculated ones and that fetal death also occurred in the presence of antibodies. However, the

pregnancy was not interrupted (Pensaert et al., 2004). Another study reported that 10 of 14

pregnant sows inoculated with PCV2 directly into one of the fluid-filled fetal compartments

at mid- and late-gestation, respectively, had dead and/or stillborn piglets at the end of

gestation (Yoon et al., 2004). In addition, PCV2 infection was evident by PCR and/or IHC in

those sows while five of six sham-inoculated control sows had no or minimal adverse affects

from in utero injection (Yoon et al., 2004). More recently, it has been reported that six sows

intranasally inoculated with PCV2 3 weeks prior to the expected farrowing date had

abortions and premature farrowing. In contrast, two uninfected negative control sows

remained clinically healthy and farrowed at the normal time. PCV2 antigen and DNA were 34 detected in the lymph nodes, spleen, thymus, lung, tonsil and liver from both stillborn and liveborn piglets from the infected sows (Park et al., 2005). This experiment suggests that

PCV2 is capable of crossing the placenta, replicating primarily in lymphoid tissues, and inducing reproductive failure in sows. However, in a retrospective examination of diagnostic

tissues submitted to the University of Saskatchewan between 1995 and 1998, neither PCVl

or PCV2 antigen, nor PCV2 nucleic acid was detected by IHC or PCR, respectively, in any

reproductive tissues (Bogdan et al., 2001).

Congenital tremors type All

Congenital tremors (CT) in pigs is characterized by a tremor of the head and limbs in

new-born pigs (Edwards, 1999). Its subtype All has traditionally been associated with an

unidentified virus, but several reports from the U.S. have suggested that PCV (Hines, 1994)

or more precisely, PCV2 (Stevenson et al., 2001) is the causal agent of this CT subtype. It

has been reported that PCV nucleic acid was detected in neural tissues and liver of both CT-

affected and normal pigs (Stevenson et al., 2001). However, recent work performed in

Europe on cases of CT subtype All did not find circovirus nucleic acid or antigen in any CT

piglets (Kennedy et al., 2003). 35

CHAPTER 2. DEVELOPMENT OF A REVERSE TRANSCRIPTION

PCR ASSAY TO DETECT PORCINE CIRCOVIRUS TYPE 2

TRANSCRIPTION AS A MEASURE OF REPLICATION

A paper published in the Journal ofVirological Methods'

Shan Yua, Susan Carpenter3, Tanja Opriessnig^ Patrick G. Halburb, Eileen Thacker8*

^Department of Veterinary Microbiology and Preventive Medicine and and ^Department of

Veterinary Diagnostic and Production Animal Medicine, Veterinary Medicine, Iowa State

University, Ames. IA.

Abstract

Porcine circovirus type 2 (PCV2) is a non-enveloped, single-stranded, circular DNA virus. In situ hybridization and PCR assays have detected PCV2 DNA in multiple organs and cell types from infected pigs; however, it is not clear if this represents replicating virus or virion DNA. We describe the development of a single-tube RT-PCR assay to differentiate

PCV2 replication products and viral DNA. Primers targeted to the open-reading frame 2

(ORF2) of PCV2 were designed to amplify both virus DNA (984 bp) and the spliced capsid

Cap mRNA (594 bp). The 984 bp fragment, but not the 594 bp fragment, was amplified from

PCV2 stock, confirming that the spliced Cap mRNA was not present in the PCV2 stock. The

594 bp fragment was amplified from DNase-treated RNA extracted from PCV2-infected PK-

15 cells, and was detected as early as 14 hours post-infection. No products were amplified from either the PCVl stock or PCVl-infected PK-15 cells, or from cells infected with

'reprinted from J Virol Methods 123, Yu, S., Carpenter, S., Opriessnig, T., Halbur, P.G. and Thacker, E., Development of a reverse transcription-PCR assay to detect porcine circovirus type 2 transcription as a measure of replication, 109-12, 2005, with permission from Elsevier. 36

UV-inactivated PCV2. Therefore, the presence of the 594 bp fragment is specific for PCV2 replication. This assay will be useful in assessing cell populations that support PCV2 replication in vivo or in vitro and advance the understanding of PCV2 replication and pathogenesis.

Keywords: Porcine circovirus; RT-PCR; Replication

Text

Porcine circovirus (PCV) is a small, non-enveloped, single-stranded, circular DNA

virus with a genome of approximately 1.7 kb belonging to the genus Circovirus of the

Circoviridae family. It has an ambisense genome that encodes proteins by the encapsidated

viral DNA and the complementary DNA of the replicative intermediate synthesized in the

host. Two genotypes of PCV have been identified. PCV type 1 (PCVl), considered non­

pathogenic, is a common contaminant of the porcine kidney cell line PK-15 (CCL-33)

(Tischer et al., 1982). Serological surveys have demonstrated a high prevalence of anti-PCVl

antibodies in the swine population but no disease has been correlated with PCV 1 infection

(Tischer et al., 1986; Mahe et al., 2000). A newly emerged disease designated postweaning

multisystemic wasting syndrome (PMWS) was first identified in a swine herd in Canada in

1991 (Ellis et al., 1998; Harding, et al., 1997). The cause of PMWS was attributed to a new

PCV variant designated PCV type 2 (PCV2). Since then, PCV2 has been reported in many

countries (Allan et al., 1999; Pénaux et al., 2000) and is associated with PMWS, respiratory

disease, reproductive failure and a variety of other disease manifestations (Segales et al.,

2004). PCV2-associated PMWS is characterized by depletion of lymphocytes in the

lymphoid follicles and their replacement by macrophages. Variable amounts of

granulomatous inflammation are also observed in other tissues. The severity of the 37 microscopic lesions and the amount of viral antigen in the lesions closely correlates with the severity of clinical disease (Quintana et al., 2001; Rosell et al., 1999). PCV2 antigen and

DNA can be detected using immunohistochemistry (IHC), in situ hybridization (ISH) and polymerase chain reaction (PCR) from multiple organs and multiple cell types from infected pigs; however, the target cell for viral replication has not been definitively identified. To

better understand specific cell populations that support viral replication in vitro and in vivo,

an assay that discriminates between replicating and non-replicating virus would be useful.

The genome organization of PCVl and PCV2 consists of two major open reading

frames (CRTs), ORF1 and ORF2. ORF1 encodes the replication associated protein (Rep) and

ORT2 encodes the major capsid protein (Cap) (Nawagitgul et al., 2000; Liu et al., 2001). The

overall DNA sequence identity within PCVl or PCV2 isolates is greater than 90%, while the

identity between PCVl and PCV2 isolates is 68-76% (Pénaux et al., 2000; Hamel et al.,

1998). The Rep genes of PCVl and PCV2 are highly conserved, with 83% identity at the

nucleotide sequence level, whereas the Cap genes share only 67% identity (Mankertz et al.,

1998). Transcriptional analysis of PCV2 identified one capsid mRNA and a cluster of five

Rep-associated RNAs, which increase in a time dependent manner during PCV2 replication

in PK-15 cells (Cheung, 2003,#8). Interestingly, the capsid mRNA contains a splice junction

at nucleotides 361 and 1737 (Cheung, 2003). Using primers designed to amplify across the

Cap mRNA splice junction, we developed a PCV2-specific reverse transcription polymerase

chain reaction (RT-PCR) assay that can differentiate between PCV2 replication products and

virus DNA.

ORF2 sequences from PCVl (GenBank Accession No. AY184287) and PCV2

(GenBank Accession No. AF264042) were aligned and PCV2-specific primers were 38 designed to amplify across the Cap mRNA splice junction. Amplification with the forward primer, CapF: 5' -GGAGT C A AG A AC AGGTTTGGGTG-3 ' (nucleotides 232-254) and the reverse primer, CapR: 5 ' -AGACTCCCGCT CT CC AAC AAG-3 ' (nucleotides 1196-1216) resulted in amplification of two different sized product, a 984 bp product amplified from virus DNA and a 594 bp product amplified from spliced Cap mRNA (Fig. 1). To determine if the RT-PCR assay could distinguish between PCVl and PCV2, nucleic acid was isolated from either PCVl that originated from the ATCC PK-15 cell line (PCVl stock) (Tischer et al., 1986) and PCV2 isolated from splenic tissue from a pig with naturally occurring PMWS

(isolate ISU-40895) ( PCV2 stock) (Fenaux et al., 2002). The DNA was isolated using

QIAamp DNA Mini kit (QIAGEN) according to the manufacturer's instructions, while total

RNA was isolated using the E.Z.N.A.® total RNA kit (Omega Biotek, Doraville, GA) and treated with DNA-free™ (Ambion, Austin, TX). All samples were quantified and the purity determined using a spectrophotometer. The O.D.260/O.D.280 ratios were above 1.80 corresponding to 90-100% pure nucleic acid. The RT-PCR assay was performed in a

Mastercycler® (Eppendorf, Westbury, NY) using the Access RT-PCR System (Promega,

Madison, WI) according to the manufacturer's instructions. The RT-PCR reaction was performed in 50 |xl total volume per sample with 0.2 mM dNTPs, Ix AMV/Tfl reaction buffer, 1 mM MgSO^ 1 |iM of each primer, 0.1 U/p.1 of AMV reverse transcriptase (AMV

RT), 0.1 U/|il of Tfl DNA polymerase, 4 (il of total RNA template (levels in the range of 0.5-

1 pg) and 27 (il of nuclease-free water. The reaction was incubated at 48 °C for 45 min,

94 °C for 2 min, followed by 40 cycles of 94 °C for 30 sec, 65 °C for 45 sec, 70 °C for 1 min,

and a final extension step of 70 °C for 7 min. A control PCR assay in the absence of reverse

transcriptase (RT) was performed in order to test for DNA contamination in the RNA 39 samples. A DNA-PCR assay was carried out under identical conditions with omission of RT and the 45 min incubation at 48 °C. A 984 bp fragment was amplified from the DNA sample from the PCV2 stock while no products were amplified from the PCVl stock (Fig. 2). There was no evidence of amplified products in the RNA-enriched samples treated with DNase from either PCVl or PCV2 stock (Fig. 2). These findings indicate that the RT-PCR assay can distinguish between PCVl and PCV2 and that viral DNA, but not spliced Cap mRNA, is present in the PCV2 virus stock.

To detect PCV2 replication products, PCV free PK-15 cells (Fenaux et al., 2002) were infected with PCVl, PCV2 or UV-inactivated PCV2 at a multiplicity of infection of 0.1 for 1 hour followed by washing five times with PBS. Cells were gently scraped and collected at various times post-infection. Mock-infected PK-15 cells were collected at each time point and used as negative controls. Each sample was treated with RNAlater™ (Ambion, Austin,

TX) and kept at 4 °C for RNA extraction. Total RNA was isolated, treated with DNase, and amplified by RT-PCR assay as described above. The 594 bp fragment corresponding to the spliced Cap mRNA was detected as early as 14 hours post-infection (HPI) and was present through 48 HPI (Fig. 3). No products were amplified from RNA extracted from cells infected with PCVl, UV-inactivated PCV2 (Fig. 3) or from mock-infected PK-15 cells (data not shown). These data indicate that the spliced Cap mRNA is present only during PCV2 replication and confirms the specificity of this assay for PCV2. When RNA samples were not treated with DNase and amplified by the RT-PCR assay described above, a 984 bp fragment corresponding to PCV2 DNA was amplified with or without RT (Fig. 4). The 984 bp fragment was preferentially amplified by RT-PCR from the DNase-untreated RNA extracted from infected PK-15 cells at 24 HPI, even though the presence of spliced Cap mRNA could 40 be detected in the DNase-treated samples (Fig. 4). Therefore, DNase treatment was necessary for removal of DNA contamination in the RNA samples obtained from infected cells to detect the spliced Cap mRNA.

To confirm the identity of the PCR and RT-PCR products, the 984 and 594 bp

amplification products were purified using the Qiaquick spin extraction kit (Qiagen),

amplified, and sequenced at the Iowa State University Sequencing and Synthesis Facility

using the primers described above. Analylsis of the sequencing results revealed that the

amplicons of both 985 and 594 bp fragments were PCV2-specific.

To evaluate the sensitivity of the RT-PCR assay, semi-confluent PK 15 cells were

inoculated for 1 hour at 37 °C with the PCV2 stock (104 TCIDso/ml). The cells were washed

five times with PBS buffer, fresh MEM medium (5% bovine calf serum and lx antibiotics)

was added, and the cells were incubated at 37 °C with 5% CO%. The PK-15 cells were

detached by gentle scraping at 48 HPI, disrupted manually, counted and 1 x 105 PCV2-

infected cells were diluted with PBS buffer in 10-fold dilutions. Uninfected PK-15 cells were

added to each dilution until the total numbers of cells was equal to 1 x 105. Each sample was

treated with RNAlater™ (Ambion, Austin, TX) and the total RNA was extracted. The RT-

PCR assay was performed on the 104 to 10"' cell dilutions in a 50 pi volume using the

protocol described above. The spliced Cap mRNA was amplified from infected cells diluted

to 101. These results suggest that the detection limit of the RT-PCR assay could be as few as

10 infected PK-15 cells based on the serial dilutions (Fig. 5). A previous study showed that

without glucosamine treatment, only about 2% PCV-infected cells could be detected using

indirect immunofluorescence assay (IFA) (Tischer et al., 1987). Compared to the detection

ability of IF A, the RT-PCR assay described here appears highly sensitive. 41

We have demonstrated that our assay is able to detect the spliced Cap mRNA during virus replication. The assay is able to distinguish between PCV1 and PCV2 as no products were amplified from either PCV1 stock or PCV1-infected PK-15 cells. The ORF2 region was chosen as the target for this assay due to the variability in sequence between the two types of

PCV. To distinguish between RNA products and viral DNA, the Cap primers were designed to amplify across the splice junction of the target sequence. The results also showed that the

PCV2 DNA was easily detected from RNA extraction samples in the absence of DNase, indicating the necessity of DNase treatment in the RNA samples from infected cells. The single-tube RT-PCR protocol used in this study eliminates the need to open the tube to add

PCR mix to the RT mix, thereby avoiding potential cross-contamination of samples.

Although other researchers have reported the detection of virus replication using virus titration, ISH or Southern blot assays, these assays have either a low sensitivity or are time consuming. Our assay offers a rapid, specific and sensitive technique for detecting type- specific PCV2 while discriminating between replicating PCV2 and PCV2 virions. The incidence of PCV2-associated disease in pigs continues to increase globally, making identification of the cellular sites of replication important for understanding the pathogenesis of PCV2 infection and associated diseases. Our RT-PCR assay will assist in identifying the specific cell populations that support PCV2 replication in vivo and in vitro.

Acknowledgements

We thank Ors. Xiang-Jin Meng and Martijn Fenaux from Virginia Polytechnic

Institute and State University for supplying the PCV free PK-15 cells, PCV1 and PCV2. 42

References

Allan, G.M., Me Neilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A. and Charreyre, C.E., 1999. Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland. Vet Microbiol 66, 115-23. Cheung, A.K., 2003. Transcriptional analysis of porcine circovirus type 2. Virology 305, 168-80. Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D. and Haines, D., 1998. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J 39, 44-51. Fenaux, M., Halbur, P.G., Gill, M., Toth, T.E. and Meng, X.J., 2000. Genetic characterization of type 2 porcine circovirus (PCV-2) from pigs with postweaning multisystemic wasting syndrome in different geographic regions of North America and development of a differential PCR-restriction fragment length polymorphism assay to detect and differentiate between infections with PCV-1 and PCV-2. J Clin Microbiol 38, 2494-503. Fenaux, M., Halbur, P.G., Haqshenas, G., Royer, R., Thomas, P., Nawagitgul, P., Gill, M., Toth, T.E. and Meng, X.J., 2002. Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions. J Virol 76, 541-51. Hamel, A.L., Lin, L.L. and Nayar, G.P., 1998. Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J Virol 72, 5262-7. Harding, J.C. and Clark, E.G., 1997. Recognizing and diagnosing postweaning multisystemic wasting syndrome (PMWS). Swine Health Prod., 201-203. Liu, Q., Tikoo, S.K. and Babiuk, L.A., 2001. Nuclear localization of the ORF2 protein encoded by porcine circovirus type 2. Virology 285, 91-9. Mahe, D., Blanchard, P., Truong, C., Arnauld, C., Le Cann, P., Cariolet, R., Madec, F., Albina, E. and Jestin, A., 2000. Differential recognition of ORF2 protein from type 1 and type 2 porcine circoviruses and identification of immunorelevant epitopes. J Gen Virol 81, 1815-24. Mankertz, A., Mankertz, J., Wolf, K. and Buhk, H.J., 1998. Identification of a protein essential for replication of porcine circovirus. J Gen Virol 79 ( Pt 2), 381-4. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D. and Paul, P.S., 2000. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81, 2281-7. Quintana, J., Segales, J., Resell, C., Calsamiglia, M., Rodriguez-Arrioja, G.M., Chianini, F., Folch, J.M., Maldonado, J., Canal, M., Plana-Duran, J. and Domingo, M., 2001. Clinical and pathological observations on pigs with postweaning multisystemic wasting syndrome. Vet Rec 149, 357-61. 43

Rosell, C., Segales, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioja, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S. and Domingo, M., 1999. Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120, 59-78. Segales, J., Rosell, C. and Domingo, M., 2004. Pathological findings associated with naturally acquired porcine circovirus type 2 associated disease. Vet Microbiol 98, 137-49. Tischer, I., Gelderblom, H., Vettermann, W. and Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295, 64-6. Tischer, I., Mields, W., Wolff, D., Vagt, M. and Griem, W., 1986. Studies on epidemiology and pathogenicity of porcine circovirus. Arch Virol 91, 271-6. Tischer, I., Peters, D., Rasch, R. and Pociuli, S., 1987. Replication of porcine circovirus: induction by glucosamine and dependence. Arch Virol 96, 39-57. 44

CapF —•-

CapR PCV2 DNA 11 984bp

739 1132 Spliced —• 594bp Cap mRNA

Fig. 1. Strategy for design of oligonucleotide primers to detect 594 bp spliced Cap mRNA and 984 bp genomic DNA of PCV2. Arrows indicate the primers used in amplification of two different sized products, a 984 bp product amplified from virus DNA and a 594 bp product amplified from spliced Cap mRNA.

DNA RNA PCV2 PCV1 PCV2 PCV1

DNase

1000 bp 984 bp 650 bp

Fig. 2. Amplification of PCV2 DNA, but not mRNA, from virus stock. Arrows indicate locations of the 984 bp virus DNA amplification product. Products were separated on 1.5% agarose gels and visualized by UV light after staining for 10 min in ethidium bromide. M: marker (Gibco BRL lkb plus DNA ladder, Life Technologies), +: presence of reverse transcriptase (RT) /with DNase treatment, absence of RT /without DNase treatment. 45

UV PCV1PCV2 PCV2 HPI 48 "48 Ï 12 14 18 24 48 RT M

Fig. 3. Kinetics of PCV2 spliced Cap mRNA synthesis in infected PK-15 cells. Total cell

RNA isolated at different time PI, indicated at the top of each lane. The single-tube RT-PCR was carried out with DNase-treated samples from PCVl infected PK-15 cells at 48 HPI, UV- inactivated PCV2 infected cells at 48 HPI, and PCV2 infected cells at 1, 12, 14, 18, 24, and

48 HPI. Agarose gel electrophoresis of RT-PCR products demonstrate band size of 594 bp for spliced Cap mRNA. M: marker (Gibco BRL lkb plus DNA ladder, Life Technologies),

+: presence of RT, -: absence of RT. 46

DNase + +

Fig. 4. Amplification products from total RNA extracted from infected PK-15 cells with and without DNase treatment. The single-tube RT-PCR was carried out with DNase-treated and untreated samples from PCV2 infected cells at 1, 12 and 24 HPI. Agarose gel electrophoresis of RT-PCR products demonstrates band size of 984 bp for PCV2 genomic DNA. M: marker

(Gibco BRL lkb plus DNA ladder, Life Technologies), +: presence of RT /with DNase treatment, -: absence of RT /without DNase treatment. 47

M 104 103 102 101 10° 10"1 C

Fig. 5. Sensitivity of RT-PCR on DNase-treated total RNA extractions from 10-fold dilution of 1X104PCV2 infected PK-15 cells. Arrows indicate the location of the 594bp spliced Cap mRNA amplification product. M: marker (Gibco BRL lkb plus DNA ladder, Life

Technologies) and 104, 103, 102, 101, 10°, 10"1 PCV2-infected PK-15 cells, C: mock-infected

PK-15 cells. 48

CHAPTER 3. DETECTION OF PCV2 CAPSID TRANSCRIPT IN

PERIPHERAL BLOOD MONONUCLEAR CELLS (PBMCS)

INFECTED IN VITRO

A paper to be submitted to Veterinary Microbiology

S. Yua, A. Vincentb, T. Opriessnig0, S. Carpenterd, P. Kitikoon3, P. G. Halbur0, E. Thacker3

"Department of Veterinary Microbiology and Preventive Medicine College of Veterinary

Medicine, Iowa State University, Ames. IA. ^National Animal Disease Center, United States

Department of Agriculture, Ames. IA, ^Department of Veterinary Diagnostic and Production

Animal Medicine, College of Veterinary Medicine, Iowa State University, Ames. IA.

^Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine,

Washington State University, Pullman, WA

Abstract

The presence of PCV2 DNA and/or spliced capsid mRNA (Cap mRNA), as a measure of replication, was assessed, following addition of PCV2 to resting or concanavalin

A (ConA) stimulated peripheral blood mononuclear cells (PBMCs) using real-time PCR or real-time RT-PCR assays, respectively. The results of the study demonstrated that PCV2 replication increased in infected PBMCs over time. Replication within infected PBMCs was significantly (P<0.05) increased when PBMCs were stimulated with ConA, compared to unstimulated PBMCs. The data showed a strong correlation between the level of PCV2 Cap mRNA and the level of viral DNA in the ConA stimulated PBMCs. Moreover, PCV2 replication was also assessed in T lymphocyte- and monocyte-enriched or monocyte-depleted

PBMCs populations which were stimulated with ConA for 3 days. It was demonstrated that 49 the enriched T lymphocytes and the monocyte-depleted PBMCs had significantly higher Cap

mRNA and viral DNA levels (P<0.05) compared to the monocyte-enriched population,

indicating that PCV2 replicates in lymphocytes, particularly T lymphocytes, in addition to

monocytes following stimulation. These results suggest that the presence of activated T

lymphocytes may play an important role in PCV2 replication and the development of clinical

disease.

Keywords: Peripheral blood mononuclear cells; PCV2; Real-time RT-PCR

Introduction

Porcine circovirus (PCV) is a circular single-stranded DNA virus in the Circoviridae

family (Tischer et al., 1982; Buhk et al., 1985; Meehan et al., 1997). Currently, two PCV

viruses are recognized, porcine circovirus type 2 (PCV2) and PCV type 1 (PCVl). PCVl

was first isolated from a porcine kidney cell line (PK-15) (ATCC CCL-33) (Tischer et al.,

1974) while PCV2 was first reported to be associated with pigs exhibiting the post-weaning

multisystemic wasting syndrome (PMWS) (Clark, 1997). The depletion of lymphocytes in

the lymphoid follicles and their replacement by macrophages in conjunction with the

presence of PCV2 antigen is a consistent finding associated with PMWS (Allan et al., 1999;

Meehan et al., 1998). Nucleotide sequence analysis of PCV2 associated with PMWS

revealed differences when compared to PCVl. While PCVl is considered non-pathogenic,

PCV2 is considered to be pathogenic and has been associated with a number of pathological

disease syndromes including PMWS, enteritis, pneumonia, abortion, porcine respiratory

disease complex (PRDC) and porcine dermatitis and nephropathy syndrome (PDNS) (Allan

and Ellis, 2000; Segales et al., 2004). 50

Previous studies demonstrated that PCV has an ambisense circular genome (Tischer et al., 1982) that encodes proteins by the encapsidated viral DNA and by the complementary

DNA of the replication intermediate synthesized in the host. The encapsidated viral DNA codes for the replication associated proteins and non-structural proteins, while the complementary strand synthesized during replication codes for the capsid protein (Cap)

(Cheung, 2003a, b; Cheung and Bolin, 2002; Mankertz and Hillenbrand, 2001, 2002;

Mankertz et al., 1998a; Mankertz et al., 1998b; Nawagitgul et al., 2000). For Cap expression, it is believed that the complementary strand is synthesized as a consequence of creating an intermediate double-stranded replication form (RF) (Meerts et al., 2005). A previous study showed that during productive PCV2 infection of PK-15 cells, a viral capsid mRNA, five replication-associated mRNAs, and three non-structural-associated mRNAs are generated and the capsid mRNA is a spliced RNA (Cheung, 2003b).

In situ hybridization (ISH) and polymerase chain reaction (PCR) assays have been used to detect PCV2 DNA in multiple organs and cell types recovered from infected pigs, however, these assays fail to differentiate between replicating virus and virion DNA.

Recently, we developed a single-tube reverse transcription-PCR (RT-PCR) assay capable of detecting PCV2 spliced capsid mRNA (Cap mRNA), enabling us to discriminate between replicating PCV2 and PCV2 virions in PK-15 cells (Yu et al., 2005). However, this assay did not allow quantification of the viral product. To overcome this problem, a quantitative real­ time RT-PCR assay to detect PCV2 Cap mRNA was developed and assessed in this study.

It has been shown that the viremia caused by PCV2 is both cell-free and cell- associated, but the cell-associated form appears to be more apparent and long-lasting

(Pensaert et al., 2004). However, it is unknown whether the PCV2 found in association with 51

PBMCs resulted from active replication within the different cell populations, or was due to non-replicating virus that had either been adsorbed to or endocytosed by the cells. It has been demonstrated that increased PCV2 genome levels in serum or plasma samples recovered from infected pigs with clinical disease have been observed when compared to infected healthy controls (Brunborg et al., 2004; Liu et al., 2000). However, there was no report about increased PCV2 genome levels in PBMCs from PMWS affected pigs. In addition, several experimental studies have reported that immunostimulation of pigs results in an increased

PCV2 replication and an increased incidence of PMWS (Krakowka et al., 2001; Kyriakis et al., 2002). To address whether immune stimulation may result in increased PCV2 replication in PBMCs, the study reported here assessed PCV2 replication in cultured PBMCs with or

without mitogen stimulation at different time points by detecting PCV2 DNA and Cap

mRNA using a real-time PCR and real-time RT-PCR assays, respectively. To further identify

the specific PBMC populations in which PCV2 replicates, PCV2 infected and concanavalin

A (ConA) stimulated PBMCs were sorted by flow cytometry into CD3+ (T lymphocyte),

SWC3+ (monocyte), and SWC3 (PBMCs with monocytes removed) populations. Propidium

iodide (PI) was used in the flow cytometric sorting to make sure each collected cell

population was viable cells. The various populations were evaluated for PCV2 DNA and Cap

mRNA levels to ascertain cell populations permissive for PCV2 replication.

Materials and methods

Virus

The strain of PCV2 used in this study was PCV2 isolate 40895 (GenBank Accession

No. AF264042) that has been shown to induce PMWS in pigs and has been adapted to grow

in PK-15 cells. The titer of the in vitro propagated PCV2 was 1 x 104 50% tissue culture 52 infective dose (TCIDso)/ml as determined by an immunofluorescence assay (IFA) (Fenaux et al., 2002). All PK-15 cells used in this study had been confirmed to be PCV-free (Fenaux et

al., 2002).

Experimental design

PBMCs were isolated by density centrifugation using FicollHypaque (Histopaque

1077; Sigma, St Louis, MO) from four PCV2-free crossbred pigs using standard methods

(Waters et al., 2000) and resuspended in complete medium (RPMI 1640 supplemented with

10% fetal calf serum, 0.05 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml

streptomycin, 1% non-essential amino acids lOOx (GibcoBRL, Life Technologies, Carlsbad,

CA), and 2 mM L-glutamine (Sigma, St. louis, MO)). The isolated PBMCs (1% 106

cells/sample) were infected with PCV2 at a multiplicity of infection (MOI) of approximately

0.1 or sham infected with media for one hour followed by washing 3 times with phosphate-

buffered saline (PBS) and resuspension in complete medium. The PCV2 infected and non-

infected PBMCs were incubated at 37 °C with 5% CO? with or without the mitogen, ConA at

5 |ig/ml (Sigma, St. Louis, MO). Cells were harvested at 1, 18, 38, or 72 hours post-infection

(HPI). At each time point, the cells were washed four times with PBS to remove free PCV2.

Total cells were enumerated after the addition of a non-enzymatic cell dissociation solution

(Sigma-Aldrich, St. Louis, MO) and cell viability was determined using trypan blue

exclusion. An aliquot containing 1><105 viable cells per sample was centrifuged and the cell

pellet was suspended in 200 pi RNAlater (Ambion, Austin, TX) and used for total RNA

isolation. An additional aliquot of lxlO5 viable cells was placed in 200 pi PBS and used for

total DNA isolation. This experiment was performed twice. 53

Enrichment of cellular subpopulations from PCV2 infected PBMCs

PBMCs with and without PCV2 infection as described above were incubated 3 days

with and without ConA (5 pg/ml) at 37 °C with 5% CO%. Cells were then labeled with FITC-

conjugated mouse anti-CD3 antibodies (PPT3, Southern Biotech, Birmingham, AL) to

identify T lymphocytes or FITC-conjugated mouse anti-porcine SWC3 antibodies (74-22-15,

Southern Biotech, Birmingham, AL) to detect monocytes, followed by staining with

propidium iodide (PI) to identify viable cells. The CD3+PI", SWC3+PI" and SWC3'PF (SWC3"

cells consist of PBMCs with monocytes removed) cell fractions were collected using an

EPICS ALTRA flow cytometer (Beckman Coulter, Miami, FL) at the Iowa State University

Cell facility. Each fraction was counted, and 1 xlO5 viable cells was suspended in 200 pi

RNAlater for total RNA isolation with an additional lxlO3 viable cells placed in 200 pi PBS

for DNA isolation.

Nucleic acid extraction

Total RNA was extracted using the Versagene total RNA purification kit (Centra

Systems, Minneapolis, MN) according to the manufacturer's instruction, and solubilized in

70 pi of elution solution. The RNA extracts were stored at -80 °C until real-time RT-PCR

amplification was carried out. Viral DNA was extracted from each cell sample using the

QIAamp DNA Mini kit (QIAGEN, Valencia, CA) according to the manufacturer's

instruction and solubilized in 100 pi of elution buffer. The DNA extracts were stored at -20

°C until assayed.

Real-time RT-PCR assay for PCV2 Cap mRNA

The forward primer (5'-AGATGCCATTTTTCCTTCTC-3'), reverse primer (5'-

GCTCC ACATT C AAT AACT AT G AC-3 ') and the probe used in quantification of spliced 54 capsid transcript of PCV2 were designed with the Primer 3 software (Rozen and Skaletsky.

2000; http://w ww- genome. wi. mit.edu/c gi-bin/ primer/primer 3 www .ceil based on sequence data of PCV2 isolate 40895 (GenBank Accession No. AF264042). The probe (5'-/56-

FAM/TCTTCTTCTGCGGTAACGCCTC/3BHQ1/-3') was labeled with a fluorescent reporter dye, 6-carboxyfluorescein (FAM) at 5' end and a quencher dye, Black Hole

Quencher 1 (BHQ_1) at 3' end. To avoid amplification interference from potential DNA

contamination, the reverse primer was designed to span the splice junction to ensure that

PCV2 DNA was not amplified.

To make a RNA standard, a 594 bp RT-PCR product was amplified from Cap mRNA

with the forward primer (5' -GGAGTCAAGAACAGGTTTGGGTG-3 ' ) and the reverse

primer (5 '-AGACTCCCGCTCTCCAACAAG-3 '). The product was ligated directly into the

pCRII cloning vector (TA Cloning kit, Invitrogen Corporation, Carlsbad, CA) according to

the manufacturer's instructions. After transformation into competent E. coli (Invitrogen

Corporation, Carlsbad, CA), individual bacterial colonies were screened for recombinant

plasmid using blue/white color selection. Purified, cloned plasmid DNA was prepared using

a QIAprep Spin miniprep kit (QIAGEN, Valencia, CA) and the sequence and orientation of

the insert was verified by DNA sequencing at the DNA Sequencing and Synthesis Facility,

Iowa State University. The plasmid was linearized using the NotI restriction enzyme and in

vitro transcribed using the SP6 RNA polymerase of RiboMax large scale RNA production

systems (Promega, Madison, WI) as described by the manufacturer. The RNA transcript was

purified using a standard phenol-chloroform extraction method. The final RNA pellet was

resuspended in DNase/RNase-free water. After determining the concentration by absorbance

at 260 nm using NanoDrop® ND-1000 Spectrophotometer (NanoDrop Technologies, 55

Wilmington, DE ), the RNA transcript was diluted to a concentration of 108 copies/|il in

DNase/RNase-free water and stored at -80 °C until use.

The quantification of Cap mRNA was performed using real-time RT-PCR on a Rotor-

Gene RG-300 (Corbett Research, Sydney, AU). The 20 pi reaction mixture consisted of 10 pi

2x TaqMan Universal PCR master mix buffer (Applied Biosystems, Foster City, CA); 0.1 pi

SuperScript III reverse transcriptase (200 U/pl) (Invitrogen, Carlsbad, CA); 0.2 pi RNaseout

(40 U/pl ) (Invitrogen, Carlsbad, CA); 2 pi of forward primer with final concentration 450 nM and 2 pi of reverse primer with final concentration 150 nM; 0.8 pi of TaqMan probe with final concentration 150 nM; 2.9 pi DNase/RNase-free water and 2 pi of 10-fold dilutions of

RNA standard or 2 pi of extracted total RNA from each sample. The amplification was performed at 55 °C for 45 min, 95 °C for 10 min; then for 45 cycles at 95 °C for 15 sec each and a single cycle at 60 °C for 60 sec. The fluorescence was read at the end of each round of amplification. All standard dilutions and unknown samples were run in duplicate. Standard curves were accepted when the coefficients of correlation (r2) were > 0.99. Quantification of

PCV2 Cap mRNA were achieved by comparing the threshold cycle (CT) value of the input sample RNA with the CT value of the standard RNA.

The sensitivity of the Cap mRNA detection assay was evaluated using 10-fold serial dilutions of the RNA standard described above. To ensure RNA specificity, the described real-time RT-PCR procedures were performed with and without reverse transcriptase as well as performed on total RNA samples isolated 48 hours after infecting PK-15 cells with PCVl

(Tischer et al., 1974). Independent assays were performed at least twice. To evaluate intra- assay variability and the inter-assay reproducibility, 10-fold serial dilutions of the Cap mRNA standard were tested in triplicate in three separate experiments. 56

Real-time PCR assay for PCV2 DNA

The PCV2 real-time PCR assay was performed using the Rotor-Gene RG-300

(Corbett Research, Sydney, AU) as previously described (Opriessnig et al., 2003) with some modifications. Briefly, the probe (5'-/56-

FAM/CCAGCAATCAGACCCCGTTGGAATG/3 BHQ_1 A3 ') was labeled with a fluorescent reporter dye, FAM at 5' end and a quencher dye, BHQl at 3' end. The PCR reaction was performed in a 25 pi volume containing: 12.5 pi TaqMan Universal PCR master mix

(Applied Biosystems, Foster City, CA); 5 pi of each forward and reverse primer (final

concentration 450 nM); 1 pi of TaqMan probe (final concentration 150 nM); 1.5 pi of 10-

fold dilutions of PCV2 plasmid DNA or DNA extracts. Quantification of viral DNA was

achieved by comparing the CT value of the input sample DNA with the CT value of the

standard template DNA. All dilutions of PCV2 plasmid DNA and unknown samples were

tested in duplicate.

Statistical analysis

Analysis of variance (ANOVA) was used to analyze the data. P values less than 0.05

were considered to be statistically significant for all test procedures. The correlation of the

copy numbers of PCV2 Cap mRNA and viral DNA was evaluated by nonparametric

correlations test, Spearman's Rho in Multivariate Methods using JMP5.1 (SAS Institute Inc.,

Cary, NC).

Results

Analytical performance of the real-time RT-PCR

A 151 bp fragment was amplified in the real-time RT-PCR assay that corresponded

with the anticipated size of Cap mRNA. Standard curves ranging from 500 to 5xl07 57 copies/reaction were constructed using serial dilutions of a RNA standard. The results were linear over a 5-log range demonstrating the dynamic range of the assay. A typical curve generated from the analysis of 10-fold dilutions of RNA standard is shown in Fig. 1. A strong linear relationship (R2 > 0.99) between the Cj values and the logio of the input copy number was observed. The coefficient of variation (%) of the mean Ct values within the run was in the range of 0.4-1.4% and from run to run was in the range of 1.0-2.0%. In the absence of reverse transcriptase, the Cap mRNA can not be detected. No RT-PCR product was detected from RNA samples recovered from PCVl infected PK-15 cells.

Measurement of PCV2 Cap mRNA and viral DNA production in cultured PBMCs

To detect PCV2 replication in PBMCs at different time post-infection in vitro, the

amount of Cap mRNA and viral DNA were measured. As expected, PCV2 DNA was

detected as early as 1 HPI, whereas no Cap mRNA was detected at that time. The Cap

mRNA was detected in the cultured PBMCs beginning at 18 HPI. Following infection with

PCV2, Cap mRNA copy numbers increased in both ConA-stimulated and non-stimulated

PBMCs over time; however, the levels of Cap mRNA were significantly higher (P<0.05) in

ConA stimulated PBMCs compared to non-stimulated PBMCs at all three time points post­

infection (Table 1). The PCV2 DNA copy number also increased in infected PBMCs over

time, and as with the Cap mRNA copy numbers, the levels were significantly higher

(P<0.05) in ConA-stimulated PBMCs compared to non-stimulated PBMCs at 18, 38, and 72

HPI (Table 1). A strong correlation existed between the levels of Cap mRNA and viral DNA

in ConA stimulated PBMCs (r = 0.97, f <0.001) whereas no significant correlation was

observed in non-stimulated PBMCs. Neither the Cap mRNA nor viral DNA product was

amplified from sham-infected PBMCs at any time point. 58

Measurement of PCV2 Cap mRNA and viral DNA production in PBMC subpopulations

To detect the specific cell population supporting PCV2 replication during the active viral replication period, T lymphocytes, monocytes and monocyte-depleted PBMCs were sorted from ConA stimulated PBMCs three days post-infection with PCV2. The purity of

monocyte (SWC3+) and T lymphocyte (CD3+) populations were >90%. Less than 1%

SWC3+ cells were detected in the SWC3" cell population which consisted primarily of

lymphocytes (data not shown). The T lymphocyte population (CD3+) had increased levels of

Cap mRNA consistent with PCV2 replication (Fig. 2). The PCV2 Cap mRNA and viral DNA

levels were significantly lower in the SWC3+ monocyte-enriched population than all other

cell populations (P<0.05). The level of PCV2 replication in the SWC3" group was equivalent

to the CD3+ and total PBMC populations, and is greater than SWC3+ cells.

Discussion

A previous study demonstrated PCV2 was associated with PBMCs from PCV2

infected pigs (Pensaert et al., 2004). However, no detailed assessment of PCV2 replication

within porcine PBMCs has been performed. Therefore, it was unclear whether PBMCs are

capable of supporting PCV2 replication or if the virus had been adsorbed to or endocytosed

by the cells. To date, the population of cells associated with PCV2 replication has not been

well characterized. Microscopic lesions associated with PCV2-induced disease have been

characterized by lymphoid depletion (Allan and Ellis, 2000). However, the pathogenic

mechanism by which PCV2 induces lymphoid depletion and the role virus infection of

lymphocytes plays in the disease process has not been fully elucidated. Previous investigators

have suggested that immune stimulation increases the level of PCV2 detected in the blood and tissues and it was hypothesized that this increase in viral load may be related to the

increased pathological changes associated with PMWS (Krakowka et al., 2001; Kyriakis et

al., 2002 ; Opriessnig et al., 2003). In order to investigate PCV2 replication in PBMCs as

well as to define the temporal relationship between cellular activation (e.g., ConA

stimulation) and PCV2 replication, a quantitative assay to measure replication-associated

PCV2 Cap mRNA was utilized (Yu et al., 2005). In order to demonstrate that active viral

replication would result in increased numbers of PCV2 virions, a real-time PCR assay was

used to measure PCV2 DNA levels. The results showed that both the PCV2 Cap mRNA copy

number and the PCV2 DNA copy number increased in PBMCs in vitro and significantly

increased (P<0.05) in PBMCs in association with ConA stimulation. These results support

the hypothesis that activation of lymphocytes (i.e., immune stimulation) enhances PCV2

replication (Krakowka et al., 2001; Kyriakis et al., 2002; Opriessnig et al., 2003).

In order to further identify the specific cell populations in which PCV2 actively

replicates, infected PBMCs were stimulated with ConA for 3 days, and then sorted by flow

cytometry into viable T lymphocytes (CD3+), monocytic/macrophage cells (SWC3+) and

PBMCs with monocytic/macrophage cells removed (SWC3"). Both the real-time RT-PCR

assay and real-time PCR assay were used to quantify the replication of PCV2 in these cell

populations. Based upon the results of both assays it was determined that the number of

PCV2 Cap mRNA and PCV2 virions in SWC3" monocyte-depleted PBMCs or CD3+ T

lymphocytes were significantly increased (P < 0.05) compared to the levels in the

monocytic/macrophage cells (SWC3+). This suggests that lymphocytes are a primary site for

PCV2 replication when they are activated. Previous studies using ISH or IHC staining

demonstrated that PCV2 nucleic acid or antigen in PMWS-affected pigs is primarily 60 localized to the cytoplasm of histiocytes, multinucleate giant cells, and other monocyte/macrophage lineage cells (Allan and Ellis, 2000; Chianini et al., 2003; Ellis et al.,

1998; Gilpin et al., 2003; Rosell et al., 1999). However, several in vitro studies have failed to observe PCV2 replication in monocyte/macrophage lineage cells (Gilpin et al., 2003; Meerts et al., 2005; Vincent et al., 2003). These studies suggested that monocytic cells may not represent the primary target for PCV2 replication, but that they acquired viral antigens or nucleic acid through phagocytosis (Gilpin et al., 2003). In vivo infected lymphocytes may be

phagocytized immediately by macrophages present within the lymphoid tissues. Thus, the

accumulated PCV2 in macrophage was detected by ISH or IHC assays which may not be

sensitive enough to detect lower amounts of virus in lymphocytes in vivo. In support of this

hypothesis, it has been demonstrated that more than 107 PCV2 genome copies per 500 ng of

tissue has been obtained from mesenteric lymph nodes of pigs with PMWS (Brunborg et al.,

2004). However, the estimated minimal viral load of 108 PCV2 genome copies per 500 ng

DNA is required in order to detect viral antigen using IHC assay (Brunborg et al., 2004). In

our study, we were able to detect both the PCV2 Cap mRNA and viral DNA in the SWC3+

monocytic cell population. However, we cultured these cells with lymphocytes for 3 days

prior to separation. It is possible that some of the Cap mRNA in these cells may have

originated from lymphocytes subsequently taken up by these monocytic cells. Whether the

detection of PCV2 Cap mRNA and viral DNA in SWC3+ cells was due to uptake of infected

lymphocytes or due to active replication of PCV2 within them was not investigated, so a low

level of replication in monocytic cells can not be excluded. However, the fact that the level of

viral Cap mRNA was about 100-fold lower (P < 0.05) in the SWC3+cells suggested that

these cells are not the primary target for PCV2 replication. 61

In contrast to a previous study (Gilpin et al., 2003), our study demonstrated that both viral RNA and DNA levels were increased in T lymphocyte populations compared to the

SWC3+ monocyte population. These results confirm that PCV2 is lymphotropic as has been observed with other Circoviridae family members such as chicken anemia virus and TT virus

(Adair, 2000; Maggi et al., 2001). One significant difference between the study reported here

and that of Gilpin et al. (Gilpin et al., 2003) is that the cells used in this study were stimulated

with ConA in addition to being infected with PCV2. We stimulated the cells to increase

viable cells as typically more than 80% of the lymphocytes in culture die within the first 3

days in the absence of stimuli. Thus, total cellular viability was enhanced by ConA

stimulation and this allowed for increased viral replication and the ability to detect

replication within the lymphocyte population. In addition, immune stimulation has been

associated with increased viral loads and clinical disease (i.e., PMWS) in pigs (Krakowka et

al., 2001; Kyriakis et al., 2002; Opriessnig et al., 2003). However, by stimulating PBMCs

with ConA, selection for specific lymphocyte subpopulations may have occurred. Subsequent

studies will be required to further define the subpopulation(s) of lymphocytes in which PCV2

replicates.

Due to the lack of reagents to identify and stimulate porcine B cells, the PCV2

replication in this lymphocyte population was not investigated. However, the copy number of

PCV2 Cap mRNA and viral DNA in PBMCs depleted of monocytes (SWC3 ) tended to be

higher than the levels in either the complete PBMCs or the T lymphocyte-enriched

populations, suggesting that B cells may also allow viral replication.

Previously, we have developed a single-tube RT-PCR assay that detects PCV2 Cap

mRNA and is able to discriminate between replicating PCV2 and PCV2 virions in PK-15 62 cells (Yu et al., 2005). However, this assay was not quantitative. In the present study, a real­ time RT-PCR assay to detect and quantify PCV2 Cap mRNA was developed. The primers and the probe were designed to detect only Cap mRNA transcript. No PCV2 DNA was amplified. The evaluation of the performance of this real-time RT-PCR assay demonstrated that this assay was a sensitive, specific, and highly reproducible technique for assessing

PCV2 replication. Moreover, this real-time RT-PCR method is performed in a closed tube and requires no post-PCR analyses. Therefore, outside contamination by viral DNA was eliminated.

The results of this study demonstrated that PBMCs support PCV2 replication and that

in vitro stimulation of PBMCs with ConA enhanced viral replication. Using flow cytometric

sorting of PBMCs, PCV2 replication in T lymphocytes was also demonstrated. While a low

level (i.e., 100-fold less) of viral replication was detected in the monocytic/macrophage cells

(SWC3+), it was not determined whether this represented viral replication or phagocytic

uptake of viral products. Further studies to identify the specific subpopulations of cells

permitting PCV2 replication in vivo are required to better understand the pathogenesis of

PMWS and the mechanisms by which PCV2 infection progresses to PMWS.

Acknowledgements

The authors would like to thanks Dr. Shawn Rigby at Iowa State University Cell

facility for assisting in purifying the cell populations, Jack Gallup at the department of

Veterinary Pathology College of Veterinary Medicine, Iowa State University for the advice

on real-time RT-PCR assay and Dr. Xiang-Jin Meng from Virginia Polytechnic Institute and

State University for supplying the PCV2 plasmid DNA. This work was supported by Healthy

Livestock Initiative fund. 63

References

Adair, B.M., 2000, Immunopathogenesis of chicken anemia virus infection. Dev Comp Immunol 24, 247-255. Allan, G.M., Ellis, J.A., 2000, Porcine circoviruses: a review. J Vet Diagn Invest 12, 3-14. Allan, G.M., Mc Neilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A., Charreyre, C.E., 1999, Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland. Vet Microbiol 66, 115-123. Brunborg, I.M., Moldal, T., Jonassen, C.M., 2004, Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J Virol Methods 122, 171-178. Cheung, A.K., 2003a, Comparative analysis of the transcriptional patterns of pathogenic and nonpathogenic porcine circoviruses. Virology 310, 41-49. Cheung, A.K., 2003b, Transcriptional analysis of porcine circovirus type 2. Virology 305, 168-180. Cheung, A.K., Bolin, S.R., 2002, Kinetics of porcine circovirus type 2 replication. Arch Virol 147, 43-58. Chianini, F., Majo, N., Segales, J., Dominguez, J., Domingo, M., 2003, Immunohistochemical characterisation of PCV2 associate lesions in lymphoid and non-lymphoid tissues of pigs with natural postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 94, 63-75. Clark, E., 1997, Post-weaning multisystemic wasting syndrome. Proceedings of the Western Canadaian Association of Swine Practitioners 28, 499-501. Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D., Haines, D., 1998, Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J 39, 44- 51. Fenaux, M., Halbur, P.G., Haqshenas, G., Royer, R., Thomas, P., Nawagitgul, P., Gill, M., Toth, T.E., Meng, X.J., 2002, Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions. J Virol 76, 541-551. Gilpin, D.F., McCullough, K., Meehan, B.M., McNeilly, F., McNair, I., Stevenson, L.S., Foster, J.C., Ellis, J.A., Krakowka, S., Adair, B.M., Allan, G.M., 2003, In vitro studies on the infection and replication of porcine circovirus type 2 in cells of the porcine immune system. Vet Immunol Immunopathol 94, 149-161. Krakowka, S., Ellis, J.A., McNeilly, F., Ringler, S., Rings, D.M., Allan, G., 2001, Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2). Vet Pathol 38, 31-42. Kyriakis, S.C., Saoulidis, K., Lekkas, S., Miliotis Ch, C., Papoutsis, P.A., Kennedy, S., 2002, The effects of immuno-modulation on the clinical and pathological expression of postweaning multisystemic wasting syndrome. J Comp Pathol 126, 38-46. 64

Liu, Q., Wang, L., Willson, P., Babiuk, L.A., 2000, Quantitative, competitive PCR analysis of porcine circovirus DNA in serum from pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 38, 3474-3477. Maggi, F., Fornai, C., Zaccaro, L., Morrica, A., Vatteroni, M.L., Isola, P., Marchi, S., Ricchiuti, A., Pistello, M., Bendinelli, M., 2001, TT virus (TTV) loads associated with different peripheral blood cell types and evidence for TTV replication in activated mononuclear cells. J Med Virol 64, 190-194. Mankertz, A., Hillenbrand, B., 2001, Replication of porcine circovirus type 1 requires two proteins encoded by the viral rep gene. Virology 279, 429-438. Mankertz, A., Hillenbrand, B., 2002, Analysis of transcription of Porcine circovirus type 1. J Gen Virol 83,2743-2751. Mankertz, A., Mankertz, J., Wolf, K., Buhk, H.J., 1998a, Identification of a protein essential for replication of porcine circovirus. J Gen Virol 79 ( Pt 2), 381-384. Mankertz, J., Buhk, H.J., Blaess, G., Mankertz, A., 1998b, Transcription analysis of porcine circovirus (PCV). Virus Genes 16, 267-276. Meehan, B.M., McNeilly, F., Todd, D., Kennedy, S., Jewhurst, V.A., Ellis, J.A., Hassard, L.E., Clark, E.G., Haines, D.M., Allan, G.M., 1998, Characterization of novel circovirus associated with wasting syndromes in pigs. J Gen Virol 79 ( Pt 9), 2171-2179. Meerts, P., Misinzo, G., McNeilly, F., Nauwynck, H.J., 2005, Replication kinetics of different porcine circovirus 2 strains in PK-15 cells, fetal cardiomyocytes and macrophages. Arch Virol 150, 427-441. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D., Paul, P.S., 2000, Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81, 2281-2287. Opriessnig, T., Yu, S., Gallup, J.M., Evans, R.B., Fenaux, M., Pallares, F., Thacker, E.L., Brockus, C.W., Ackermann, M.R., Thomas, P., Meng, X.J., Halbur, P.G., 2003, Effect of vaccination with selective bacterins on conventional pigs infected with type 2 porcine circovirus. Vet Pathol 40, 521-529. Pensaert, M.B., Sanchez, R.E., Ladekjaer-Mikkelsen, A.S., Allan, G.M., Nauwynck, H.J., 2004, Viremia and effect of fetal infection with porcine viruses with special reference to porcine circovirus 2 infection. Vet Microbiol 98, 175-183. Rosell, C., Segales, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioja, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S., Domingo, M., 1999, Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120, 59-78. Segales, J., Rosell, C., Domingo, M., 2004, Pathological findings associated with naturally acquired porcine circovirus type 2 associated disease. Vet Microbiol 98, 137-149. Tischer, I., Gelderblom, H., Vettermann, W., Koch, M.A., 1982, A very small porcine virus with circular single-stranded DNA. Nature 295, 64-66. Tischer, I., Rasch, R., Tochtermann, G., 1974, Characterization of papovavirus-and picornavirus-like particles in permanent pig kidney cell lines. Zentralbl Bakteriol [Orig A] 226, 153-167. 65

Vincent, I.E., Carrasco, C P., Herrmann, B., Meehan, B.M., Allan, G.M., Summerfield, A., McCullough, K.C., 2003, Dendritic cells harbor infectious porcine circovirus type 2 in the absence of apparent cell modulation or replication of the virus. J Virol 77, 13288-13300. Waters, W.R., Hontecillas, R., Sacco, R.E., Zuckermann, F.A., Harkins, K.R., Bassaganya- Riera, J., Wannemuehler, M.J., 2000, Antigen-specific proliferation of porcine CD8alphaalpha cells to an extracellular bacterial pathogen. Immunology 101, 333- 341. Yu, S., Carpenter, S., Opriessnig, T., Halbur, P.G., Thacker, E., 2005, Development of a reverse transcription-PCR assay to detect porcine circovirus type 2 transcription as a measure of replication. J Virol Methods 123, 109-112. 66

50 CT R-0.99864 R"2-0.99728 Efficiencv4).99

10

if"

! |1(T2 ilCTG MCT4 (1CT5 HCTG ,10"7 Concentration

Fig. l.A standard curve derived from the amplification of a dilution series containing 5xl02 to 5><107 copies/reaction of the RNA standard for PCV2 spliced capsid mRNA. The standard curve was plotted for starting copy number versus threshold cycle (CT) and had a correlation coefficient (R2) of 0.997. 67

A)

8

Mon Meg PBMC CD3 Mon fos cell population

B) 8 n

Mon Meg PBMC CD3 Mon Pos

cell population

Fig. 2. Quantification of PCV2 spliced capsid mRNA (A) and PCV2 DNA (B) in infected peripheral blood mononuclear cell populations with concanavalin A stimulation for 3 days.

The populations include peripheral blood mononuclear cell (PBMCs) without monocytes

(Mon Neg), PBMCs (PBMC), T lymphocytes (CD3) and monocytes (Mon Pos).

* Significant difference at f <0.05 within sorted cell populations. Error bars represent standard deviation from the average values. 68

Table 1. In vitro kinetics of PCV2 replication in resting or concanavalin A (ConA)- stimulated peripheral blood mononuclear cells (PBMCs).

PCV2 spliced capsid mRNA copy number1 PCV2 DNA copy number (Mean ± Std Dev) (Mean ± Std Dev)

HPI Non-stimulated ConA-stimulated2 NS ConA-stimulated 1 ND ND 8.21 ±0.17 8.15 ± 0.19 18 4.58 ±0.26 5.45 ±0.17* 8.15 ± 0.19 8.43 ±0.07* 38 4.64 ± 1.14 7.43 ± 0.07* 8.28 ±0.16 9.46 ±0.14* 72 4.78 ± 1.60 8.69 ±0.09* 8.33 ±0.14 9.98 ± 0.11*

'Copy number reported as the logio at each time point.

2PBMC cultures were stimulated with 5 |ig/mL of ConA at the same time when PCV2 was

added to the cells.

Viral replication was evaluated by measuring the level of PCV2 spliced capsid mRNA and

viral DNA using real-time reverse transcription (RT)-PCR and a real-time PCR assay,

respectively.

ND = Not Detected

* Significant difference between PCV2 infected PBMCs that were ConA stimulated in

comparison to non-stimulated PBMCs (P<0.05). 69

CHAPTER 4. PORCINE CIRCOVIRUS TYPE 2 (PCV2)

DISTRIBUTION AND REPLICATION IN TISSUES AND IMMUNE

CELLS IN EARLY INFECTED PIGS

A paper to be submitted to Viral Immunology and Immunopathology

S. Yua, T. Opriessnigb, P. Kitikoon3, D. Nilubol3, P. G. Halburb, E. Thackera

^Department of Veterinary Microbiology and Preventive Medicine College of Veterinary

Medicine, Iowa State University, Ames. IA. ^Department of Veterinary Diagnostic and

Production Animal Medicine, College of Veterinary Medicine, Iowa State University, Ames.

IA.

Abstract

Replication of porcine circovirus type 2 (PCV2) in pigs, as measured by spliced capsid mRNA (Cap mRNA) and viral DNA, was investigated following experimental infection. Peripheral blood mononuclear cells (PBMCs), and tissues from the bronchial lymph nodes (BLN), inguinal lymph nodes (ILN), tonsils, lungs, liver, kidneys, spleen and thymus from infected pigs on different days post-infection (DPI) were assessed. PCV2 replication differed dramatically between tissues from the same infected pig. The virus actively replicated in most tested tissues at 14 DPI in association with severe PCV2 associated lesions and abundant PCV2 antigen. The PCV2 Cap mRNA was only detected at

13 DPI in PBMCs from infected pigs, suggesting replication of the virus in circulating blood and peripheral blood is transient and thus not a major site for PCV2 replication in vivo.

Evaluation of the Cap mRNA and viral DNA synthesis in T and B lymphocyte and monocyte populations from PBMCs and BLN at various intervals post-inoculation revealed the 70 replication of PCV2 in all cell subpopulations; viral replication in B lymphocytes was greater than in monocytes from BLN at 14 DPI indicating that B lymphocytes are permissive for

PCV2 replication. These findings further our understanding of the cell types permissive for

PCV2 replication and the pathogenesis of PCV2 infection in vivo.

Keywords: PCV2; Real-time RT-PCR; Invivo

Introduction

Porcine circovirus type 2 (PCV2) is a circular single-stranded DNA virus in the

Circoviridae family (Tischer et al., 1982; Buhk et al., 1985; Meehan et al., 1997). It was first

associated with pigs exhibiting the postweaning multisystemic wasting syndrome (PMWS) in

Western Canada (Clark, 1997). Depletion of lymphocytes in the lymphoid follicles and their

replacement by macrophages make up the hallmark lesions observed in this syndrome (Allan

et al., 1999; Meehan et al., 1998). Infection with PCV2 has also been associated with a

number of other pathologic disease syndromes including enteritis, pneumonia and respiratory

disease, abortion and porcine dermatitis and nephropathy syndrome (PDNS) (Allan and Ellis,

2000; Segales et al., 2004b).

In situ hybridization (ISH) and polymerase chain reaction (PCR) assays have been

used to detect PCV2 DNA in tissues and cells from infected pigs. In addition, the lymphocyte

depletion of follicular and interfollicular lymphoid tissues together with the macrophage

infiltration of lymphoid tissues observed in PMWS affected pigs are highly correlated with a

decrease in numbers of circulating B and T cells (Chianini et al., 2003 ; Clark, 1997;

Darwich et al., 2002; Nielsen et al., 2003; Quintana et al., 2001; Rosell et al., 1999; Sarli et

al., 2001; Segales et al., 2000; Shibahara et al., 2000). However, it is not clear which tissue or

cell type is the primary site for PCV2 infection and replication. Recently we demonstrated 71 that PCV2 replicates in PBMCs using a quantitative real-time reverse transcription-PCR

(RT-PCR) assay that detects PCV2 spliced capsid mRNA (Cap mRNA) and allowing discrimination between replicating PCV2 and PCV2 virions (Yu et al., 2004). The aim of this study was to understand the replication of PCV2 in vivo and identify cell populations that are permissive for PCV2 replication in vivo. In this study, we investigated the levels of PCV2

Cap mRNA and viral DNA in PBMCs, bronchoalveolar lavage (BAL) cells, and multiple

tissues (bronchial lymph nodes (BLN), inguinal lymph nodes (ILN), lung, tonsil, thymus,

spleen, liver and kidney) from pigs during the acute phase PCV2 infection as well as the viral

DNA levels in serum and cell-free BAL fluid. The microscopic lesions and the amount of

PCV2 antigen in tissues was measured using histopathology and immunohistochemistry

(IHC), respectively. PCV2 antibody levels in serum and BAL fluid were also assessed.

Specific immune cell populations were sorted by AutoMACS from peripheral blood or BLN

mononuclear cells and the PCV2 infection and replication in each cell population was further

measured by real-time RT-PCR and real-time PCR assays, respectively. Our studies show

that PCV2 replication is dramatically different between tissues from the same pig and

suggest that lymphocytes are permissive for PCV2 replication while monocytes may be the

site for PCV2 persistence in the infected pigs.

Materials and methods

PCV2 inocula

The challenge inoculum was prepared from a PCV2 virus stock derived from the

molecular clone of PCV2 isolate 40895 (GenBank Accession No. AF264042). This virus was

isolated from the spleen of a pig with naturally occurring PMWS (Pénaux et al., 2002). The

titer of the PCV2 inoculum was 1*10 4'75 50% tissue culture infective dose (TClD^)Zml as 72 determined by titration on PCV-free PK-15 cells using a previously described immunofluorescence assay (IFA) (Fenaux et al., 2002).

Experimental design

Twenty-four PCV2-free cross-bred pigs were used in this study. The pigs were assigned to two rooms (twelve pigs/room) on the day of challenge (trial day 0). Twelve pigs

in one room were inoculated intranasally at the age of 4 to 5 weeks with 5 ml of the PCV2

inoculum. The remaining pigs housed in a separate room were sham-inoculated with 5 ml of

PCV-free PK15 cell lysate and served as negative controls. All study procedures and animal

care were conducted in accordance within the guidelines and under the approval of the Iowa

State University Institutional Committee on Animal Care and Use.

Necropsy and sample collection

Three pigs from each group were necropsied at 3, 7, 14 and 21 days post-infection

(DPI). Tissue samples from BLN, ILN, lungs, tonsils, thymus, spleen, liver and kidney of

each pig were collected at necropsy and fixed in 10% formalin for histological examination

and IHC assay. Fresh BLN samples were also placed immediately in RPMI 1640 medium

supplemented with 10% fetal calf serum, 100 U/ml penicillin and 0.1 mg/ml streptomycin for

isolation of mononuclear cells. In addition, pieces of each tissue described above were snap

frozen on dry ice and stored at -80 °C until used for isolation of total RNA or DNA.

The right lung of each necropsied pig was lavaged with 50 ml of collecting solution

(sterile phosphate-buffered saline (PBS) with 1% bovine serum albumin (BSA), 300 U/ml

penicillin and 300 mg/ml streptomycin). The BAL was centrifuged (400 g, 10 min, 4 °C) to

separate cells and cell-free lavage fluid. BAL cells (lxlO6) were resuspended in 200 pi

RNAlater (Ambion, Austin, TX) for total RNA and DNA isolation. The cell-free lavage fluid 73 was stored at -20 °C for PCV2 antibody detection and DNA isolation. Serum samples were collected at 0,2,6, 13, and 20 DPI and stored at -20 °C until used for DNA isolation or assayed for PCV2 antibodies. Concurrently, heparinized blood samples were collected for

PBMCs isolation.

Isolation of mononuclear cells from BLN and peripheral blood

Fresh BLN tissues were cut into small pieces and pushed through a 70 pm pore-size nylon cell strainer (Falcon) to create single-cell suspensions. The cells were centrifuged at

300 g for 8-10 min and resuspended in 3 ml sterile water for 15 sec to lyse red blood cells

immediately followed by the addition of 3.5% sodium chloride. Cells were washed with PBS

twice and resuspended in complete medium (RPMI 1640 supplemented with 10% fetal calf

serum, 0.05 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1% non­

essential amino acids lOOx (GibcoBRL, Life Technologies, Carlsbad, CA), and 2 mM L-

glutamine (Sigma, St. louis, MO)). PBMCs were isolated by Ficoll-hypaque (Histopaque

1077; Sigma, St Louis, MO) density centrifugation from collected peripheral blood using

standard methods (Waters et al., 2000) and resuspended in complete medium.

Enrichment of T, B lymphocytes and monocytes

The isolated BLN mononuclear cells or the PBMCs were separated by positive

selection using the AutoMACS, magnetic separation system (Miltenyi Biotec, Auburn CA),

according to the manufacturer's instructions. Briefly, the single-cell suspensions at a

concentration of 3xl07, 6><107, 6x 107 cells were centrifuged followed by incubation with the

following monoclonal antibodies; FITC-conjugated mouse anti-pig CD3 (PPT3, Southern

Biotechnology Associates, Birmingham, AL) for T lymphocytes, FITC-conjugated mouse

anti-pig CD21 (BB6-11C9.6, Southern Biotechnology Associates, Birmingham, AL ) for B 74 lymphocytes and FITC-conjugated mouse anti-pig SWC3 (74-22-15, Southern

Biotechnology Associates, Birmingham, AL) for monocytes/macrophages, respectively, for

10 min in the dark at 4-8 °C. The cells were washed twice with 2 ml cold MACS buffer (PBS containing 5 mM EDTA and 0.5% BSA) per 107 cells and centrifuged at 300 g for 10 min.

The supernatant was removed completely and the cells resuspended in 90 pi of MACS buffer per 107 total cells. Ten pi of anti-FITC coated MicroBeads per 107 total cells was then added

and incubated for 15 min at 4-8 °C. The cells were again washed twice by adding 2 ml of

buffer per 107 cells and centrifuged at 300 g for 10 min followed by re-suspension in 500 pi

of MACS buffer. The T, B lymphocyte and monocyte populations were separated using the

autoMACS by positive selection. The purity of sorted cell fractions was assessed by flow

cytometric analysis with a FACScan (Becton-Dickinson, Franklin Lakes, NJ). 7-amino-

actinomycin D (7AAD) was added to each tested cell fractions before conduct the flow

cytomertic analysis to assess the cell viability. Each subpopulation was centrifuged and

1 x 106 cells/ cell fraction was resuspended in 200 pi RNAlater (Ambion, Austin, TX ) for

total RNA isolation and an additional 1 x 106 cells placed in 200 pi PBS for DNA isolation.

Extraction of nucleic acids

To isolate the total RNA from collected tissues, small pieces of each frozen tissue

described above was incubated at -20 °C for 16 hours in 2 ml of RNA later-ice frozen tissue

transition solution (Ambion® Austin, TX). Twenty mg of each incubated tissue was

homogenized and the total RNA was isolated using RNAqueous small scale phenol-free total

RNA isolation kit (Ambion, Austin, TX) according to the manufacturer's instructions. To

extract total RNA from a known number of each cell population including PBMCs, the

purified T lymphocytes, B lymphocytes and monocytes, the Versagene RNA purification kit (Centra systems, Minneapolis, MN) was used according to the manufacturer's instructions.

Genomic DNA was isolated from frozen tissues, serum, cell-free BAL fluid, and purified T or B lymphocyte and monocyte preparations using the QIAamp DNA mini kit (Qiagen,

Valencia, CA) according to the manufacturer's instructions. For DNA extraction of serum or cell-free BAL fluid samples, 200 pi was used as starting material. For DNA extraction of

tissue samples, 10 mg spleen or 20 mg of each other tissue sample was used. For the

AutoMACs sorted immune cells, 1><106 cells/cell fraction were used. Each tissue sample was

added to lysis buffer with Proteinase K (20 mg/ml) and incubated at 55 °C for 6-7 hours until

completely lysed. The DNA was eluted in 100 pi elution buffer and storage at -20 °C until

use.

Real-time RT-PCR assay and real-time PCR assay

A real-time RT-PCR assay to detect the Cap mRNA of PCV2 was performed on total

RNA as previously described (Yu et al., 2004). The forward primer (5'-

AGATGCCATTTTTCCTTCTC-3'), reverse primer (5'-

GCTCC AC ATTC A AT A ACTAT G AC -3 ') and the probe (5'-/56-

FAM/TCTTCTTCTGCGGTAACGCCTC/3BHQ1A3') were used to amplify and quantify

the Cap mRNA on Rotor-Gene RG-300 (Corbett Research, Sydney, AU). The probe was

labeled with a fluorescent reporter dye, 6-carboxyfluorescein (FAM) at 5' end and a

quencher dye, Black Hole Quencher 1 (BHQ l) at 3' end. The reaction mixture was in a 20

pi final volume and the reactions were carried out at 55 °C for 45 min, 95 °C for 10 min, then

for 45 cycles at 95 °C for 15 sec and 60 °C for 60 sec. All unknown samples and standard

dilutions ranging from 500 to 5*106 copy numbers were run in duplicates. Quantification of 76

PCV2 Cap mRNA were achieved by comparing the threshold cycle (Cr) value of the input sample RNA with the C? value of the standard RNA.

DNA extracts were used to quantify the amount of PCV2 genomic DNA by real-time

PGR assay. The real-time PGR assay was performed using the Rotor-Gene RG-300 (Corbett

Research, Sydney, AU) as previously described (Opriessnig et al., 2003) with some

modifications. Briefly, the probe (5'-/56-

FAM/CCAGCAATCAGACCCCGTTGGAATG/3BHQ1/-3') was labeled with a fluorescent

reporter dye, FAM at 5' end and a quencher dye, BHQl at 3' end. The PGR reaction was

carried out in a 25 pi final volume. All reactions were carried out in duplicate. In addition,

each run included 10-fold dilutions ranging from 20 to 2x 105 copy numbers of PCV2

plasmid DNA to generate a standard curve. Quantification of viral DNA was achieved by

comparing the Ct value of the input sample DNA with the Cj value of the standard template

DNA.

Histopathology and Immunohistochemistry

Tissue samples of BLN, ILN, lung, tonsil, thymus, spleen, liver and kidney collected

at each necropsy were fixed in 10% neutral buffered formalin, embedded in paraffin wax,

and processed routinely for histological examination. Microscopic lesions were evaluated

blindly by two veterinary pathologists (T. Opriessnig, P. G. Halbur) using a previously

described scoring system (Opriessnig et al., 2004).

PCV2-specific antigen was measured by IHC on sections of paraffin embedded tissue

samples using a rabbit polyclonal antiserum as previously described (Sorden et al., 1999).

The amount and distribution of PCV2 antigen was assessed by evaluation of IHC signals of

each tissue section ranging from 0 (= no signal) to 3 (= strong positive signals) as previously described (Opriessnig et al., 2004) in a blinded fashion. The mean group score was determined for each tissue and compared.

PCV2 antibody detection

A PCV2 enzyme-linked immunosorbent assay (ELISA) based on the recombinant

open reading frame 2 (ORF2) capsid protein of PCV2 was performed to detect antibodies to

PCV2 in serum samples as described previously (Nawagitgul et al., 2000). The cut-off values

used were as follows: samples with S/P ratio (sample-to-positive ratio) <0.12 were

considered negative, ratios between 0.12 to 0.2 were considered suspect, and ratios of > 0.2

were considered positive (Nawagitgul et al., 2002). PCV2-specific antibodies were assessed

in BAL using an ELISA assay as described previously with some modification (Nawagitgul

et al., 2002). Briefly, Immulon-2HB 96-well plates (Dynex, Chantilly, VA) were coated with

100 |il of ORF2 protein and the negative control, wide type (WT) protein. Plates were

incubated at 4 °C for 40 hours and washed 3 times with 0.05% Tween 20 in PBS (PBS-T).

Each BAL sample (100 ja.1) was added to duplicate wells and incubated at 37 °C for 30 min,

washed 3 times with PBS-T, then incubated with peroxidase-labeled goat anti-swine IgG

(Kirkegaard and Perry, Gaithersburg, MD), peroxidase-labeled goat anti-swine IgA (Bethyl,

TX) or peroxidase-labeled goat anti-swine IgM (Bethyl, TX) at 37 °C for 30 min. The

substrate, 2,2'-azino-di-(3- ethylbenzthiazoline-6-sulfonate) (ABTS)Zperoxidase (Kirkegaard

and Perry laboratories, Gaithersburg, MD) was used to develop the color, and 1% SDS was

added to stop the reaction. Optical density (OD) value was calculated by OD in ORF2 protein

coated well subtract OD in WT protein coated well. Antibody levels were reported as the

mean optical density (OD). The mean OD value from the infected group and non-infected

control group was compared. 78

Statistical analyses

In order to normalize the data for statistical comparisons, the Cap mRNA copy numbers and viral DNA copy numbers obtained from the real-time RT-PCR and real-time

PCR, respectively, were logio transformed. Data were assessed by analysis of variance

(ANOVA) using JMP5.1 (SAS Institute Inc., Cary, NC). Differences were considered significant for all test procedures when f<0.05. Differences between groups were evaluated

with Tukey's test. The correlation of the copy numbers of PCV2 Cap mRNA and copy

numbers of viral DNA was evaluated by nonparametric correlations test, Spearman's Rho in

Multivariate Methods using JMP5.1.

Results

Quantification of PCV2 Cap mRNA and viral DNA from different tissues

To investigate PCV2 replication and distribution in infected pigs during the early

stages of infection, PCV2 DNA and the Cap mRNA levels were measured at 3, 7, 14, and 21

DPI, and the results are shown in Fig. I. At 3 DPI, no Cap mRNA was detected from any

tissues with the exception of lung tissue from one infected pig whereas PCV2 DNA was

detected in most tissues. However, there was no significant difference in levels of the viral

DNA between the tested tissue samples at 3 DPI. The Cap mRNA was detected in most

tissues at 7 DPI with the level in BLN being significantly higher than kidney and liver. No

Cap mRNA was detected in thymus at that time. Viral DNA was present in all tissues and the

level in BLN was significantly higher than kidney and thymus at 7 DPI. At 14 DPI, both the

Cap mRNA and viral DNA were elevated in infected pigs. At that time, Cap mRNA was

detected in all collected tissues and the level in the BLN was significantly higher than kidney

and thymus. Levels of Cap mRNA in the ILN, spleen, lung, liver, and tonsil were equivalent 79 while the levels of Cap mRNA in the thymus were significantly lower than all other tissues.

The level of PCV2 DNA at 14 DPI was consistent with the Cap mRNA levels with BLN level being significantly greater than the level in kidney, liver and thymus. At 21 DPI, the

Cap mRNA levels were reduced in all tissues and no PCV2 Cap mRNA was detected in ILN, kidney, liver and thymus. In contrast, PCV2 DNA levels, while reduced compared to samples collected at 14 DPI, remained detectable in all tissues at 21 DPI. No Cap mRNA or viral

DNA was amplified in any tissue samples from the negative control pigs at any time point

during this experiment.

Strong correlation was found between the level of PCV2 Cap mRNA and the level of

viral DNA in the following tested tissues: BLN (r=0.75, P=0.005), ILN (r=0.82, P=0.001),

kidney (r=0.82, P=0.001), liver (r=0.83, P=0.001), lung (r=0.92, PO.OOOl), spleen (r=0.92,

f <0.0001), tonsil (r=0.93, P<0.0001)) except the thymus.

Investigation of PCV2 Cap mRNA and viral DNA levels in PBMCs and BAL cells and

the PCV2 DNA level in serum and cell-free BAL fluid

To evaluate PCV2 infection and replication in the respiratory tract, the level of Cap

mRNA and viral DNA was evaluated in BAL cells. Because PCV2 Cap mRNA as the

transcript are cell associated, only viral DNA was assessed in the cell-free BAL fluid and

serum. As shown in Fig. 2, Cap mRNA was detected in BAL cells 3 DPI from 2 of 3 infected

pigs. The mean logio copy number of Cap mRNA increased from 2.87 per 1 x 106 cells at 3

DPI to 7.84 per lxlO6 cells at 7 DPI and 7.24 per lxlO6 cells at 14 DPI, followed by a

decrease to 2.58 per 1 xlO6 cells at 21 DPI. However, none of these differences in the mRNA

levels were statistically significant between different time points. The level of PCV2 DNA in

BAL cells began to increase at 7 DPI, was further increased at 14 DPI. That was followed by 80 a decreased level at 21 DPI. In the case of viral DNA, the levels in the cell fraction of the

BAL were significantly greater at 7 and 14 DPI compared to 3 and 21 DPI. The levels of

PCV2 DNA in cell-free BAL fluid were similar to the levels observed in BAL cells. A strong

correlation was found between the level of Cap mRNA and the viral DNA in BAL cells

(.PO.OOl) and between the level of PCV2 DNA in BAL cells and in cell-free BAL fluid

(PO.OOl).

To assess the presence of PCV2 infection and replication systemically, serum and

PBMCs were collected at 2, 6,13, and 20 DPI. As shown in Fig. 3, PCV2 Cap mRNA was

detected in PBMCs only at 13 DPI, while the viral DNA was detected as early as 6 DPI. The

viral DNA level was significantly higher in PBMCs at 13 DPI compared to 6 and 20 DPI.

The detection of viral load in serum revealed a similar trend as that observed in PBMCs. A

strong correlation was found between the level of Cap mRNA and the viral DNA in PBMCs

(P=0.004). Moreover, a strong correlation was also found between the level of PCV2 DNA

in PBMCs and in serum (P<0.001). No Cap mRNA or viral DNA was amplified in BAL

cells or PBMCs and no PCV2 DNA was amplified in BAL fluid or serum samples from

control pigs at any time point during the experiment.

Investigation of PCV2 infection and replication in mononuclear cell subpopulations

isolated from peripheral blood or BLN from infected pigs

To investigate PCV2 replication in specific cell populations in vivo, T and B

lymphocyte and monocyte populations were sorted from PBMCs collected at 13 DPI or BLN

mononuclear cells collected at 7, 14, and 21 DPI from infected pigs. Cap mRNA and viral

DNA were measured in each cell fraction. Purity of the T lymphocyte, B lymphocyte, and

monocyte populations was confirmed by flow cytometry and was determined to be equal to or greater than 95%. The viability of each purified population was determined to be greater than 95% (data not shown). As shown in Fig. 4, the level of Cap mRNA in T lymphocytes in

PBMCs at 13 DPI was significantly higher compared to levels in monocytes (P<0.05). In contrast, the PCV2 DNA levels in B lymphocytes was significantly higher than the level in the monocyte fraction (P0.05).

As shown in Fig. 5A, similar to the findings in PBMCs, the level of Cap mRNA in T

or B lymphocytes were significantly higher than the level in monocytes (PO.OOl) at 7 DPI.

At 14 DPI, the level of Cap mRNA in B lymphocytes was significantly higher than the level

in either T lymphocytes or monocytes (PO.05). By 21 DPI, no statistical significant

difference between the Cap mRNA levels in tested populations was present. The level of

PCV2 DNA in each cell population is shown in Fig. 5B. There was no significant difference

between the viral DNA levels in tested cell populations at 7 DPI. At 14 DPI, the amount of

PCV2 DNA in B lymphocytes and monocytes was significantly increased compared to the

level in T lymphocytes (P<0.05), whereas the amount of viral DNA was significantly higher

in monocytes than either lymphocyte population at 21 DPI (P=0.001).

Evaluation of Histopathology and Immunohistochemistry

No clinical signs of disease were detected in any of the pigs throughout the study

period. There were no microscopic lesions consistent with PCV2 infection in the tissues

collected from the negative pigs at any point throughout the study. The mean microscopic

lesion scores in the collected tissue samples from PCV2 infected pigs are summarized in

Table 1. Microscopic lesions characterized by lymphoid depletion of follicles with

macrophage infiltration were observed in BLN, ILN, and tonsils from 2 of 3 of the infected

pigs as early as 7 DPI. At 14 DPI, characteristic microscopic lesions were observed in the liver, BLN, tonsil, lung and ILN from all 3 tested pigs as well as in spleen and kidney from 2 of the 3 necropsied pigs. There was a significant difference (P<0.05) in the severity of PCV2- associated lesions observed in liver at 14 DPI. The severity of PCV2-associated lesions observed in BLN was significantly higher at 14 DPI than at 21 DPI. No microscopic lesions

were observed in the lungs at 3 and 7 DPI whereas the lung lesion score was high at 14 DPI.

The lesion scores of spleen, kidney, tonsil and ILN from infected pigs showed no significant

differences at any time point throughout the trial. No microscopic lesions were observed in

thymus samples from infected pigs at any time.

PCV2 antigen was detected by IHC in BLN and tonsils from 3 pigs, in spleen and

lung from 2 of 3 pigs, and in thymus and ILN from 1 of 3 pigs at 7 DPI. At 14 DPI, PCV2

antigen was detected in liver, BLN, tonsils and lungs from all 3 pigs examined as well as in

thymus, spleen and ILN from 2 of 3 pigs. The PCV2 antigen was still detectable in BLN

from all 3 pigs and in the tonsils from 2 of the 3 pigs at 21 DPI. There was no detection of

PCV2 antigen in kidney samples collected from infected pigs at any time point. There were

no significant differences between the amounts of PCV2 antigen in thymus, spleen, or ILN

collected from infected pigs at any necropsy day. At 14 DPI, the amount of PCV2 antigen in

BLN was significantly (P<0.05) higher than that at 7 or 21 DPI. No immunostaining was

detected in sections of collected tissues from the negative control pigs inoculated with PK-15

cell lysate at any time points.

The correlation was examined between the level of Cap mRNA or viral DNA and the

amount of PCV2 antigen within each tested tissue except kidney in which no PCV2 antigen

was detected. Strong correlations were revealed between the level of Cap mRNA and PCV2

antigen in liver (r=0.82, P=0.001), BLN (r=0.73, P=0.007), spleen (r=0.82, P=0.001), lung 83

(r=0.84, P=0.001), tonsil (r=0.87, P=0.0002), and ILN (r=0.71, P=0.009) but not in thymus

(r=0.52, P=0.08). Strong correlations were also revealed between the level of PCV2 DNA and PCV2 antigen in liver (r=0.75, P=0.0046), thymus (r=0.59, P=0.04), BLN (r=0.90, f<0.0001), spleen (r=0.67, P=0.017), lung (r=0.88, P=0.0002), and tonsil (r=0.92, P<0.0001) but not in ILN (r=0.53, P=0.07). Except in the kidney tissues where no PCV2 antigen was detected, strong correlations were revealed between the level of PCV2 DNA in serum or in

PBMCs and the amount of PCV2 antigens in all tested tissues, whereas no correlation was found between the level of Cap mRNA in PBMCs and the amount of PCV2 antigens in

thymus, spleen or ILN (data not shown).

Antibody response against PCV2

Upon arrival, all pigs had maternal antibodies to PCV2 which decayed gradually.

PCV2 inoculum was administered to 12 pigs at 4 weeks of age when antibody levels in those

pigs were negative for PCV2 by ELISA using a positive cut-off level (S/P ratio 0.2)

(Nawagitgul et al., 2002). The remaining 12 pigs with antibody levels above the cut-off level

were placed in the negative control group and sham-infected. At 3 DPI, serum samples from

the negative control pigs were still PCV2 antibody positive, but all pigs were seronegative by

7 DPI and remained negative for PCV2 antibody until the completion of the study. No

seroconversion to PCV2 was observed in infected pigs until 21 DPI, the last day of this

experiment (data not shown).

An ELISA assay was performed to detect PCV2-specific antibodies in BAL. No

significant differences in the PCV2-specific IgG level in BAL fluid were detected between

the PCV2 infected group and the negative control group at any time throughout the trial (data

not shown). As shown in Fig. 6, the PCV2-specific IgM antibody levels were increased from 84

7 DPI in BAL fluid from infected pigs and the levels were significantly higher compared to the negative control pigs at 14 and 21 DPI. The level of PCV2-specific IgM antibodies was significantly higher in BAL from control pigs than from infected pigs at 3 DPI. This may be due to the effect of remaining maternal antibody in those pigs. Similar findings were observed with PCV2-specific IgA antibodies at 3 DPI, with the negative control group having higher levels than the infected group. The PCV2-specific IgA antibody levels in BAL fluid were increased in the infected group at 14 DPI, although no statistical difference was

present. At 21 DPI, the level of PCV2-specific IgA antibody was significantly higher in the

BAL fluid from infected pigs compared to the control pigs (Fig. 7).

A strong negative correlation was found between the PCV2-specific IgA antibody

levels and Cap mRNA or viral DNA levels in BAL cells, or the level of PCV2 DNA in cell-

free BAL fluid from infected pigs at 14 DPI. A strong negative correlation was also found

between the PCV2-specific IgM antibody level and the level of PCV2 DNA in BAL cells or

the cell-free BAL fluid from infected pigs at 21 DPI.

Discussion

The goal of this study was to investigate PCV2 infection and replication early in

infection and identify cell populations that are permissive for PCV2 replication in vivo. This

study was performed on conventional pigs that had been inoculated with PCV2 by the

intranasal route, which is potentially a common route of exposure of young swine

(Calsamiglia et al., 2002; Shibata et al., 2003; Yang et al., 2003). In an earlier study, a

sensitive real-time RT-PCR assay was developed that enabled quantification ofPCV2 Cap

mRNA in infected PBMCs in vitro (Yu, et al., 2004). The results of this earlier study

demonstrated that it was feasible to discriminate between replicating PCV2 and PCV2 85 virions. In the present study, viral replication was measured in multiple tissues and cells recovered from experimentally infected pigs at 3, 7, 14, and 21 DPI.

The results of this study determined that the level of viral DNA and the amount of

Cap mRNA differed dramatically between tissues obtained from the same pig. Analysis of

BLN samples consistently provided the highest yield of the Cap transcript and consistently

higher levels of viral DNA than any other tissues tested at 7, 14, or 21 DPI. Because the pigs

were inoculated using the intranasal route, BLN would be the lymphoid tissue closest to the

inoculation site assessed in this study and as a result, had higher levels of both Cap mRNA

and viral DNA levels compared to the more distant ILN. In addition, the amount of Cap

mRNA in BLN samples peaked at 7 DPI while levels of Cap mRNA or viral DNA in ILN

were greatest at 14 DPI. At 21 DPI, Cap mRNA was no longer detectable in the ILN while

the amount of the Cap mRNA remained at a moderate high level in BLN. These findings

suggested that the PCV2 begins replication in the lymph nodes nearest the site of infection

and then spreads systemically. Moreover, the results of this study suggested that the lymph

nodes near the infection site may play an important role in PCV2 persistence in the infected

host.

Though viral DNA was detected in the thymus and there was positive staining by IHC

for PCV2 antigen at 7 and 14 DPI, the amplification of the Cap mRNA was only detected

from one infected pig at a statistically significantly reduced level at 14 DPI (P<0.05). These

results indicate that the thymus may not be an important site for PCV2 replication. This is in

contrast to an earlier study using 1-day old colostrum-deprived piglets that had been

experimentally infected by oral/nasal and intravenous (IV) routes found that thymus was the

primary site of PCV2 antigen detection (Allan et al., 1995). The differences observed 86 between that study and the data presented here may have been due to the IV challenge route in their study or due to differences in ages of the pigs, with the pigs in the present study being

4-5 weeks of age and from a conventional farm source. Another PCV2 and porcine

parvovirus co-infection study also demonstrated that the thymus, like other lymph nodes and

tonsil was the primary detection site of PCV2 DNA in co-infected 4-week old pigs by ISH

(Kim et al., 2003). Whether the virus can replicate in thymic cells under certain conditions

and why PCV2 antigen and DNA were detected there needs to be further investigated.

Assessment of PCV2 replication and viral DNA levels systemically was determined

by evaluating serum and PBMCs at 2,6, 13 and 20 DPI. It was demonstrated that Cap

mRNA was detected in PBMCs only at 13 DPI, while the viral DNA was detected earlier at 6

DPI. In addition, the level of viral DNA was significantly higher at 13 DPI compared with

the levels at 6 or 20 DPI. As the Cap mRNA is the replication product of PCV2, this data

indicates that PCV2 is able to replicate in PBMCs in vivo, though it may be a transient

process. These findings suggest that PBMCs may not be a major site for PCV2 replication

but may play an important role in viral dissemination. In this study, PCV2 DNA levels in

serum and the amount of viral DNA and Cap mRNA in PBMCs correlated well with the

amount of viral DNA in all tested tissues. These findings are important as high levels of

PCV2 appear to be crucial in the pathogenesis of PMWS (Allan et al., 2000b; Krakowka et

al., 2005). In the present study, it was shown that the Cap mRNA in PBMCs was only

detected when the microscopic lesions were most severe and the highest levels PCV2

antigens were present in tissues. Therefore, these findings suggest that the detection of PCV2

Cap mRNA in PBMCs from infected pigs may be predictive of disease progression in vivo. PCV2 capsid antigens have been described in the cytoplasm of monocytes and alveolar macrophages (Allan et al., 1994). It has been questioned whether this signal was due to transcription of the viral genome or due to accumulation of virus present in other cell populations that was taken up by phagocytosis. Previous in vitro studies demonstrated that

PAMs may not be a primary cell type for PCV2 replication (Gilpin et al., 2003; Meerts et al.,

2005). In contrast to their findings, Cap mRNA was detected in BAL cells as early as 3 DPI

from a pig which had a high level of the transcription product in lung tissue in the present

study. Over time, the levels increased and remained high throughout the period of the study.

A similar trend was observed with the levels of PCV2 DNA in BAL cells. Because cells from

BAL consisted of greater than 90% pulmonary alveolar macrophages (PAMs) (Ganter and

Hensel, 1997), PAMs appears to be an important cell type for PCV2 replication in infected

pigs under certain conditions. However, the ability to detect high levels of PCV2 DNA and

its replication product in BAL cells in our study needs further investigation, especially under

different stimulation factors of PCV2 infection in vivo.

PCV2 replication was assessed in specific lymphocyte and monocyte populations

separated from PBMCs collected at 13 DPI or from BLN mononuclear cells at 7, 14, and 21

DPI from infected pigs. In contrast to previous findings that lymphocytes appear not to be the

primary site for PCV2 replication (Allan and Ellis, 2000; Gilpin et al., 2003; Rosell et al.,

1999), the results of this study demonstrate that T and B lymphocytes are important cell

populations that support PCV2 replication. These in vivo results support an earlier in vitro

study in which it was demonstrated that PCV2 replicated in lymphocytes under ConA

stimulation (Yu et al., 2004). In the present study, it was demonstrated that as the Cap mRNA

and viral DNA levels in the lymphocytes from BLN mononuclear cells decreased at 21 DPI, 88 the level of viral DNA in monocytes remained consistent and as a result these cells become the cell population with the highest amount of PCV2 DNA. These findings suggest that while the lymphocytes appear to be primary sites for PCV2 replication, the monocytes may be the site for PCV2 persistence in the infected host.

Previous studies have suggested there is an immunosuppressive feature associated

with PMWS due to the lack of response to antibiotic therapy in systemic and/or pulmonary

bacterial infections in PMWS affected farms (Segales et al., 2004a; Segales et al., 1997) as

well as infections with unusual swine pathogens, such as Pneumocystis carinii (Darwich et

al., 2004), Chlamydia spp. Aspergillus spp and Cryptosporidium parvum (Carrasco et al.,

2000; Clark, 1997; Ellis et al., 1998; Nunez et al., 2003; Segales et al., 2004a). Furthermore,

pathologie, immunohistologic, and flow cytometric studies have shown that lymphocyte

depletion of follicular and interfollicular areas, together with macrophage infiltration of

lymphoid tissues presented as a unique lesion observed in PMWS affected pigs (Chianini et

al., 2003; Clark, 1997; Darwich et al., 2002; Quintana et al., 2001; Rosell et al., 1999; Sarli et

al., 2001; Shibahara et al., 2000) and is highly correlated with a decrease in circulating B and

T cells (Darwich et al., 2002; Nielsen et al., 2003; Segales et al., 2000). Like chicken anemia

virus, classical swine fever virus, porcine reproductive and respiratory syndrome virus

(PRRSV) and the human immunodeficiency virus (HIV), all of which infect immune cells

and cause immunosuppression in the infected host (Markowski-Grimsrud and Schat, 2003;

Pauly et al., 1998; Shellito, 2004), the present observations demonstrating that PCV2

infection and active replication in immune cell populations suggest a similar pathogenic

mechanism by which PCV2 may induce immunosuppression that has been associated with

PMWS. 89

The absence of clinical signs in the PCV2 inoculated pigs in this study indicates that the PCV2 infection alone was subclinical and suggests that an additional factor is needed for the reproduction of PMWS disease. Similar findings have been observed in a number of earlier studies indicating that the co-factors such as porcine parvovirus (PPV), PRRSV,

Mycoplasma hyopneumoniae, or immunostimulating factors are needed to develop the full spectrum of clinical PWMS (Allan et al., 2000a; Harms et al., 2001; Kennedy et al., 2000;

Krakowka et al., 2001; Krakowka et al., 2000; Kyriakis et al., 2002; Opriessnig et al., 2003;

Rovira et al., 2002 ). Several studies have demonstrated that there is a correlation between

the amount of PCV2 antigen or genetic material detected in the tissue and the severity of the

lymphoid depletion associated with PMWS (Chianini et al., 2003; Darwich et al., 2002;

Rosell et al., 1999). However, this correlation was only demonstrated for samples from BLN

and liver and was not demonstrable for samples from other tissues analyzed in this study.

These results may be due to the lack of an additional factor. Thus, the amount of virus

detected in PCV2 infected pigs was less than what has been reported in pigs with clinical

PMWS. In contrast to the previous study in which the ILN had more severe lesions compared

to other lymphoid tissues in field affected-PMWS pigs (Calsamiglia et al., 2002; Sarli et al.,

2001), an increased severity of lesions was demonstrated in BLN which was the lymph node

closest to the inoculation site. Whether PCV2 replication and persistence is related to the

exposure area or the active status of local lymph node needs to be further studied.

With exception of the kidneys in which no PCV2 antigens were detected and the

thymus, which lacked the replication product in this study, there were strong correlations

between the level of Cap mRNA and the level of viral DNA or the amount of PCV2 antigen. 90

In addition, a strong correlation was observed between the level of viral DNA and PCV2 antigen in liver, thymus, BLN, spleen, lung, and tonsil but not in ILN.

In this study, no seroconversion occurred in PCV2 infected pigs at 2, 6, 13, or 20

DPI. No significant difference was detected in the IgG level in BAL fluid between the PCV2 infected group and the negative control group over time. However, PCV2-specific IgA and

IgM were detected in BAL fluid at 14 and 21 DPI. In addition, a strong negative correlation was found between the level of IgA antibody and the amount of Cap mRNA or viral DNA in

BAL cells, or the level of PCV2 DNA in cell-free BAL fluid at 14 DPI. A strong negative correlation was also found between the IgM antibody levels and the level of PCV2 DNA in

BAL cells or the BAL cell-free fluid from infected pigs at 21 DPI. These findings suggest

that the IgG response to PCV2 occurs late in the infection process and the local antibody

responses (e.g., IgA and IgM), but not systemic IgG may be important in controlling PCV2

during early infection. In our study, higher levels of IgA and IgM in BAL were observed in

the negative control pigs at 3 DPI and may be attributed to maternal antibodies. As antibody

levels in the negative control pigs continued to decrease over time, the PCV2-specific IgA

and IgM antibody levels in the infected pigs began to increase after 7 DPI. The presence of

PCV2-specific IgA and IgM in the BAL associated with maternal antibodies may play a role

in their reported protection in young pigs {Allan, 2002 #334}.

The results of this study demonstrated that PCV2 replication as measured by Cap

mRNA occurs in multiple tissues but with highest levels in BLN of pigs in the early stages of

infection. There was a strong correlation between the level of this transcript and viral DNA

levels in all tested tissues except the thymus in which no Cap mRNA was detected at 3, 7 and

21 DPI. In addition, we demonstrated that it was possible to detect PCV2 Cap mRNA in 91

PBMCs from infected pigs which may indicate active viral replication in these cells in vivo.

More importantly, the results of this study confirmed the earlier findings that PCV2 replicates in T lymphocytes and further demonstrated that B cells appear to be the primary site for PCV2 replication during early infection (Yu et al., 2004). The present findings will

increase our knowledge of the cell populations and tissues in which PCV2 replicated

following challenge and further the understanding of the pathogenesis of PCV2 infection.

Acknowledgements

The authors would like to thanks Dr. Xiang-Jin Meng from Virginia Polytechnic

Institute and State University for supplying the PCV2 plasmid DNA, and Wasin

Charerntantanakul for giving some advice on the statistical analysis of the data. This work

was supported by the Healthy Livestock Initiative fund.

References

Allan, G.M., Ellis, J.A., 2000, Porcine circoviruses: a review. J Vet Diagn Invest 12, 3-14. Allan, G.M., Me Neilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A., Charreyre, C.E., 1999, Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland. Vet Microbiol 66, 115-123. Allan, G.M., McNeilly, F., Cassidy, J.P., Reilly, G.A., Adair, B., Ellis, W.A., McNulty, M.S., 1995, Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Vet Microbiol 44, 49-64. Allan, G.M., McNeilly, F., Foster, J.C., Adair, B.M., 1994, Infection of leucocyte cell cultures derived from different species with pig circovirus. Vet Microbiol 41, 267- 279. Allan, G.M., McNeilly, F., Kennedy, S., Meehan, B., Ellis, J., Krakowka, S., 2000a, Immunostimulation, PCV-2 and PMWS. Vet Rec 147, 170-171. Allan, G.M., McNeilly, F., Meehan, B.M., Ellis, J.A., Connor, T.J., McNair, I., Krakowka, S., Kennedy, S., 2000b, A sequential study of experimental infection of pigs with porcine circovirus and porcine parvovirus: immunostaining of cryostat sections and virus isolation. J Vet Med B Infect Dis Vet Public Health 47, 81-94. Calsamiglia, M., Segales, J., Quintana, J., Rosell, C., Domingo, M., 2002, Detection of porcine circovirus types 1 and 2 in serum and tissue samples of pigs with and without postweaning multisystemic wasting syndrome. J Clin Microbiol 40, 1848-1850. 92

Carrasco, L., Segales, J., Bautista, M.J., Gomez-Villamandos, J.C., Resell, C., Ruiz- Villamor, E., Sierra, M.A., 2000, Intestinal chlamydial infection concurrent with postweaning multisystemic wasting syndrome in pigs. Vet Rec 146, 21-23. Chianini, F., Majo, N., Segales, J., Dominguez, J., Domingo, M., 2003, Immunohistochemical characterisation of PCV2 associate lesions in lymphoid and non-lymphoid tissues of pigs with natural postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 94, 63-75. Clark, E., 1997, Post-weaning multisystemic wasting syndrome. Proceedings of the Western Canadaian Association of Swine Practitioners 28, 499-501. Darwich, L., Segales, J., Domingo, M., Mateu, E., 2002, Changes in CD4(+), CD8(+), CD4(+) CD8(+), and immunoglobulin M-positive peripheral blood mononuclear cells of postweaning multisystemic wasting syndrome-affected pigs and age-matched uninfected wasted and healthy pigs correlate with lesions and porcine circovirus type 2 load in lymphoid tissues. Clin Diagn Lab Immunol 9, 236-242. Darwich, L., Segales, J., Mateu, E., 2004, Pathogenesis of postweaning multisystemic wasting syndrome caused by Porcine circovirus 2: an immune riddle. Arch Virol 149, 857-874. Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D., Haines, D., 1998, Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J 39, 44- 51. Fenaux, M., Halbur, P.G., Haqshenas, G., Royer, R., Thomas, P., Nawagitgul, P., Gill, M., Toth, T.E., Meng, X.J., 2002, Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions. J Virol 76, 541-551. Ganter, M., Hensel, A., 1997, Cellular variables in bronchoalveolar lavage fluids (BALF) in selected healthy pigs. Res Vet Sci 63, 215-217. Gilpin, D.F., McCullough, K., Meehan, B.M., McNeilly, F., McNair, I., Stevenson, L.S., Foster, J.C., Ellis, J.A., Krakowka, S., Adair, B.M., Allan, G.M., 2003, In vitro studies on the infection and replication of porcine circovirus type 2 in cells of the porcine immune system. Vet Immunol Immunopathol 94, 149-161. Harms, P.A., Sorden, S.D., Halbur, P.G., Bolin, S.R., Lager, K.M., Morozov, I., Paul, P.S., 2001, Experimental reproduction of severe disease in CD/CD pigs concurrently infected with type 2 porcine circovirus and porcine reproductive and respiratory syndrome virus. Vet Pathol 38, 528-539. Kennedy, S., Moffett, D., McNeilly, F., Meehan, B., Ellis, J., Krakowka, S., Allan, G.M., 2000, Reproduction of lesions of postweaning multisystemic wasting syndrome by infection of conventional pigs with porcine circovirus type 2 alone or in combination with porcine parvovirus. J Comp Pathol 122, 9-24. Kim, J., Choi, C., Chae, C., 2003, Pathogenesis of postweaning multisystemic wasting syndrome reproduced by co-infection with Korean isolates of porcine circovirus 2 and porcine parvovirus. J Comp Pathol 128, 52-59. 93

Krakowka, S., Ellis, J., McNeilly, F., Waldner, C., Allan, G., 2005, Features of porcine circovirus-2 disease: correlations between lesions, amount and distribution of virus, and clinical outcome. J Vet Diagn Invest 17, 213-222. Krakowka, S., Ellis, J.A., McNeilly, F., Ringler, S., Rings, D.M., Allan, G., 2001, Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2). Vet Pathol 38, 31-42. Krakowka, S., Ellis, J.A., Meehan, B., Kennedy, S., McNeilly, F., Allan, G., 2000, Viral wasting syndrome of swine: experimental reproduction of postweaning multisystemic wasting syndrome in gnotobiotic swine by coinfection with porcine circovirus 2 and porcine parvovirus. Vet Pathol 37, 254-263. Kyriakis, S C., Saoulidis, K., Lekkas, S., Miliotis Ch, C., Papoutsis, P.A., Kennedy, S., 2002, The effects of immuno-modulation on the clinical and pathological expression of postweaning multisystemic wasting syndrome. J Comp Pathol 126, 38-46. Markowski-Grimsrud, C.J., Schat, K.A., 2003, Infection with chicken anaemia virus impairs the generation of pathogen-specific cytotoxic T lymphocytes. Immunology 109, 283- 294. Meehan, B.M., McNeilly, F., Todd, D., Kennedy, S., Jewhurst, V.A., Ellis, J.A., Hassard, L.E., Clark, E.G., Haines, D.M., Allan, G.M., 1998, Characterization of novel circovirus DNAs associated with wasting syndromes in pigs. J Gen Virol 79 ( Pt 9), 2171-2179. Meerts, P., Misinzo, G., McNeilly, F., Nauwynck, H.J., 2005, Replication kinetics of different porcine circovirus 2 strains in PK-15 cells, fetal cardiomyocytes and macrophages. Arch Virol 150, 427-441. Nawagitgul, P., Harms, P.A., Morozov, I., Thacker, B.J., Sorden, S.D., Lekcharoensuk, C., Paul, P.S., 2002, Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. Clin Diagn Lab Immunol 9, 33-40. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D., Paul, P.S., 2000, Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81, 2281-2287. Nielsen, J., Vincent, I.E., Botner, A., Ladekaer-Mikkelsen, A.S., Allan, G., Summerfield, A., McCullough, K.C., 2003, Association of lymphopenia with porcine circovirus type 2 induced postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 92, 97-111. Nunez, A., McNeilly, F., Perea, A., Sanchez-Cordon, P.J., Huerta, B., Allan, G., Carrasco, L., 2003, Coinfection by Cryptosporidium parvum and porcine circovirus type 2 in weaned pigs. J Vet Med B Infect Dis Vet Public Health 50, 255-258. Opriessnig, T., Thacker, E.L., Yu, S., Fenaux, M., Meng, X.J., Halbur, P.G., 2004, Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2. Vet Pathol 41, 624-640. Opriessnig, T., Yu, S., Gallup, J.M., Evans, R.B., Fenaux, M., Pallares, F., Thacker, E.L., Brockus, C.W., Ackermann, M.R., Thomas, P., Meng, X.J., Halbur, P.G., 2003, Effect of vaccination with selective bacterins on conventional pigs infected with type 2 porcine circovirus. Vet Pathol 40, 521-529. 94

Pauly, T., Konig, M., Thiel, H.J., Saalmuller, A., 1998, Infection with classical swine fever virus: effects on phenotype and immune responsiveness of porcine T lymphocytes. J Gen Virol 79 ( Pt 1), 31-40. Quintana, J., Segales, J., Rosell, C., Calsamiglia, M., Rodriguez-Arrioja, G.M., Chianini, F., Folch, J.M., Maldonado, J., Canal, M., Plana-Duran, J., Domingo, M., 2001, Clinical and pathological observations on pigs with postweaning multisystemic wasting syndrome. Vet Rec 149, 357-361. Rosell, C., Segales, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioja, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S., Domingo, M., 1999, Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120, 59-78. Rovira, A., Balasch, M., Segales, J., Garcia, L., Plana-Duran, J., Rosell, C., Ellerbrok, H., Mankertz, A., Domingo, M., 2002, Experimental inoculation of conventional pigs with porcine reproductive and respiratory syndrome virus and porcine circovirus 2. J Virol 76, 3232-3239. Sarli, G., Mandrioli, L., Laurenti, M., Sidoli, L., Cerati, C., Rolla, G., Marcato, P.S., 2001, Immunohistochemical characterisation of the lymph node reaction in pig post­ weaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 83, 53-67. Segales, J., Domingo, M., Chianini, F., Majo, N., Domi, nguez, J., Darwich, L., Mateu, E., 2004a, Immunosuppression in postweaning multisystemic wasting syndrome affected pigs. Vet Microbiol 98, 151-158. Segales, J., Pastor, J., Cuenca, R., Domingo, M., 2000, Haematological parameters in postweaning multisystemic wasting syndrome-affected pigs. Vet Rec 146, 675-676. Segales, J., Rosell, C., Domingo, M., 2004b, Pathological findings associated with naturally acquired porcine circovirus type 2 associated disease. Vet Microbiol 98, 137-149. Segales, J., Sitjar, M., Domingo, M., Dee, S., Del Pozo, M., Noval, R., Sacristan, C., De las Fieras, A., Ferro, A., Latimer, K.S., 1997, First report of post-weaning multisystemic wasting syndrome in pigs in Spain. Vet Rec 141, 600-601. Shellito, J.E., 2004, Failure of host defenses in human immunodeficiency virus. Semin Respir Crit Care Med 25, 73-84. Shibahara, T., Sato, K., Ishikawa, Y., Kadota, K., 2000, Porcine circovirus induces B lymphocyte depletion in pigs with wasting disease syndrome. J Vet Med Sci 62, 1125-1131. Shibata, I., Okuda, Y., Yazawa, S., Ono, M., Sasaki, T., Itagaki, M., Nakajima, N., Okabe, Y., Hidejima, I., 2003, PCR detection of Porcine circovirus type 2 DNA in whole blood, serum, oropharyngeal swab, nasal swab, and feces from experimentally infected pigs and field cases. J Vet Med Sci 65, 405-408. Sorden, S.D., Harms, P.A., Nawagitgul, P., Cavanaugh, D., Paul, P.S., 1999, Development of a polyclonal-antibody-based immunohistochemical method for the detection of type 2 porcine circovirus in formalin-fixed, paraffin-embedded tissue. J Vet Diagn Invest 11, 528-530. 95

Waters, W.R., Hontecillas, R., Sacco, R.E., Zuckermann, F.A., Harkins, K.R., Bassaganya- Riera, J., Wannemuehler, M.J., 2000, Antigen-specific proliferation of porcine CDSalphaalpha cells to an extracellular bacterial pathogen. Immunology 101, 333- 341. Yang, J.S., Song, D.S., Kim, S.Y., Lyoo, K.S., Park, B.K., 2003, Detection of porcine circovirus type 2 in feces of pigs with or without enteric disease by polymerase chain reaction. J Vet Diagn Invest 15, 369-373. Yu, S., Vincent, A. Opriessnig, T.Carpenter,S. Kitikoon, P. Halbur, P.O. Thacker, E., 2004, In vitro studies on the use of a quantitative real-time RT-PCR assay to detect PCV2 replication in peripheral blood mononuclear cells (PBMCs). the 18th Congress of the International Pig Veterinary Society. 96

Table 1. Microscopic lesions of tissue samples in PCV2 infected pigs at 3, 7, 14 and 21 days post-infection (DPI).

DPI liver thymus BLN spleen kidney tonsil lung ILN

~3 0.33±0.58b O.OOiO.OO 0.67±0.58b 0.00+0.00 O.OOiO.OO 0.33±0.58 0.00±0.00b I.OOiO.OO

7 0.33+0.58" O.OOiO.OO 1.33i1.15ab O.OOiO.OO O.OOiO.OO 0.67i0.58 O.OOiO.OO" 0.66i0.58

14 1.67i0.58a O.OOiO.OO 3.00i0.00a 0.67i0.58 0.67i0.58 I.OOiO.OO 1.33i0.58a 1.00+0.00

21 O.OOiO.OO" O.OOiO.OO I.OOiO.OO" 0.33i0.58 O.OOiO.OO O.OOiO.OO 0.33i0.58a" 0.33+0.58

Tissue samples are bronchial lymph nodes (BLN), superficial inguinal lymph nodes (ILN),

kidney, liver, lung, spleen, thymus, and tonsil.

Different superscripts (a, b) within each column indicate that values in mean score within

infection group for each DPI was significantly different (P<0.05).

Values are presented as mean score ± standard deviation. Scoring: 0 = normal; 1 = mild; 2 =

moderate; 3 = severe. 97

Table 2. Immunohistochemical analysis of tissue samples from infected pigs for the presence of PCV2 antigen.

DPI liver thymus BLN spleen kidney tonsil lung ILN

3 O.OOiO.OO O.OOiO.OO 0.00i0.00c 0.00+0.00 O.OOiO.OO O.OOiO.OO" 0.00+0.00" O.OOiO.OO

7 O.OOiO.OO 0.3310.57 1.67+0.58" 0.67i0.58 0.00+0.00 1.00i0.00a" 0.67i0.58a" 0.33i0.58

14 I.OOiO.OO 0.66i0.57 3.00i0.00a 0.67i0.58 O.OOiO.OO 1.67+0.58a 1.33i0.58a 0.67+0.58

21 O.OOiO.OO O.OOiO.OO 1.67+0.58" O.OOiO.OO O.OOiO.OO 0.67+0.58a" O.OOiO.OO" O.OOiO.OO

Tissue samples are bronchial lymph nodes (BLN), superficial inguinal lymph nodes (ILN),

kidney, liver, lung, spleen, thymus, and tonsil from PCV2 infected 4-week-old conventional

pigs at 3, 7,14 and 21 days post-infection (DPI).

Different superscripts (a, b, c) within each column indicate that values in mean score within

infection group for each DPI were significantly different (P<0.05).

Values are presented as mean score ± standard deviation. Scoring: ranging from 0 = not

detectable to 3 = strong signal. 98

A)

_ 8 .Q0 ab E xaTb aby h 1 6 ab lX abj | ab ab ab à IfI ab 8 4 bb I ab a „ b T O) - 0 a_E 7 14 21 day post infection

• BLN E ILN Q kidney • liver El lung 0 spleen • thymus • tonsil

B)

in 10

x b|.Jj cd-L- ab abc bed ab t I 7 14 21

day post infection

• BLN • ILN 0 kidney B liver ED lung 0 spleen • thymus • tonsil

Fig. 1. Quantification of PCV2 spliced capsid mRNA (A) and PCV2 DNA (B) in tissue samples from infected pigs at 3, 7, 14 and 21 days post-infection (DPI). Tissue samples are bronchial lymph nodes (BLN), superficial inguinal lymph nodes (ILN), kidney, liver, lung, spleen, thymus, and tonsil. Averages with different letters (a, b, c) within the tissues at each

DPI are statistically different by least significant difference (P<0.05). Values in Fig. 1A are expressed as logarithm of PCV2 spliced capsid mRNA copies/mg of tissue. Values in Fig. IB are expressed as logarithm of PCV2 DNA copies/mg of tissue. 99

day post infection

Fig. 2. Quantification of PCV2 DNA in cell-free bronchoalveolar lavage (BAL) fluid or BAL cells, and PCV2 spliced capsid mRNA in BAL cells. Averages with different letters (a, b) within the levels of nucleic acid products in tested samples at each DPI are statistically different by least significant difference (-P<0.05). Values are expressed as logarithm of PCV2

DNA copies/ml of BAL fluid, or 106 cells and as logarithm of PCV2 spliced capsid mRNA copies/106 cells. 100

il 6 13 20 day post infection

• PBMCs DNA M PBMCs RNA • Serum DNA

Fig. 3. Quantification of PCV2 DNA in serum or peripheral blood mononuclear cells

(PBMCs), and PCV2 spliced capsid mRNA in PBMCs. Averages with different letters (a, b) within the levels of nucleic acid products in tested samples tissues at each DPI are statistically different by least significant difference (P<0.05). Values are expressed as logarithm of PCV2 DNA copies/ml of serum, mg of tissue or 106 cells and as logarithm of

PCV2 spliced capsid mRNA copies/10 cells. 101

a F-C C ab

iMT B 1 Mono+ cell population

i I ORNA m DNA

Fig. 4. Quantification of PCV2 spliced capsid mRNA and viral DNA in purified cell populations from peripheral blood mononuclear cells (PBMCs) from infected pigs at 13 days post-infection (DPI). Purified cell populations are T lymphocytes (T), B lymphocytes (B), and monocytes (Mono+). Averages with different letters (a, b) within the cell fractions are statistically different (P<0.05). Values are expressed as logarithm of PCV2 DNA copies/106 cells and logarithm of PCV2 spliced capsid mRNA copies/106 cells. 102

A)

>. 10 n o 8 i ————————b———b— - ïs 6. rMm—rDm ab, î m ï i 4 — •• M rM

— o ——^—i———i——^—. 7 14 21 day post-infection

•T BB BMono+

B)

day post-infection

I • T • B • Mono+

Fig. 5. Quantification of PCV2 spliced capsid mRNA (A) and PCV2 DNA (B) in purified

cell populations from bronchial lymph node mononuclear cells from infected pigs. Purified

cell populations are T lymphocytes (T), B lymphocytes (B) and monocytes (Mono+).

Averages with different letters (a, b) within the cell fractions at each day post-infection (DPI)

are statistically different by least significant difference (P< 0.05). Values are expressed as

logarithm of PCV2 DNA copies/106 cells and logarithm of PCV2 spliced capsid mRNA

copies/106 cells. 103

0.5

«u 0.4

1 0.3 QO o 0.2 O)eu 2 1

-0.1

day post-infection

- • - PCV2 infected • Negative control

Fig. 6. Comparison of PCV2 specific IgM antibody levels in bronchoalveolar lavage fluid from PCV2 infected and non-infected groups. Samples are collected at 3, 7, 14 and 21 days post-infection (DPI). The symbol * represents significant difference between PCV2 infected group and negative control group within each DPI at P0.05.

> 0.5 a O 0.4 o a>D) 2 g ro 0.1

7 14 21 day post-infection

PCV2 infected • Negative control

Fig. 7. Comparison of PCV2 specific IgA antibody levels in bronchoalveolar lavage fluid from PCV2 infected and non-infected groups. Samples are collected at 3, 7, 14 and 21 day post-infection (DPI). The symbol * represents significant difference PCV2 infected group and negative control group within each DPI at P<0.05. 104

CHAPTER 5. THE EFFECTS OF PCV2 INFECTION AND

REPLICATION ON ACTIVATED PORCINE PERIPHERAL BLOOD

MONONUCLEAR CELLS IN VITRO AND THE RELATIONSHIP

BETWEEN PCV2 REPLICATION AND CELLULAR PROLIFERATION

A paper to be submitted to Veterinary Research

S. Yua, P. G. Halburb, E. Thacker3

^Department of Veterinary Microbiology and Preventive Medicine College of Veterinary

Medicine, Iowa State University, Ames. IA. ^Department of Veterinary Diagnostic and

Production Animal Medicine, College of Veterinary Medicine, Iowa State University, Ames.

IA.

Abstract

This study was to examine the effect of porcine circovirus type 2 (PCV2) infection and replication on peripheral blood mononuclear cells (PBMCs) in the presence of the mitogens, concanavalin A (ConA) or pokeweed mitogen (PWM) in vitro as well as the relationship between PCV2 replication and cell proliferation. PCV2 replication, cell viability and stimulation, and apoptosis indices in PCV2 infected PBMCs with or without mitogen stimulation were measured. The data showed that mitogen stimulation increased viral replication. PCV2 infection did not affect the ability of PBMCs to proliferate in response to

ConA or PWM stimulation as no significant differences in proliferation occurred in PCV2 infected PBMCs with different stimuli in vitro. Increased apoptosis was associated with

PCV2 infection in PWM stimulated PBMCs. Interestingly, a significantly lower apoptotic index (AI) was observed in PCV2 infected PBMCs compared to non-infected cells in the 105 absence of mitogens. No significant differences were observed in the levels of PCV2 replication product, the spliced capsid mRNA (Cap mRNA), in PBMCs stimulated with

ConA for 12, 36, and 72 hours prior to infection. It was also demonstrated that there was no significant differences in the amount of Cap mRNA in ConA or PWM stimulated proliferating PBMCs compared to non-proliferating cells. In conclusion, the findings of this study indicated that PCV2 replication increases with cell stimulation and apoptosis increased with PCV2 infection under certain stimulation conditions. In addition, our results suggest that

PCV2 needs a specific stimulation/trigger to enhance viral replication, which is not

dependent on cell division and proliferation.

Keywords: PCV2; Peripheral blood mononuclear cells; Proliferation; Apoptosis

Introduction

Porcine circovirus type 2 (PCV2) is a virus in the Circoviridae family and is the

cause of postweaning multisystemic wasting syndrome (PMWS) [30, 6], Lesions associated

with PCV2 infection are characterized by lymphocyte depletion of follicular and

interfollicular areas together with macrophage infiltration of lymphoid tissues [1], These

findings are highly correlated with a decrease in circulating B and T cells and reduced

numbers of lymphocytes in lymphoid organs [8, 10, 22, 27, 32, 33].

A decrease in the number of B lymphocytes and high number of apoptotic B

lymphocytes along with macrophages containing PCV2 antigen and virions have been

reported in lymphoid tissues of pigs with clinical disease consistent with PMWS [33]. This

study suggested that PCV2 infection induces apoptosis in B lymphocytes, followed by

phagocytosis by macrophages resulting in lymphoid depletion. However, other studies appear

to contradict these results by finding reduced levels of apoptosis in the B-cell areas of 106 lymphoid tissues of PMWS affected pigs compared to healthy non-PCV2 infected pigs [25].

Apoptosis associated with systemic viral diseases can be attributed to pyrexia in addition to the direct or indirect effects of viruses on target cells [16]. Decreased cell proliferation and not increased apoptosis appeared to be an important factor in the depletion of cells in

lymphoid tissues from PMWS-affected pigs under field conditions [20]. Research has

suggested that vaccination and stimulation of an immune response by antigens or adjuvants

may predispose pigs to PMWS [15, 17, 18]. Vaccination or any stimulation of the immune

system could stimulate lymphocytes to proliferate and enhance the replication of PCV2 in

lymphocytes as they divide. These conflicting theories make the pathogenesis of the

lymphoid depletion associated with PCV2 infection confusing. Several studies have

demonstrated a correlation between the amount of PCV2 antigen or genetic material detected

in tissues and the severity of the lymphoid depletion [8, 10, 26]. A recent study in our

laboratory demonstrated that PCV2 replication in infected PBMCs was significantly

increased when PBMCs were stimulated with ConA compared to unstimulated PBMCs [39].

The aim of this study was to evaluate the effect of PCV2 infection on activated porcine

PBMCs in vitro by measuring proliferation, cell viability and apoptosis as well as the level of

PCV2 replication and cellular proliferation. Previous study showed that PCV2 spliced capsid

mRNA (Cap mRNA) increases in a time dependent manner during PCV2 replication in PK-

15 cells [7]. Previously, it was demonstrated that PCV2 Cap mRNA can be used as a measure

of PCV2 replication [38, 39]. A real-time reverse transcription polymerase chain reaction

(RT-PCR) assay to detect PCV2 Cap mRNA was used to assess viral replication in PBMCs

in vitro in this study. Understanding the impact of PCV2 infection on stimulated immune

cells will increase our knowledge of the pathogenesis of PCV2 infection. 107

Materials and methods

Preparation of PCV2

PCV2 isolate 40895 (GenBank Accession No. AF264042) previously shown to induce PMWS in pigs [13] and passaged in PK-15 cells was used in this study. The titer of the virus was lxlO4 50% tissue culture infectious dose (TCID5o)/ml as determined by

titration on PK-15 cells using an immunofluorescence assay (IFA) [13]. All PK-15 cells used

in this study were confirmed to be PCV-free [13].

Experimental design

To prepare PBMCs, blood samples were collected by jugular venipuncture in

heparinized tubes from four healthy PCV2-negative crossbred pigs. The PBMCs were

isolated by density gradient centrifugation [37] followed by labeling with 5-(and-6)-

carboxyfluorescein diacetate, succinimidyl ester (CFSE) (Molecular Probes, Carlsbad, CA), a

cytoplasmic dye that is used to measure cell division as described previously [19] with

modifications. Briefly, 1 xlO6 PBMCs suspension from each pig was centrifuged in a 15-ml

conical tube. The supernatant was decanted, and the pellet resuspended in 1 ml of sterile

phosphate-buffered saline (PBS). One ml of CFSE at a concentration of 2.0 p.m was added to

each tube and vortexed. Cells were incubated at room temperature for 5 min with periodic

mixing and sterile PBS was added to bring the final volume to 10 ml following the addition

of 0.5 ml of fetal bovine serum (FBS) to each tube to absorb excess CFSE. The cells were

centrifuged for 10 min at 4 °C to remove the FBS from the media. Cells were resuspended in

10 ml of complete media consisting of RPMI 1640 supplemented with 10% fetal calf serum,

0.05 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1% non-essential

amino acids lOOx (GibcoBRL, Life Technologies, Carlsbad, CA), and 2 mM L-glutamine 108

(Sigma, St. louis, MO) followed by centrifuging and resuspension in 500 p.1 complete media.

Following CFSE labeling, cells were counted, infected with PCV2 at a multiplicity of infection (MOI) of 0.1 for one hour and incubated in 96-well plate with or without ConA (5

Hg/ml) or PWM (10 |_ig/ml). Control cells were treated identically without the addition of

PCV2 and/or mitogen. Cells were harvested at 3 and 5 days post-infection (DPI) and were enumerated after the addition of a non-enzymatic cell dissociation solution (Sigma-Aldrich,

St. Louis, MO). Cell viability was determined using trypan blue exclusion. An aliquot containing 2xl05 viable cells/sample was centrifuged and the cell pellet was suspended in

200 |al RNAlater (Ambion, Austin, TX) and used for total RNA isolation.

Lymphocyte proliferation of CFSE-labeled PBMCs infected with PCV2 was assessed

with or without mitogen stimulation. CFSE-labeled PBMCs were harvested at 3 and 5 days

following stimulation with ConA (5 pg/ml) or PWM (10 p.g/ml). Flow cytometry was used to

detect CFSE intensity as previously described [21, 14]. ModFit software (Verity Software

House, Topsham, ME) was used to analyze the CSFE intensity of cells to determine the cell

proliferation index. PBMCs from each pig incubated with medium alone were used as the

negative control. The stimulation index was calculated by sample proliferation

index/negative control proliferation index.

To determine cell viability and apoptosis index in PCV2 infected PBMCs stimulated

with ConA or PWM, PBMCs were cultured with each mitogen as described above and

harvested at 3 and 5 DPI. The cells were washed and simultaneously labeled with FITC-

Annexin V (AN) (BD Biosciences Pharmingen, San Jose, CA) and 7-amino-actinomycin D

(7AAD) (BD Biosciences Pharmingen, San Jose, CA) according to the company's protocol.

Flow cytometric analysis of labeled cells was performed in a FACScan (Becton-Dickinson, 109

Franklin Lakes, NJ) using CellQuest (BD Biosciences, San Jose, CA). The AN-/7AAD-,

AN+/7AAD-, and AN+/7AAD+ populations have been found to correspond to live cells, early apoptotic cells and late apoptotic and necrotic cells, respectively [34]. The apoptotic

index (AI) was calculated as follows: (% of Annexin V+ cells) / (% of Annexin V- cells) +

(% of Annexin V+ cells) when cells are gated by 7AAD negative staining.

To determine whether cellular proliferation increases PCV2 replication, PBMCs were

stimulated with ConA (5 |ig/ml) for 12, 36, and 72 hours prior to inoculation with PCV2 at a

MOI of 0.1. The cells were counted and viability assessed by trypan blue exclusion at 24

hours post-infection (HPI). An aliquot of lxlO6 viable cells was centrifuged and the pellet

suspended in 200 JJ.1 RNAlater for total RNA isolation.

To determine the effect cell proliferation has on PCV2 replication, PBMCs were

isolated and labeled with CFSE as described above. The CFSE labeled, PCV2 infected cell

samples were harvested at 5 days post ConA or PWM stimulation. Proliferated cells (low

CFSE intensity) and the non-proliferated cells (high CFSE intensity) were collected

separately within the live cell gate using an EPICS ALTRA flow cytometer (Beckman

Coulter, Miami, FL) at the Iowa State University cell facility. Each cell fraction (2x105

cells/sample) was centrifuged and the pellet suspended in 200 JJ.1 RNAlater for total RNA

isolation.

Total RNA extraction

Total RNA was extracted using the Versagene total RNA purification kit (Centra

Systems, Minneapolis, MN) according to the manufacturer's instruction, and solubilized in

70 (il of elution solution. The RNA extracts were stored at -80 °C until real-time RT-PCR

amplification was carried out. 110

Real-time RT-PCR assay

The forward primer (5'-AGATGCCATTTTTCCTTCTC-3'), reverse primer (5'-

GCTCCAC ATT C AAT AACT ATGAC-3') and the probe (5'-/56-

FAM/TCTTCTTCTGCGGTAACGCCTC/3BHQ1/-3') were used to quantify Cap mRNA of

PCV2 in real-time RT-PCR assay. The probe was labeled with a fluorescent reporter dye, 6- earboxyfluorescein (FAM) at 5' end and a quencher dye, Black Hole Quencher 1 (BHQl) at

3' end. RNA amplification and quantification was performed on Rotor-Gene RG-300

(Corbett Research, Sydney, AU). The reaction mixture was in a 20 |al final volume and the reactions were carried out at 55 °C for 45 min, 95 °C for 10 min; then for 45 cycles at 95 °C for 15 sec and 60 °C for 60 sec. All samples and standard dilutions ranging from 500 to

5*106 copy numbers were run in duplicates. Quantification of PCV2 Cap mRNA was achieved by comparing the threshold cycle (CT) value of the input sample RNA with the CT value of the standard RNA.

Statistical analysis

Data were analyzed by one-way analysis of variance (ANOVA) followed by Tukey-

Kramer multiple comparisons test. P<0.05 was considered to be statistically significant for all test procedures. The correlation of the copy numbers of PCV2 Cap mRNA, stimulation index and apoptosis index were evaluated by nonparametric correlations test, Spearman's

Rho in Multivariate Methods using JMP5.1 (SAS Institute Inc., Cary, NC). Ill

Results

Quantification of the Cap mRNA in PCV2 infected PBMCs stimulated with ConA or

PWM

The levels of Cap mRNA were assessed in PBMCs collected at 3 and 5 DPI (Table

1). The level of Cap mRNA was significantly greater in PBMCs with either ConA or PWM stimulation compared to non-stimulated cells at both time points. No significant differences in the level of Cap mRNA in infected PBMCs were observed between ConA and PWM stimulated cells at 3 DPI. However, the level of Cap mRNA in PWM stimulated cells was significantly greater than in ConA stimulated cells at 5 DPI. No significant differences in the

levels of Cap mRNA were observed between 3 DPI and 5 DPI within each treatment. No Cap

mRNA was detected in non-infected PBMCs with or without ConA or PWM stimulation at

either collection day.

Evaluation of cell proliferation

The ability of PCV2 infected PBMCs to proliferate in response to ConA or PWM

stimulation at 3 and 5 DPI, CFSE intensity was measured and a cell proliferation index

determined. No significant difference in the ability of cells to proliferate was observed

between PCV2 infected and non-infected PBMCs at either time or with either mitogen (Table

2). The stimulation index in PCV2 infected PBMCs with ConA stimulation was greater at 5

days post-stimulation than 3 days, though no significant difference in the index was found in

PCV2 infected PBMCs with PWM stimulation between those two days. No correlation was

found between the copy numbers of PCV2 Cap mRNA and the stimulation index in any

tested cell samples (data not shown). 112

Cell viability and apoptosis analysis

Cell viability and apoptosis were measured using Annexin V and 7 AAD staining. As

shown in Table 3, there were no significant differences in the percentage of live cells

between PCV2 infected and non-infected PBMCs within each treatment group at either 3 or 5

DPI. However, cell viability was significantly lower in PCV2 infected PBMCs stimulated

with PWM compared to cells without stimulation at 3 and 5 DPI or with ConA stimulation at

5 DPI. The results of the apoptotic index from tested samples demonstrated that PWM

stimulated and PCV2 infected cells had a significantly higher apoptotic index compared to

the non-infected PBMCs at 3 and 5 DPI. No significant difference was observed in ConA

stimulated cells (Fig. 2A and Fig. 2B). Without mitogen stimulation, a significantly lower

apoptotic index was detected in PCV2 infected PBMC samples at both 3 and 5 DPI. No

significant correlation was found between the copy numbers of Cap mRNA and the apoptotic

index in tested cell samples (data not shown).

Evaluation of the relationship between PCV2 replication and cellular proliferation

To study the effect of PBMC proliferation on PCV2 replication, the levels of Cap

mRNA were assessed in PBMCs that had been stimulated with ConA for 12, 36, or 72 hours

prior to inoculation of PCV2 for 24 hours. No significant differences were observed in the

levels of Cap mRNA in PBMCs stimulated at any time point prior to PCV2 infection (data

not shown).

To further determine the relationship between cellular proliferation and PCV2

replication, PCV2 infected PBMCs were labeled with CFSE and stimulated with ConA or

PWM for 5 days. No significant differences in Cap mRNA copy numbers were observed in

ConA or PWM stimulated PBMCs that had proliferated compared to non-proliferated cells. 113

However, the level of Cap mRNA was significantly greater in proliferated and non-

proliferated cells stimulated with PWM compared to ConA stimulation (Fig. 1).

Discussion

PCV2 infection is associated with lymphoid depletion and histiocytic and

granulomatous replacement of follicles in lymphoid tissues [2, 9]. It has been reported that

the use of immunostimulating factors, such as keyhole limpet hemocyanin (KLH) emulsified

in incomplete Freund's adjuvant, vaccines, or non-specific immunomodulating drugs

(Baypamun, Bayer, Levewrkusen, Germany) increases the amount of PCV2 antigen in

tissues and can increase the number of pigs that develop PMWS [3, 17, 18, 23]. A consistent

finding in pigs with PMWS is abundant PCV2 antigen in macrophages in the lymphoid

tissues and the presence of a marker for late apoptosis characterized by terminal

deoxynucleotidyl transferase (TdT)-mediated incorporation of biotinylated nucleotides

(UTP) onto the 3'-exposed hydroxyl groups (nick end labeling) nuclear deoxyribonucleic

acid (TUNEL) [33]. In contrast, recent studies suggested that PCV2 does not induce

apoptosis of lymphocytes in PMWS affected pigs [16] and that decreased cell proliferation

and not increased apoptosis appeared to be important mechanism for lymphoid depletion in

PMWS-affected pigs under field conditions [20]. To date, little is known about the effect of

PCV2 infection and replication on the immune cells of PWMS-affected pigs. The objective

of this study was to evaluate the effects of PCV2 infection and replication on activated

PBMCs in vitro. The virus replication, the stimulation index and apoptotic index in PCV2

infected PBMCs with or without stimuli were investigated.

Recently, we have developed an RT-PCR assay that detects PCV2 Cap mRNA and is

able to discriminate between replicating PCV2 and PCV2 virions in PK-15 cells [38]. A 114 strong correlation between the levels of Cap mRNA and viral DNA in ConA stimulated

PBMCs was observed [39]. In the present study, Cap mRNA was used to measure PCV2 replication in PCV2 infected PBMCs stimulated with ConA or PWM. ConA and PWM stimulate different subpopulation of T lymphocytes [11]. It has been reported that ConA is T- cell-specific mitogen and PWM is T-cell-dependent B-cell mitogen in pigs [35]. We determined that the levels of PCV2 Cap mRNA were significantly increased in ConA or

PWM stimulated PBMCs compared to non-stimulated cells at 3 and 5 DPI. In addition, the level of PCV2 Cap mRNA in PWM stimulated cells was significantly higher than in ConA stimulated cells at 5 DPI. These findings are in agreement with our previous results [39] that

reported an increase in PCV2 replication in PBMCs in the presence of the mitogens, ConA or

PWM. These results indicate that stimulation of different populations of lymphocytes results

in different levels of viral replication. It has been shown that the severity of PCV2-induced

disease is based on the amount of virus present in the pig. Variation in immune stimuli may

explain the differences in incidence of PCV2-induced disease between farms and even

individual animals.

In order to evaluate whether PCV2 infection affects the ability of cells to proliferate

or undergo apoptosis, lymphocyte proliferation and apoptosis indices were assessed. Cell

proliferation has traditionally been measured by [3H] -thymidine uptaken in cells following

stimulation with antigens or mitogens in vitro. However, the ability of CFSE to label

lymphocytes intracellularly and track their mitotic activity by progressive two-fold reduction

in fluorescence intensity using flow cytometry has proven to be equivalent to the traditional

measurement. The advantages of using CFSE labeling is ease of the assay, ability to identify

specific subpopulations of proliferating cells and avoiding the use of radioactivity [14]. 115

Results from this study indicated no significant differences in the ability of cells to proliferate when infected with PCV2 at either 3 or 5 days post-stimulation with either mitogen. Thus,

PCV2 infection and virus replication did not impact PBMCs proliferation in vitro. The results suggest that lymphoid depletion is probably not due to reduced proliferation by PCV2 infection. However, this would need to be further confirmed in vivo.

In this study, fluorescein labeled annexin V was combined with 7-A AD to assess the

number of viable and/or early apoptotic cells within cultured PBMCs. Annexin V is a Ca2+-

dependent phospholipid binding protein known to bind to phosphatidylserine on the surface

of apoptotic cells [4]. Phosphatidylserine is normally found on the inner, cytosolic side of cell

membranes but is exposed on the outside at the early stages of apoptosis [12]. 7A AD is a

DNA dye which is excluded by viable cells, but can penetrate cell membranes of dead cells

[28]. Results showed that with PWM stimulation, a significantly higher apoptotic index was

obtained in virus infected PBMC samples compared to non-infected PBMCs at 3 and 5 DPI,

indicating that PCV2 infection and replication increases the level of apoptosis in PWM

stimulated PBMCs. This finding provides a possible mechanism for the loss of B cells and a

reduction of T cells (CD3+) in lymphoid tissues [31, 33], as well as the reduction of CD4+ T

cells and B lymphocytes in peripheral blood of PMWS pigs described in earlier studies [10,

29]. However, no significant differences in the apoptotic index in ConA stimulated PBMCs

with or without PCV2 infection was observed in our study. These findings indicate that

PCV2 does not increase the apoptosis rate in all stimulated cells suggesting that certain

stimulation factors are required for PCV2-induced apoptosis. Previous studies showed that

both mitogens stimulate PBMCs to proliferate, but activate different lymphocyte cell

populations. The predominant subsets of porcine lymphocytes responding to ConA 116 stimulation are CD4(+)CD8(+), CD4(-)CD8(+) alpha(hi), CD4(-) CD8(+) alpha(lo) and gammadelta TCR(+) cells while PWM stimulates CD4(+)CD8(+), CD4CD8(+ )alpha(hi) but not CD4(-)CD8(+) alpha(lo) or gammadelta TCR(+) cells [11]. In addition, the two mitogens

induce different levels of cytokine production in PBMCs at varying time points after

stimulation [36]. This may be the reason why some studies showed the use of

immunostimulating factors, such as KLH emulsified in incomplete Freund's adjuvant,

vaccines, or non-specific immunomodulating drugs (Baypamun, Bayer, Levewrkusen,

Germany) were able to induce PMWS in PCV2 infected pigs [3, 17, 18, 23] while others did

not when using a commercial vaccine adjuvant as immunostimulating reagent in PCV2

experimentally infected conventional pigs [24]. Further identification of the cells, factors and

mechanisms that trigger PCV2 to induce cell apoptosis is required.

Interestingly, without mitogen stimulation, a significantly lower apoptotic index was

observed in PBMCs samples at both 3 and 5 days post PCV2 infection. It appears that PCV2

infection alone may be able to delay clearance by the host immune system by preventing

cells from undergoing apoptosis. This could explain the presence of PCV2 DNA in tissues

from experimentally infected pigs at 125 DPI [5]. The information obtained in this study

increases our understanding of the mechanism of PCV2 evading from the immune system

and how it persists in infected pigs.

To further study whether the proliferation of PBMCs facilitates PCV2 replication, the

levels of Cap mRNA was assessed in PBMCs that had been stimulated with ConA for 12,36,

and 72 hours prior to inoculation with PCV2 for 24 hours. No significant differences were

observed in the levels of Cap mRNA in PBMCs at any of the stimulated time intervals prior

to PCV2 infection. This suggests that PCV2 replication in vitro is not dependent on prior 117 proliferation status of the cells for replication. An alternative explanation would be that productive PCV2 replication requires longer than the 24 hours time period used in this study, though, earlier studies have found differences in replication rate as early as 18 HPI [39].

Future studies should investigate the level of Cap mRNA produced at different time points

post-infection and identify the optimum time for the activation factors that will facilitate

virus replication.

The level of Cap mRNA in cells induced to proliferate with ConA or PWM

stimulation was compared to non-proliferated infected PBMCs. We found that there was no

significant difference in Cap mRNA copy numbers in mitogen stimulated proliferating

PBMCs compared to non-proliferating cells. Mitogen stimulation also induces macrophage

maturation from monocytes in the PBMC population, thus the high level of Cap mRNA in

stimulated cells that have not divided may have been from macrophages rather than

lymphocytes. It can be hypothesized that macrophages take up infected lymphocytes

resulting in further viral replication in the macrophage cell population. In addition, levels of

Cap mRNA were significantly greater in PWM stimulated independent of proliferation status

compared to ConA stimulated cells. These findings support the earlier findings that PWM

stimulated cells are better able to support virus replication compared to cells stimulated with

ConA.

In the present study, no significant correlation was found between the copy numbers

of Cap mRNA and either the cell stimulation or apoptosis indices. This provides further

support for the theory that PCV2 replication is not dependent on cell division. In addition,

PCV2 infection alone does not increase the level of apoptosis in infected cells but needs

certain stimulation factors to trigger increased levels of viral replication and cell apoptosis. 118

In conclusion, our data indicates that mitogen stimulation increases virus replication.

PCV2 infection and replication do not appear to detrimentally affect the ability of PBMCs to proliferate in response to ConA or PWM stimulation. In addition, no significant differences in cell proliferation occurred in PCV2 infected PBMCs with different stimuli in vitro.

Increased apoptosis was associated with PCV2 infection in the presence of PWM stimulation

while the apoptosis rate was reduced in cells infected with PCV2 alone. In addition, our

results further confirmed our earlier finding that PCV2 replicates in activated lymphocytes.

However, stimulation alone is not enough to enhance viral replication. A specific stimulation

or trigger is appears to be required, not just cell division or proliferation alone. Determining

the role of cellular apoptosis and proliferation plays on PCV2 infection and replication on

PBMCs provides important information on the mechanisms involved in the pathogenesis of

PCV2 infection and allows us to further determine how this pathogen impacts the immune

system of pigs.

Acknowledgements

The authors would like to thanks Dr. Xiang-Jin Meng from Virginia Polytechnic

Institute and State University for supplying the PCV2 plasmid DNA, Dr. Tanya Opriessnig

and Pete Thomas at the department of Veterinary Diagnostic and Production Animal

Medicine, Iowa State University for providing blood samples, Douglas E. Jones and Amanda

Ramer at the department of Veterinary Pathology, Iowa State University for suggestions on

CFSE label and Dr. Shawn Rigby at Iowa State University Cell facility for cell sorting. This

work was supported by the Healthy Livestock Initiative fund. 119

References

[1] Allan G.M., Ellis J.A., Porcine circoviruses: a review, J. Vet. Diagn. Invest. 12 (2000) 3-14. [2] Allan G.M., Me Neilly F., Meehan B.M., Kennedy S., Mackie D.P., Ellis J.A., Clark E.G., Espuna E., Saubi N., Riera P., Botner A., Charreyre C.E., Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland, Vet. Microbiol. 66 (1999) 115-123. [3] Allan G.M., McNeilly F., Kennedy S., Meehan B., Ellis J., Krakowka S., Immunostimulation, PCV-2 and PMWS, Vet. Rec. 147 (2000) 170-171. [4] Andree H.A., Reutelingsperger C.P., Hauptmann R., Hemker H.C., Hermens W.T., Willems G.M., Binding of vascular anticoagulant alpha (VAC alpha) to planar phospholipid bilayers, J. Biol. Chem. 265 (1990) 4923-4928. [5] Bolin S.R., Stoffregen W.C., Nayar G.P., Hamel A.L., Postweaning multisystemic wasting syndrome induced after experimental inoculation of cesarean-derived, colostrum-deprived piglets with type 2 porcine circovirus, J. Vet. Diagn. Invest. 13 (2001) 185-194. [6] Chae C., Postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and pathology, Vet. J. 168 (2004) 41-49. [7] Cheung A.K., Bolin S.R., Kinetics of porcine circovirus type 2 replication, Arch. Virol. 147 (2002) 43-58. [8] Chianini F., Majo N., Segales J., Dominguez J., Domingo M., Immunohistochemical characterisation of PCV2 associate lesions in lymphoid and non-lymphoid tissues of pigs with natural postweaning multisystemic wasting syndrome (PMWS), Vet. Immunol. Immunopathol. 94 (2003) 63-75. [9] Clark E., Post-weaning multisystemic wasting syndrome, Proceedings of the Western Canadaian Association of Swine Practitioners 28 (1997) 499-501. [10] Darwich L., Segales J., Domingo M., Mateu E., Changes in CD4(+), CD8(+), CD4(+) CD8(+), and immunoglobulin M-positive peripheral blood mononuclear cells of postweaning multisystemic wasting syndrome-affected pigs and age-matched uninfected wasted and healthy pigs correlate with lesions and porcine circovirus type 2 load in lymphoid tissues, Clin. Diagn. Lab. Immunol. 9 (2002) 236-242. [11] Dorn A.D., Waters W.R., Byers V.M., Pesch B.A., Wannemuehler M.J., Characterization of mitogen-stimulated porcine lymphocytes using a stable fluorescent dye (PKH2) and multicolor flow cytometry, Vet. Immunol. Immunopathol. 87 (2002) 1-10. [12] Fadok V.A., Voelker D.R., Campbell P.A., Cohen J.J., Bratton D.L., Henson P.M., Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages, J. Immunol. 148 (1992) 2207- 2216. [13] Fenaux M., Halbur P.G., Haqshenas G., Royer R., Thomas P., Nawagitgul P., Gill M., Toth T.E., Meng X.J., Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions, J. Virol. 76 (2002) 541- 551. 120

[14] Fulcher D., Wong S., Carboxyfluorescein succinimidyl ester-based proliferative assays for assessment of T cell function in the diagnostic laboratory, Immunol. Cell Biol. 77(1999) 559-564. [15] Grasland B., Loizel C., Blanchard P., Oger A., Nignol A.C., Bigarre L., Morvan H., Cariolet R., Jestin A., Reproduction of PMWS in immunostimulated SPF piglets transacted with infectious cloned genomic DNA of type 2 porcine circovirus, Vet. Res. 36 (2005) 685-697. [16] Krakowka S., Ellis J., McNeilly F., Meehan B., Oglesbee M., Alldinger S., Allan G., Features of cell degeneration and death in hepatic failure and systemic lymphoid depletion characteristic of porcine circovirus-2-associated postweaning multisystemic wasting disease, Vet. Pathol. 41 (2004) 471-481. [17] Krakowka S., Ellis J.A., McNeilly F., Ringler S., Rings D.M., Allan G., Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2), Vet. Pathol. 38 (2001) 31-42. [18] Kyriakis S C., Saoulidis K., Lekkas S., Miliotis Ch C., Papoutsis P.A., Kennedy S., The effects of immuno-modulation on the clinical and pathological expression of postweaning multisystemic wasting syndrome, J. Comp. Pathol. 126 (2002) 38-46. [19] Lyons A.B., Parish C.R., Determination of lymphocyte division by flow cytometry, J. Immunol. Methods 171 (1994) 131-137. [20] Mandrioli L., Sarli G., Panarese S., Baldoni S., Marcato P.S., Apoptosis and proliferative activity in lymph node reaction in postweaning multisystemic wasting syndrome (PMWS), Vet. Immunol. Immunopathol. 97 (2004) 25-37. [21] Mannering S.I., Morris J.S., Jensen K.P., Purcell A.W., Honeyman M.C., van Endert P.M., Harrison L.C., A sensitive method for detecting proliferation of rare autoantigen-specific human T cells, J. Immunol. Methods 283 (2003) 173-183. [22] Nielsen J., Vincent I.E., Botner A., Ladekaer-Mikkelsen A.S., Allan G., Summerfield A., McCullough K.C., Association of lymphopenia with porcine circovirus type 2 induced postweaning multisystemic wasting syndrome (PMWS), Vet. Immunol. Immunopathol. 92 (2003) 97-111. [23] Opriessnig T., Yu S., Gallup J.M., Evans R.B., Fenaux M., Pallares F., Thacker E.L., Brockus C.W., Ackermann M.R., Thomas P., Meng X.J., Halbur P.G., Effect of vaccination with selective bacterins on conventional pigs infected with type 2 porcine circovirus, Vet. Pathol. 40 (2003) 521-529. [24] Resendes A., Segales J., Balasch M., Calsamiglia M., Sibila M., Ellerbrok H., Mateu E., Plana-Duran J., Mankertz A., Domingo M., Lack of an effect of a commercial vaccine adjuvant on the development of postweaning multisystemic wasting syndrome (PMWS) in porcine circovirus type 2 (PCV2) experimentally infected conventional pigs, Vet. Res. 35 (2004) 83-90. [25] Resendes A.R., Majo N., Segales J., Espadamala J., Mateu E., Chianini F., Nofrarias M., Domingo M., Apoptosis in normal lymphoid organs from healthy normal, conventional pigs at different ages detected by TUNEL and cleaved caspase-3 immunohistochemistry in paraffin-embedded tissues, Vet. Immunol. Immunopathol. 99 (2004) 203-213. 121

[26] Rosell C., Segales J., Plana-Dur an J., Balasch M., Rodriguez-Arrioja G.M., Kennedy S., Allan G.M., McNeilly F., Latimer K.S., Domingo M., Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs, J. Comp. Pathol. 120 (1999) 59-78. [27] Sarli G., Mandrioli L., Laurenti M., Sidoli L., Cerati C., Rolla G., Marcato P.S., Immunohistochemical characterisation of the lymph node reaction in pig post­ weaning multisystemic wasting syndrome (PMWS), Vet. Immunol. Immunopathol. 83 (2001) 53-67. [28] Schmid I., Krall W.J., Uittenbogaart C.H., Braun J., Giorgi J.V., Dead cell discrimination with 7-amino-actinomycin D in combination with dual color immunofluorescence in single laser flow cytometry, Cytometry 13 (1992) 204-208. [29] Segales J., Alonso F., Rosell C., Pastor J., Chianini F., Campos E., Lopez-Fuertes L., Quintana J., Rodriguez-Arrioja G., Calsamiglia M., Pujols J., Dominguez J., Domingo M., Changes in peripheral blood leukocyte populations in pigs with natural postweaning multisystemic wasting syndrome (PMWS), Vet. Immunol. Immunopathol. 81 (2001) 37-44. [30] Segales J., Domingo M., Postweaning multisystemic wasting syndrome (PMWS) in pigs. A review, Vet. Q. 24 (2002) 109-124. [31] Segales J., Domingo M., Chianini F., Majo N., Domi, nguez J., Darwich L., Mateu E., Immunosuppression in postweaning multisystemic wasting syndrome affected pigs, Vet. Microbiol. 98 (2004) 151-158. [32] Segales J., Pastor J., Cuenca R., Domingo M., Haematological parameters in postweaning multisystemic wasting syndrome-affected pigs, Vet. Rec. 146 (2000) 675-676. [33] Shibahara T., Sato K., Ishikawa Y., Kadota K, Porcine circovirus induces B lymphocyte depletion in pigs with wasting disease syndrome, J. Vet. Med. Sci. 62 (2000)1125-1131. [34] Takahashi R., Shimazaki C., Inaba T., Okano A., Hatsuse M., Okamoto A., Hirai H., Ashihara E., Nakagawa M., A newly developed bisphosphonate, YM529, is a potent apoptosis inducer of human myeloma cells, Leuk. Res. 25 (2001) 77-83. [35] Tuchscherer M., Kanitz E., Otten W., Tuchscherer A., Effects of prenatal stress on cellular and humoral immune responses in neonatal pigs, Vet. Immunol. Immunopathol. 86 (2002) 195-203. [36] Verfaillie T., Cox E., To L.T., Vanrompay D., Bouchaut H., Buys N., Goddeeris B.M., Comparative analysis of porcine cytokine production by mRNA and protein detection, Vet. Immunol. Immunopathol. 81 (2001) 97-112. [37] Waters W.R., Hontecillas R., Sacco R.E., Zuckermann F.A., Harkins K.R., Bassaganya-Riera J., Wannemuehler M.J., Antigen-specific proliferation of porcine CD8alphaalpha cells to an extracellular bacterial pathogen, Immunology 101 (2000) 333-341. [38] Yu S., Carpenter S., Opriessnig T., Halbur P.G., Thacker E., Development of a reverse transcription-PCR assay to detect porcine circovirus type 2 transcription as a measure of replication, J. Virol. Methods 123 (2005) 109-112. 122

Yu S.V., A. Opriessnig, T. Carpenter,S. Kitikoon, P. Halbur, P.O. Thacker, E., In vitro studies on the use of a quantitative real-time RT-PCR assay to detect PCV2 replication in peripheral blood mononuclear cells (PBMCs), the 18th Congress of the International Pig Veterinary Society (2004). 123

Table 1. Quantification of PCV2 spliced capsid mRNA in PCV2 infected peripheral blood mononuclear cells with concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation.

3 DPI 5 DPI

Treatment Mean ± Std Dev Mean ± Std Dev

MEMPCV2 4.06 ± 0.89" 3.22 ±0.36°

ConAPCV2 6.37 ±0.41» 5.80 ±0.25"

PWMPCV2 6.33 ± 0.46= 6.34 ±0.13"

MEMPCV2: PCV2 infected PBMCs, ConAPCV2: PCV2 infected PBMCs with ConA

stimulation, PWMPCV2: PCV2 infected PBMCs with PWM stimulation

Different superscripts (a, b, c) within each column indicate that values in mean score of

treatments for 3 or 5 days post-infection (DPI) is significantly different by least significant

difference (f<0.05). Values are presented as the mean of loglO mRNA copy number ±

standard deviation. 124

Table 2. The stimulation index of PCV2 infected peripheral blood mononuclear cells with or without concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation.

3DPI 5DPI

Treatment mean ± Std Dev mean ± Std Dev

MEM 1.00±0.00c 1.00 ±0.00"

MEMPCV2 1.38 ± 0.20bc 1.49 ±0.26"

ConA 2.67 ±0.33" 4.05 ± 1.10ab

ConAPCV2 2.92 ± 0.31a 7.33 ± 3.04"

PWM 1.79 ±0.36" 4.02 ± 1.87""

PWMPCV2 1.74 ±0.15" 4.29 ±2.55""

MEM: Non-infected PBMCs, MEMPCV2: PCV2 infected PBMCs, ConA: Non-infected

PBMCs with ConA stimulation, ConAPCV2: PCV2 infected PBMCs with ConA stimulation,

PWM: Non-infected PBMCs with PWM stimulation PWMPCV2: PCV2 infected PBMCs

with PWM stimulation.

Different superscripts (a,b,c) within each column indicate that values in mean score of

treatments for 3 or 5 days post-infection (DPI) is significantly different by least significant

difference (P<0.05). Values are presented as the mean of stimulation index ± standard

deviation. 125

Table 3. The viability of PCV2 infected peripheral blood mononuclear cells with concanavalin A (ConA) or pokeweed mitogen (PWM) stimulation.

3DPI 5DPI

Treatment mean ± Std Dev mean ± Std Dev

MEM 65.84 ±8.85a0 49.57 ± 11.14ab

MEMPCV2 69.95 ± 9.34" 68.40 ±6.34a

ConA 71.66 ±3.65" 65.60 ± 12.11"

ConAPCV2 65.38 ± 6.69"" 62.35 ± 12.39"

PWM 64.90 ± 3.96ab 46.85 ± 7.87ab

PWMPCV2 53.65 ± 6.24b 31.51 ± 10.96b

MEM: Non-infected PBMCs, MEMPCV2: PCV2 infected PBMCs, ConA: Non-infected

PBMCs with ConA stimulation, ConAPCV2: PCV2 infected PBMCs with ConA stimulation,

PWM: Non-infected PBMCs with PWM stimulation PWMPCV2: PCV2 infected PBMCs

with PWM stimulation.

Different superscripts (a, b) within each column indicate that values in mean score of

treatments for 3 or 5 days post-infection (DPI) is significantly different by least significant

difference (P<0.05). Values are presented as the mean of the percentage of live cells ±

standard deviation 126

l. 8 -

H ConA •PWM

CFSE High CFSE Low intensity of CFSE

Fig. 1. Quantification of PCV2 spliced capsid mRNA in PCV2 infected peripheral blood mononuclear cells (PBMCs) which are proliferated and non-proliferated. PBMCs are stimulated with concanavalin A (ConA) or pokeweed mitogen (PWM) for 5 days and sorted based on the intensity of CFSE staining. The proliferated cells are with low CFSE intensity and non-proliferated cells with high CFSE intensity. Values are expressed as logarithm 10 of

PCV2 spliced capsid mRNA copies/105 cells. The symbol * represents significant difference between ConA and PWM stimulation at /*<().05. 127

A)

•y 0.4 I non-infection 5 0.3 IPCV2 infection o 0.2

MEM ConA PWM treatment

B)

.£ 0.5 I non-infection *3 0.4 IPCV2 infection ô. 0.3

MEM ConA PWM treatment

Fig. 2. Apoptotic index of PCV2 infected peripheral blood mononuclear cells (PBMCs) at 3

(A) and 5 (B) days post-infection. PCV2 infected and non-infected PBMCs were stimulated

with concanavalin A (ConA) or pokeweed mitogen (PWM). The symbol * represents

significant difference between PCV2 infected PBMCs and non-infected cells at .P<0.05. 128

CHAPTER 6. GENERAL CONCLUSIONS

Porcine circovirus type 2 (PCV2) is considered an important pathogen of swine and is associated with postweaning multisystemic wasting syndrome (PMWS). Lymphocyte depletion of follicular and interfollicular areas together with macrophage infiltration of lymphoid tissues is the hallmark lesions of PMWS-affected pigs (Allan and Ellis, 2000).

PCV2 nucleic acid or antigen in PMWS-affected pigs is usually found in the cytoplasm of

histiocytes, multinucleate giant cells and other monocyte/macrophage lineage cells. A strong

correlation has been observed between the amount of PCV2 nucleic acid or antigen in the

tissues and the severity of microscopic lymphoid lesions (Segales and Domingo, 2002).

Studies of PMWS-affected pigs found a reduction or complete loss of B cells in lymphoid

tissues of PMWS pigs (Rosell et al., 1999). A reduction of T cells (CD3+) and an increase in

cells expressing lysozyme (mononuclear-phagocytic cells) was also revealed (Sarli et al.,

2001). In peripheral blood, circulating monocyte numbers are increased in PMWS affected

piglets, but T cells (CD4+) and B lymphocytes are decreased (Nielsen et al., 2003). Our long-

term goal is to determine the mechanism by which PCV2 induces lymphoid depletion and

PMWS. Two main objectives were addressed in the research reported here. One was to

evaluate PCV2 replication in the immune cell populations in vitro and in vivo, and the other

one was to investigate the effects of PCV2 infection and replication on immune cells that had

been activated in vitro as well as the relationship between PCV2 replication and cellular

proliferation.

Three studies were conducted to evaluate PCV2 replication in the immune cell

populations in vitro and in vivo. In the first study, we developed a PCV2-specific reverse

transcription polymerase chain reaction (RT-PCR) assay. We demonstrated that our assay 129 was able to detect the spliced capsid mRNA (Cap mRNA) of PCV2 during virus replication in PK-15 cells and distinguish between PCVl and PCV2 as no products were amplified from either PCVl stock or PCVl-infected PK-15 cells. This assay provided a rapid, specific and sensitive technique for detecting type-specific PCV2 while discriminating between replicating PCV2 and PCV2 virions.

In the second study, we further investigated PCV2 replication in peripheral blood mononuclear cells (PBMCs) as well as determining the temporal relationship between cell stimulation with ConA and the level of Cap mRNA using a quantitative real-time RT-PCR

assay. This assay was shown to be a sensitive, specific and highly reproducible technique for

assessing PCV2 replication. A real-time PCR assay to detect the viral DNA was also

performed and the results of the two assays compared. The results showed the Cap mRNA

copy number and the PCV2 DNA copy number increased in PBMCs following infection and

that stimulation of the PBMCs significantly enhanced both copy numbers in vitro. These

findings indicated that PBMCs were capable of PCV2 replication, and stimulation with

ConA significantly increased virus replication in vitro. The results support the hypothesis

that immune activation may result in increased PCV2 replication (Grasland et al., 2005;

Krakowka et al., 2001; Kyriakis et al., 2002; Opriessnig et al., 2003). Moreover, the specific

cell populations in which PCV2 actively replicates were identified by labeling cells labeled

with FITC-conjugated anti-CD3 antibodies to identify T lymphocytes or FITC-conjugated

mouse anti-pig SWC3 antibodies to detect monocytes. An EPICS ALTRA flow cytometer

was used to collect each cell population; CD3+ (T lymphocytes), SWC3+ (monocytes) and

SWC3' (PBMCs with monocytes removed) cell fractions. It was found that both PCV2 Cap

mRNA and viral DNA copy numbers in the cell populations depleted of monocytes (SWC3 ) 130 and the T lymphocytes population (CD3+) were significantly increased compared to the copy numbers in the monocyte population (SWC3+). These results suggest that lymphocytes are an important site for PCV2 replication. However, low levels of viral replication products were found in monocytic/macrophage cells which were SWC3+. Further studies are needed to determine whether these products were due to virus replication or uptake of viral products produced by infected lymphocytes.

In the third study, we investigated PCV2 distribution and replication in tissues and

immune cells in early infected pigs and further confirmed the immune cell populations in

which PCV2 replicates under in vivo conditions. Results of this study found that the viral

load and the amount of Cap mRNA levels differed dramatically between tested tissues

(bronchial lymph nodes (BLN), superficial inguinal lymph nodes (ILN), lung, tonsil, thymus,

spleen, liver and kidney) from the same pig. It was determined that BLN had the highest

number of Cap mRNA and also consistently higher levels of viral DNA than any of the other

tissues tested at 7, 14 and 21 DPI. These findings indicate that the infection site is important

for PCV2 infection and may play a major role in virus spread and persistence in the infected

host since PCV2 was inoculated by intranasal route in this study. Cap mRNA was detected in

PBMCs only at 13 DPI indicating that PCV2 is able to replicate in PBMCs in vivo, though

perhaps only transiently when no other pathogens are present. These results also suggest that

PBMCs may not be a major source for PCV2 but may be more important in viral

dissemination. In contrast, the detection of high levels of PCV2 DNA and replication product

in bronchoalveolar lavage (BAL) cells indicates that pulmonary alveolar macrophages

(PAM) may be an important site for PCV2 active replication in vivo. In contrast to an earlier

study, in which it was demonstrated that porcine pulmonary macrophages in vitro may not be 131 a primary target for PCV2 replication (Gilpin et al., 2003; Meerts et al., 2005). The absence of PCV2 replication in their studies may be due to the effect of the in vitro culture system on cell activation. More importantly, our results indicated that virus actively replicates in T and

B lymphocytes, which appear to be the primary cells that support virus replication. However, the results of detecting PCV2 replication in specific cell populations from BLN mononuclear cells from infected pigs show that both the Cap mRNA and viral DNA levels decreased in T,

B lymphocytes at 21 DPI, and monocytes became the cell population with the greatest amount of Cap mRNA and viral DNA. These results suggest that the monocytes may be the

site for PCV2 persistence in the infected host. We also found that the local PCV2 specific

antibody response consists of IgA and IgM but not IgG. The levels of IgA and IgM appear to

be important in restricting PCV2 levels during early infection. Moreover, a strong correlation

was present between the levels of Cap mRNA and PCV2 antigen in all tested tissues except

the thymus in this study.

Our last study investigated the effect of PCV2 infection and replication on activated

porcine PBMCs in vitro and the relationship between PCV2 replication and cellular

proliferation. The virus replication, cell proliferation, cell viability, and apoptosis in PCV2

infected PBMCs with or without stimuli (concanavalin A (ConA) or pokeweed mitogen

(PWM)) were evaluated. This study demonstrated that stimulation with either mitogen

increased virus replication in proliferating lymphocytes. However, when we further

investigated the relationship between virus replication and cellular proliferation, we found no

significant differences between the level of Cap mRNA in PBMCs that had been stimulated

12, 36, and 72 hours prior to PCV2 infection. In addition, there were no significant

differences in the amount of Cap mRNA in ConA or PWM stimulated PBMCs that had 132 proliferated compared to non-proliferated cells. These findings suggested that PCV2 needs a specific stimulation/trigger for facilitating virus replication and is not just dependent on non­ specific cell division/proliferation. We also demonstrated that PCV2 infection does not impact the ability of PBMCs to proliferate in response to either ConA or PWM stimulation.

Increased apoptosis was found to be associated with PCV2 infection in the presence of PWM not ConA, indicating that PCV2 replication may result in the increase of apoptosis under certain stimulation conditions.

Recent studies have reported that pigs with PMWS have altered cytokine mRNA

expression patterns in affected lymphoid tissues (Darwich et al., 2003b) and PBMCs (Sipos

et al., 2004). An in vitro study of PCV2 infection of PBMC from healthy and diseased pigs

revealed that PCV2 has substantial and specific affects on the function of PBMCs from

PMWS pigs in terms of cytokine release (Darwich et al., 2003a). A correlation between

PCV2 and MCP-1 and MIP-1 expression in serial sections from lymph nodes of piglets

inoculated intranasally with PCV2 has been demonstrated (Kim and Chae, 2003; Kim and

Chae, 2004b), suggesting that there is an up regulation of monocyte chemoattractant protein-

1 and macrophage inflammatory protein-1 expression by mononuclear cells in response to

PCV2. Therefore, future studies should include investigation of cytokine and chemokine

profile changes in PCV2 infected immune cell populations in vivo and in vitro. The results of

those studies would provide more information on the mechanism by which PCV2 induces

lymphocyte depletion and PMWS. Information on the cytokines altered or modulated by

PCV2 infection would also increase our understanding of the potential immunosuppression

or immunostimulation that has been associated with PCV2 infection in the field. 133

REFERENCES CITED

Allan, G., Meehan, B., Todd, D., Kennedy, S., McNeilly, F., Ellis, J., Clark, E.G., Harding, J., Espuna, E., Botner, A. and Charreyre, C., 1998a. Novel porcine circoviruses from pigs with wasting disease syndromes. Vet Rec 142, 467-8. Allan G.M., M.F., McNair I., Meehan B., Marshall M., Ellis J. , Lasagna C., Boriosi G., Krakowka S., Reynaud G., Boeuf-Tedeschi L., Bublot M.and Charreyre C., 2002. Passive transfer of maternal antibodies to PCV2 protects against development of post­ weaning multisystemic wasting syndrome (PMWS): experimental infections and a field study. The Pig Journal 50, p.59-67. Allan, G.M. and Ellis, J.A., 2000. Porcine circoviruses: a review. J Vet Diagn Invest 12, 3- 14. Allan, G.M., Kennedy, S., McNeilly, F., Foster, J.C., Ellis, J.A., Krakowka, S.J., Meehan, B.M. and Adair, B.M., 1999a. Experimental reproduction of severe wasting disease by co-infection of pigs with porcine circovirus and porcine parvovirus. J Comp Pathol 121, 1-11. Allan, G.M., Mackie, D.P., McNair, J., Adair, B.M. and McNulty, M.S., 1994a. Production, preliminary characterisation and applications of monoclonal antibodies to porcine circovirus. Vet Immunol Immunopathol 43, 357-71. Allan, G.M., Mc Neilly, F., Meehan, B.M., Kennedy, S., Mackie, D P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A. and Charreyre, C.E., 1999b. Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland. Vet Microbiol 66, 115-23. Allan, G.M., McNeilly, F., Cassidy, J.P., Reilly, G.A., Adair, B., Ellis, W.A. and McNulty, M.S., 1995. Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Vet Microbiol 44, 49-64. Allan, G.M., McNeilly, F., Foster, J.C. and Adair, B.M., 1994b. Infection of leucocyte cell cultures derived from different species with pig circovirus. Vet Microbiol 41, 267-79. Allan, G.M., McNeilly, F., Kennedy, S., Daft, B., Clarke, E.G., Ellis, J.A., Haines, D.M., Meehan, B.M. and Adair, B.M., 1998b. Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe. J Vet Diagn Invest 10, 3-10. Allan, G.M., McNeilly, F., Kennedy, S., Meehan, B., Ellis, J. and Krakowka, S., 2000. Immunostimulation, PCV-2 and PMWS. Vet Rec 147, 170-1. Allan, G.M., McNeilly, F., Meehan, B., Kennedy, S., Johnston, D., Ellis, J., Krakowka, S., Fossum, C., Wattrang, E. and Wallgren, P., 2002. Reproduction of PMWS with a 1993 Swedish isolate of PCV-2. Vet Rec 150, 255-6. Allan, G.M., Phénix, K.V., Todd, D. and McNulty, M.S., 1994c. Some biological and physico-chemical properties of porcine circovirus. Zentralbl Veterinarmed B 41, 17- 26. Balasch, M., Segales, J., Rosell, C., Domingo, M., Mankertz, A., Urniza, A. and Plana- Duran, J., 1999. Experimental inoculation of conventional pigs with tissue homogenates from pigs with post-weaning multisystemic wasting syndrome. J Comp Pathol 121, 139-48. 134

Blanchard, P., Mahe, D., Cariolet, R., Keranflec'h, A., Baudouard, M.A., Cordioli, P., Albina, E. and Jestin, A., 2003a. Protection of swine against post-weaning multisystemic wasting syndrome (PMWS) by porcine circovirus type 2 (PCV2) proteins. Vaccine 21, 4565-75. Blanchard, P., Mahe, D., Cariolet, R., Truong, C., Le Dimna, M., Arnauld, C., Rose, N., Eveno, E., Albina, E., Madec, F. and Jestin, A., 2003b. An ORF2 protein-based ELISA for porcine circovirus type 2 antibodies in post-weaning multisystemic wasting syndrome. Vet Microbiol 94, 183-94. Bogdan, J., West, K., Clark, E., Konoby, C., Haines, D., Allan, G., McNeilly, F., Meehan, B., Krakowka, S. and Ellis, J.A., 2001. Association of porcine circovirus 2 with reproductive failure in pigs: a retrospective study, 1995-1998. Can Vet J 42, 548-50. Bolin, S.R., Stoffregen, W.C., Nayar, G.P. and Hamel, A.L., 2001. Postweaning multisystemic wasting syndrome induced after experimental inoculation of cesarean- derived, colostrum-deprived piglets with type 2 porcine circovirus. J Vet Diagn Invest 13, 185-94. Brunborg, I.M., Moldal, T. and Jonassen, C.M., 2004. Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J Virol Methods 122, 171-8. Calsamiglia, M., Segales, J., Quintana, J., Rosell, C. and Domingo, M., 2002. Detection of porcine circovirus types 1 and 2 in serum and tissue samples of pigs with and without postweaning multisystemic wasting syndrome. J Clin Microbiol 40, 1848-50. Carrasco, L., Segales, J., Bautista, M.J., Gomez-Villamandos, J.C., Rosell, C., Ruiz- Villamor, E. and Sierra, M.A., 2000. Intestinal chlamydial infection concurrent with postweaning multisystemic wasting syndrome in pigs. Vet Rec 146, 21-3. Chae, C., 2004. Postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and pathology. Vet J 168, 41-9. Cheung, A.K., 2003a. Comparative analysis of the transcriptional patterns of pathogenic and nonpathogenic porcine circoviruses. Virology 310, 41-9. Cheung, A.K., 2003b. The essential and nonessential transcription units for viral protein synthesis and DNA replication of porcine circovirus type 2. Virology 313, 452-9. Cheung, A.K., 2003c. Transcriptional analysis of porcine circovirus type 2. Virology 305, 168-80. Cheung, A.K., 2004. Identification of the essential and non-essential transcription units for protein synthesis, DNA replication and infectious virus production of Porcine circovirus type 1. Arch Virol 149, 975-88. Cheung, A.K. and Bolin, S.R., 2002. Kinetics of porcine circovirus type 2 replication. Arch Virol 147,43-58. Chianini, F., Majo, N., Segales, J., Dominguez, J. and Domingo, M., 2003. Immunohistochemical characterisation of PCV2 associate lesions in lymphoid and non-lymphoid tissues of pigs with natural postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 94, 63-75. Choi, C. and Chae, C., 1999. In-situ hybridization for the detection of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J Comp Pathol 121, 265-70. 135

Choi, C. and Chae, C., 2001. Colocalization of porcine reproductive and respiratory syndrome virus and porcine circovirus 2 in porcine dermatitis and nephrology syndrome by double-labeling technique. Vet Pathol 38, 436-41. Choi, C., Chae, C. and Clark, E.G., 2000. Porcine postweaning multisystemic wasting syndrome in Korean pig: detection of porcine circovirus 2 infection by immunohistochemistry and polymerase chain reaction. J Vet Diagn Invest 12, 151-3. Clark, E., 1997. Post-weaning multisystemic wasting syndrome. Proceedings of the Western Canadaian Association of Swine Practitioners 28, 499-501. Darwich, L., Balasch, M., Plana-Duran, J., Segales, J., Domingo, M. and Mateu, E., 2003a. Cytokine profiles of peripheral blood mononuclear cells from pigs with postweaning multisystemic wasting syndrome in response to mitogen, superantigen or recall viral antigens. J Gen Virol 84, 3453-7. Darwich, L., Pie, S., Rovira, A., Segales, J., Domingo, M., Oswald, LP. and Mateu, E., 2003b. Cytokine mRNA expression profiles in lymphoid tissues of pigs naturally affected by postweaning multisystemic wasting syndrome. J Gen Virol 84, 2117-25. Darwich, L., Segales, J., Domingo, M. and Mateu, E., 2002. Changes in CD4(+), CD8(+), CD4(+) CD8(+), and immunoglobulin M-positive peripheral blood mononuclear cells of postweaning multisystemic wasting syndrome-affected pigs and age-matched uninfected wasted and healthy pigs correlate with lesions and porcine circovirus type 2 load in lymphoid tissues. Clin Diagn Lab Immunol 9, 236-42. Darwich, L., Segales, J. and Mateu, E., 2004. Pathogenesis of postweaning multisystemic wasting syndrome caused by Porcine circovirus 2: an immune riddle. Arch Virol 149, 857-74. de Boisseson, C., Beven, V., Bigarre, L., Thiery, R., Rose, N., Eveno, E., Madec, F. and Jestin, A., 2004. Molecular characterization of Porcine circovirus type 2 isolates from post-weaning multisystemic wasting syndrome-affected and non-affected pigs. J Gen Virol 85, 293-304. Dorn, A.D., Waters, W.R., Byers, V.M., Pesch, B.A. and Wannemuehler, M.J., 2002. Characterization of mitogen-stimulated porcine lymphocytes using a stable fluorescent dye (PKH2) and multicolor flow cytometry. Vet Immunol Immunopathol 87,1-10. Drolet, R., Thibault, S., DAllaire, S., Thompson, J. and Done, S., 1999. Porcine dermatitis and nephropathy syndrome (PDNS): an overview of the disease. Swine Health Prod. 76, pp. 283-285. Dulac, G.C. and Afshar, A., 1989. Porcine circovirus antigens in PK-15 cell line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian pigs. Can J Vet Res 53, 431-3. Duran, C.O., Ramos-Vara, J. and Render,.J.A., 1997. Porcine dermatitis and nephropathy syndrome: a new condition to include in the differential diagnosis list for skin discolouration in swine . Swine Health Prod., pp. 241-244. Edwards, M.J., Mulley, R.C., 1999. Genetic, developmental, and neoplastic diseases. Diseases of Swine, 8th ed. Iowa State University Press, Iowa, USA,, pp. 695-712. Edwards, S. and Sands, J.J., 1994. Evidence of circovirus infection in British pigs. Vet Rec 134, 680-1. 136

Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D. and Haines, D., 1998. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J 39, 44-51. Ellis, J., Krakowka, S., Lairmore, M., Haines, D., Bratanich, A., Clark, E., Allan, G., Konoby, C., Hassard, L., Meehan, B., Martin, K., Harding, J., Kennedy, S. and McNeilly, F., 1999. Reproduction of lesions of postweaning multisystemic wasting syndrome in gnotobiotic piglets. J Vet Diagn Invest 11, 3-14. Ellis, J., Spinato, M., Yong, C., West, K., McNeilly, F., Meehan, B., Kennedy, S., Clark, E., Krakowka, S. and Allan, G., 2003. Porcine circovirus 2-associated disease in Eurasian wild boar. J Vet Diagn Invest 15, 364-8. Ellis, J.A., Bratanich, A., Clark, E.G., Allan, G., Meehan, B., Haines, D.M., Harding, J., West, K.H., Krakowka, S., Konoby, C., Hassard, L., Martin, K. and McNeilly, F., 2000. Coinfection by porcine circoviruses and porcine parvovirus in pigs with naturally acquired postweaning multisystemic wasting syndrome. J Vet Diagn Invest 12,21-7. Famham, M.W., Choi, Y.K., Goyal, S.M. and Joo, H.S., 2003. Isolation and characterization of porcine circovirus type-2 from sera of stillborn fetuses. Can J Vet Res 67, 108-13. Fenaux, M., Halbur, P.G., Gill, M., Toth, T.E. and Meng, X.J., 2000. Genetic characterization of type 2 porcine circovirus (PCV-2) from pigs with postweaning multisystemic wasting syndrome in different geographic regions of North America and development of a differential PCR-restriction fragment length polymorphism assay to detect and differentiate between infections with PCV-1 and PCV-2. J Clin Microbiol 38, 2494-503. Fenaux, M., Halbur, P.G., Haqshenas, G., Royer, R., Thomas, P., Nawagitgul, P., Gill, M., Toth, T.E. and Meng, X.J., 2002. Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions. J Virol 76, 541-51. Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F. and Meng, X.J., 2004a. A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCVl induces protective immunity against PCV2 infection in pigs. J Virol 78, 6297-303. Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F. and Meng, X.J., 2004b. Two amino acid mutations in the capsid protein of type 2 porcine circovirus (PCV2) enhanced PCV2 replication in vitro and attenuated the virus in vivo. J Virol 78, 13440-6. Fenaux, M., Opriessnig, T., Halbur, P.G. and Meng, X.J., 2003. Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCVl in weanling pigs. J Virol 77, 11232-43. Fenaux, M., Opriessnig, T., Halbur, P.G., Xu, Y., Potts, B. and Meng, X.J., 2004c. Detection and in vitro and in vivo characterization of porcine circovirus DNA from a porcine- derived commercial pepsin product. J Gen Virol 85, 3377-82. Ferreira D., S.B., Laval A., 2001. Attempt to use serotherapy to control mortality in PMWS. Proceedings ssDNA viruses of plants, birds, pigs, primates, pi 44. 137

Gibbs, M.J. and Weiller, G.F., 1999. Evidence that a plant virus switched hosts to infect a vertebrate and then recombined with a vertebrate-infecting virus. Proc Natl Acad Sci U S A 96, 8022-7. Gilpin, D.F., McCullough, K., Meehan, B.M., McNeilly, F., McNair, I., Stevenson, L.S., Foster, J.C., Ellis, J.A., Krakowka, S., Adair, B.M. and Allan, G.M., 2003. In vitro studies on the infection and replication of porcine circovirus type 2 in cells of the porcine immune system. Vet Immunol Immunopathol 94, 149-61. Grasland, B., Loizel, C., Blanchard, P., Oger, A., Nignol, A.C., Bigarre, L., Morvan, H., Cariolet, R. and Jestin, A., 2005. Reproduction of PMWS in immunostimulated SPF piglets transfected with infectious cloned genomic DNA of type 2 porcine circovirus. Vet Res 36, 685-97. Gresham, A., Jackson, G., Giles, N., Allan, G., McNeilly, F. and Kennedy, S., 2000. PMWS and porcine dermatitis nephropathy syndrome in Great Britain. Vet Rec 146, 143. Grierson, S.S., King, D.P., Sandvik, T., Hicks, D., Spencer, Y., Drew, T.W. and Banks, M., 2004. Detection and genetic typing of type 2 porcine circoviruses in archived pig tissues from the UK. Arch Virol 149, 1171-83. Haines, D.M. and Chelack, B.J., 1991. Technical considerations for developing enzyme immunohistochemical staining procedures on formalin-fixed paraffin-embedded tissues for diagnostic pathology. J Vet Diagn Invest 3, 101-12. Halbur PG, 1998. Porcine viral respiratory diseases. Proceedings of the International Pig Veterinary Society Congress, Vol 1, pp. 1-10. Hamel, A.L., Lin, L.L. and Nayar, G.P., 1998. Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J Virol 72, 5262-7. Hamel, A.L., Lin, L.L., Sachvie, C., Grudeski, E. and Nayar, G.P., 2000. PCR detection and characterization of type-2 porcine circovirus. Can J Vet Res 64, 44-52. Harding, J., 1996. Post-weaning multisystemic wasting syndrome: preliminary epidemiology and clinical findings. Proceedings of the Western Canadaian Association of Swine Practitioners, P21. Harding, J., Clark, EG., Strokappe, JH. et al., 1998. Postweaning multisystemic wasting syndrome: Epidemiology and clinical presentation. J Swine Health Prod 6, 249-254. Harms, P.A., Sorden, S.D., Halbur, P.G., Bolin, S.R., Lager, K.M., Morozov, I. and Paul, P.S., 2001. Experimental reproduction of severe disease in CD/CD pigs concurrently infected with type 2 porcine circovirus and porcine reproductive and respiratory syndrome virus. Vet Pathol 38, 528-39. Harms, P.A., Sorden, S.D.„ 2000. Porcine circovirus-associated pneumonia. Proceedings of the 16th IPVS on PMWS: a new emerging disease of swine, pp. 33-37. Hattermann, K., Roedner, C., Schmitt, C., Finsterbusch, T., Steinfeldt, T. and Mankertz, A., 2004. Infection studies on human cell lines with porcine circovirus type 1 and porcine circovirus type 2. Xenotransplantation 11, 284-94. Helie, P., Drolet, R., Germain, M.C. and Bourgault, A., 1995. Systemic necrotizing vasculitis and glomerulonephritis in grower pigs in southwestern Quebec. Can Vet J 36, 150-4. Hines, R.K. and Lukert, P.D., 1994. Porcine circovirus as a cause of congenital tremors in newborn pigs. Proceedings of the American Association on Swine Practitioners, pp. 344-345. 138

Kamstrup, S., Barfoed, A.M., Frimann, T.H., Ladekjaer-Mikkelsen, A.S. and Botner, A., 2004. Immunisation against PCV2 structural protein by DNA vaccination of mice. Vaccine 22, 1358-61. Kawashima, K., Tsunemitsu, H., Horino, R., Katsuda, K., Onodera, T., Shoji, T., Kubo, M., Haritani, M. and Murakami, Y., 2003. Effects of dexamethasone on the pathogenesis of porcine circovirus type 2 infection in piglets. J Comp Pathol 129, 294-302. Kennedy, S., Allan, G., McNeilly, F., Adair, B.M., Hughes, A. and Spillane, P., 1998. Porcine circovirus infection in Northern Ireland. Vet Rec 142,495-6. Kennedy, S., Moffett, D., McNeilly, F., Meehan, B., Ellis, J., Krakowka, S. and Allan, G.M., 2000. Reproduction of lesions of postweaning multisystemic wasting syndrome by infection of conventional pigs with porcine circovirus type 2 alone or in combination with porcine parvovirus. J Comp Pathol 122, 9-24. Kennedy, S., Segales, J., Rovira, A., Scholes, S., Domingo, M., Moffett, D., Meehan, B., O'Neill, R., McNeilly, F. and Allan, G., 2003. Absence of evidence of porcine circovirus infection in piglets with congenital tremors. J Vet Diagn Invest 15, 151-6. Kim, J. and Chae, C., 2001a. Differentiation of porcine circovirus 1 and 2 in formalin-fixed, paraffin-wax-embedded tissues from pigs with postweaning multisystemic wasting syndrome by in-situ hybridisation. Res Vet Sci 70, 265-9. Kim, J. and Chae, C., 2001b. Optimized protocols for the detection of porcine circovirus 2 DNA from formalin-fixed paraffin-embedded tissues using nested polymerase chain reaction and comparison of nested PCR with in situ hybridization. J Virol Methods 92, 105-11. Kim, J. and Chae, C., 2002. Double in situ hybridization for simultaneous detection and differentiation of porcine circovirus 1 and 2 in pigs with postweaning multisystemic wasting syndrome. Vet J 164, 247-53. Kim, J. and Chae, C., 2003. Expression of monocyte chemoattractant protein-1 but not interleukin-8 in granulomatous lesions in lymph nodes from pigs with naturally occurring postweaning multisystemic wasting syndrome. Vet Pathol 40, 181-6. Kim, J. and Chae, C., 2004a. A comparison of virus isolation, polymerase chain reaction, immunohistochemistry, and in situ hybridization for the detection of porcine circovirus 2 and porcine parvovirus in experimentally and naturally coinfected pigs. J Vet Diagn Invest 16, 45-50. Kim, J. and Chae, C., 2004b. Expression of monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 in porcine circovirus 2-induced granulomatous inflammation. J Comp Pathol 131, 121-6. Kim, J., Ha, Y., Jung, K., Choi, C. and Chae, C., 2004a. Enteritis associated with porcine circovirus 2 in pigs. Can J Vet Res 68, 218-21. Kim, J., Han, D.U., Choi, C. and Chae, C., 2001. Differentiation of porcine circovirus (PCV)-l and PCV-2 in boar semen using a multiplex nested polymerase chain reaction. J Virol Methods 98, 25-31. Kim, J., Jung, K. and Chae, C., 2004b. Prevalence of porcine circovirus type 2 in aborted fetuses and stillborn piglets. Vet Rec 155, 489-92. Kiupel, M., Stevenson, G.W., Mittal, S.K., Clark, E.G. and Haines, D.M., 1998. Circovirus- like viral associated disease in weaned pigs in Indiana. Vet Pathol 35, 303-7. 139

Krakowka, S., Ellis, J., McNeilly, F., Meehan, B., Oglesbee, M., Alldinger, S. and Allan, G., 2004. Features of cell degeneration and death in hepatic failure and systemic lymphoid depletion characteristic of porcine circovirus-2-associated postweaning multisystemic wasting disease. Vet Pathol 41, 471-81. Krakowka, S., Ellis, J.A., McNeilly, F., Gilpin, D., Meehan, B., McCullough, K. and Allan, G., 2002. Immunologic features of porcine circovirus type 2 infection. Viral Immunol 15,567-82. Krakowka, S., Ellis, J.A., McNeilly, F., Ringler, S., Rings, D.M. and Allan, G., 2001. Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2). Vet Pathol 38, 31-42. Krakowka, S., Ellis, J.A., Meehan, B., Kennedy, S., McNeilly, F. and Allan, G., 2000. Viral wasting syndrome of swine: experimental reproduction of postweaning multisystemic wasting syndrome in gnotobiotic swine by coinfection with porcine circovirus 2 and porcine parvovirus. Vet Pathol 37, 254-63. Kyriakis, S.C., Saoulidis, K., Lekkas, S., Miliotis Ch, C., Papoutsis, P.A. and Kennedy, S., 2002. The effects of immuno-modulation on the clinical and pathological expression of postweaning multisystemic wasting syndrome. J Comp Pathol 126, 38-46. Labarque, G.G., Nauwynck, H.J., Mesu, A.P. and Pensaert, M.B., 2000. Seroprevalence of porcine circovirus types 1 and 2 in the Belgian pig population. Vet Q 22, 234-6. Ladekjaer-Mikkelsen, A.S., Nielsen, J., Stadejek, T., Storgaard, T., Krakowka, S., Ellis, J., McNeilly, F., Allan, G. and Botner, A., 2002. Reproduction of postweaning multisystemic wasting syndrome (PMWS) in immunostimulated and non- immunostimulated 3-week-old piglets experimentally infected with porcine circovirus type 2 (PCV2). Vet Microbiol 89, 97-114. Ladekjaer-Mikkelsen, A.S., Nielsen, J., Storgaard, T., Botner, A., Allan, G. and McNeilly, F., 2001. Transplacental infection with PCV-2 associated with reproductive failure in a gilt. Vet Rec 148, 759-60. Lainson, F.A., Aitchison, K.D., Donachie, W. and Thomson, J.R., 2002. Typing of Pasteurella multocida isolated from pigs with and without porcine dermatitis and nephropathy syndrome. J Clin Microbiol 40, 588-93. Larochelle, R., Antaya, M., Morin, M. and Magar, R., 1999a. Typing of porcine circovirus in clinical specimens by multiplex PCR. J Virol Methods 80, 69-75. Larochelle, R., Bielanski, A., Muller, P. and Magar, R., 2000. PCR detection and evidence of shedding of porcine circovirus type 2 in boar semen. J Clin Microbiol 38, 4629-32. Larochelle, R., Magar, R. and D'Allaire, S., 2003. Comparative serologic and virologie study of commercial swine herds with and without postweaning multisystemic wasting syndrome. Can J Vet Res 67, 114-20. Larochelle, R., Morin, M., Antaya, M. and Magar, R., 1999b. Identification and incidence of porcine circovirus in routine field cases in Quebec as determined by PCR. Vet Rec 145,140-2. Liu, C., Ihara, T., Nunoya, T. and Ueda, S., 2004. Development of an ELISA based on the baculovirus-expressed capsid protein of porcine circovirus type 2 as antigen. J Vet Med Sci 66, 237-42. Liu, Q., Tikoo, S.K. and Babiuk, L.A., 2001. Nuclear localization of the ORF2 protein encoded by porcine circovirus type 2. Virology 285, 91-9. 140

Liu, Q., Wang, L., Willson, P. and Babiuk, L.A., 2000. Quantitative, competitive PCR analysis of porcine circovirus DNA in serum from pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 38, 3474-7. M.A. Sierra, J.M.D.L.M., R.F. Molenbeek, C. Van Maanen, J.H. Vos and M. Quezada,, 1997. Porcine immune complex glomerulonephritis dermatitis (PIGD) syndrome. Eur. J. Vet. Pathol. 3, pp. 63-70. Madec, F., Eveno, E. , Morvan, P., Hamon, L., Blanchard, P., Cariolet, R., Amenna, N., Marvan, H., Truong, C., Mahe, D., Albina, E. and Jestin, A., 2000. Post-weaning multisystemic wasting syndrome (PMWS) in pigs in France: clinical observations from follow-up studies on affected farms. Livestock Prod. Sci. 63, pp. 223-233. Magar, R., Larochelle, R., Thibault, S. and Lamontagne, L., 2000a. Experimental transmission of porcine circovirus type 2 (PCV2) in weaned pigs: a sequential study. J Comp Pathol 123, 258-69. Magar, R., Muller, P. and Larochelle, R., 2000b. Retrospective serological survey of antibodies to porcine circovirus type 1 and type 2. Can J Vet Res 64, 184-6. Mandrioli, L., Sarli, G., Panarese, S., Baldoni, S. and Marcato, P.S., 2004. Apoptosis and proliferative activity in lymph node reaction in postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 97, 25-37. Mankertz, A., Domingo, M., Folch, J.M., LeCann, P., Jestin, A., Segales, J., Chmielewicz, B., Plana-Duran, J. and Soike, D., 2000. Characterisation of PCV-2 isolates from Spain, Germany and France. Virus Res 66, 65-77. Mankertz, A. and Hillenbrand, B., 2001. Replication of porcine circovirus type 1 requires two proteins encoded by the viral rep gene. Virology 279, 429-38. Mankertz, A. and Hillenbrand, B., 2002. Analysis of transcription of Porcine circovirus type 1. JGen Virol 83,2743-51. Mankertz, A., Mankertz, J., Wolf, K. and Buhk, H.J., 1998a. Identification of a protein essential for replication of porcine circovirus. J Gen Virol 79 ( Pt 2), 381-4. Mankertz, A., Mueller, B., Steinfeldt, T., Schmitt, C. and Finsterbusch, T., 2003. New reporter gene-based replication assay reveals exchangeability of replication factors of porcine circovirus types 1 and 2. J Virol 77, 9885-93. Mankertz, J., Buhk, H.J., Blaess, G. and Mankertz, A., 1998b. Transcription analysis of porcine circovirus (PCV). Virus Genes 16, 267-76. McNeilly, F., Kennedy, S., Moffett, D., Meehan, B.M., Foster, J.C., Clarke, E.G., Ellis, J.A., Haines, D.M., Adair, B.M. and Allan, G.M., 1999. A comparison of in situ hybridization and immunohistochemistry for the detection of a new porcine circovirus in formalin-fixed tissues from pigs with post-weaning multisystemic wasting syndrome (PMWS). J Virol Methods 80, 123-8. Meehan, B.M., Creelan, J.L., McNulty, M.S. and Todd, D., 1997. Sequence of porcine circovirus DNA: affinities with plant circoviruses. J Gen Virol 78 ( Pt 1), 221-7. Meehan, B.M., McNeilly, F., Todd, D., Kennedy, S., Jewhurst, V.A., Ellis, J.A., Hassard, L.E., Clark, E.G., Haines, D.M. and Allan, G.M., 1998. Characterization of novel circovirus DNAs associated with wasting syndromes in pigs. J Gen Virol 79 ( Pt 9), 2171-9. 141

Meerts, P., Misinzo, G., McNeilly, F. and Nauwynck, H.J., 2005. Replication kinetics of different porcine circovirus 2 strains in PK-15 cells, fetal cardiomyocytes and macrophages. Arch Virol 150, 427-41. Nawagitgul, P., Harms, P.A., Morozov, I., Thacker, B.J., Sorden, S.D., Lekcharoensuk, C. and Paul, P.S., 2002. Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. Clin Diagn Lab Immunol 9, 33-40. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D. and Paul, P.S., 2000. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81, 2281-7. Nayar, G.P., Hamel, A. and Lin, L., 1997. Detection and characterization of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. Can Vet J 38, 385-6. Niagro, F.D., Forsthoefel, A.N., Lawther, R.P., Kamalanathan, L., Ritchie, B.W., Latimer, K.S. and Lukert, P.D., 1998. Beak and feather disease virus and porcine circovirus genomes: intermediates between the geminiviruses and plant circoviruses. Arch Virol 143, 1723-44. Nielsen, J., Vincent, I.E., Botner, A., Ladekaer-Mikkelsen, A.S., Allan, G., Summerfield, A. and McCullough, K.C., 2003. Association of lymphopenia with porcine circovirus type 2 induced postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 92, 97-111. Nunez, A., McNeilly, F., Perea, A., Sanchez-Cordon, P.J., Huerta, B., Allan, G. and Carrasco, L., 2003. Coinfection by Cryptosporidium parvum and porcine circovirus type 2 in weaned pigs. J Vet Med B Infect Dis Vet Public Health 50, 255-8. O'Connor, B., Gauvreau, H., West, K., Bogdan, J., Ayroud, M., Clark, E.G., Konoby, C., Allan, G. and Ellis, J.A., 2001. Multiple porcine circovirus 2-associated abortions and reproductive failure in a multisite swine production unit. Can Vet J 42, 551-3. Olvera, A., Sibila, M., Calsamiglia, M., Segales, J. and Domingo, M., 2004. Comparison of porcine circovirus type 2 load in serum quantified by a real time PCR in postweaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected pigs. J Virol Methods 117, 75-80. Onuki, A., Abe, K., Togashi, K., Kawashima, K., Taneichi, A. and Tsunemitsu, H., 1999. Detection of porcine circovirus from lesions of a pig with wasting disease in Japan. J Vet Med Sci61, 1119-23. Oppenheim, J.J., Zachariae, C.O., Mukaida, N. and Matsushima, K., 1991. Properties of the novel proinflammatory supergene "intercrine" cytokine family. Annu Rev Immunol 9,617-48. Opriessnig, T., Thacker, E.L., Yu, S., Fenaux, M., Meng, X.J. and Halbur, P.G., 2004. Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2. Vet Pathol 41, 624-40. Opriessnig, T., Yu, S., Gallup, J.M., Evans, R.B., Fenaux, M., Pallares, F., Thacker, E.L., Brockus, C.W., Ackermann, M.R., Thomas, P., Meng, X.J. and Halbur, P.G., 2003. Effect of vaccination with selective bacterins on conventional pigs infected with type 2 porcine circovirus. Vet Pathol 40, 521-9. 142

Pallares, F.J., Halbur, P.G., Opriessnig, T., Sorden, S.D., Villar, D., Janke, B.H., Yaeger, M.J., Larson, D.J., Schwartz, K.J., Yoon, K.J. and Hoffman, L.J., 2002. Porcine circovirus type 2 (PCV-2) coinfections in US field cases of postweaning multisystemic wasting syndrome (PMWS). J Vet Diagn Invest 14, 515-9. Park, J.S., Kim, J., Ha, Y., Jung, K., Choi, C., Lim, J.K., Kim, S.H. and Chae, C., 2005. Birth abnormalities in pregnant sows infected intranasally with porcine circovirus 2. J Comp Pathol 132, 139-44. Pensaert, M.B., Sanchez, R.E., Ladekjaer-Mikkelsen, A.S., Allan, G.M. andNauwynck, H.J., 2004. Viremia and effect of fetal infection with porcine viruses with special reference to porcine circovirus 2 infection. Vet Microbiol 98, 175-183. Phénix, K.V., Weston, J.H., Ypelaar, I., Lavazza, A., Smyth, J.A., Todd, D., Wilcox, G.E. and Raidal, S.R., 2001. Nucleotide sequence analysis of a novel circovirus of canaries and its relationship to other members of the genus Circovirus of the family Circoviridae. J Gen Virol 82, 2805-9. Pogranichniy, R.M., Yoon, K.J., Harms, P.A., Sorden, S.D. and Daniels, M., 2002. Case- control study on the association of porcine circovirus type 2 and other swine viral pathogens with postweaning multisystemic wasting syndrome. J Vet Diagn Invest 14, 449-56. Pogranichnyy, R.M., Yoon, K.J., Harms, P.A., Swenson, S.L., Zimmerman, J.J. and Sorden, S.D., 2000. Characterization of immune response of young pigs to porcine circovirus type 2 infection. Viral Immunol 13, 143-53. Pringle, C.R., 1999. Virus at the Xlth International Congress of Virology, Sydney, Australia, 1999. Arch Virol 144, 2065-70. Quintana, J., Segales, J., Rosell, C., Calsamiglia, M., Rodriguez-Arrioja, G.M., Chianini, F., Folch, J.M., Maldonado, J., Canal, M., Plana-Duran, J. and Domingo, M., 2001. Clinical and pathological observations on pigs with postweaning multisystemic wasting syndrome. Vet Rec 149, 357-61. Resendes, A., Segales, J., Balasch, M., Calsamiglia, M., Sibila, M., Ellerbrok, H., Mateu, E., Plana-Duran, J., Mankertz, A. and Domingo, M., 2004a. Lack of an effect of a commercial vaccine adjuvant on the development of postweaning multisystemic wasting syndrome (PMWS) in porcine circovirus type 2 (PCV2) experimentally infected conventional pigs. Vet Res 35, 83-90. Resendes, A.R., Majo, N., Segales, J., Espadamala, J., Mateu, E., Chianini, F., Nofrarias, M. and Domingo, M., 2004b. Apoptosis in normal lymphoid organs from healthy normal, conventional pigs at different ages detected by TUNEL and cleaved caspase-3 immunohistochemistry in paraffin-embedded tissues. Vet Immunol Immunopathol 99,203-13. Resendes, A.R., Majo, N., Segales, J., Mateu, E., Calsamiglia, M. and Domingo, M., 2004c. Apoptosis in lymphoid organs of pigs naturally infected by porcine circovirus type 2. J Gen Virol 85, 2837-44. Ritchie, B.W., Niagro, F.D., Lukert, P.D., Steffens, W.L., 3rd and Latimer, K.S., 1989. Characterization of a new virus from cockatoos with psittacine beak and feather disease. Virology 171, 83-8. 143

Roca, M., Balasch, M., Segales, J., Calsamiglia, M., Viaplana, E., Urniza, A., Hattermann, K., Mankertz, A., Plana-Duran, J. and Domingo, M., 2004. In vitro and in vivo characterization of an infectious clone of a European strain of porcine circovirus type 2. J Gen Virol 85, 1259-66. Rodriguez-Arrioj a, G.M., Segales, J., Balasch, M., Rosell, C., Quintant, J., Folch, J.M., Plana-Duran, J., Mankertz, A. and Domingo, M., 2000. Serum antibodies to porcine circovirus type 1 and type 2 in pigs with and without PMWS. Vet Rec 146, 762-4. Rodriguez-Arrioja, G.M., Segales, J., Calsamiglia, M., Resendes, A.R., Balasch, M., Plana- Duran, J., Casal, J. and Domingo, M., 2002. Dynamics of porcine circovirus type 2 infection in a herd of pigs with postweaning multisystemic wasting syndrome. Am J Vet Res 63, 354-7. Rodriguez-Arrioj a, G.M., Segales, J., Rosell, C., Quintana, J., Ayllon, S., Camprodon, A. and Domingo, M., 1999. Aujeszky's disease virus infection concurrent with postweaning multisystemic wasting syndrome in pigs. Vet Rec 144, 152-3. Rollins, B.J., 1997. Chemokines. Blood 90, 909-28. Rosell, C., Segales, J. and Domingo, M., 2000a. Hepatitis and staging of hepatic damage in pigs naturally infected with porcine circovirus type 2. Vet Pathol 37, 687-92. Rosell, C., Segales, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioj a, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S. and Domingo, M., 1999. Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120, 59-78. Rosell, C., Segales, J., Ramos-Vara, J.A., Folch, J.M., Rodriguez-Arrioja, G.M., Duran, C.O., Balasch, M., Plana-Duran, J. and Domingo, M., 2000b. Identification of porcine circovirus in tissues of pigs with porcine dermatitis and nephropathy syndrome. Vet Rec 146, 40-3. Rovira, A., Balasch, M., Segales, J., Garcia, L., Plana-Duran, J., Rosell, C., Ellerbrok, H., Mankertz, A. and Domingo, M., 2002. Experimental inoculation of conventional pigs with porcine reproductive and respiratory syndrome virus and porcine circovirus 2. J Virol 76, 3232-9. Royer, R.L., P.N., Halbur, P.G. and Pau, P.S., 2001. Susceptibility of porcine circovirus type 2 to commercial and laboratory disinfectants. Swine Health and Production 9, 218- 284. Sanchez, R., Nauwynck, H.J., Pensaert, M.B.„ 2001. Localization and identification of porcine circovirus 2 target cells in fetuses. Proceedings of the International Conference on SsDNA Vir. Plants, Birds, Pigs, Primates,, 130. Sanchez, R.E., Jr., Meerts, P., Nauwynck, H.J., Ellis, J.A. and Pensaert, M.B., 2004. Characteristics of porcine circovirus-2 replication in lymphoid organs of pigs inoculated in late gestation or postnatally and possible relation to clinical and pathological outcome of infection. J Vet Diagn Invest 16,175-85. Sanchez, R.E., Jr., Meerts, P., Nauwynck, H.J. and Pensaert, M.B., 2003. Change of porcine circovirus 2 target cells in pigs during development from fetal to early postnatal life. Vet Microbiol 95, 15-25. 144

Saoulidis, K., Kyriakis, S C., Kennedy, S., Lekkas, S., Miliotis Ch, C., Allan, G., Balkamos, G.C. and Papoutsis, P.A., 2002. First report of post-weaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome in pigs in Greece. J Vet Med B Infect Dis Vet Public Health 49, 202-5. Sarli, G., Mandrioli, L., Laurenti, M., Sidoli, L., Cerati, C., Rolla, G. and Marcato, P.S., 2001. Immunohistochemical characterisation of the lymph node reaction in pig post­ weaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 83, 53-67. Schulze, C., Segales, J., Neumann, G., Hlinak, A., Calsamiglia, M. and Domingo, M., 2004. Identification of postweaning multisystemic wasting syndrome in European wild boar (Sus scrofa). Vet Rec 154, 694-6. Segales, J., Alonso, F., Rosell, C., Pastor, J., Chianini, F., Campos, E., Lopez-Fuertes, L., Quintana, J., Rodriguez-Arrioj a, G., Calsamiglia, M., Pujols, J., Dominguez, J. and Domingo, M., 2001. Changes in peripheral blood leukocyte populations in pigs with natural postweaning multisystemic wasting syndrome (PMWS). Vet Immunol Immunopathol 81, 37-44. Segales, J., Calsamiglia, M., Rosell, C., Soler, M., Maldonado, J., Martin, M. and Domingo, M., 2002. Porcine reproductive and respiratory syndrome virus (PRRSV) infection status in pigs naturally affected with post-weaning multisystemic wasting syndrome (PMWS) in Spain. Vet Microbiol 85, 23-30. Segales, J. and Domingo, M., 2002. Postweaning multisystemic wasting syndrome (PMWS) in pigs. A review. Vet Q 24, 109-24. Segales, J., Domingo, M., Chianini, F., Majo, N., Domi, nguez, J., Darwich, L. and Mateu, E., 2004a. Immunosuppression in postweaning multisystemic wasting syndrome affected pigs. Vet Microbiol 98, 151-158. Segales, J., Pastor, J., Cuenca, R. and Domingo, M., 2000. Haematological parameters in postweaning multisystemic wasting syndrome-affected pigs. Vet Rec 146, 675-6. Segales, J., Piella, J., Marco, E., Mateu-de-Antonio, E.M., Espuna, E. and Domingo, M., 1998. Porcine dermatitis and nephropathy syndrome in Spain. Vet Rec 142,483-6. Segales, J., Rosell, C. and Domingo, M., 2004b. Pathological findings associated with naturally acquired porcine circovirus type 2 associated disease. Vet Microbiol 98, 137-49. Segales, J., Sitjar, M., Domingo, M., Dee, S., Del Pozo, M., Noval, R., Sacristan, C., De las Heras, A., Ferro, A. and Latimer, K.S., 1997. First report of post-weaning multisystemic wasting syndrome in pigs in Spain. Vet Rec 141, 600-1. Shibahara, T., Sato, K., Ishikawa, Y. and Kadota, K., 2000. Porcine circovirus induces B lymphocyte depletion in pigs with wasting disease syndrome. J Vet Med Sci 62, 1125-31. Shibata, I., Okuda, Y., Yazawa, S., Ono, M., Sasaki, T., Itagaki, M., Nakajima, N., Okabe, Y. and Hidejima, I., 2003. PCR detection of Porcine circovirus type 2 DNA in whole blood, serum, oropharyngeal swab, nasal swab, and feces from experimentally infected pigs and field cases. J Vet Med Sci 65, 405-8. 145

Sibila, M., Calsamiglia, M., Segales, J., Blanchard, P., Badiella, L., Le Dimna, M., Jestin, A. and Domingo, M., 2004. Use of a polymerase chain reaction assay and an ELISA to monitor porcine circovirus type 2 infection in pigs from farms with and without postweaning multisystemic wasting syndrome. Am J Vet Res 65, 88-92. Sipos, W., Duvigneau, J.C., Willheim, M., Schilcher, F., Hartl, R.T., Hofbauer, G., Exel, B., Pietschmann, P. and Schmoll, F., 2004. Systemic cytokine profile in feeder pigs suffering from natural postweaning multisystemic wasting syndrome (PMWS) as determined by semiquantitative RT-PCR and flow cytometric intracellular cytokine detection. Vet Immunol Immunopathol 99, 63-71. Sirinarumitr, T., Morozov, I., Nawagitgul, P., Sorden, S.D., Harms, P.A. and Paul, P.S., 2000. Utilization of a rate enhancement hybridization buffer system for rapid in situ hybridization for the detection of porcine circovirus in cell culture and in tissues of pigs with postweaning multisystemic wasting syndrome. J Vet Diagn Invest 12, 562- 5. Smith, W.J., Thomson, J.R. and Done, S., 1993. Dermatitis/nephropathy syndrome of pigs. Vet Rec 132, 47. Stevenson, G.W., Kiupel, M., Mittal, S.K., Choi, J., Latimer, K.S. and Kanitz, C.L., 2001. Tissue distribution and genetic typing of porcine circoviruses in pigs with naturally occurring congenital tremors. J Vet Diagn Invest 13, 57-62. Terai, C., Wasson, D.B., Carrera, C.J. and Carson, D.A., 1991. Dependence of cell survival on DNA repair in human mononuclear phagocytes. J Immunol 147, 4302-6. Thacker, E.L., 2001. Immunology of the porcine respiratory disease complex. Vet Clin North Am Food Anim Pract 17, 551-65. Thibault, S., Drolet, R., Germain, M.C., DAllaire, S., Larochelle, R. and Magar, R., 1998. Cutaneous and systemic necrotizing vasculitis in swine. Vet Pathol 35, 108-16. Thomson, J., Smith, B., Allan, G., McNeilly, F. and McVicar, C., 2000. PDNS, PMWS and porcine circovirus type 2 in Scotland. Porcine dermatitis and nephropathy syndrome. Post-weaning multisystemic wasting syndrome. Vet Rec 146, 651-2. Thomson, J.R., Maclntyre, N., Henderson, L.E. and Meikle, C.S., 2001. Detection of Pasteurella multocida in pigs with porcine dermatitis and nephropathy syndrome. Vet Rec 149,412-7. Tischer, I., Bode, L., Apodaca, J., Timm, H., Peters, D., Rasch, R., Pociuli, S. and Gerike, E., 1995. Presence of antibodies reacting with porcine circovirus in sera of humans, mice, and cattle. Arch Virol 140, 1427-39. Tischer, I. and Buhk, H.J., 1988. Viral DNA from cells infected with porcine circovirus. Zentralbl Bakteriol Mikrobiol Hyg [A] 270, 280-7. Tischer, I., Gelderblom, H., Vettermann, W. and Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295, 64-6. Tischer, I., Mields, W., Wolff, D., Vagt, M. and Griem, W., 1986. Studies on epidemiology and pathogenicity of porcine circovirus. Arch Virol 91, 271-6. Tischer, I., Peters, D., Rasch, R. and Pociuli, S., 1987. Replication of porcine circovirus: induction by glucosamine and cell cycle dependence. Arch Virol 96, 39-57. Tischer, I., Rasch, R. and Tochtermann, G., 1974. Characterization of papovavirus-and picornavirus-like particles in permanent pig kidney cell lines. Zentralbl Bakteriol [Orig A] 226, 153-67. 146

Todd, D., Niagro, F.D., Ritchie, B.W., Curran, W., Allan, G.M., Lukert, P.D., Latimer, K.S., Steffens, W.L., 3rd and McNulty, M.S., 1991. Comparison of three animal viruses with circular single-stranded DNA genomes. Arch Virol 117, 129-35. Todd, D., Weston, J.H., Soike, D. and Smyth, J.A., 2001. Genome sequence determinations and analyses of novel circoviruses from goose and pigeon. Virology 286, 354-62. Trujano, M., Iglesias, G., Segales, J. and Palacios, J.M., 2001. PCV-2 from emaciated pigs in Mexico. Vet Rec 148, 792. Truong, C., Mahe, D., Blanchard, P., Le Dimna, M., Madec, F., Jestin, A. and Albina, E., 2001. Identification of an immunorelevant ORF2 epitope from porcine circovirus type 2 as a serological marker for experimental and natural infection. Arch Virol 146, 1197-211. Vicente, J., Segales, J., Hofle, U., Balasch, M., Plana-Duran, J., Domingo, M. and Gortazar, C., 2004. Epidemiological study on porcine circovirus type 2 (PCV2) infection in the European wild boar (Sus scrofa). Vet Res 35, 243-53. Vincent, I.E., Carrasco, C.P., Herrmann, B., Meehan, B.M., Allan, G.M., Summerfield, A. and McCullough, K.C., 2003. Dendritic cells harbor infectious porcine circovirus type 2 in the absence of apparent cell modulation or replication of the virus. J Virol 77, 13288-300. Walker, I.W., Konoby, C.A., Jewhurst, V.A., McNair, I., McNeilly, F., Meehan, B.M., Cottrell, T.S., Ellis, J.A. and Allan, G.M., 2000. Development and application of a competitive enzyme-linked immunosorbent assay for the detection of serum antibodies to porcine circovirus type 2. J Vet Diagn Invest 12, 400-5. Wellenberg, G.J., Stockhofe-Zurwieden, N., de Jong, M.F., Boersma, W.J. and Elbers, A.R., 2004. Excessive porcine circovirus type 2 antibody titres may trigger the development of porcine dermatitis and nephropathy syndrome: a case-control study. Vet Microbiol 99, 203-14. West, K.H., Bystrom, J.M., Wojnarowicz, C., Shantz, N., Jacobson, M., Allan, G.M., Haines, D.M., Clark, E.G., Krakowka, S., McNeilly, F., Konoby, C., Martin, K. and Ellis, J.A., 1999. Myocarditis and abortion associated with intrauterine infection of sows with porcine circovirus 2. J Vet Diagn Invest 11, 530-2. Williams, K., Schwartz, A., Corey, S., Grandie, M., Kennedy, W., Thompson, B., Alvarez, X., Brown, C., Gartner, S. and Lackner, A., 2002. Proliferating cellular nuclear antigen expression as a marker of perivascular macrophages in simian immunodeficiency virus encephalitis. Am J Pathol 161, 575-85. Williams, P.P., 1993. Immunomodulating effects of intestinal absorbed maternal colostral leukocytes by neonatal pigs. Can J Vet Res 57, 1-8. Wolpe, S.D., Davatelis, G., Sherry, B., Beutler, B., Hesse, D.G., Nguyen, H.T., Moldawer, L.L., Nathan, C.F., Lowry, S.F. and Cerami, A., 1988. Macrophages secrete a novel heparin-binding protein with inflammatory and neutrophil chemokinetic properties. J Exp Med 167, 570-81. Woods, L.W., Latimer, K.S., Barr, B.C., Niagro, F.D., Campagnoli, R.P., Nordhausen, R.W. and Castro, A.E., 1993. Circovirus-like infection in a pigeon. J Vet Diagn Invest 5, 609-12. 147

Yang, J.S., Song, D.S., Kim, S.Y., Lyoo, K.S. and Park, B.K., 2003. Detection of porcine circovirus type 2 in feces of pigs with or without enteric disease by polymerase chain reaction. J Vet Diagn Invest 15, 369-73. Yoon, K.J., Jepsen, R.J., Pogranichniy, R.M., Sorden, S., Stammer, R. and Evans, L.E., 2004. A novel approach to intrauterine viral inoculation of swine using PCV type 2 as a model. Theriogenology 61, 1025-37. Yu, S., Carpenter, S., Opriessnig, T., Halbur, P.O. and Thacker, E., 2005. Development of a reverse transcription-PCR assay to detect porcine circovirus type 2 transcription as a measure of replication. J Virol Methods 123, 109-12. 148

ACKNOWLEDGEMENTS

First of all, I would like to thank my major professor, Dr. Eileen Thacker for her guidance and support throughout my graduate studies. Her encouragement and support enable me to conduct my research independently. Words cannot express all of my gratitude towards her. I am so thankful to all members of my committee: Ors. Patrick Halbur, Brad

Thacker, Michael Wannemuehler, and Chris Minion. You have made great contributions to my academic study and research project and I have learned a lot from each of you.

I am very thankful for the help from everyone in Thacker's laboratory. The

technicians: Nancy Upchurch, Barbara Erickson and Kris Ruebling help me order reagents

and get them ready for my experiment. You have made my live in the Lab easier. I feel so

lucky to have my fellow graduate students, Pravina Voraphani, Amy Vincent, Erin Strait,

Kate Jones, Dachrit Nilubol and Brad Leuwerke. We are quite a team. In addition, I am

thankful to Heather Hilbrands, Gavin Yager, Maggie Aleff, and Raye Taylor for helping me

with the necropsy, the bleeding from pigs, and processing my experimental samples. I could

not finish my experiments without any help from them all.

I appreciate the support from Healthy Livestock Initiative Competitive Grants

Program. I am thankful to everyone at the Department of Veterinary Microbiology and

Preventive medicine for their friendship and kind assistance. I would also like to thank Dr.

Deming Zhao, my former adviser at China Agriculture University for his inspiration to guide

me here.

Finally, I would like to thank my family for their love, support and understanding all

these years. Thank you all!