Detection of porcine circoviruses in clinical specimens using multiplex PCR in Hubei, central China
Keli Yang Corresp., 1 , Zuwu Jiao 1 , Danna Zhou 1 , Rui Guo 1 , Zhengying Duan 1 , Fangyan Yuan 1 , Yongxiang Tian 1
1 Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Sciences, Wuhan, Hubei, China
Corresponding Author: Keli Yang Email address: [email protected]
In order to detect and simultaneously discriminate PCV1, PCV2 and PCV3, a multiplex PCR assay was developed and used to detect clinical samples in this study. Each of target genes of PCV1, PCV2 and PCV3 was amplified using the designed primers, while no other porcine viruses genes were detected. The limit of detection of the assay was 10 copies/μL of PCV1, PCV2 and PCV3. The tissue samples from eight pig farms were detected using the multiplex PCR assay. The results showed that PCV1, PCV2 and PCV3 are co-circulating in central China. The PCV1, PCV2 and PCV3 singular infection rate was 52.4% (150/286), 61.2% (175/286) and 45.1% (129/286), respectively, while the PCV1 and PCV2 co-infection rate was 11.2% (32/286), the PCV1 and PCV3 co-infection rate was 5.9% (17/286), the PCV2 and PCV3 co-infection rate was 23.4% (67/286), and the PCV1, PCV2 and PCV3 co- infection rate was 1.7% (5/286), respectively, which were 100% consistent with the sequencing method and Real-time PCR methods. It proved that this multiplex PCR assay could be used as a differential diagnostic tool for monitoring and control of PCVs in the field. The results also indicate that the PCVs infection and their co-infection are severe in Hubei Province, Central China.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Detection of porcine circoviruses in clinical specimens using multiplex PCR in Hubei, central China
1 Keli Yang1,2, Zuwu Jiao1, Danna Zhou1,3, Rui Guo1, Zhengying Duan1,
2 Fangyan Yuan1 and Yongxiang Tian1,2
3 1Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Sciences, Wuhan 430064, P. R. 4 China
5 2Key Laboratory of Prevention and Control Agents for Animal Bacteriosis (Ministry of Agriculture), Wuhan 430064, 6 P. R. China
7 3Hubei Key Laboratory of Animal Embryo and Molecular Breeding, Wuhan 430064, P. R. China
8 Corresponding authors
9 Keli Yang,
11 Yongxiang Tian,
12 [email protected] 13
14 ABSTRACT
15 In order to detect and simultaneously discriminate PCV1, PCV2 and PCV3, a multiplex PCR
16 assay was developed and used to detect clinical samples in this study. Each of target genes of
17 PCV1, PCV2 and PCV3 was amplified using the designed primers, while no other porcine
18 viruses genes were detected. The limit of detection of the assay was 10 copies/μL of PCV1,
19 PCV2 and PCV3. The tissue samples from eight pig farms were detected using the multiplex
20 PCR assay. The results showed that PCV1, PCV2 and PCV3 are co-circulating in central China.
21 The PCV1, PCV2 and PCV3 singular infection rate was 52.4% (150/286), 61.2% (175/286) and
22 45.1% (129/286), respectively, while the PCV1 and PCV2 co-infection rate was 11.2% (32/286),
23 the PCV1 and PCV3 co-infection rate was 5.9% (17/286), the PCV2 and PCV3 co-infection rate
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 24 was 23.4% (67/286), and the PCV1, PCV2 and PCV3 co-infection rate was 1.7% (5/286),
25 respectively, which were 100% consistent with the sequencing method and Real-time PCR
26 methods. It proved that this multiplex PCR assay could be used as a differential diagnostic tool
27 for monitoring and control of PCVs in the field. The results also indicate that the PCVs infection
28 and their co-infection are severe in Hubei province, Central China.
29 Keywords Porcine circovirus; PCV1; PCV2; PCV3; viral discrimination; multiplex PCR
30 INTRODUCTION
31 Porcine circoviruses (PCVs), are non-enveloped and circular DNA viruses, which belong to the
32 genus Circovirus, family Circoviridae (Mankertz et al., 2004). At present, PCVs are smallest
33 animal viruses. Two species of circovirus, PCV1 and PCV2, had been proved as infectious to
34 pigs before 2015 (Ku et al., 2017). PCV1 was first isolated and in 1974, which just was a
35 contaminant of the PK-15 cell, and nonpathogenic for pigs (Tischer et al., 1974; 1986). PCV2
36 was first identified from the pigs which was suffering post-weaning multisystemic wasting
37 syndrome (PMWS) in the middle of 1990s (Allan et al., 1998). Pigs infected PCV2 have various
38 clinical diseases, which have made the swine industries huge economic losses all over the world
39 (Opriessnig et al., 2007). In 2016, a novel circovirus, called PCV type 3 (PCV3), was isolated
40 from diseased pigs in the USA (Phan et al., 2016; Palinski et al., 2017). Subsequently, several
41 outbreaks of it were reported from the United Kingdom of Great Britain (Collins et al., 2017),
42 Poland (Stadejek et al 2017), Italy, Denmark, Spain (Franzo et al., 2018), Korean (Kwon et al.,
43 2017), Brazil (Tochetto et al., 2018), and China (Fan et al., 2017; Ku et al., 2017; Zhai et al.,
44 2017; Zheng et al., 2017). PCV1 and PCV3 had been confirmed as potential pathogen associated
45 with many kinds of clinical symptoms, which are similar as PCV2 infection (Saha et al., 2011;
46 Palinski et al., 2017; Kwon et al., 2017; Ku et al., 2017; Franzo et al., 2018). And now, PCV3
47 has been found in about 20 provinces in China (Fig. 1).
48 Both PCV1 and PCV2 infections are common in pig herds all over the world (Beach et al.,
49 2010), and PCV3 is the third porcine circovirus type found in swine, which is circulating in the
50 swine population (Palinski et al., 2017). The clinical manifestations of PCV3 are similar to those
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 51 of PCV2 and to co-infection with PCV1, PCV2 and PCV3 in pig herds in the several countries
52 described above. The co-infection of PCV3 with PCV2 was reported in clinical samples of
53 diseased pigs in Hubei province (Ku et al. 2017). And co-infection of PCV2 with PCV1 was
54 found in Hubei province. However, PCV1, PCV2 and PCV3 or their co-infections were tested
55 separately using different methods in the previous reports. Considering the similarities between
56 the clinical manifestations associated with PCV3 and PCV2, and the high impact of PCV2 and
57 PCV3 on the economy of pig industry, it is necessary to develop a rapid, convenient, sensitive,
58 and specific diagnostic approach to discriminate PCV1, PCV2 and PCV3 infection.
59 However, there is no rapid, convenient and specific diagnostic assay capable of
60 differentiating PCV1, PCV2 and PCV3 infection. Therefore, to understand the current
61 epidemiology of PCVs in Hubei province, a rapid, simple, specific and sensitive multiplex PCR
62 assay was developed to detect and discriminate PCV1, PCV2 and PCV3. The accuracy and
63 applicability of the multiplex PCR were evaluated for detection of PCVs DNA in clinical
64 samples collected from the eight pig farms in Hubei province (Fig. 1) where co-infection of
65 PCVs was reported (Ku et al. 2017). The objective of the present study was to investigate the
66 epidemiological characteristics of PCVs in the Hubei province using the developed multiplex
67 PCR.
68 MATERIALS AND METHODS
69 Cells and viruses
70 PK15 cells were cultured in DMEM supplemented with 10% fetal bovine serum (Gibco) at 37
71 °C in an incubator with humidified 5% CO2. PCV1, PCV2, PCV3 and other viruses, including
72 classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus
73 (PRRSV), pseudorabies virus (PRV), porcine parvovirus (PPV), rotavirus (RV), Japanese
74 encephalitis virus (JEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus
75 (PDCoV), stored at Key Laboratory of Prevention and Control Agents for Animal Bacteriosis
76 (Ministry of Agriculture), were used to verify the specificity of the developed multiplex PCR
77 assay. And the viruses PCV1, PCV2, PCV3 were also used as positive control viruses. Viral
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 78 genomic DNA or RNA for the specificity of the proposed multiplex PCR assay were extracted
79 according to our previous study (Yang et al., 2017).
80 Primers design
81 The primers were designed based on PCV1, PCV2, PCV3 sequences in GenBank database
82 (Table 1). The PCR-amplified PCV1, PCV2 and PCV3 products were 310, 505 and 1021 bp,
83 respectively. The primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).
84 DNA extraction
85 Viral DNA samples for proposed multiplex PCR were extracted using the Viral DNA/RNA
86 Miniprep Kit (Axygen Scientific, CA, USA) from the tissue samples. Total DNA was eluted
87 with 30 μL of diethyl pyrocarbonate-treated water, used immediately or stored at -80 °C.
88 Optimization of the Multiplex PCR
89 In order to obtain the best reaction parameters, the multiplex PCR was optimized by varying
90 single parameters while other parameters were maintained. The optimization was performed in a
91 50 µL PCR reaction mixture as follows: 10 × PCR buffer 5.0 µL, 10 mM dNTPs 2-4 µL, each 10
92 µM primer (Table 1) 0.5-1 µL, Taq DNA polymerase (5U/µL) (TaKaRa, Dalian, China) 0.5-1
93 µL, the DNA template 3.0-5.0 µL, and added distilled water to 50 µL. 94 The amplifications were performed under the following conditions in a thermal cycler (Bio- 95 Rad, Hercules, CA, USA). After 5 min initial denaturation at 95 °C, 35 cycles were conducted at 96 94 °C for 40 s, 52-58 °C for 40 s and 72 °C for 50-70 s, followed by a 10-min final extension at 97 72 °C. The PCR products were detected according to our previous study (Yang et al., 2017). The 98 specific viral targets fragments were cloned into the plasmid pMD18-T (TaKaRa, Dalian, China). 99 Plasmids containing the PCV1, PCV2 or PCV3 gene were purified using a MiniBEST Plasmid 100 Purification Kit (TaKaRa, Dalian, China). Each plasmid sample concentration was determined 101 by measuring the absorbance at 260 nm using a Eppendorf BioSpectrometer (Eppendorf, 102 Hamburg, Germany), and each cloned gene copy numbers was quantified as previously 103 described (Parida et al., 2011). The standard PCV1, PCV2 and PCV3 DNA samples were ten-
104 fold diluted (from 107 to 10-2 copies/μL) and stored at −80 °C until use.
105 Specificity and sensitivity of the multiplex PCR
106 Specificity of the multiplex PCR assay was determined by using the DNA or cDNA of above-
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 107 mentioned porcine viruses as templates and ddH2O as a negative control. PCV1, PCV2 and
108 PCV3 were verified by sequencing and the other virus strains (CSFV, PRRSV, PRV, PPV, RV,
109 JEV, PEDV and PDCoV) were identified by serological or PCR methods.
110 Total DNA from the plasmids was extracted and used to detect the sensitivity of the developed
111 multiplex PCR assay. The ten-fold diluted standard PCV1, PCV2 or PCV3 DNA samples (from
112 107 to 10-2 copies/μL) were used as templates for multiplex PCR.
113 Clinical Sample Collection
114 A total of 286 tissue samples including lung, spleen and lymph node, were collected from
115 diseased pigs from eight farms in Hubei Province (Fig. 1), central China, from July to December,
116 2017. These pigs were suspected to have clinical signs of PCVs. Specifically, the clinical signs
117 of the diseased pig were as follow: 92 samples of reproductive failure cases, 78 samples of pigs
118 with PMWS, 65 samples of respiratory disorders cases, 36 diarrhea samples and 15 PDNS
119 samples. All samples were collected in accordance with the standards for animal welfare
120 approved by the Animal Ethics Committee of the Hubei province.
121 Sample preparation and detection of PCVs
122 The tissue samples were 5-fold diluted with phosphate-buffered saline (0.1 M, pH 7.2) and
123 homogenized. All samples were frozen and thawed three times, and centrifuged at 12,000 rpm
124 for 5 min at 4 °C. The supernatants were used for DNA extraction immediately or stored at −80
125 °C until use.
126 The DNA of the clinical specimens were detected using the multiplex PCR assay to
127 investigate the epidemiology of PCVs in Hubei province, central China. To confirm the accuracy
128 of the developed protocol, each PCR product of positive samples was cloned into the plasmid
129 pMD18-T and sequenced. And two Real-time PCR methods (Kim et al., 2017; Li et al., 2013)
130 were used to detect PCV1, PCV2 and PCV3 for comparison.
131 RESULTS
132 Optimization of the Multiplex PCR assay
133 The optimum parameters of the proposed multiplex PCR were as follows. A final 50-µL volume
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 134 of master mix for the multiplex PCR including 10×Buffer 5.0 μL, Taq polymerase (5 U/μL) 0.5
135 μL, DNA template 5.0 μL, dNTPs (10 mM) 4 μL, each primer (10 μM) 1.0 μL, and nuclease-free
136 water was added to 50 μL. An optimized experimental protocol consisted of a 5-min denaturation
137 program at 95 °C, and 35 cycles amplification program (denaturation at 94 °C for 40 s, 56 °C for
138 40 s, and elongation at 72°C for 50 s), followed by an extension at 72°C for 10 min.
139 DNAs of PCV1, PCV2, PCV3, and ddH2O, the negative control, were detected using the
140 protocol described above and the multiplex PCR amplification results are illustrated in Fig. 2.
141 Specificity and sensitivity of the proposed multiplex PCR
142 The specificity of the three primer pairs for PCVs was analyzed using the developed multiplex
143 PCR. As illustrated in Fig. 3, the multiplex PCR assay was specific for PCVs because no
144 amplification products occurred with CSFV, PRRSV, PRV, PPV, RV, JEV, PEDV, PDCoV and
145 ddH2O (lanes 4-12), whereas the PCV1, PCV2 and PCV3 target genes were specifically
146 amplified using the three defined primer pairs (lanes 1-3).
147 The sensitivity of the proposed multiplex PCR assay was defined as the minimum DNA
148 molecules concentration which could be detected. DNA standards, which was 10-fold diluted,
149 with known copy numbers (107 copies/μL to 10-2 copies/μL) were used for multiplex PCR. As
150 shown in Fig. 4, the detection limits of multiplex PCR were 10 copies/μL plasmid DNA
151 molecules for PCV1, PCV2 and PCV3, which indicated that the sensitivity of the multiplex PCR
152 was 10 copies/μL for PCV1, PCV2 and PCV3.
153 Detection of viruses in clinical specimens
154 A total 286 clinical samples were detected by the multiplex PCR assay. The results were as
155 follows: The PCV1-positive, PCV2-positive and PCV3-positive rate at the farm level was 62.5%
156 (5/8), 87.5% (7/8) and 62.5% (5/8), respectively. The positive rates of PCV1, PCV2 and PCV3
157 in these samples were 52.4% (150/286), 61.2% (175/286) and 45.1% (129/286), respectively,
158 which were 100% consistent with the sequencing method and the Real-time PCR methods
159 (Table 2). The results of the multiplex PCR method and subsequent sequencing further
160 demonstrated the accuracy of the developed assay.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 161 Additionally, the PCV1 and PCV2 co-infection rate was 11.2% (32/286), the PCV1 and PCV3
162 co-infection rate was 5.9% (17/286), the PCV2 and PCV3 co-infection rate was 23.4% (67/286),
163 and the PCV1, PCV2 and PCV3 co-infection rate was 1.7% (5/286), respectively in the samples
164 from eight pig farms (Table 3). The total co-infection rate was 42.3% (121/286) in all of the
165 detected samples.
166 DISCUSSION
167 PCV3 is associated with nephropathy syndrome, reproductive failure and porcine dermatitis
168 (Palinski et al., 2017), respiratory disease complex, and cardiac and multisystemic inflammation
169 (Phan et al., 2016). PCV2 is clinically characterized by decreased weight gain, wasting, dyspnea,
170 and enlarged lymph nodes. It has also been identified from diseased pigs with various other
171 clinical presentations, such as porcine dermatitis and nephropathy syndrome, porcine respiratory
172 disease complex (PRDC) and reproductive failure (Chen et al., 2016). Therefore, PCV2 is
173 confirmed as an endemic viral disease of swine all over the world. And in modern swine
174 production, it is also recognized as one of the most economically important infectious pathogens
175 (Opriessnig et al., 2008). Although PCV1-seroprevalence at herd level diversifies between 10%
176 and 100% (Puvanendiran et al., 2011), it is generally known that PCV1 has no pathogenicity to
177 pigs (Allan et al., 1998; Tischer et al., 1986). It was found originally as a contaminant of the
178 porcine kidney cell line PK15 (Tischer et al., 1974). However, PCV1 has recently gained focus
179 of attention because it was discovered as contaminant in several live veterinary vaccines and
180 human vaccines (Beach et al., 2010; Pastoret, 2010). Moreover, PCV1 has been identified in
181 cases of congenital tremors in aborted/stillborn piglets and newborn pigs, which indicated that
182 PCV1 can proliferate and may produce pathological change in the lungs of fetal porcine (Saha et
183 al., 2011). There could be a potential damage to the piglets’ immune system caused by PCV1
184 infection (Cao et al., 2018). Both PCV1 and PCV2 infections are common in pig herds
185 worldwide (Allan & Ellis 2000), and PCV3 is already widely outbreak and distributed on pig
186 farms in many countries (Palinski et al., 2017; Kwon et al., 2017; Ku et al., 2017; Franzo et al.,
187 2018). Single infection of PCV2 or PCV3, or co-infection of PCV1, PCV2 and PCV3 could
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 188 cause many kinds diseases in pig herds (Collins et al., 2017; Ku et al., 2017; Kwon et al., 2017).
189 Veterinary workers should inestable suitable prevention and control policies for PCVs and their
190 novel strains emerging from viral evolution (Liu et al., 2018).
191 In order to establish prevention and control strategies for PCVs, a convenient and sensitive
192 diagnostic method is necessary to simultaneously detect and discriminate PCVs in clinical
193 samples. PCR assays are sensitive methods to detect a circovirus infection in viremia animals
194 (Denner & Mankertz, 2017). Several different PCR methods, including digital droplet PCR
195 (ddPCR), real-time PCR and quantitative PCR (qPCR) using specific primers have been
196 developed for detection of PCV1 and PCV2 (Brunborg et al., 2004; Chang et al., 2010;
197 Mankertz et al., 2000; Olvera et al., 2004; Quintana et al., 2006; Rovira et al., 2002; Segalés et
198 al., 2005; Wang et al., 2014; Wang et al., 2016; Zhao et al., 2010; Zhao et al., 2015). And
199 recently, two qPCR methods were proposed to detect and quantify PCV3 DNA (Wang et al.,
200 2017; Palinski et al., 2017). However, there is no specific, sensitive and reliable single assay
201 capable of detecting and differentiating infection by PCV1, PCV2 and PCV3. Therefore, a
202 specific, sensitive and rapid multiplex PCR assay to detect and discriminate PCV1, PCV2 and
203 PCV3 in clinical specimens was developed in the present study.
204 In this study, an efficient and sensitive multiplex PCR assay was developed to detect and
205 discriminate PCV1, PCV2 and PCV3 using three specific primer pairs. The amplified PCR
206 products of PCV1, PCV2 and PCV3 strain from the specific primers are very different, which
207 can be easily differentiated by electrophoresis. The specific primers for multiplex PCR assay
208 successfully amplified the 310-bp PCV1, 505-bp PCV2 or 1021-bp PCV3 gene. Furthermore, the
209 multiplex PCR assay with three sets of PCV1-, PCV2- and PCV3-specific primers
210 simultaneously detected and discriminated PCV1, PCV2 and PCV3 DNA in a single reaction.
211 And the sensitivity of the multiplex PCR assay was 10 copies/μL for PCV1, PCV2 and PCV3,
212 which is similar to several previous studies (Brunborg et al., 2004; Ku et al., 2017; Li et al.,
213 2018; Wang et al., 2017; Palinski et al., 2017; Zhang et al., 2018).
214 Although multiplex qPCR assays that can discriminate PCV2 and PCV3 have already been
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 215 developed, including one study from China (Li et al, 2018), but all the assays must be practiced
216 in an expensive instrument—Fluorescent Quantatitive PCR. It is unaffordable for many
217 laboratories especially which in the counties and towns in China, so the multiplex qPCR assays
218 couldn’t be practiced in their laboratories. However, almost all of them are equipped with the
219 conventional PCR. The sensitivity of the multiplex PCR assay in this study was 10 copies/μL for
220 PCV1, PCV2 and PCV3, which is similar to several qPCR assays. Definitely, the multiplex PCR
221 is a more convenient and sensitive diagnostic method to detect and discriminate PCVs in clinical
222 samples in China and any other developing countries.
223 A total of 286 specimens from eight pig farms in Hubei province, central China, were
224 analyzed using the proposed multiplex PCR. The results were 100% same as those of sequencing
225 method and Real-time PCR methods. The PCV1, PCV2 and PCV3 singular infection rate, the
226 PCV1 and PCV2 or PCV3 co-infection rate, the PCV2 and PCV3 or PCV1, PCV2 and PCV3 co-
227 infection rate were higher than the previous reports (Ku et al., 2017; Zhai et al., 2017; Zhang et
228 al., 2018). The results indicated that the PCVs infection and their co-infection are severe in
229 Hubei Province, Central China. And the epidemiology and genome characterizations of PCVs in
230 Hubei Province would be further studied in the near future.
231 DNAs of PCV2 and PCV3 were detected using multiplex PCR in aborted fetal tissue samples
232 and respiratory diseased piglet tissue samples. The results suggested that both PCV2 and PCV3
233 infection are associated with reproductive failure and respiratory disease at the infection pig
234 farms, as previous researches (Palinski et al., 2017; Ku et al., 2017; Wang et al., 2017). These
235 results indicated that co-infections, as well as singular infection of PCV1, PCV2 and PCV3, are
236 common in pig herds, which are similar with previous studies (Ku et al., 2017; Palinski et al.,
237 2017; Wang et al., 2017; Kwon et al., 2017). The PCV singular infection, and PCV1, PCV3 and
238 PCV2 co-infection play an etiological role in porcine circovirus associated disease (PCVAD),
239 which had caused huge economic losses to pig farms all over the world.
240 The multiplex PCR assay allows to detect PCVs in field samples with a sensitivity level, and
241 also allows to simultaneously discriminate PCV1, PCV2, and PCV3 in a single reaction, which
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 242 makes it lower consumption and less time. Considering the prevalence of PCV1, PCV2 and
243 PCV3 co-infection in the field, the multiplex PCR will enable the correct diagnosis of suspected
244 clinical cases and stimulate further epidemiological researches for its control.
245 CONCLUSIONS
246 In summary, the developed multiplex PCR is a rapid, convenient, sensitive, efficient, and highly
247 specific assay to detect and discriminate PCVs, which will be useful in etiological and
248 epidemiological studies, as well as diagnosis in clinical cases. The accuracy and simplicity of the
249 assay makes it a useful, suitable and powerful tool for PCVs detection, prevention and control in
250 China and any other developing countries.
251 ADDITIONAL INFORMATION AND DECLARATIONS
252 Funding
253 This study was supported by the National Key R & D Program of China (2016YFD0500703), the
254 Opening Subject of Key Laboratory of Prevention and Control Agents for Animal Bacteriosis
255 (Ministry of Agriculture) (2017ZD06). It was also financed by Hubei Province Innovation
256 Center of Agricultural Sciences and Technology (2016-620-000-001-026).
257 Competing Interests
258 The authors declare there are no competing interests.
259 Author Contributions
260 Keli Yang and Yongxiang Tian conceived and designed the experiments. Danna Zhou, Fangyan
261 Yuan and Zhengying Duan performed the experiments. Rui Guo and Zuwu Jiao performed
262 sampling, and provided the biological material. Keli Yang analyzed the data and wrote the paper.
263 All the authors read and approved the final manuscript.
264 REFERENCES
265 Allan GM, Ellis J A. 2000. Porcine circoviruses: a review. Journal of Veterinary Diagnostic 266 Investigation 12:3–14. DOI 10.1177/104063870001200102.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 267 Allan G, Krakowka S, Ellis J, Charreyre C. 2012. Discovery and evolving history of two 268 genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus 269 Research. 64:4–9. DOI 10.1016/j.virusres.2011.09.013. 270 Allan GM, McNeilly F, Kennedy S, Daft B, Clarke EG, Ellis JA, Haines DM, Meehan BM, 271 Adair BM. 1998. Isolation of porcine circovirus-like viruses from pigs with a wasting 272 disease in the USA and Europe. Journal of Veterinary Diagnostic Investigation 10:3–10. 273 DOI 10.1177/104063879801000102. 274 Beach NM, Juhan NM, Cordoba L, Meng XJ. 2010. Replacement of the replication factors of 275 porcine circovirus (PCV) type 2 with those of PCV type 1 greatly enhances viral replication 276 in vitro. Journal of Virology 84:8986–8989. DOI 10.1128/JVI.00522–10. 277 Brunborg IM, Moldal T, Jonassen CM. 2004. Quantitation of porcine circovirus type 2 278 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning 279 multisystemic wasting syndrome using a TaqMan-based real-time PCR. Journal of 280 Virological Methods 122:171–178. DOI 10.1016/j.jviromet.2004.08.014. 281 Cao L, Sun W, Lu H, Tian M, Xie C, Zhao G, Han J, Wang W, Zheng M, Du R, Jin N,
282 Qian A. 2018. Genetic variation analysis of PCV1 strains isolated from Guangxi Province
283 of China in 2015. BMC Veterinary Research 14(1):43. DOI 10.1186/s12917-018-1345-z. 284 Chang GN, Huang JF, Chen JT, Tsen HY, Wang JJ. 2010. Fast diagnosis and quantification 285 for porcine circovirus type 2 (PCV-2) using real-time polymerase chain reaction. Journal of 286 Microbiology, Immunology and Infection 43:85–92. DOI 10.1016/S1684-1182(10)60014-X. 287 Chen DJ, Wei YW, Huang LP, Wang YP, Sun JH, Du WJ, Wu HL, Liu CM. 2016. 288 Synergistic pathogenicity in sequential coinfection with Mycoplasma hyorhinis and porcine 289 circovirus type 2. Veterinary Microbiology 182:123–130. DOI 290 10.1016/j.vetmic.2015.11.003. 291 Collins PJ, McKillen J, Allan G. 2017. Porcine circovirus type 3 in the UK. Veterinary Record 292 181(22): 599. DOI 10.1136/vr.j5505. 293 Denner J, Mankertz A. 2017. Porcine Circoviruses and Xenotransplantation. Viruses, 9, 83, 294 DOI 10.3390/v9040083. 295 Fan S, Ku X, Chen F, Wang Y, Yu X, He Q. 2017. Complete genome sequence of a novel 296 porcine circovirus type 3 strain, PCV3/CN/Hubei-618/2016, Isolated from China. Genome 297 Announcements 5(15): e00100–e00117. DOI 10.1128/genomeA.00100–17.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 298 Franzo G, Legnardi M, Hjulsager CH, Klaumann F, Larsen LE, Segales J, Drigo M. 2018. 299 Full genome sequencing of porcine circovirus 3 fields strains from Denmark, Italy and 300 Spain demonstrates and high within-Europe genetic heterogenecity. Transboundary and 301 Emerging Disease. 65(3):602–606. DOI 10.1111/tbed.12836. 302 Kim HR, Park YR, Lim D, Park MJ, Park JY, Kim SH, Lee KK, Lyoo YS, Park CK. 2017. 303 Multiplex real-time polymerase chain reaction for the differential detection of porcine 304 circovirus 2 and 3. Journal of Virological Methods 250: 11-16. DOI 305 10.1016/j.jviromet.2017.09.021. 306 Ku X, Chen F, Li P, Wang Y, Yu X, Fan S, Qian P, Wu M, He Q. 2017. Identification and 307 genetic characterization of porcine circovirus type 3 in China. Transboundary and 308 Emerging Diseases 64:703–708. DOI 10.1111/tbed.12638. 309 Kwon T, Yoo SJ, Park CK, Lyoo YS. 2017. Prevalence of novel porcine circovirus 3 in Korean 310 pig populations. Veterinary Microbiology 207:178–180. DOI 10.1016/j.vetmic.2017.06.013. 311 Li J, Shi JL, Wu XY, Cong XY, Xu SJ, Yuan XY, Wu JQ, Sun WB, Du YJ, Peng Z, Wang 312 JB, Huang BH. 2013. Differentiation of PCV1 and PCV2 by a multiplex real-time PCR 313 assay. Veterinary Record 12,173(14):346. DOI 10.1136/vr.101686. 314 Liu JK, Wei CH, Ailing Dai AL, Lin ZF, Fan KW, Fan JL, Liu JY, Luo ML and Yang XY. 315 2018. Detection of PCV2e strains in Southeast China. Peer J 6:e4476. DOI 316 10.7717/peerj.4476. 317 Li X, Qiao M, Sun M, Tian K. 2018. A Duplex Real-Time PCR Assay for the Simultaneous 318 Detection of Porcine Circovirus 2 and Circovirus 3. Virologica Sinica 33(2): 181-186. DOI 319 10.1007/s12250-018-0025-2. 320 Mankertz A, Caliskan R, Hattermann K, Hillenbrand B, Kurzendoerfer P, Mueller B, 321 Schmitt C, Steinfeldt T, Finsterbusch T. 2004. Molecular biology of Porcine circovirus: 322 analyses of gene expression and viral replication. Veterinary Microbiology 98: 81–88. 323 Mankertz A, Domingo M, Folch JM, Le Cann P, Jestin A, Segalés J, Chmielewicz B, Plana- 324 Durán J, Soike D. 2000. Characterisation of PCV-2 isolates from Spain, Germany and 325 France. Virus Research 66: 65–77. 326 Olvera A, Sibila M, Calsamiglia M, Segalés J, Domingo M. 2004. Comparison of porcine 327 circovirus type 2 load in serum quantified by a real time PCR in postweaning multisystemic
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 328 wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected 329 pigs. Journal of Virological Methods 117: 75–80. DOI 10.1016/j.jviromet.2003.12.007. 330 Opriessnig T, Madson DM, Prickett JR, Kuhar D, Lunney JK, Elsener J, Halbur PG. 2008. 331 Effect of porcine circovirus type 2 (PCV2) vaccination on porcine reproductive and 332 respiratory syndrome virus (PRRSV) and PCV2 coinfection. Veterinary Microbiology 333 131(1–2): 103–114. DOI 10.1016/j.vetmic.2008.03.002. 334 Opriessnig T, Meng XJ, Halbur PG. 2007. Porcine circovirus type 2 associated disease: update 335 on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention 336 strategies. Journal of Veterinary Diagnostic Investigation 19: 591–615. DOI 337 10.1177/104063870701900601. 338 Palinski R, Piñeyro P, Shang P, Yuan F, Guo R, Fang Y, Byers E, Hause BM. 2017. A novel 339 porcine circovirus distantly related to known circoviruses is associated with porcine 340 dermatitis and nephropathy syndrome and reproductive failure. Journal of Virology 91: 341 e01879–16. DOI 10.1128/JVI.01879–16. 342 Parida M, Shukla J, Sharma S, Santhosh SR, Ravi V, Mani R, Thomas M, Khare S, Rai A, 343 Ratho RK, Pujari S, Mishra B, Rao PVL, Vijayaraghavan R. 2011. Development and 344 evaluation of reverse transcription loop-mediated isothermal amplification assay for rapid 345 and real-time detection of the swine-origin influenza A H1N1 virus. Journal of Molecular 346 Diagnostics 13: 100–107. 347 Pastoret PP. 2010. Human and animal vaccine contaminations. Biologicals 38: 332–334. DOI 348 10.1016/j.biologicals.2010.02.015. 349 Phan TG, Giannitti F, Rossow S, Marthaler D, Knutson T, Li L, Deng X, Resende T, 350 Vannucci F, Delwart E. 2016. Detection of a novel circovirus PCV3 in pigs with cardiac 351 and multi-systemic inflammation. Virology Journal 13(1): 184. DOI 10.1186/s12985–016– 352 0642–z. 353 Puvanendiran S, Stone S, Yu W, Johnson CR, Abrahante J, Jimenez LG, Griggs T, Haley 354 C, Wagner B, Murtaugh MP. 2011. Absence of porcine circovirus type 1 (PCV1) and 355 high prevalence of PCV 2 exposure and infection in swine finisher herds. Virus Research 356 157(1):92–98. DOI 10.1016/j.virusres.2011.02.012.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 357 Quintana J, Segalés J, Calsamiglia M, Domingo M. 2006. Detection of porcine circovirus type 358 1 in commercial pig vaccines using polymerase chain reaction. Veterinary Journal 171: 359 570–573. DOI 10.1016/j.tvjl.2004.12.008. 360 Rovira A, Balasch M, Segales J, Garcia L, Plana-Duran J, Rosell C, Ellerbrok H, Mankertz 361 A, Domingo M. 2002. Experimental inoculation of conventional pigs with porcine 362 reproductive and respiratory syndrome virus and porcine circovirus 2. Journal of Virology 363 76: 3232–3239. 364 Saha D, Lefebvre DJ, Ducatelle R, Doorsselaere JV, Nauwynck HJ. 2011. Outcome of 365 experimental porcine circovirus type 1 infections in mid-gestational porcine foetuses. BMC 366 Veterinary Research 7: 64. DOI 10.1186/1746–6148–7–64. 367 Segalés J, Calsamiglia M, Olvera A, Sibila M, Badiella L, Domingo M. 2005. Quantification 368 of porcine circovirus type 2 (PCV2) DNA in serum and tonsillar, nasal, tracheo-bronchial, 369 urinary and faecal swabs of pigs with and without postweaning multisystemic wasting 370 syndrome (PMWS). Veterinary Microbiology 111: 223–229. DOI 371 10.1016/j.vetmic.2005.10.008. 372 Stadejek T, Wozniak A, Miłek D, Biernacka K. 2017. First detection of porcine circovirus 373 type 3 on commercial pig farms in Poland. Transboundary and Emerging Diseases 64: 374 1350–1353. DOI 10.1111/tbed.12672. 375 Tischer I, Mields W, Wolff D, Vagt M, Griem W. 1986. Studies on epidemiology and 376 pathogenicity of porcine circovirus. Archives of Virology 91(3-4): 271–276. 377 Tischer I, Rasch R. 1974. Tochtermann, G. Characterization of papovavirus-and picornavirus- 378 like particles in permanent pig kidney cell lines. Zentralbl Bakteriol Parasitenkd Infekionskr 379 Hyg, I Abt Orig,reihe A Med Mikrobiol Parasitol, 226, 153–167. 380 Tochetto C, Lima DA, Varela APM, Loiko MR, Paim WP, Scheffer CM, Herpich JI, Cerva 381 C, Schmitd C, Cibulski SP, Santos AC, Mayer FQ, Roehe PM. 2018. Full-Genome 382 Sequence of Porcine Circovirus type 3 recovered from serum of sows with stillbirths in 383 Brazil. Transboundary and Emerging Diseases 65(1): 5–9. DOI 10.1111/tbed.12735. 384 Wang C, Pang V., Lee F, Liao PC, Huang YL, Lin YL, Lai SS, Jeng CR. 2014. Development 385 and evaluation of a loop-mediated isothermal amplification method for rapid detection and 386 differentiation of two genotypes of porcine circovirus type 2. Journal of Microbiology, 387 Immunology and Infection 47: 363–370. DOI 10.1016/j.jmii.2013.05.003.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 388 Wang J, Wang J, Liu L, Li R, Yuan W. 2016. Rapid detection of Porcine circovirus 2 by 389 recombinase polymerase amplification. Journal of Veterinary Diagnostic Investigation 28: 390 574–578. DOI 10.1177/1040638716654201. 391 Wang J, Zhang Y, Zhang R, Han Q, Wang J, Liu L, Li R, Yuan W. 2017. Recombinase 392 polymerase amplification assay for rapid detection of porcine circovirus 3. Molecular and 393 Cellular Probes 36: 58–61. DOI 10.1016/j.mcp.2017.09.001. 394 Yang KL, Tian YX, Zhou DN, Duan ZY, Guo R, Liu ZW, Yuan FY, Liu W. 2017. A 395 Multiplex RT-PCR Assay to Detect and Discriminate Porcine Reproductive and Respiratory 396 Syndrome Viruses in Clinical Specimens. Viruses 9: 205. DOI 10.3390/v9080205. 397 Zhai SL, Zhou X, Zhang H, Hause BM, Lin T, Liu R, Chen QL, Wei WK, Lv DH, Wen XH, 398 Li F, Wang D. 2017. Comparative epidemiology of porcine circovirus type 3 in pigs with 399 different clinical presentations. Virology Journal 14(1): 222. DOI 10.1186/s12985–017– 400 0892–4. 401 Zhang L, Luo Y, Liang L, Li J, Cui S. 2018. Phylogenetic analysis of porcine circovirus type 3 402 and porcine circovirus type 2 in China detected by duplex nanoparticle-assisted PCR. 403 Infection Genetics and Evolution 60: 1–6. DOI 10.1016/j.meegid.2018.02.006. 404 Zhao K, Han F, Zou Y, Zhu L, Li C, Xu Y, Zhang C, Tan F, Wang J, Tao S, He X, Zhou Z, 405 Tang, X. 2010. Rapid detection of porcine circovirus type 2 using a TaqMan-based real- 406 time PCR. Virology Journal 7: 374. DOI 10.1186/1743-422X-7-374. 407 Zhao S, Lin H, Chen S, Yang M, Yan Q, Wen C, Hao Z, Yan Y, Sun Y, Hu J, Chen Z, Xi L. 408 2015. Sensitive detection of Porcine circovirus-2 by droplet digital polymerase chain 409 reaction. Journal of Veterinary Diagnostic Investigation 27(6): 784–788. DOI 410 10.1177/1040638715608358. 411 Zheng S, Wu X, Zhang L, Xin C, Liu Y, Shi J, Peng Z, Xu S, Fu F, Yu J, Sun W, Xu S, Li J, 412 Wang J. 2017. The occurrence of porcine circovirus 3 without clinical infection signs in 413 Shandong Province. Transboundary and Emerging Diseases 64(5): 1337–1341. DOI 414 10.1111/tbed.12667. 415 416
417
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Figure 1
Figure
FIGURE 1| Geographical distribution of PCV3 in China (red regions, till June 2018 ) and the position of pig farms (red stars) in this study
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Figure 2
Figure
FIGURE 2| Electrophoresis of multiplex PCR products in optimization conditions.
Lane M, DL2000 DNA marker; lane 1, PCV1; lane 2, PCV2; lane 3, PCV3; lane 4, ddH2O.
*Note: Auto Gamma Correction was used for the image. This only affects the reviewing manuscript. See original source image if needed for review.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Figure 3
Figure
FIGURE 3| Specificity of multiplex PCR for the detection of PCVs. Lane M, DL2000 DNA marker; lane 1, PCV1; lane 2, PCV2; lane 3, PCV3; lane 4, CSFV; lane 5, PRRSV; lane 6,
PRV; lane 7, PPV; lane 8, RV; lane 9, JEV; lane 10,PEDV; lane 11, PDCoV; lane 12, ddH2O.
*Note: Auto Gamma Correction was used for the image. This only affects the reviewing manuscript. See original source image if needed for review.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Figure 4
Figure
FIGURE 4| Sensitivity of multiplex PCR for the detection of PCVs. Lane M, DL2000 DNA marker; lanes 1-10 are: 1, 107; 2, 106; 3, 105; 4, 104; 5, 103; 6, 102; 7, 101; 8, 100; 9, 10-1 ; 10, 10-2 copies/μL.
*Note: Auto Gamma Correction was used for the image. This only affects the reviewing manuscript. See original source image if needed for review.
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Table 1(on next page)
Table
Sequences of the primers for multiplex PCR
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 1 Table 1 Sequences of the primers for multiplex PCR
Primer Primer sequences (5’-3’) Origin/target gene Location Products PCV1-F GAAAGTGAGCGGGAAGAT 499-516 PCV1 (GenBank: KX827790.1) 310 bp PCV1-R CTGATTGCTGGTAATCAA 790-808
PCV2-F CACATCGAGAAAGCGAAAGGAAC 294-316 PCV2(GenBank: MG229682.1) 505 bp PCV2-R TGCGGGCCAAAAAAGGTACAGTT 776-798 PCV3-F AGCAGTGCTCCCCATTGA 1431-1448 PCV3(GenBank: KX898030.1) 1021 bp PCV3-R TGGGCCCGACCAAATCCGG 428-446
2 3
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Table 2(on next page)
Table
Detection of clinical specimens by multiplex PCR and sequencing method
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 1 Table 2 Detection of clinical specimens by multiplex PCR and sequencing method
multiplex PCR Sequencing method PCV1 PCV2 PCV3 PCV1 PCV2 PCV3 Concordance rate Pig Farm No. of specimens positive positive positive positive positive positive (%) (%) (%) (%) (%) (%) (%) 1 50 0 (0) 36 (72.0) 33 (66.0) 0 (0) 36 (72.0) 33 (66.0) 100
2 48 41 (85.4) 33 (68.8) 31 (64.6) 41 (85.4) 33 (68.8) 31 (64.6) 100
3 38 35 (92.1) 25 (65.8) 0 (0) 35 (92.1) 25 (65.8) 0 (0) 100
4 36 32(88.89) 27 (75.0) 26 (72.2) 32(88.89) 27 (75.0) 26 (72.2) 100
5 33 0 (0) 21 (63.6) 20 (60.6) 0 (0) 21 (63.6) 20 (60.6) 100
6 30 0 (0) 17 (56.7) 19 (63.3) 0 (0) 17 (56.7) 19 (63.3) 100
7 26 20 (76.9) 0 (0) 0(0) 20 (76.9) 0 (0) 0(0) 100
8 25 22 (88.0) 16 (64.0) 0 (0) 22 (88.0) 16 (64.0) 0 (0) 100
Total 286 150 (52.4) 175 (61.2) 129 (45.1) 150 (52.4) 175 (61.2) 129 (45.1) 100
2
3
4
5
6
7
8
9
10
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 Table 3(on next page)
Table
Detection of the co-infection of clinical specimens by multiplex PCR
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018 1 Table 3 Detection of the co-infection of clinical specimens by multiplex PCR
PCV1 and PCV2 PCV1 and PCV3 PCV2 and PCV3 PCV1, PCV2 and Pig Farm No. of specimens positive positive positive PCV3 positive (%) (%) (%) (%) 1 50 0 (0) 0 (0) 20(40.0) 0 (0)
2 48 13 (27.1) 9 (18.8) 19(39.6) 2 (4.2)
3 38 9 (23.7) 0 (0) 0 (0) 0 (0)
4 36 8(22.2) 5 (13.9) 13(36.1) 3 (8.3)
5 33 0 (0) 0 (0) 5(15.2) 0 (0)
6 30 0 (0) 0 (0) 10(33.3) 0 (0)
7 26 0 (0) 0 (0) 0 (0) 0 (0)
8 25 2 (8.0) 3 (12.0) 0 (0) 0 (0)
Total 286 32 (11.2) 17 (5.9) 67 (23.4) 5 (1.7)
2 3
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.27145v1 | CC BY 4.0 Open Access | rec: 27 Aug 2018, publ: 27 Aug 2018