Curriculum Vitae

The Roles of Autophagic SNARE proteins SNAP29 and SNAP47 in Autophagy and Enterovirus D68 Replication

Item Type dissertation

Authors Corona, Abigail

Publication Date 2019

Abstract Enterovirus-D68 (EV-D68) is a positive-sense, single-stranded RNA virus of the Picornaviridae family that causes respiratory disease in children and has been implicated in recent outbreaks of acute flaccid myelitis, a severe paralysis syndrome. We ha...

Keywords Virology; Cellular biology; amphisome; picornavirus; SNAP29; SNAP47; Autophagy; Enterovirus D, Human; Picornaviridae

Download date 04/10/2021 22:18:40

Link to Item http://hdl.handle.net/10713/11615 Curriculum Vitae

Abigail Kristen Corona Formerly: Abigail Kristen McGillivray [email protected]

Education

Doctor of Philosophy* to be conferred - 2019 Degree in Molecular Microbiology and Immunology University of Maryland-Baltimore; Baltimore, Maryland 21201 Advisor: William T. Jackson, PhD

Bachelor of Science 2014 Degree in Biochemistry Carroll University; Waukesha, Wisconsin 53186

Publications

Corona AK and Jackson WT. “Finding the middle ground for autophagic fusion requirements.” Trends in Cell Biology 2018. 28 (11): 869-881.

Corona AK, Mohamud Y, Jackson WT, Luo H. “Oh, SNAP! How enteroviruses redirect autophagic traffic away from degradation.” Autophagy 2018. 14 (8): 1469-1471.

Corona Velazquez AF, Corona AK, Klein KA, Jackson WT. “Poliovirus induces autophagic signaling independent of the ULK1 complex.” Autophagy 2018. 14 (7):1201-1213.

Corona AK, Saulsbery HM, Corona Velazquez AF, Jackson WT. “Enteroviruses remodel autophagic trafficking through regulation of host SNARE proteins to promote virus replication and cell exit.” Cell Reports 2018. 22 (12): 3304-3314.

Singh RK, Lall N, Leedahl TS, McGillivray A, Mandal T, Haldar M, Mallik S, Cook G, Srivastava DK. “Kinetic and thermodynamic rationale for suberolyanilide hydroxamic acid being a preferential human histone deacetylase 8 inhibitor as compared to the structurally similar ligand, trichostatin a” Biochemistry 2013. (45): 8139-49.

Presentations

Oral Presentations Corona AK, Jackson WT. “The roles of SNAP29 and SNAP47 during Enterovirus D68 Infection and Autophagy.” The Tenth Annual UMB/UMCP Research Symposium on Host-Pathogen Interactions, June 18, 2019.

Corona AK, Jackson WT. “The effects of autophagy and the manipulation of autophagy on EVD68.” 36th American Society for Virology National Meeting, Madison WI, June 24th-28nd, 2017.

Corona AK, Jackson WT. “The effects of autophagy and the manipulation of autophagy on EVD68.” Molecular Microbiology and Immunology Annual Graduate Student Symposium, Baltimore MD, June 7th-8th, 2017.

McGillivray AK, Corona Velazquez AF, Jackson WT. “Differential effects of members of an autophagy fusion complex on the growth of a model picornavirus.” 35th American Society for Virology National Meeting, Blacksburg VA, June 18th-22nd, 2016

McGillivray AK, Corona Velazquez AF, Jackson WT. “Differential effects of members of an autophagy fusion complex on the growth of a model picornavirus.” Molecular Microbiology and Immunology Annual Graduate Student Symposium, Baltimore MD, June 8th-9th, 2017.

Poster Presentations Corona AK and Jackson WT. “Autophagy SNARES SNAP29 and SNAP47 have novel roles revealed during virus infection” ASM, San Francisco CA, June 21, 2019.

Corona AK and Jackson WT. “Autophagy SNARES SNAP29 and SNAP47 have novel roles revealed during virus infection” ASCB/EMBO, San Diego CA, December 10, 2018.

McGillivray AK. “Discovery of Novel Inhibitors for the SIRT5 Enzyme” 247th American Chemical Society National Meeting & Exposition, Dallas TX, March 16-20, 2014.

Schoeberle A, McGillivray AK and Marks GT. “Determining the effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on expression of 3β/17β-hydroxysteroid dehydrogenase and 17α hydroxylase-17,20 lyase in human granulosa cells using RT-qPCR” 247th American Chemical Society National Meeting & Exposition, Dallas TX, March 16-20, 2014.

McGillivray AK. “Discovery of Novel Inhibitors for the SIRT5 Enzyme” Poster Competition by American Chemical Society, Milwaukee Section, University of Wisconsin-Milwaukee, November, 2013.

McGillivray AK. “Discovery of Novel Inhibitors for the SIRT5 Enzyme” Poster Celebration for National Science Foundation sponsored Research Experience for Undergraduates, North Dakota State University, Fargo ND, August 2013.

Research Experience

March 2015-Present:* PhD Candidate, Virology, Principle Investigator: Dr. William T. Jackson

Research has focused on understanding the role of autophagy on Enterovirus D68 replication. Autophagy is marked by the formation of an isolated double-membrane that engulfs specific or non-specific cargo. The membrane fuses around cargo to form an autophagosome, which then sequentially fuses with an endosome and a lysosome, referred to as an amphisomes and autolysosome respectively, and the contents are degraded. Several picornaviruses have been shown to exploit canonical autophagy as a means to benefit their own survival and replication. These studies focus on the subversion of specific proteins that facilitate the fusion of the autophagosome and endosome/lysosome and the redirection of this pathway to benefit EV-D68 replication.

August 2011 – May 2014: Undergraduate Researcher, Biochemistry, Mentor: Dr. Gregory T. Marks. Carroll University.

Research focused on the effects of dioxin exposure on the estrogen synthesis pathway in primary human granulosa cells via qRT-PCR. Studies have previously shown that exposure to 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD) have affected the estrogen pathway. These studies were a focused effort to elucidate the precise step in the pathway that is affected by the exposure to TCDD.

June-August 2013: Undergraduate Researcher, Biochemistry, Mentor: Dr. DK Srivastava. North Dakota State University.

Research focused on the effects of many small molecule barbiturate derivatives for inhibitors of the kinetics of human histone deactylases (HDACs) and, furthermore, a family of HDACs known as the sirtuins. Many sirtuins have a high impact in the proliferation and prolongation of cancer cells, so it would be advantageous to be able to modulate the activity of these enzymes.

Teaching and Mentoring Experience

Teaching at an Undergraduate University Workshop May 2019 • Attended sessions that related to how fund a laboratory at a Primarily Undergraduate Institution and how to balance research, teaching and service at the PUI research level Collaborative Teaching Fellow Sept 2018-March 2019 • Training completed in Bloom’s Taxonomy application to learning outcomes and assessments, interactive teaching technologies, active learning techniques, and course development Graduate Mentor Summers 2017 and 2018 • Mentored undergraduate students in research design, data collection, data analysis and presentation preparation for the Nathan Schnaper Internship Program Laboratory Teaching Assistant 2011-2014 • Assisted faculty in 100-level chemistry laboratory courses • Aided 15-20 students per course during laboratory assignments and experiments • Collected, organized and graded laboratory assignments and reports

Abstract

Title of Dissertation: The Roles of Autophagic SNARE proteins SNAP29 and SNAP47 in Autophagy and Enterovirus D68 Replication

Abigail Corona, Doctor of Philosophy, 2019

Dissertation Directed by: Dr. William T. Jackson, Associate Professor, Department of

Microbiology and Immunology

Enterovirus-D68 (EV-D68) is a positive-sense, single-stranded RNA virus of the

Picornaviridae family that causes respiratory disease in children and has been implicated in recent outbreaks of acute flaccid myelitis, a severe paralysis syndrome. We have demonstrated that EV-D68 induces autophagy upon infection and modifies the autophagic process to benefit its own replication. Autophagy is a regulated process of cytosolic degradation in eukaryotic cells which maintains cellular homeostasis by degrading damaged organelles, protein aggregates, microbes and other xenobiotics in the cytoplasm. The autophagic process is characterized by the formation of double- membraned autophagosomes around cytosolic cargo, which then undergo a series of fusion steps with endosomes and lysosomes to degrade the vesicle’s contents. The autophagy pathway is targeted by many pathogens, either to protect themselves from degradation or to utilize components to benefit replication. EV-D68 uses virally-encoded proteases to cleave an autophagosome fusion SNARE protein, SNAP29, blocking delivery of autophagosome contents, including nascent viruses, to the lysosome. Our data show that relocalization occurs for SNAP47 during autophagy induction, and is required

for normal virus replication. SNAP47 plays a major role in acidification of autophagosomes into amphisomes, with binding partner VAMP7, which we hypothesize promotes maturation of virions into infectious particles. Using both viral- and non-viral forms of autophagy induction, these data suggest that the cellular network of SNARE proteins is being redirected during infection to promote EV-D68 replication and egress from the cell.

The Roles of Autophagic SNARE proteins SNAP29 and SNAP47 in Autophagy and Enterovirus D68 Replication

by Abigail Kristen Corona

Dissertation submitted to the faculty of the Graduate School of the University of Maryland, Baltimore in partial fulfillment of the requirements for the degree of Doctor of Philosophy 2019

To my family and friends

iii

Table of Contents Chapter 1: Introduction ...... 1

A. Autophagy ...... 2 B. SNARE Proteins and Their Role in Autophagosome-Lysosome Fusion ...... 7 C. Picornaviruses ...... 13 D. Enterovirus D68 ...... 16 E. Picornaviruses and Autophagy – What is Known...... 21 F. Specific Aims ...... 21

Chapter 2: Materials and Methods ...... 23

A. Cell Culture ...... 23 B. Viral Plasmids...... 23 C. Viral Stock Growth Method ...... 23 D. Viral Infections ...... 24 E. Drug Treatments ...... 25 F. Plaque Assays ...... 26 G. Western Blotting...... 27 H. siRNA Knockdowns ...... 28 I. Overexpression transfections ...... 29 J. Electron Microscopy ...... 30 K. Fluorescence Microscopy ...... 31 L. Autoradiography ...... 32

Chapter 3: Enteroviruses remodel autophagic trafficking through regulation of host SNARE proteins to promote virus replication and cell exit ...... 38

A. Introduction ...... 38 B. Results ...... 40 C. Discussion ...... 68

Chapter 4: Snap47 – The Amphisomal Qbc SNARE...... 74

A. Introduction ...... 74 B. Results ...... 75

C. Discussion ...... 91

Chapter 5: Discussion ...... 96

References ...... 105

List of Tables Table 1. Antibody Table...... 33

Table 2. Oligonucleotide Table ...... 36

List of Figures

Figure 1. The Autophagy pathway...... 3

Figure 2. TEM images of autophagic vacuoles in isolated mouse hepatocytes...... 5

Figure 3. Tandem-fluorescent tagged LC3 as a tool for fluorescent microscopy ...... 6

Figure 4. The lifecycle of a transport vesicle...... 8

Figure 5: The zippering model for SNARE-catalyzed membrane fusion...... 10

Figure 6. Picornavirus Genome Structure...... 14

Figure 7: Phylogenetic tree of EV-D68 including acute flaccid myelitis (AFM)-related strains...... 17

Figure 8. Enterovirus D68 Replication is Affected by Autophagy-altering Treatments. 41

Figure 9. Validation of starvation medium in H1-HeLa cells...... 44

Figure 10. Trifluoperazine treatments inhibit EV-D68 replication...... 44

Figure 11. Enterovirus D68 changes cell membrane morphology upon infection in H1-

HeLa cells...... 46

Figure 12. Traditional autophagy markers respond to Enterovirus D68 infection...... 47

Figure 13. Enterovirus D68-Induced autophagosomes costain with LAMP1 but not

CTSB...... 49

Figure 14. Enterovirus D68 infection affects autophagosomal fusion SNARE protein levels...... 54

vii

Figure 15. SNAP29 reduction is not due to regular protein turnover, lysosomal or proteasomal degradation...... 56

Figure 16. SNAP29 reduction is a result of cleavage by Enterovirus D68’s 3C protease.

...... 57

Figure 17. FLAG-SNAP29-Q161A is not cleaved by EV-D68 3C protease...... 58

Figure 18. SNAP29 affects EV-D68 infection in H1-HeLa cells...... 60

Figure 19. Overexpression of SNARE proteins involved in autophagosome-lysosome fusion and EV-D68 viral titers...... 63

Figure 20. SNAP47 is essential for degradative autophagy and negatively affects viral exit...... 65

Figure 21. SNAP47 reduction is not due to EV-D68 protease cleavage, but may be due to protein turnover...... 67

Figure 22. SNAP47 is required for autophagic degradation...... 76

Figure 23. Snap47 relocalizes in the cell under starvation conditions...... 78

Figure 24. SNAP47 Cofractionates with Mitochondria, Autophagy Cargo Adaptor

SQSTM1 and Lysosomes...... 79

Figure 25. SNAP47 Colocalizes with Mitochondria, Endosomes and Lysosomes...... 81

Figure 26. Endogenous SNAP47 interacts with endogenous VAMP7...... 84

Figure 27. VAMP7 Colocalizes with late endosomes and recycling endosomes...... 85

Figure 28. Amphisome Detection Methodology...... 87

Figure 29. SNAP47 facilitates the formation of the amphisome...... 89

viii

List of Abbreviations Abbreviation Expanded Term ACTB β-actin ADP Adenosine diphosphate AF Alexa Fluor AF568 Alexa Fluor 568 AFM Acute flaccid myelitis Amph. Amphisome Arf ADP ribosylation factor ATCC American Type Culture Collection ATG7 Autophagy related protein 7 ATG8 Autophagy related protein 8 Autolys. Autolysosome Autop. Autophagosome AVd Autophagic vesicle-degradative AVi Autophagic vesicle-immature

BafA1 Bafilomycin A1 BFP Blue fluorescent protein BSA Bovine serum albumin

CaCl2 Calcium chloride CD81 Cluster of differentiation 81 CDC Center for Disease Control CHX Cycloheximide CL Cleavage fragment COXIV Cytochrome c oxidase subunit 4 isoform 1, mitochondrial CTSB Cathepsin B CVB3 Coxsackievirus B3 DAPI 4′,6-diamidino-2-phenylindole DMEM Dulbecco's Minimum essential medium DMSO Dimethyl sulfoxide DMV Double membrane vesicle DNA Deoxyribonucleic acid dsRNA Double stranded RNA 2S,3S-trans-Epoxysuccinyl-L-leucylamido-3-methylbutane ethyl E64-D ester Enhanced Chemiluminescence, reagent for visualizing westerns ECL using HRP EDTA Ethylenediamine tetraacetic acid EEA1 Early endosome antigen 1

EGF Epidermal growth factor EGFR Epidermal growth factor receptor Endo. Endosome Endolys. Endolysosome ER Endoplasmic reticulum ESCRT Endosomal sorting complexes required for transport EV-D68 Enterovirus D68 FBS Fetal bovine serum FL Full length FLAG Protein tag of DYKDDDDK sequence FT Flow-through GABARAP Gamma-aminobutyric acid receptor-associated protein GAP GTPase activating protein GAPDH Glyceraldehyde-3-phosphate dehydrogenase GDI GDP-dissociation inhibitor GDP Guanine diphosphate GFP Green fluorescent protein GTP Guanine triphosphate GTPase Guanine triphosphate hydrolase HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HOPS Homotypic fusion and protein sorting complex HRP Horseradish peroxidase HRV87 Human rhinovirus 87 ICAM5 Intercellular adhesion molecule 5, also known as telencephalin IgG Immunoglobulin G IP Immunoprecipitation IRES Internal ribosome entry site IRF7 Interferon regulatory factor 3 IRGM Immunity-related GTPase family M protein KCl Potassium chloride kDa Kilodaltons KOH Potassium hydroxide LAMP1 Lysosome associated membrane protein 1 LAMP2 Lysosome associated membrane protein 2 LB Luria broth LBPA Lactoferrin-binding protein A LC3 Microtubule associated proteins 1, light chain 3 LC3B Microtubule associated protein 1, light chain B LC3-I Microtubule associated proteins 1, light chain 3 -I, cytosolic form LC3-II Microtubule associated proteins 1, light chain 3 -II, lipidated form

LIR LC3 interacting region LSM Light Scanning Microscope Lyso. Lysosome mA Milliamps MCC Mander's Correlation Coefficient mCherry Monomeric Fruit derivative of RFP, from mFruit collection MEM Minimum essential medium

MgCl2 Magnesium chloride min Minutes mito Mitochondria mL Milliliter MOI Multiplicity of infection MRI Magnetic resonance imaging mRNA Messenger RNA MT Mutant MVB Multivesicular body

NaH2PO4 Sodium bisphosphate NCBI National Center for Biotechnology Information ng Nanogram NIAID National Institute of of Allergy and Infectious Diseases nm Nanometer NS Non-specific on a western, not significant on a graph NSF N-ethylmaleimide-sensitive factor O-GlcNAc O-Linked β-N-acetylglucosamine PBS Phosphate-buffered salien pcDNA Plasmid of cDNA used as a vector in cloning PCR Polymerase chain reaction PFU Plaque forming units PIPES Piperazine-N,N′-bis(2-ethanesulfonic acid PV Poliovirus PVDF Polyvinylidene fluoride qPCR Quantitative PCR Q-SNARE SNARE protein with a glutamine at level 0 Rab Ras related protein Rab11 Ras-related protein Rab-11 Rab21 Ras-related protein Rab-21 Rab5 Ras-related protein Rab-5A Rab7 Ras-related protein Rab-7A RdRp RNA dependent RNA polymerase RFP Red fluorescent protein

RNA Ribonucleic acid R-SNARE SNARE protein with an arginine at level 0 RV1A Human rhinovirus 1A Sar Secretion-associated RAS-related protein SBF2 Myotubularin-related protein 13 (SET-binding factor 2) SDS-PAGE Sodium dodecyl sulfate–polyacrylamide gel electrophoresis Sec22b SEC22 vesicle-trafficking protein homolog B SEM Standard error of the mean Ser Serine SETD3 SET domain containing 3 siRNA Silencing RNA siS29 SNAP29 siRNA treated condition siS47 SNAP47 siRNA treated condition SNAP23 Synaptosomal associated protein 23 SNAP25 Synaptosomal-associated protein 25 SNAP29 Synaptosomal-associated protein 29 SNAP47 Synaptosomal associated protein 47 Soluble N-ethylmaleimide-sensitive factor attachment protein SNARE receptors SQSTM1 Sequestosome 1 STX17 Syntaxin 17 SybL1 Synaptobrevin-like protein 1, same protein as VAMP7 TBST Tris-buffered saline with Tween TEM Transmission electron microscopy tfLC3 Tandem-fluorophore LC3 Thr Threonine TUBA α-tubulin VAMP Vesicle associated membrane protein VAMP1 Vesicle associated membrane protein 1 VAMP2 Vesicle associated membrane protein 2 VAMP3 Vesicle associated membrane protein 3 VAMP4 Vesicle associated membrane protein 4 VAMP5 Vesicle associated membrane protein 5 VAMP7 Vesicle associated membrane protein 7 VAMP8 Vesicle associated membrane protein 8 vATPase Vacuolar ATPase VP0 Viral Protein 0, precursor to VP2 and VP4 VP1 Viral Protein 1 VP2 Viral Protein 2 VP3 Viral Protein 3

xii

VP4 Viral Protein 4 VpG Viral Protein G, also known as 3B W1 Wash 1 W2 Wash 2 WIPI1 WD repeat domain phosphoinositide-interacting protein 1, WIPI-1 WIPI2 WD repeat domain phosphoinositide-interacting protein 2, WIPI-2 WT Wild type YKT6 Synaptobrevin homolog protein YKT6 α-SNAP Alpha-soluble NSF attachment protein μCi Microcuries μM Micromolar μm Micrometer

xiii

Chapter 1: Introduction

Worldwide, 17 million people die from a range of infectious diseases per year (1).

Many of these illnesses are the product of pathogenic microorganisms, including viruses.

A virus can be defined as a non-living particle with the capability of replication by exploiting outside resources. While viruses can have a range of sizes and styles of genomes, none carry all the information required to replicate outside of a host. When a virus infects a human host cell, it uses the host cell’s machinery and resources for replication basics, such as genome replication, protein production or creation of a favorable, cellular environment for long-term survival. Viruses have been grouped into families based on similarities between their structures, genome and replication strategies within a host cell. While many of these “takeover” strategies may be similar among virus families, increased granularity of research has demonstrated that it is necessary to study viruses on an individual level to understand their unique interaction within the host cell setting. Developing therapeutics and/or vaccines is the end goal when studying a human pathogen, to better protect and serve the patients involved. As such, it is foundationally important to study the cell biology surrounding virus infection to have a better understanding of how to identify functional drug targets.

In this dissertation, the interaction between a historically anti-viral, cellular response process and a virus infection has been studied. This chapter aims to introduce the reader to: autophagy, SNARE proteins and the regulation of autophagosome- lysosome fusion, Picornaviruses, Enterovirus D68, and the history of known relationships

1 between viruses and autophagy. The chapter will end in a proposal of aims addressed in this document.

A. Autophagy From Phagophore to Autolysosome

Macroautophagy, hereafter referred to as autophagy, is a regulated process of cytosolic degradation in eukaryotic cells that occurs at basal levels in all cells, but can also be upregulated in response to stimuli. Autophagy maintains cellular homeostasis by degrading damaged organelles, protein aggregates, microbes and other xenobiotics in the cell. The multi-step process of autophagy turns cargo into recycled nutrients available for the cell’s use. Induction of the level of autophagy over basal levels is controlled by many stress and nutrient sensors (2). The ATG8 protein family includes microtubule associated protein 1, light chain 3 (MAP1LC3) homologs (LC3A, LC3B and LC3C) and gamma- aminobutyric acid type A receptor-associated protein (GABARAP) proteins. In response to numerous stressors in the cells, cytosolic protein LC3B-I (referred to within as LC3-I) is conjugated to a phosphatidylethanolamine upon autophagic induction. This modification allows the protein to bind to membranes and lipidated LC3, now referred to as LC3-II, then localizes to nascently-forming autophagic membranes.

LC3 is traditionally used to measure autophagy induction by either western blot, to detect changes in amount or lipidation of LC3, or by fluorescence microscopy, to observe the relocalization of LC3 into small punctate structures or foci in the cytoplasm.

An increase in number of LC3 foci within the cell is frequently used as an indicator of autophagy induction. Other early autophagy proteins that can be used to visualize

2 induction of autophagy include WIPI1 and WIPI2 (3–7). Lipidated LC3 and other signals catalyze the formation of a phagophore, or crescent-shaped double membrane (Figure 1)

(5, 8), that is wrapped around cargo until it is fully enveloped and the double membrane is closed to form an autophagosome (9). Phagophores use membranes that originate at either the endoplasmic reticulum or mitochondria (10–12). Substrates for degradation can be recognized by a family of cargo adaptors; the best studied of which is Sequestosome1

(SQSTM1). SQSTM1 is a cargo adaptor that functions during macroautophagy and binds to both LC3 and ubiquitinated cargo to correctly localize the substrate for degradation.

Figure 1. The Autophagy Pathway. LC3 (green cross) becomes lipidated, which converts the molecule from LC3-I to LC3-II. LC3-II then binds to an initiating phagophore. The phagophore elongates around cargo bound to it by a cargo receptor, in this depiction the cargo receptor is SQSTM1 (red crescent) with miscellaneous cargo bound. The phagophore elongates into a fully formed autophagosome. The autophagosome then either may fuse with an endosome, forming an amphisome, and then fuse with a lysosome, or alternatively fuse directly with a lysosome to form a final structure known as an autolysosome.

After the formation of the autophagosome, there are a couple paths the newly formed autophagosome may take. Fusion of the autophagosome with an endosome generates an intermediary structure known as an amphisome (13). The amphisome is a vesicle that contains vATPases which begin acidifying the interior of the vesicle. This structure may also begin to breakdown the inner membrane from the autophagosomes

(13). Autophagosomes or amphisomes may then fuse with lysosomes, forming autolysosomes, where contents can be recycled by lysosomal enzymes. The completion of this pathway by way of degradation of cargo is frequently termed “autophagic flux.”

There are several ways to measure autophagic flux. The classical method of measuring a change in autophagic flux is by electron microscopy. Using negative staining, the microscopist is able to differentiate light, or cytosolic-colored, double- membraned vesicles (DMVs) from electron-dense dark DMVs (Figure 2). The similar- to-cytosol stained vesicles are termed AVis, for autophagic vesicle-immature. The electron-dense dark DMVs are termed AVds, for autophagic vesicle-degradative. An increase in the ratio of AVds/AVis suggests that there is an increase in the autophagic flux (7). For a western blot method, cargo adaptors can be monitored for decreased protein levels, which is an indication of autolysosome degradation. The final assay discussed in this dissertation to measure the acidification of the autophagosome is by using a dual fluorophore tagged LC3 molecule. LC3 lipidation and subsequent localization to autophagosomes is considered a hallmark of autophagic induction. LC3 can insert in either side of the autophagosome during initiation. Over the course of the autophagosome maturation, the interior of the autophagosome becomes acidified, by endosome or lysosome fusion, and degradative, upon lysosome fusion. In the degradative

4 step, LC3 on the interior of the autophagosome is degraded by lysosomally-delivered enzymes. Using two different fluorophores, an acid-stable RFP or mCherry, and an acid- labile GFP, different autophagosome conditions can be quantified by fluorescent microscopy. A schematic describing how this works can be found in Figure 3. With either fluorophore set up conjugated to LC3, RFP-GFP or mCherry-GFP,

Figure 2. TEM images of autophagic vacuoles in isolated mouse hepatocytes. (A) One autophagosome or early initial autophagic vacuole (AVi) and one degradative autophagic vacuole (AVd) are shown. The AVi can be identified by its contents (morphologically intact cytoplasm, including ribosomes, and rough ER), and the limiting membrane that is partially visible as 2 bilayers separated by a narrow electron-lucent cleft, i.e., as a double membrane (arrow). The AVd can be identified by its contents, partially degraded, electron-dense rough ER. The vesicle next to the AVd is an endosomal/lysosomal structure containing 5-nm gold particles that were added to the culture medium to trace the endocytic pathway. (B) One AVi, containing rough ER and a mitochondrion, and one AVd, containing partially degraded rough ER, are shown. Note that the limiting membrane of the AVi is not clearly visible, possibly because it is tangentially sectioned. However, the electron-lucent cleft between the 2 limiting membranes is visible and helps in the identification of the AVi. The AVd contains a region filled by small internal vesicles (asterisk), indicating that the AVd has fused with a multivesicular endosome. mi, mitochondrion. Image provided by E.-L. Eskelinen. Reprinted, modified, with permission from Taylor and Francis: Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) © 2016.

Figure 3. Tandem-fluorescent tagged LC3 as a tool for fluorescent microscopy A schematic to describe the tandem fluorescent-tagged LC3 overexpression construct as a tool to show acidification rates of autophagosomes in a cell. Acidification of the autophagosomes can occur by fusion between the autophagosome and an endosome or lysosome containing membrane-bound vacuolar ATPases that have the ability to acidify the lumen of the vesicle. In a cell transfected with either eGFP-RFP-LC3 or eGFP- mCherry-LC3, autophagic vesicles either will fluoresce green and red (appearing as yellow when images are overlaid) or only red for whether the vesicle is non-acidified or acidified, respectively. The ratio between red and yellow vesicles can describe the overall state of autophagy in a cell. When autophagy is high in a cell, it can be expected that there would be more red vesicles than yellow vesicles, as shown in the top cell. If autophagic flux is inhibited, it can be expected that there would be more yellow vesicles than red vesicles, as described by the bottom cell in the schematic. This important tool is now used broadly in the autophagy field to describe the state autophagosome acidification in a cell. Reprinted with permission from Trends in Cell Biology, Corona AK, and Jackson WT. Finding the Middle Ground for Autophagic Fusion Requirements. Cell Rep. 28(11):869-881. © 2018.

autophagosomes that have not been acidified will overlay as yellow puncta while either acidified amphisomes or autolysosomes will appear only as red puncta. Quantification of this process is measured by the ratio of red to yellow puncta. These constructs, originally

6 developed in (14) and available on Addgene, have been used in the field to measure the effect of factors of interest on autophagic flux.

B. SNARE Proteins and Their Role in Autophagosome-Lysosome Fusion Autophagosome/amphisome-lysosome fusion is a highly regulated process on many levels, including protein, lipid and biochemical. Each primary component of fusion, such as the core SNARE proteins, tethering complexes or physical positioning by microtubule-associated dynein motors, are regulated at multiple points to ensure optimum conditions for autophagic flux to proceed.

I. SNARE Proteins

SNARE proteins are responsible for mediating fusion events throughout the cell, through the use of their SNARE domains. See Figure 4 for details on how SNARE- mediated systematic vesicle fusion events occur. SNARE-domain containing proteins fall into broadly defining classifications depending on whether the SNARE protein contains a key glutamine (Q-SNAREs) or arginine (R-SNAREs) residue in the center of the SNARE motif (15). SNARE domains are structurally alpha helix coiled-coil domains designed to interact with each other via SNARE zippering (Figure 5) (16). Q- and R-SNAREs function as v- or t-SNAREs based on whether they are associated with the incoming

Vesicle membrane (typically the R-SNAREs) or with the Target compartment (typically the Q-SNAREs). Four SNARE motifs are required for a SNARE bundle, sometimes referred to as a SNAREpin, 1 R-SNARE and 3 Q-SNAREs, subdivided as Qa, Qb, and

Qc SNAREs based on peptide sequence (17). These motifs can be divided into 3 or 4 proteins, as the SNAP25-protein family members carry 2 Q-SNARE domains that

Figure 4. The lifecycle of a transport vesicle. 1: Budding. A small Arf/Sar GTPase is recruited to the donor membrane by its cognate guanine nucleotide exchange factor. Next, incoming coat components are bound and cargo proteins diffuse into the budding site where they are trapped by their interaction with coat proteins or cargo receptors. The membrane forms a coated bud, giving rise to a vesicle. A GTPase activating protein (GAP) that is part of the coat stimulates GTPase activity, which leads to uncoating and release of the GTPase and coat proteins into the cytosol, where they can recycle. 2: Transport. Vesicles are transported from their budding site to the acceptor compartment through association with cytoskeletal elements and transport motors (not shown). 3: Docking. Vesicles are targeted to sites of fusion in an event that involves a GTP-bound Rab protein, elongated coiled-coil tethering proteins and other tethering factors (not shown). After the docking step, an R-SNARE (VAMP) assembles with a Qa-SNARE (syntaxin), a Qb-SNARE (SNAP N) and a Qc-SNARE (SNAP C) to form a parallel, four-helical bundle. Interactions of Sec1s with Qa-SNAREs are probably critical in forming the core fusion complex. 4: Fusion. After nucleation of the ternary core fusion complex, further zippering of the parallel helices brings the vesicle and acceptor membrane close together, perhaps driving the fusion reaction. 5: Disassembly. After fusion, Rab-GDP is released from the membrane by GDP-dissociation inhibitor (GDI) and recruited back to the donor membrane. The SNARE complex is disassembled by the ATPase N-ethylmalemide-sensitive factor (NSF) and α-SNAP so that SNAREs can be recycled for further rounds of transport. Reprinted by permission from Springer Nature Customer Service Centre GmbH: Springer Nature Bock, J., Matern, H., Peden, A., and Scheller, R. A genomic perspective on membrane compartment organization. Nature (409), 839–841 © 2001.

8 provide Qbc SNARE domains for the interaction. Other involved protein families include the vesicle associated membrane proteins, or VAMP, family which is composed of R-

SNAREs and the Syntaxin protein family which is composed of Qa-SNAREs (18, 19).

The general mechanism of action of the SNAREs is to pull 2 opposing membranes together for fusion to occur (Figure 5). The fusion-permissive SNARE bundle is formed by sequential binding stages with non-fusogenic intermediates.

Typically, the Q-SNAREs first bind together on the target membrane to together form a receptor for the incoming R-SNARE-laden vesicle, which would be required before the addition of R-SNARE’s coiled-coil domain could be “zippered” into the SNARE bundle

(16). Once the Qabc SNARE bundle is formed, it can accept the R-SNARE binding into the complex. Though this complex now has the required components, it is not yet fusogenic. Calcium ions are thought to be required for permissive fusion (20–22).

Clamping factors, such as complexin, hold SNARE bundles ready for permissive fusion conditions and regulated by the calcium-activated synaptotagmin family proteins. Upon

Ca2+ availability, synaptotagmin can remove the fusion clamp from the complex and allow rapid membrane fusion to occur. Synaptotagmin family members have not been yet implicated for a role in autophagic membrane fusion, though a few have been reported in functions in related to the lysosome (16, 18, 19, 23, 24).

Figure 5: The zippering model for SNARE-catalyzed membrane fusion. (A) The zippering model for SNARE-catalyzed membrane fusion. Three helices anchored in one membrane (the t-SNARE) assemble with the fourth helix anchored in the other membrane (v-SNARE) to form trans-SNARE complexes, or SNAREpins. Assembly proceeds progressively from the membrane-distal N termini toward the membrane- proximal C termini of the SNAREs. This generates an inward force vector (F) that pulls the bilayers together, forcing them to fuse. Complete zippering is sterically prevented until fusion occurs, so that fusion and the completion of zippering are thermodynamically coupled. (B) Therefore, when fusion has occurred, the force vanishes and the SNAREs are in the low-energy cis-SNARE complex. From Südhof, T.C., and Rothman, J.E. Membrane Fusion: Grappling with SNARE and SM Proteins. Science 2009; 323:474-477. Reprinted with permission from AAAS. © 2009.

II. Autophagy Related SNARE Proteins

There are now five SNARE proteins that have been cited to mediate autophagosome-lysosome fusion events, in two distinct groupings. The first discovered permissive bundle is made up of Syntaxin 17 (STX17), vesicle associated membrane protein 8 (VAMP8) and synaptosome associated protein 29 (SNAP29) discovered in

2012 in human cells and in 2013 in D. melanogaster (25, 26). Additional binding sets were hypothesized to exist, as knockdown of STX17 failed to completely eliminate autolysosome formation. Recently, a second permissive bundle has addressed the gaps in the functionality of the first. This bundle is comprised of YKT6, Syntaxin 7, and

SNAP29 (27). Cocurrent knockdowns of YKT6 and STX17 prevent the progression of autophagy from an autophagosome to its final stage, the autolysosome. These SNAREs are responsible for the physical fusion of the two opposing membranes of the lysosome and autophagosome/amphisome (26, 27). This dissertation has focused on the originally discovered bundle of STX17, VAMP8 and SNAP29.

III. Syntaxin Family and Syntaxin17

The Syntaxin family of proteins make up the entirety of the Qa SNARE group

(15). Syntaxins share a N-terminal domain, called a Habc domain, that is required for cell viability and performs an inhibitory function of binding back to its coiled-coil domain

(28–30). STX17 is a Qa-SNARE that contains an LC3-interacting region (LIR) and two transmembrane domains which are necessary for correct localization. Immunogold electron microscopy revealed that STX17 localizes specifically to the outer membrane of the completed autophagosome (26). Colocalization studies using LC3, LAMP1 and

LBPA showed that STX17 has a role in autophagosome to endosome or lysosome fusion events (26). The localization of STX17 is regulated by LAMP2, LC3/GABARAP proteins, and IRGM (26, 31, 32). Loss of LAMP2 disrupts the autophagy process due to a mislocalization of STX17 (31). IRGM binds to STX17 via its dual transmembrane domains. The silencing of IRGM disrupts the normal colocalization of STX17 with LC3, demonstrating a targeting role for IRGM (32).

IV. VAMP Family and VAMP8

The VAMP family of SNARE proteins represent the R type of SNARE in a

SNARE fusion bundle. This family can be subdivided into RD SNAREs or RG SNAREs, dependent on the conservation of the residue to the C-terminal side of the zero-level

11 arginine within the coiled-coil domain structure. While coiled-coil domains are generally conserved, small differences in the residues exposed near the arginine may add a level of regulation for recognition by non-SNARE accessory proteins (33, 34). RD SNAREs contain an aspartic acid, while RG SNAREs contain a glycine residue (35). Throughout structural alignments, other residues within the bundles seem to remain conserved based on these differentiated groups (35). The RD SNARE group contains VAMP1, VAMP2 and VAMP3 in humans and is exclusively used for fast exocytosis of neurotransmitters.

These three proteins are known as “brevins” (36) based on their lack of a common

SNARE N-terminal longin domain which has been shown to be regulatory by self- inhibiton (37, 38) and modulate localization (39). The RG SNARE group contains human

RG brevins: VAMP4, VAMP5 and VAMP8; as well as RG longins (RG SNAREs that contain the N-terminal longin domain): SybL1/VAMP7, YKT6, and Sec22b. (35).

VAMP8 is the transmembrane R-SNARE on the lysosome that binds STX17-

SNAP29 (40). VAMP8 has been shown to be important in pathogen-containing autophagic vacuoles, as knockdown of VAMP8 decreases the antimicrobial effects of the autophagy pathway (41). VAMP8’s localization is not dependent on LAMP2 (31), but is dependent on the small GTPase RAB21 (42). In starvation conditions, RAB21 requires activation by SBF2, a guanine nucleotide exchange factor for GTPases, to interact with

VAMP8. However, neither RAB21 nor SBF2 affect lysosome quantity, acidification, or the endocytic degradation pathway (42).

V. SNAP25 Family and SNAP29 and SNAP47

The SNAP25 protein family is comprised of a unique subtype of SNARE protein.

These SNARE proteins contain two coiled-coil domains, bridged by a linker region in the

12 middle. There are four proteins of this family: SNAP25, SNAP23, SNAP29 and

SNAP47. SNAP29 is a promiscuous, non-lipid anchored Qbc-SNARE that donates its 2 coiled-coil domains to the forming SNARE bundle (43). SNAP29 binds STX17 on the autophagosome and facilitates binding to VAMP8 (26). An exceedingly rare deletion mutation in SNAP29 has been characterized in 7 patients as causing Cerebral dysgenesis, neuropathy, ichthyosis, and keratoderma (CEDNIK) syndrome, a fatal disease in children

(44, 45). SNAP29 knockout cells have showed significant accumulation of vesicles in D. melanogaster (46), suggesting that it could have a damaging effect on autophagy or other vesicle fusion events if removed. SNAP29-STX17 binding is inhibited by an O-

GlcNAcylation on SNAP29 in nutrient-sufficient conditions. Decreased O-

GlcNAcylation levels during in starvation conditions results in a more stable STX17-

SNAP29-VAMP8 complex (47). The localization of SNAP29 is dependent on LAMP2, although this is hypothesized to be a secondary effect of the mislocalization of STX17

(31). SNAP47 is an orphan SNARE within SNAP25-family proteins. The limited work that has been performed on SNAP47 demonstrates a membrane-binding role and slower membrane fusion kinetics than SNAP29 (48), and that it interacts with certain endosomal

VAMP proteins (49). This leads to the hypothesis that SNAP47 may have a role in autophagy.

C. Picornaviruses

Picornaviruses are classically defined by their non-enveloped capsids containing a positive-sense, single-stranded RNA genome (50). The capsid is a small icosahedral shell, about 30nm in diameter, and is comprised of 240 total protein copies of four main structural proteins (51). The genome of Enterovirus D68 contains 7.37kB of RNA

(Genome Assembly Number ASM281672v1). The virus’s genome is transcribed as a single polyprotein which then is processed into functional protein units (52). The polyprotein cleavage scheme for an average picornavirus and individual proteins are described in Figure 6.

Figure 6. Picornavirus Genome Structure. After translation of the vRNA into protein, the proteases will cleave themselves from the polyprotein and then subdivide the polyprotein into the functional intermediates and final protein/peptide units. The internal ribosome entry site (IRES) depicted here is from Poliovirus 1.

I. Picornavirus Lifecycle

The virus is internalized after engaging a receptor through endocytosis. A signal, either receptor engagement and/or the addition of endosomal acidification, triggers formation of the A-particle structure to facilitate the genome to escape the entry vesicle.

This structure comprises conformation rearrangements of VP1 and departure of VP4 from the capsid (53–55). The RNA is translated then replicated to be used for progeny genomic RNA and viral proteins. Virus capsids then begin to assemble and package

RNA, to form a complete progeny virion (for review of the lifecycle, see (56)). It has

14 been shown for poliovirus that this progeny virion is not infectious until the VP0 in the capsid undergoes a cleavage into VP2 and VP4 (57), a required modification for the formation of the A-particle during the subsequent round of infection. The cleavage is believed to be an autocleavage event, but the precise triggers are unknown. This lab has previously demonstrated for poliovirus that acidification for intracellular compartments is required for this maturation cleavage in the second half of the replication cycle (58). It has also been observed that enterovirus A71 VP1 A107 is required for this cleavage (59).

Historically, it has been reported that the exit of the virus occurs by lysis of the host cell, however, there have been reports of picornaviruses exiting their host cells in a host- derived quasi-envelope (60, 61).

II. Viral Protein Functions

Picornavirus replication cycles are simpler in comparison to many other virus classes. Much of what is known about protein function is based on work done in other picornaviruses, mainly poliovirus. Protein 1, P1, is divided into VP0, VP1 and VP3, all of which are structural proteins that make up the capsid. P2 is divided into 2A, 2B and 2C, with intermediate protein 2BC. 2A is a protease that is primarily responsible for cleaving cellular targets to enhance viral replication (62–65). 2BC is an intermediate protein that has been shown to have membrane sculpting and possibly autophagy-inducing functions in the cell (66, 67). 2B is a viroporin, a protein that binds to membranes, such as endoplasmic reticulum, and dysregulates membrane permeability, which in turn disrupts calcium ion homeostasis within a cell (68, 69). 2C has been shown to have RNA-binding functions (70). P3 is divided into 3A, 3B, 3C and 3D, with intermediate proteins of 3AB and 3CD. 3A is a membrane binding protein with roles related to autophagy have been

15 cited (67), but it has also been shown to block different points of trafficking throughout the cell: secretory vesicle trafficking and ER-Golgi trafficking (71, 72). 3B, also known as VpG, performs a primer function for the replication of the genomic RNA (73). It is the only protein, other than the capsid proteins, that is contained in a matured virion particle.

3C is the second protease that is encoded by the virus genome. 3C has been predominately cited to cleave the polyprotein into its individual units, with other cellular roles involving shut down of host transcription and activation of apoptosis (74–78). 3D is the RNA-dependent RNA polymerase required to replicate the viral genome, whose localization is dependent on 2A (79).

D. Enterovirus D68

I. History and Clinical Presentation of Enterovirus D68 Infections

Enterovirus D68 (EV-D68) is a virus in the family of Picornaviridae, in the genus of Enterovirus. EV-D68 was first isolated in 1962 from four cases of respiratory disease in California, giving rise to four prototypic isolates of the virus: Fermon, Rhyne, Robison and Franklin. It was originally classified independently as HRV87 and EV-D68, but after a study demonstrated it was the same serotype, it was reclassified entirely as EV-D68

(80). Since then, the classification scheme has subdivided strains into original strains, and clades A-D (Figure 7). Only 26 cases of EV-D68-associated respiratory disease were reported between 1970-2005 (81).

Figure 7: Phylogenetic tree of EV-D68 including acute flaccid myelitis (AFM)-related strains. A maximum likelihood phylogenetic tree of EV-D68 strains based on nearly complete polyprotein gene (1-6388 nt of coding sequences) was constructed using the bootstrap method with 1000 replications based on the Tamura–Nei model in MEGA X. The representative circulated EV-D68 strains during past years were collected in NCBI’s GenBank sequence database (n = 76). AFM-related EV-D68 strains are marked in red. AFM-associated stains are mostly in subclade B1 and B3. Branch lengths are drawn proportionally to the number of nucleotide substitutions per position. Reprinted with permission from Viruses: Sun, J., Hu, X., and Yu, XF. Current Understanding of Human Enterovirus D68. Viruses, 11(6), 490 © 2019.

II. Epidemiology and Progress of Therapeutic Developments

Enterovirus D68 infections occur primarily in young children. Between 2005 and

2014, there were 643 confirmed cases of EV-D68, designating this virus as a reemerging pathogen. While many cases are asymptomatic or display flu-like symptoms, increases in the severity of disease have been reported, including hospitalizations (82), with increased numbers of cases detected every 2 years. There were 14 deaths associated with EV-D68 in the 2014 infection season (83). There are currently no EV-D68 specific therapeutics available for use for the public. A few viral inhibitors, pleconaril, pocapavir, and vapendavir, have been tested by the CDC for their effectiveness against EV-D68, and the drugs proved unsuccessful at limiting the infection in humans (82, 83).

III. Evaluation to Date on Association to Acute Flaccid Myelitis

Acute flaccid myelitis (AFM) is another, seemingly disparate, condition that was following a similar trend of reports, occurring every two years. A case definition that was used in the 2014 AFM outbreak by Children’s Hospital of Colorado was “individuals less than 21 years of age with acute flaccid limb weakness and MRI involvement of predominantly the gray matter of the spinal cord without identified etiology presenting after August 1, 2014” (84). Research has begun to determine if these two conditions,

EV-D68 infection and the paralysis, are related. It has been reported that EV-D68 can preferentially can infect motor neurons, opposed to neurons in general, in the absence of one of its cited receptors sialic acid (85). It is notable that ICAM5, an additional cited receptor, is enriched in cerebrum grey matter, where cell somas are located, and could provide a potential link to how a respiratory pathogen could replicate in the nervous system (86). There have been cases reported where patients with AFM have tested

19 positive for EV-D68 by PCR, but there are also AFM cases where EV-D68 was not detected. Likewise, there are patients that are PCR-positive for EV-D68 who have no symptoms of AFM. One particular study that tested if EV-D68 has the potential to cause

AFM in mice found that certain contemporary strains have the capacity to cause limb weakness and paralysis, in mice, using Koch’s postulates as a definition of causation

(87). Bradford Hill criteria for causation is a group of nine criteria used to statistically provide evidence for a link between cause and effect in a public health setting. A second study used Bradford Hill’s statistic-based criteria to establish an epidemiological-based definition of causation between EV-D68 and AFM (88). Future work needs to be done to either support or refute the current literature claims of the link between EV-D68 and

AFM.

IV. Lifecycle Specifics of Enterovirus D68 Replication

Much of the lifecycle has not been explicitly studied in EV-D68, but extrapolated from data that exist for poliovirus, a highly related virus to EV-D68. Enterovirus D68 binds to a receptor on a cell surface, it is not yet known if there is a cell tropism for this virus. two possible receptors have been identified in the literature, ICAM5 and α-2,6 sialic acids (86, 89). Both receptors are classified as uncoating receptors, rather than attachment receptors, indicating that interaction between capsid and receptor engagement is a signal for capsid uncoating (56). It has been reported that actin histidine methyltransferase SET domain containing 3 (SETD3) is required for the RNA replication portion of the viral lifecycle (90). Enterovirus D68 has been studied in the context of modulating the cytokine response from its infected cell. The 3C protease cleaves IRF7, manipulating the induction of the cytokines permissible by the virus (91).

E. Picornaviruses and Autophagy – What is Known.

Picornaviruses have a history of a connection between their lifecycles and autophagy. In 1965, George Palade’s group observed HeLa cells that had been infected with poliovirus created abundant double-membraned vesicles (92). At the time, the process of autophagy had just started to be researched (93). Picornaviruses and autophagy were first connected in the early 2000s when poliovirus was shown to be dependent on autophagy to benefit its replication (94, 95). This lab has more recently shown that poliovirus was dependent, not only on autophagy, but on acidification in the second half of its lifecycle to have fully matured virions (58, 96). As autophagy has two final stages of acidified vesicles, the connection was drawn that this acidification requirement could possibly be fulfilled by way of autophagy. There has been a report that Enterovirus A71 can use the autophagic SNAREs, as described above, to promote the maturation of the autophagy pathway (97), giving great foundational work for the work enclosed in this dissertation. Based on the summation of these observations, the work in this document has studied the connection between autophagosome acidification and EV-D68 replication.

F. Specific Aims

In this dissertation, two specific aims will be discussed. The first aim is to elucidate the role that autophagic SNARE SNAP29 plays during EV-D68 infection. This will be accomplished through genetic manipulations of SNAP29 in H1-HeLa cells, assaying for an effect on virus replication and determining the nature of the interaction

21 between SNAP29 and the virus lifecycle. The second aim will be to determine if there is a role for orphan SNARE SNAP47 during autophagy and the EV-D68 lifecycle.

Chapter 2: Materials and Methods

A. Cell Culture

H1-HeLa cells were obtained from ATCC (ATCC Cat# CRL-1958) and have been tested for mycoplasma contamination. Cells were maintained at 37°C in 5% CO2 in

MEM media (Gibco Cat# 11095098), supplemented with 10% heat inactivated FBS

(Gibco Cat# 100-106H) and 1x sodium pyruvate (Gibco Cat# 11360070). Media were changed every 2 days and subculture splits were 1:5. 293T cells were obtained from

ATCC (ATCC cat# CRL-3216). Cells were maintained at 37°C in 5% CO2 in DMEM media (Gibco Cat# 11965118), supplemented with 10% heat-inactivated FBS, and 1x sodium pyruvate. 293T cells were subcultured at 1:5-1:10 splits. Subculture procedure for both cell lines was as follows: cell plates were aspirated of used media, cells were washed once in 1x PBS if needed, 2mL of 0.05% trypsin/EDTA was added, and cells were pipette-dissociated, then re-suspended in complete medium to a total volume of 10mL.

B. Viral Plasmids

Viral plasmids were as described for Mahoney Poliovirus 1, and Coxsackievirus

B3 (98, 99). Fermon EV-D68 sequence was generated in pBluescript with the addition of a 3’ MluI restriction site (Bio Basic, inc.).

C. Viral Stock Growth Method

Viral plasmids were obtained and transformed into subcloning efficiency DH5α

Escherichia coli (Invitrogen, Cat# 18258012) and grown in selective LB agar with ampicillin. Individual colonies were selected, grown up and the plasmids purified by phenol-chloroform extraction. Viral plasmids were digested with restriction enzyme to

23 release virus genome insert, and RNA was synthesized in vitro using MEGAscript T7

Transcription Kit (Invitrogen Cat# AM1333). Newly synthesized RNA was transfected into H1-HeLa cells using DMRIE-C transfection reagent (Invitrogen Cat# 10459014) as according to manufacturer’s protocol, and overlaid with a 1:1 2x MEM/2% agar mixture

(Corning, Cat #20-010 and VWR, Cat# 90000-760). Plaques were isolated 36-48 hours post-transfection. Plaque-picks were freeze-thawed 3x between a dry ice/ ethanol bath and a 37° water bath to form a slurry of disrupted agar, cell debris and virus. The slurry was then added to a plate of H1-HeLa cells for 5-6 hours and cells were harvested in 1mL of PBS+ (PBS with 10μg/mL of both calcium chloride and magnesium chloride). These midi-stocks were freeze-thawed 3x and expanded once more for 6-7 hours. The final stocks were titered for plaque forming unit contents via plaque assay.

D. Viral Infections

Viral infections were carried out for five hours for EV-D68 and CVB3, and six hours for PV, except where noted. Cells were counted in a parallel plate by hemocytometer and virus needed for the appropriate MOI was calculated. The two MOIs used within, with exceptions where noted, are 0.1 for low MOI infections for growth curves and a MOI of 25 as a high MOI used in fluorescent microscopy, electron microscopy and western blotting methods. Virus was diluted in PBS+. Cell media was aspirated from plates and PBS+-virus mixture was added. Plates were incubated for 30 minutes at 37°C. Cells were then washed in PBS once to remove any unbound virus, and complete media was added for duration of the infection time point. Collection of samples post infection was completed by scraping cells into 1mL of PBS and either frozen at

˗20°C in the PBS+ suspension for plaque assay samples, or centrifuged at 18,600xg for

24 five minutes, PBS supernatant was aspirated, and just the pellet stored at ˗20°C for further sample processing.

E. Drug Treatments

Bafilomycin A1 (BafA1) (Santa Cruz Biotech, Cat# SC-201550) was prepared into a stock solution of 100μM in ethanol and used at a concentration of 0.1μM. BafA1 was added to fresh culture media and pretreated for 18 hours prior to infection. BafA1 was also added at its working concentration to the infection PBS+ and complete media during infection.

Starvation media was prepared as 140mM sodium chloride, 1mM calcium chloride, 1mM magnesium chloride, 5mM glucose, 20mM HEPES and 1% w/v bovine serum albumin in ddH2O (100). The solution was sterile-filtered through a 0.22μm filter.

Starvation media was used on H1-HeLa cells for four hours prior to infection. Adsorption and the duration of the infection were completed as written in “viral infections.”

Pepstatin A and E64-D (also known as 2S,3S-trans-Epoxysuccinyl-L- leucylamido-3-methylbutane ethyl ester) treatments were completed in combination to block the function of the lysosome. Pepstatin A (Invitrogen, Cat# 78436) was prepared as a stock solution of 10mg/mL in DMSO and used at a working concentration of 10μg/mL, a functional dilution of 1:1000. E64-D (Sigma, Cat# E8640) was prepared into a stock solution of 10mM in DMSO, used at a working concentration of 100μM, a functional dilution of 1:100. This combination treatment was added to the experimental plates after the adsorption phase of infections and added to the complete media for five hours, concurrent with infection.

MG132 (Sigma Aldrich, Cat# M8699) was purchased as a ready-made solution of

10mM in DMSO and was used at a working concentration of 20μM. This treatment was added concurrent with infection in the complete media.

Cycloheximide (Sigma Aldrich, Cat# C4859) was purchased as a ready-made solution of 100 mg/mL in DMSO and was used at a working concentration of 100μM.

This treatment was made up in complete media and added to a cell plate for five hours.

The cells were then collected via scraping into 1 mL of PBS, spun down at 18600xg for five minutes, PBS supernatant aspirated, and the pellet stored at -20°C.

Trifluoperazine (Selleckt Chemicals, Cat# S3201) was made up in ddH2O and recommended to use 8.3μM as a working concentration (101). This treatment was made up in complete media and pre-treated for 18 hours prior to infection. Adsorption and infection were also completed in the presence of this compound.

F. Plaque Assays

Plaque assays were used to determine viral growth titers, in plaque forming units

(PFU) in this work. Samples for assay were freeze-thawed 3x between an ethanol-dry ice bath and 37°C water bath. These samples were then serially diluted either 1:10 or 1:100 into PBS+-containing tubes. H1-HeLa cells were plated to approximately 95% confluence on 6cm plates the day before assays were to begin, a functional split of 1:6 from a 10cm plate to six 6cm plates. Media was aspirated from these plates. 250μL of the serially diluted sample was added to a plate, and plates were incubated for 30 minutes at 37°C.

After the incubation, 4mL of a 1:1 2x MEM/2% agar mixture was added to each plate.

Plates were incubated for approximately 32 hours at 37°C. The solid agar top was

26 removed from each plate, and cells were fixed with a 20% ethanol/ 0.01% crystal violet solution and rinsed in water. Plaques were counted and titers were back-calculated to plaque forming units per sample (PFU).

G. Western Blotting

Sample pellets collected for western blot were removed from the ˗20°C freezer and thawed on ice. Pellets were lysed in a 10mM sodium chloride (Fisher, Cat# S67110),

1.5mM magnesium chloride (Sigma, Cat# S67110), 1% NP-40/Tergitol (Sigma, Cat#

NP40S), 10mM Tris-HCl (pH 7.5) (Fisher, Cat# BP153), and 1x protease inhibitor cocktail (Invitrogen, Cat# 88666) for 20 minutes on ice. Protein content was quantified via Bradford assay (Sigma, Cat# B6916), using 0-1mg/mL BSA standards for comparison. Polyacrylamide gels were poured for Tris-Glycine SDS-PAGE and samples were loaded with Pageruler dyed protein ladder (Invitrogen, Cat# 26616). Gels were run at 90V through the stacking gel, and 125V through the resolving gel. Gels were transferred using an iBlot 2, on pre-installed program 0, using PVDF cassettes

(Invitrogen, Cat# IB24001).

Blots were blocked in 5% milk/TBS-T for 30 minutes at room temperature

(Biorad, Cat# 1706404). Primary antibodies were either made in 1% milk/TBS-T or 2.5%

BSA/TBS-T, as per experimental optimization dictated, and stored at ˗20° between uses.

Blots were incubated in primary antibody overnight at 4°C. Blots were washed 3x in

TBS-T for 10 minutes each, at room temperature. Secondary antibodies of either goat anti-rabbit (1:2000) or goat anti-mouse (1:10,000) (Biorad) were diluted into 5% milk/TBS-T and made fresh each week. Blots were incubated in secondary antibody for one hour at room temperature. Blots were washed 3x in TBS-T for 10 minutes each, at

27 room temperature. Western blots were visualized by a short incubation in Western

Lightning ECL (Perkin Elmer Cat# NEL122001) and use of a Biorad ChemiDoc instrument. If needed, blots were stripped for 10 minutes at room temperature using

Restore stripping buffer (Invitrogen Cat# 21059), rinsed in TBS-T to remove buffer, then re-blocked for 30 minutes using 5% milk/TBST.

H. siRNA Knockdowns

This work uses siRNA knockdown technology to silence genes of interest prior to an experiment. Mission Sirna Universal Negative Control 1 (Sigma, Cat # SIC001), was used as a negative control in all cases. The sequence for ATG7_1 and siATG7_2 were generated from Sigma’s Mission predesigned siRNA generated by Rosetta siRNA Design

Algorithm and sequences are provided in the oligonucleotide table. The sequence for siSNAP47 was from Sigma’s Mission predesigned siRNA library generated by Rosetta siRNA Design Algorithm and sequence is provided in the oligonucleotide table. The

SNAP29 siRNA sequence is provided in the oligonucleotide table. The siRNAs were generated by Sigma and were resuspended from their lyophilized form in a buffer comprised of 100mM potassium acetate (Sigma, Cat# P1190), 2mM magnesium acetate

(Fisher, Cat#M13), and 30mM HEPES-KOH (pH 7.2), as suggested by Sigma, to a concentration of 100μM. The tubes were boiled at 100°C for five minutes, and incubated at 37°C for one hour to anneal. siRNAs were aliquoted and frozen at -20°C. A total of 75 pmol per 6-well was transfected into H1-HeLa cells at a ~40% confluence density using

5μL per well of Lipofectamine 2000 (Invitrogen, Cat# 11668019) in antibiotic-free media conditions. siRNA transfected cells were incubated at 37°C for 40 hours before

28 continuing with the experiment. Knockdown efficacy was assessed by western blot in each experiment.

I. Overexpression transfections

This work uses gene-of-interest containing plasmids for ectopic expression. pcDNA was used a vector control for most overexpression experiments. FLAG-SNAP29,

FLAG-STX17 and FLAG-VAMP8 plasmid constructs were obtained through Addgene as a gift from Noboru Mizushima (Addgene plasmids 45915, 45911, and 45912, respectively) (26). GFP-SNAP47 was purchased from OriGene Technologies (Cat#

RG205867). SQSTM1-WT and SQSTM1-MT/SQSTM1-G241E were obtained from

Honglin Luo (102). FLAG-SNAP29-Q156A, FLAG-SNAP29-Q161A, EV-D68 2A, and

EV-D68 3C were generated by this lab for this work, as described below. For H1-HeLa cell transfections, 0.4μg of plasmid was transfected into 60% confluent cells using

Effectene transfection reagent’s protocol (Qiagen, Cat# 301425). Cells were incubated at

37°C for 24 hours post transfection before continuing with the experiment. For 293T cell transfections, 2.5μg of each plasmid was transfected into 80% confluent cells using Mirus

TransIT-293 and the reagent’s protocol (Mirus Bio cat# MIR2700) for 24-48 hours prior to continuing the experiment. Ectopic expression of the proteins was assessed by western blot in each experiment.

Viral protease EV-D68-2A and EV-D68-3C plasmids were constructed using the

PHAGE system, which was a gift from Richard Mulligan (103). Primers for the viral proteases were ordered from Sigma, and the Fermon strain viral plasmid was used as a template. Proteases were cloned out of the viral plasmid and into the PHAGE plasmid using restriction enzymes. PHAGE plasmid constructs were sequenced to confirm proper

29 insertion. Plasmids were transformed into DH5α E. coli, grown up in cultured and a plasmid prep performed using Genelute midiprep kit (Sigma, Cat# NA0200). PHAGE plasmid contains GFP, which can be used as a control for transfection. PHAGE plasmid was used as a vector control in these experiments only.

FLAG-SNAP29 point mutation plasmids for Q156 and Q161 were generated via

PCR using the primers listed in the oligonucleotide table below. Plasmids were transformed into DH5α E. coli, per manufacturer’s instructions, (Invitrogen, Cat#

18265017). A series of colonies were picked, had minipreps performed on them, and sequenced to confirm the point mutation was the correct and the only mutation in the

SNAP29 open reading frame.

J. Electron Microscopy For electron microscopy analysis, cells were fixed with a solution of 2% paraformaldehyde, 2.5% glutaraldehyde in 0.1 M PIPES buffer (pH 7.2), scrapped off the tissue culture vessel, washed in 0.1M PIPES buffer and collected by centrifugation. Cell pellets were enrobed in 2.5% low melting point agarose, trimmed into 1mm3 blocks and post-fixed with 1% osmium tetroxide and 1.5% potassium ferrocyanide in 0.1M PIPES buffer for 1 hour at 4oC. After washing, agarose blocks containing cells were en bloc stained with 1% uranyl acetate in water and dehydrated using increasing concentration of ethanol from 30%; 50%; 70%; 90% and 100% for 10 min at each step. Specimen were then incubated with two changes of 100% acetone and infiltrated, in increasing concentration of Araldite-Epoxy resin (Araldite, EMbed 812; Electron Microscopy

Sciences, PA), and embedded in pure resin at 60°C for 24 to 48 h. Ultrathin sections at

~70nm thickness were cut on Leica UC6 ultramicrotome (Leica Microsystems, Inc.,

Bannockburn, IL), and examined in a FEI Tecnai T12 electron microscope operated at 80 kV. Digital images were acquired by using an AMT bottom mount CCD camera and

AMT600 software.

K. Fluorescence Microscopy

For fluorescent microscopy imaging, H1-HeLa cells were plated in 12 wells on sterile poly-D-lysine coated coverslips. After experimental procedures, cells were fixed in ice-cold methanol for 15 minutes at -20°C. Coverslips were then blocked in either 1x

PBS/ 5% normal goat serum (CST, Cat#5425S)/ 0.3% Triton X-100 (AmBio, Cat#

AB02025) or 1x PBS/ 5% normal goat serum/ 0.1% Saponin (Sigma, Cat# S7900) for one hour at room temperature. Coverslips were then incubated in primary antibody overnight at 4°C. CTSB primary antibody was used at 1:800, diluted in 1x PBS/ 1%

BSA/ 0.1% Saponin antibody dilution buffer. LAMP1 primary antibody was used at

1:200, diluted in 1x PBS/ 1% BSA/ 0.3% Triton X-100 antibody dilution buffer.

Coverslips were washed three times in 1x PBS or 1x Ringers Buffer (144mM NaCl

(Fisher Cat# S67110), 5mM KCl (Sigma Cat# P3911), 1mM MgCl2 (Sigma Cat#

M9272), 1mM CaCl2 (Amresco Cat# 1B1110), 1.2mM NaH2PO4 (Sigma Cat# M9272),

5mM HEPES (Sigma Cat# H3375), and 5.5mM Glucose (Sigma Cat#7528), all pH 7.4 and sterile filtered) for five minutes each. Secondary antibody was diluted in corresponding antibody dilution buffers for each primary at a concentration of 1:1000, and incubated for one hour at room temperature. Coverslips were washed three times in

1x PBS or Ringers Buffer for five minutes each. Coverslips were then mounted with

Vectashield with DAPI (Vectashield Cat# H-1200) and slides sealed with nail polish, or mounted with hardset Prolong Glass with or without NucBlue (Invitrogen Cat# P36985

31 and Invitrogen Cat# P36982, respectively). Images were acquired on a Zeiss LSM 710

Confocal microscope, Echo Revolve Fluorescence Microscope, or a Nikon LSM 510

Spinning Disk Confocal Microscope.

L. Autoradiography H1-HeLa cells were changed to a methionine, cysteine and glutamine-free MEM

(Fisher Cat# ICN1641454) supplemented with 100µCi of 35-S Methionine (Perkin

Elmer, Cat# NEG772007MC) for one hour during the course of an infection. Cells were collected at the end of that period in PBS, centrifuged and the supernatant was collected and discarded. Pellets were maintained at -80°C until ready for processing. A 12% polyacrylamide gel was poured in large format gel plates. Lysates were loaded onto the gel and run at constant 35mA. When complete, the gel was dried on Biorad Model #583

Gel Dryer for 1.8 hours at 60°C and exposed to X-ray film for 24 hours at room temperature. Film was developed using AFP Imaging Mini-MED/90 X-Ray Film

Processor.

Table 1. Antibody Table

Mouse monoclonal anti- Abnova Abnova Corporation Cat# H00008878-M01 SQSTM1

Rabbit polyclonal anti- Novus Novus Cat# NB600-1384 LC3B

Rabbit polyclonal anti- Novus Novus Cat# NB600-532 ACTB

Rabbit monoclonal anti- Abcam Abcam Cat# ab98208 SNAP47

Rabbit monoclonal anti- Abcam Abcam Cat# ab172609 SNAP47

Rabbit polyclonal anti- Abcam Abcam Cat# ab116113 STX17

Rabbit monoclonal anti- Abcam Abcam Cat # ab138500 SNAP29 C-terminal

Rabbit polyclonal anti- Cell Signaling Cell Signaling Technology Cat # 2144 TUBA Technology

Mouse monoclonal anti- Sigma Aldrich Sigma-Aldrich Cat# F1804 FLAG

Rabbit (monoclonal) Abcam Abcam Cat # ab181151 anti-SNAP29 N-terminal

Rabbit polyclonal anti- Cell Signaling Cell Signaling Technology Cat# 2555 GFP Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 2118 GAPDH Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat#8558 ATG7 Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 31718 Cathepsin B (CTSB) Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 9091 LAMP1 Technology

Table 1 Continued.

Mouse monoclonal anti- Abcam Abcam, Cat# ab25630 LAMP1

Rabbit polyclonal anti- Cell Signaling Cell Signaling Technology Cat# 4844S COXIV Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 2679S Calnexin Technology

Mouse monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 83506S LC3 Technology

Rabbit polyclonal anti- Covalab Covalab Cat# 00117199 VAMP7

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 13876S VAMP7, IF Specific Technology

Rabbit polyclonal anti- Cell Signaling Cell Signaling Technology Cat# 2411S EEA1 Technology

Mouse monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 46449 Rab5 Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 9367S Rab7 Technology

Rabbit monoclonal anti- Cell Signaling Cell Signaling Technology Cat# 5589S Rab11 Technology

Mouse monoclonal anti- Sigma Aldrich Sigma Cat# SAB5300168 HRP

Mouse monoclonal anti- Abcam Abcam Cat# ab37266 Giantin

Mouse monoclonal anti- Scicions Scicions Cat# 10010200 dsRNA

Goat anti-Rabbit Bio-rad / AbD Bio-Rad / AbD Serotec Cat# 170-6515 Serotec

Goat anti-Mouse Bio-rad / AbD Bio-Rad / AbD Serotec Cat# 170-6516 Serotec

Table 1 Continued.

Alexa Fluor 488 goat Invitrogen Molecular Probes Cat#A-11029 anti-mouse

Alexa Fluor 568 goat Invitrogen Molecular Probes Cat#A-11031 anti-mouse

Alexa Fluor 647 goat Invitrogen Molecular Probes Cat#A-11236 anti-mouse

Alexa Fluor 488 goat Invitrogen Molecular Probes Cat#A-11008 anti-rabbit

Alexa Fluor 568 goat Invitrogen Molecular Probes Cat# A-11036 anti-rabbit

Alexa Fluor 647 goat Invitrogen Molecular Probes Cat#A-27040 anti-rabbit

HRP Antibody Abcam Abcam Cat# ab102890 Conjugation Kit

Table 2. Oligonucleotide Table

siRNA to SNAP29: (104) N/A Sense: 5’-GAAGCUAUAAGUACAAGUA-3’ Antisense 5’-UACUUGUACUUAUAGCUUC-3’ siRNA to SNAP47: Sigma Aldrich Product # Sense: 5’-GAAAGAAGGGAUACUGAUA-3’ NM_053052 Antisense: 5’-UAUCAGUAUCCCUUCUUUC-3’ siRNA to ATG7_1: Sigma Aldrich Product # Sense: 5’-GAGAUAUGGGAAUCCAUAA-3’ NM_006395 Antisense: 5’-UUAUGGAUUCCCAUAUCUC-3’ siRNA to ATG7_2: Sigma Aldrich Product # Sense: 5’-CAGCUAUUGGAACACUGUA-3’ NM_006395 Antisense: 5’-UACAGUGUUCCAAUAGCUG-3’ siRNA to VAMP7 Ambion Product # AM167708, Lot # AS02BEEQ, ID # 241467 siRNA to VAMP7 Santa Cruz Product # SC44606, Lot # F0806

Primer EV-D68 3C protease cloning primers: (104) N/A 5’end: 5’- ACGTGCGGCCGCATGGGACCAGGATTTGATTT TG-3’ 3’end (positive strand): 5’- CTCTTACTTTACTGATACACAA-3’ 3’end (negative strand): 5’- ACGTCTCGAGCTATTGTGTATCAGTAAAGTAA GAG-3’

Table 2 Continued.

EV-D68 2A protease cloning primers: (104) N/A 5’ end: 5’- ACGTGCGGCCGCATGGGTCCAGGTTTTGG-3’ 3’end: (positive strand): 5’- GATACTGATGTTATGGAACAA-3’ 3’end (negative strand): 5’- ACGTCTCGAGCTATTGTTCCATAACATCAGTAT C-3’

SNAP29 Mutagenesis primer set for Q156A: (104) N/A Positive strand: 5’- GAACTGGAAGCAAAGTACCAGGCCAGCC -3’ Negative strand: 5’- GGCTGGCCTGGTACTTTGCTTCCAGTTC -3’

SNAP29 Mutagenesis primer set for Q161A: (104) N/A Positive strand: 5’- GAACAGGAAGCAAAGTACCTGGCCAGCC -3’ Negative strand: 5’- GGCTGGCCAGGTACTTTGCTTCCTGTTC -3’

SNAP29 Sequencing primer set: (104) N/A Positive strand: 5’-GACGCAAATGGGCGGTAGGC- 3’ Negative strand: 5’-GCCACCCGGGATCCTCAG-3’

Chapter 3: Enteroviruses remodel autophagic trafficking through regulation of host SNARE proteins to promote virus replication and cell exit

A. Introduction

Enterovirus D68 (EV-D68) is a positive-sense, single-stranded RNA virus of the

Picornaviridae family. first isolated in 1962, which causes a mild, upper respiratory illness (105, 106). EV-D68 cases have been increasing in frequency and severity over the last decade, with outbreaks in the United States in 2014 and 2016 (107, 108). It is likely that the number of cases is severely under-reported, as only the most severe clinical presentations are tested for EV-D68, allowing many infections to go undetected as asymptomatic or mild flu-like cases (109). Recently, outbreaks and individual infections are often correlated with cases of acute flaccid myelitis (AFM) (110, 111). AFM is a rare condition that causes weakening in the muscles and is seen most often in children (112,

113). Though the link between EV-D68 and AFM is still under investigation, a mouse model fulfills Koch’s postulates for virus as a cause of paralysis, suggesting that EV-D68 may be one cause of AFM cases (87). EV-D68 remains relatively understudied and much about the interactions between the cell and the virus has yet to be elucidated.

Many pathogens interact positively or negatively with the host autophagic pathway. Autophagy is a process of homeostatic degradation in a cell, used to create nutrients in times of stress and as a mechanism to recycle damaged organelles or microbes in the cytosol (114). Autophagy initiation is regulated by a tightly-controlled web of post-translational modifications and is monitored by the conversion of

38 microtubule-associated protein 1A/1B-light chain 3 (LC3) from its cytosolic, resting state

(LC3-I) to the lipidated form LC3-II, through the addition of a phosphatidylethanolamine by E3-like conjugation enzymes (115). The process is characterized by the formation of a crescent membrane that engulfs cytosolic cargo and forms a double-membraned vesicle, termed an autophagosome (116). The autophagosome fuses with an acidifying endosome which delivers vacuolar ATPases, and the resultant vesicle is termed the amphisome

(117). This acidification is required for lysosomal fusion. The amphisome fuses with the lysosome to form an autolysosome, in which autophagic cargo is degraded including cargo adaptor molecules such as SQSTM1 (118). Steady-state SQSTM1 levels indicate the rate at which autophagosomes are successfully delivering their cargo to lysosomes for degradation.

The fusion events in autophagy are coordinated by a class of proteins called soluble N-ethylmaleimide-sensitive factor attachment receptors (SNAREs) (see also

SNARE section in Chapter 1) (119). SNARE fusion bundles require 4 α-helices to function: Qa, Qb, Qc, and R (120). STX17 is the Qa SNARE on the autophagosome that coordinates its fusion with other vesicles (26). SNAP29 is a cytosolic Qbc SNARE that binds to STX17, donating its helices to the forming fusion bundle (46). VAMP8 is an R

SNARE, found on lysosomal and endosomal membranes, that binds to STX17-SNAP29, tethering the membranes together for fusion (121). The family of known Qbc SNARES is small, consisting of SNAP25 exclusively in neurons, SNAP23 at plasma membranes,

SNAP29, and the larger SNAP47, which is thought to be associated with endosomes (48,

49, 122). It has been suggested that picornavirus proteins can interact with autophagosomal SNAREs to help form the autolysosome (123).

Many pathogens are degraded by autophagy, but some subvert the process for their own benefit, including several picornaviruses (124, 125). Previous work by our group has demonstrated that poliovirus 1 (PV) uses acidic amphisomes to promote virus replication and maturation (58). Coxsackievirus B3 induces the autophagic pathway, but may inhibit degradation of autophagic cargo (126–128). We report here that EV-D68 induces autophagy signaling to benefit its replication, and manipulates the autophagosomal SNAREs. SNAP29 has important roles early in EV-D68 replication and late in cellular exit, when SNAP29 is cleaved by EV-D68 viral protease 3C. Our data suggest that the manipulation of SNAREs can impact the growth and trafficking of picornaviruses.

B. Results

Enterovirus D68 is affected by autophagy-altering treatments

To characterize the effect of autophagy on EV-D68, we treated cells with an autophagy inhibitor, bafilomycin A1 (BafA1). BafA1 inhibits acidification of cellular compartments, including amphisomes, blocking autolysosome formation (129). H1-HeLa cells were treated with BafA1 for 18 hours, then infected with EV-D68. Viral titers were analyzed by plaque assay for cell-associated (Figure 8A) and extracellular (Figure 8B) virus. We found a significant drop in cell-associated virus in BafA1-treated cells. Parallel uninfected cells were collected for western blotting for LC3 and SQSTM1 to assess the effect of the treatment on autophagy (Figure 8C) and found buildup of these markers, consistent with autophagic inhibition.

Figure 8. Enterovirus D68 replication is affected by autophagy-altering treatments.

(A,B) H1-HeLa cells were treated with 0.1μM BafA1 for 18 hours prior to infection then infected at an MOI of 0.1 with EV-D68 for six hours. Viral titers were analyzed by plaque assay for both cell-associated virus (A) (p=0.0017) and extracellular virus (B). (C) Autophagy markers SQSTM1 and LC3 were analyzed by western blot of parallel samples from (A) and (B). (D, E) H1-HeLa cells were treated with starvation medium for four hours prior to infection and then infected at an MOI of 0.1 with EV-D68 for five hours. Viral titers were analyzed by plaque assay for both cell-associated virus (D) (p=0.046) and extracellular virus (E) (p=0.0019). (F) Parallel samples from (D, E) were analyzed by western blot. (D, E) H1-HeLa cells were transfected with a control siRNA or one of two different siRNAs against ATG7 for 40 hours. Cells were infected at an MOI of 0.1 with EV-D68 for five hours. Viral titers were analyzed by plaque assay for both cell-associated virus (G) (p=0.044) and extracellular virus (H) (p=0.0078, p=0.0042 respectively). (I) Parallel samples from (G,H) were analyzed by western blot for knockdown efficiency. Western blots are representative from one of the three independent experiments. Viral titers are represented as the mean ± SEM. Statistical tests were done using an unpaired Student’s T-test with statistical significance set at: **p < 0.01; *p ≤ 0.05.

Figure 8.

Since autophagic inhibition was detrimental to virus replication, we wanted to test autophagic activation. Cells were incubated in starvation medium, and induction of autophagy in H1-HeLa cells validated by western blot (Figure 9). Cells were starved for four hours, infected with EV-D68, and placed in complete media. Starvation prior to infection caused a significant increase in cell-associated (Figure 8D) and extracellular

(Figure 8E) virus. SQSTM1 levels were analyzed by western blot at the end of the starvation period, confirming autophagy induction. (Figure 8F). The increase in cell- associated virus supports that autophagy benefits viral replication. The increase in extracellular virus may suggest that autophagy also promotes exit of viral particles from the cell.

To confirm these data, we used a small-molecule autophagy activator, trifluoperazine, which induces a buildup of LC3-II (101). Cells were treated for 18 hours with 8.3µM trifluoperazine and assayed for autophagy markers. LC3-II levels did increase post-treatment (Figure 10A). SQSTM1 levels, however, also increased upon treatment, suggesting trifluoperazine may block autophagic flux, similar to BafA1 treatment. Trifluoperazine treatment induced a significant drop in both cell-associated and extracellular virus titers (Figure 10B, 10C). These data suggest, again, that autophagy is beneficial for the virus, and open new questions to the mechanism of action of trifluoperazine.

To avoid problems associated with pharmaceutical autophagy regulators, we targeted the specific autophagy protein ATG7, a critical player in the LC3 conjugation siRNAs to successfully target ATG7, and knockdown caused a significant drop in cell-

Figure 9. Validation of starvation medium in H1-HeLa cells. H1-HeLa cells were placed in starvation media for times indicated. Cells were collected and immunoblotted for SQSTM1 and ACTB.

Figure 10. Trifluoperazine treatments inhibit EV-D68 replication. (A) H1-HeLa cells were treated for 18 hours with 8.3µM Trifluoperazine. Treated cells were collected and subjected to western blot analysis, probed for SQSTM1 and LC3. Two replicates shown. (B, C) Treated cells were infected at an MOI of 0.1 with EV-D68 for five hours in the presence of trifluoperazine. Cells were collected and both cell-associated and extracellular viral titers were determined by plaque assay. Cell-associated (B, p=0.016) and extracellular (C, p=0.033) titers are represented as the mean ± SEM. Statistical tests were done using an unpaired Student’s t-test with statistical significance set at *p ≤ 0.05.

44 process required for autophagosome formation (115). We used two different associated and extracellular EV-D68 titers (Figures 8G and 8H). This supports the model that EV-

D68 benefits from the presence of autophagy in host cells.

Enterovirus D68 alters intracellular morphology during infection

Picornaviruses manipulate the membrane landscape in a cell during an infection.

Membrane rearrangements seen in the cell include single-membraned vesicles, tubular structures, and autophagic membranes (130). Since, as shown in Figure 8, EV-D68 infection benefits from autophagy, it would be expected that EV-D68 would also generate double-membraned vesicles (DMVs) characteristic of induction of the autophagy pathway. Cells were infected with an MOI of 25, and prepared for transmission electron microscopy (TEM). Figure 11 shows representative images of mock and infected cells. In the infected cells, there are increased groupings of vesicles when compared to mock cells, some of which were double-membraned, as seen on the more magnified image. These DMVs are suggestive of autophagic vesicles and demonstrates that EV-D68 induces autophagosome-like vesicles during its replicative cycle.

Traditional autophagy markers respond to Enterovirus D68 infection

We investigated the subcellular localization of LC3 during EV-D68 infection.

Previous reports have showed that LC3, normally diffuse in the cytosol, aggregates to visible puncta when autophagy is stimulated. H1-HeLa cells were transfected with a

GFP-LC3 plasmid for 24 hours, then infected with EV-D68 or placed in starvation medium. We show in Figure 12A that fed uninfected cells display diffuse cytosolic localization of GFP-LC3 as expected, while starvation or infection induce formation of

45 numerous puncta throughout the cell. This suggests that autophagosome numbers increase in both infected and starved cells.

Figure 11. Enterovirus D68 changes cell membrane morphology upon infection in H1-HeLa cells. H1-HeLa cells were infected with EV-D68 at an MOI of 25 for five hours. Cells were collected, fixed and subjected to transmission electron microscopy preparations and imaging. Mock (A,B) and EV-D68-infected (C, D) samples were imaged. Images shown are representative of the dataset.

Figure 12. Traditional autophagy markers respond to Enterovirus D68 infection. (A) H1-HeLa cells were transfected with GFP-LC3 for 24 hours prior to experiment. Cells were either untreated/mock, EV-D68 infected at an MOI of 25 for four hours, or treated with starvation medium for four hours. Cells were imaged for GFP fluorescence. Images shown are representative of three experiments. (B, C) H1-HeLa cells were infected with EV-D68 for five hours and samples collected every hour during infection. Samples were subjected to western blot analysis and immunoblotted for LC3, SQSTM1-FL and SQSTM1-CL. (D) H1-HeLa cells were transfected with pcDNA, SQSTM1-WT or SQSTM1-MT 24 hours prior to infection. Cells were infected at an MOI of 25 with EV- D68 for five hours. Parallel samples were immunoblotted for SQSTM1. (E) H1-HeLa cells were infected with PV, RV1A, or CVB3 for six hours. Samples were subjected to western blot analysis for SQSTM1. FL- Full length, CL- Cleavage fragment.

We tested for the presence of LAMP1 and cathepsin B (CTSB) on GFP-LC3 labeled vesicles in Figure 13. LAMP1 is a marker of endosomes and target vesicles that have fused with endosomes, while CTSB is a marker of lysosomes and vesicles that have fused with lysosomes. GFP-LC3-transfected H1-HeLa cells were infected or starved, then stained for LAMP1 or CTSB. Normally, LAMP1 is observed in punctate structures, consistent with endosomes, which do not colocalize with GFP-LC3 puncta. During infection, LAMP1 partially colocalizes with GFP-LC3 puncta, suggesting that some autophagosomes have fused with endosomes. This is similar to the result seen during starvation (Figure 13A).

The mock condition for CTSB staining showed a few, punctate, presumably lysosomal structures. During infection, GFP-LC3 puncta and CTSB puncta do not significantly overlap, in contrast to starvation conditions, in which autophagy progresses to the maturation of the autophagosome or amphisome to an autolysosome. An autolysosome is expected to be LC3 positive on the outer membrane, but CSTB positive in the center of the enlarged vesicle. We have denoted structures consistent with this

(solid white arrowheads) in the starved cell image. However, similar structures do not appear in the EV-D68 condition. These data suggest that the autophagosome or amphisome is unable to form autolysosomes in virus-infected cells.

Figure 13. Enterovirus D68-induced autophagosomes costain with LAMP1, but not CTSB. H1-HeLa cells were transfected with GFP-LC3 24 hours prior to experiment. Cells were either untreated/mock, infected with EV-D68 for four hours or treated with starvation medium for four hours. Cells were then fixed in methanol and stained for LAMP1 (A) or CTSB (B). Cells were imaged for GFP and AlexaFluor 568 fluorescence. Representative images shown.

Figure 13

LC3-I and LC3-II levels over the course of an EV-D68 infection were examined by western blot (Figure 12). LC3-II levels start increasing at two hours post infection.

Another set of samples was immunoblotted for SQSTM1 (Figure 12). Full-length

SQSTM1 levels decrease late in infection; longer exposures reveal the appearance of a minor, approximately 34kDa band beginning at three hours post infection. Similar data, published from studies of coxsackievirus B3, was demonstrated to represent cleavage of

SQSTM1 by the 2A viral protease (102).

We investigated the similarity between this cleavage of SQSTM1 by EV-D68 and the cleavage seen by (127), and obtained SQSTM1 expressing plasmids from the authors.

The first plasmid was a SQSTM1 wild type plasmid, originally sourced from (131). The second plasmid was SQSTM1-MT, which was mutated at G241 (G241E), the site found in the prior publication for the protease-mediated cleavage of SQSTM1. Either pcDNA vector, SQSTM1-WT, or SQSTM1-MT were transfected into H1-HeLa cells for 40 hours, then infected at an MOI of 25 with EVD68 for five hours (Figure 12D). Cell samples were collected and immunoblotted for full-length and cleaved forms of

SQSTM1. Our data suggest a common mechanism of SQSTM1 cleavage between these two viruses.

To determine if SQSTM1 cleavage is common among picornaviruses, other family members were tested for their ability to induce this cleavage of SQSTM1. Three viruses were tested: poliovirus 1 (PV), rhinovirus 1A (RV1A) and coxsackievirus B3-

Woodruff (CVB3). Our group and others have reported that PV subverts autophagy to benefit its own replication, and reduction of full-length SQSTM1 was previously interpreted as an indication of active autophagic degradation (58). RV1A does not require

51 the autophagy pathway to replicate (132). Finally, CVB3 was tested as a positive control

(102, 127). At six hours post-infection with PV, a strong 34kDa band appears cross- reacting with SQSTM1 (Figure 12E). RV1A infection generated a minor 34kDa band, while during CVB3-Woodruff infection, essentially all detectable SQSTM1 was 34 kDa, indicating that a high percentage of the host protein is cleaved (Figure 12E). These data strongly suggest that monitoring full-length SQSTM1 is not a valid measurement of degradative autophagy during picornavirus infection.

Enterovirus D68 Infection Affects Autophagosomal SNARE Protein Levels

Since the standard assay for degradation by autophagy pathway cannot be interpreted during EV-D68 infection, due to cleavage of SQSTM1, we decided to monitor the SNARE complex responsible for fusion of the autophagosome with the lysosome, facilitating the delivery of degradative enzymes into the lumen of the autophagosome:

STX17, SNAP29 and VAMP8. We were interested in autophagy-specific SNAREs, so we focused on SNAP29 and STX17. H1-HeLa cells were infected for five hours, and lysates immunoblotted for SQSTM1, LC3, STX17, and SNAP29 (Figure 14). We observe a surprising increase in STX17 levels; since EV-D68 shuts down both RNA Pol-

II transcription and cap-dependent mRNA translation, new production of host proteins is unexpected. An internal ribosomal entry site (IRES) would allow more protein translation from existing RNAs during the course of the infection, but to our knowledge, STX17 has not been identified in screens for host mRNAs that contain an IRES,

(http://www.iresite.org). It is possible that the actual abundance of the protein is not increasing, but that there are changes in its cellular localization or membrane association,

52 and that one of these factors makes STX17 more easily detected by western blot over the course of the infection.

We detect lower levels of the cytosolic SNARE SNAP29 beginning at three hours post-infection. SNAP29 is a necessary component of the amphisome-lysosome fusion complex. The timing of this loss of full-length SNAP29, at a similar time post-infection as SQSTM1 cleavage, and about an hour after LC3-II protein levels increase, suggests that EV-D68 is inducing autophagosomes but both inhibiting delivery of cargo to the autophagosomes and preventing delivery of any surviving cargo to the lysosome. This suggests that EV-D68 interrupts autophagy at the autophagosome or amphisome stage.

Figure 14. Enterovirus D68 infection affects autophagosomal fusion SNARE protein levels. H1-HeLa cells were infected at an MOI of 25 with EV-D68. Cells were collected every hour for five hours. Samples were prepared and subjected to western blotting analysis and then immunoblotted for SQSTM1, LC3, STX17, and SNAP29.

SNAP29 reduction is a result of cleavage by Enterovirus D68 3C protease

To understand the mechanism by which SNAP29 protein levels are reduced during infection, we infected H1-HeLa cells, then treated with pepstatin A and E64D (to inhibit lysosomal proteases), MG132 (to inhibit the proteasome), cycloheximide (to inhibit translation) or DMSO (as a vehicle control) (Figure 15A). SNAP29 levels remained consistent throughout the treatments in uninfected cells. SNAP29 levels also

54 remained consistent during cycloheximide treatment, suggesting that the reduction in protein is not due to turnover in the absence of new host protein synthesis during EV-D68 infection. In cell which were infected, then DMSO, PepstatinA/E64D, or MG132 treated,

SNAP29 levels were reduced. Data in Figure 15B-D confirm that treatment of cells with pepstatinA/E64D and MG132 did not inhibit virus replication.

Since the inhibitors failed to rescue SNAP29 levels, we investigated a role for viral proteases in eliminating full-length SNAP29. We used two different SNAP29 antibodies to probe for SNAP29 in infected cell lysates: one that detects the C-terminal region of SNAP29 (ab138500); and one that detects the N-terminal domain of SNAP29

(ab181151) (Figure 16A). We were able to detect an N-terminal fragment of SNAP29 beginning three hours into infection at approximately 18kDa. We detected the C-terminal fragment of SNAP29 beginning at three hours into infection at approximately 11kDa.

We constructed a 3C-expressing plasmid that expresses GFP from a separate promoter to confirm transfection. We transfected the construct, the FLAG-SNAP29 plasmid, and/or corresponding empty vectors, into H1-HeLa cells for 48 hours. Lysates were immunoblotted for FLAG and GFP (Figure 16B). Upon co-transfection with

FLAG-SNAP29 and EV-D68 3C protease, a FLAG-reactive band is observed at approximately 25kDa, the expected molecular weight of the N-terminal cleavage fragment with the 3x-FLAG tag. Based on this size information and the SNAP29 protein sequence, two putative cleavage sites for the viral 3C protease were identified, which we would expect to produce fragments of approximately 11kDa and 18kDa (Figure 16C).

We generated point mutant-containing versions of the FLAG-SNAP29 plasmid for both

Figure 15. SNAP29 reduction is not due to regular protein turnover, lysosomal or proteasomal degradation. (A) H1-HeLa cells were treated with 10μg/mL Pepstatin A and 100μM E64D, 20μM MG132, 100μM cycloheximide or vehicle. Cells were infected at an MOI of 25 with EV- D68 for five hours, then were collected. Samples were subjected to western blot analysis and immunoblotted for SNAP29 levels. (B-D) Parallel drug treatment plates were infected at an MOI of 0.1 for five hours. Cells were then collected and subjected to plaque assay analysis. Images of the 10-7 serial dilution plate are shown for each treatment.

of the putative cleavage sites, Q156A and Q161A. These constructs were transfected into

293T cells for 24 hours, then cells were infected with EV-D68. We show in Figure 16D that SNAP29 mutant Q156A, although not expressed at high levels, was still cleaved during EV-D68 infection. Mutant Q161A, however, was not cleaved. Subsequent experiments co-expressing both mutants with the EV-D68 2A and 3C protease-

Figure 16. SNAP29 reduction is a result of cleavage by Enterovirus D68’s 3C protease. (A) H1-HeLa cells were infected at an MOI of 25 for five hours and cells were collected every hour. Samples were subjected to western blot analysis and probed for SNAP29 using antibodies recognizing the C-terminus and N-terminus of the protein. Both short and long exposures are provided. (B) H1-HeLa cells were transfected with pcDNA, FLAG- SNAP29, PHAGE, or PHAGE + 3C for 48 hours. Samples immunoblotted for FLAG and GFP. (C) Amino acid alignment of SNAP29, with putative cleavage sites italicized and boxed. (D) 293T cells were transfected with pcDNA, FLAG-SNAP29, FLAG-SNAP29 Q156A, or FLAG-SNAP29 Q161A for 24 hours. Cells were then infected with EV-D68 for five hours and samples were collected. Samples were then immunoblotted for FLAG, full length and cleavage bands are marked.

57 expressing plasmids indicate that the 3C protease can cleave FLAG-SNAP29-Q156A, but not FLAG-SNAP29-Q161A (Figure 17). These data together demonstrate that reduction in full-length SNAP29 during EV-D68 infection is the result of cleavage by the viral 3C protease at Q161.

Figure 17. FLAG-SNAP29-Q161A is not cleaved by EV-D68 3C protease. 293T cells were transfected with FLAG-SNAP29, FLAG-SNAP29 Q156A (A), or FLAG- SNAP29 Q161A (B), and either EV-D68 2A or EV-D68 3C for 40 hours. Cells were collected and samples were immunoblotted for FLAG. Full length FLAG-SNAP29 and cleavage bands are marked.

SNAP29 affects EV-D68 replication in H1-HeLa cells

To further examine the role that SNAP29 plays during EV-D68 infection, siRNA- mediated knockdown of SNAP29 was carried out (Figure 18). After 48 hour knockdown and subsequent low-MOI infection, cell-associated virus (Figure 18A) and extracellular virus (Figure 18B) were analyzed by plaque assay. There was an approximately 10-fold reduction in cell-associated virus and an approximate 8-fold reduction in extracellular virus. We had hypothesized that loss of SNAP29 would have a positive effect on viral replication, since SNAP29 levels decrease late in infection (Figure 14), however, as shown here, a reduced level of SNAP29 prior to infection, results in a significant drop in titer. These data may suggest an important role for SNAP29 early in the replication cycle of EV-D68.

We next used a FLAG-tagged expression construct for SNAP29 and transfected the plasmid into H1-HeLa cells 40 hours prior to infection. By overexpressing SNAP29, we hoped to maintain a population of full-length SNAP29 throughout the entire EV-D68 infection. Uninfected transfected H1-HeLa cells were collected to confirm the overexpression by western blot (Figure 18F). We found that there was a slight reduction in the cell-associated virus, but a significant 4-fold increase in extracellular virus in cells still retaining SNAP29 (Figure 18DE). This suggests that any remaining full-length

SNAP29 may play a role in the release of the virus. It is clear that SNAP29 plays very different roles in the EV-D68 life-cycle early and late in infection.

Since SNAP29 requires STX17 and VAMP8 to carry out its membrane fusion function, we next co-expressed the proteins in multiple combinations (Figure 19C).

Overexpression of SNAP29-VAMP8 and the combination of SNAP29-STX17-VAMP8

59 both significantly decreased cell-associated EV-D68 (Figure 19AB). We hypothesize that co-expression creates more fusion complex availability within the cell, decreasing the ability of the virus to escape degradative autophagy.

Figure 18. SNAP29 affects EV-D68 infection in H1-HeLa cells. (A, B) Cells were transfected with a siRNA targeting SNAP29 40 hours prior to infection, then infected with EV-D68 at an MOI of 0.1 for five hours. Viral titers were analyzed by plaque assay for both cell-associated virus (A, p=0.018) and extracellular virus (B, p=0.012). (C) Parallel samples were analyzed by western blot for SNAP29. H1-HeLa cells were transfected with a plasmid containing FLAG-SNAP29 40 hours prior to infection. (D, E) Transfected H1-HeLa cells were infected at an MOI of 0.1 with EV-D68 for five hours. Viral titers were analyzed by plaque assay for both cell-associated virus (D) and extracellular virus (E, p=0.017). (F) Western blot to examine FLAG-SNAP29 ectopic expression. Western blots are representative of three independent experiments. H1-HeLa cells were transfected with siSNAP29 40 hours prior to infection, infected at an MOI of 25 with EV-D68, and metabolically labeled each hour with 35-S Methionine. (G) Samples were analyzed for SNAP29 in knockdown cells. Samples were subjected to SDS-PAGE and exposed to X-ray film (H). Viral titers are represented as the mean ± SEM. Statistical tests were done using Student’s T-test with statistical significance set at *p ≤ 0.05.

Figure 18.

Consistent with this hypothesis, overexpression of SNAP29 significantly increased extracellular virus levels (Figure 18E). We next analyzed the effect on autophagy. SQSTM1 levels were increased slightly in the SNAP29 and VAMP8 dual cotransfection lanes, and then dropped below control levels in the triple SNARE overexpression lanes (Figure 19C). LC3-II levels were increased in the single transfection lanes of SNAP29, STX17, or VAMP8, but dropped in co-transfection conditions. This suggests that autophagic flux is only enhanced in the presence of the autophagic SNARE complex, and transfection of a single autophagic SNARE is not sufficient for enhanced flux.

Since our data suggested a role for SNAP29 in early steps of the EV-D68 lifecycle, we analyzed virus entry, host shutoff, and polyprotein production and processing using metabolic labeling of infected cells. Post-infection, cells were either kept in complete media or placed in methionine-, glutamine-, and cysteine-free MEM supplemented with 100µCi/mL of 35S-Methionine, and collected immediately following a one hour treatment. Lysates were subjected to SDS-PAGE and exposed to film (Figure

18H). As expected, EV-D68 shuts down host translation beginning 2-3 hours into the infection. In SNAP29 siRNA treated samples, there is a reproducible one hour delay in host translation shutoff, although from these data we cannot identify the specific step in early virus events which SNAP29 affects.

Figure 19. Overexpression of SNARE proteins involved in autophagosome- lysosome fusion and EV-D68 viral titers. H1-HeLa cells were transfected with FLAG-SNAP29, FLAG-STX17, FLAG-VAMP8 or pcDNA control 40 hours prior to infection. (A, B) Transfected cells were infected at an MOI of 25 with EV-D68 for five hours and then collected. Viral titers were determined by plaque assay for both cell-associated (A, p=0.0031, p=0.0011) and extracellular virus (B, p=0.043). (C) Transfected cells were collected and immunoblotted for FLAG, SQSTM1, and LC3. Statistical tests were done using an unpaired Student’s t test with statistical significance set at *p ≤ 0.05, **p ≤0.01.

Role of SNAP47 in EV-D68 Replication

We have demonstrated that SNAP29 has a complex role in EV-D68 replication.

There are two other SNAP homologs in non-neuronal cells, SNAP23 and SNAP47 (48,

49, 122). Since SNAP23 localizes to the plasma membrane, we decided to analyze

SNAP47, which, due to its putative endosomal association, could play a role in autophagosome acidification and maturation (49). No role for SNAP47 in autophagy or

RNA virus infection had been described prior to this work, but we have previously demonstrated that autophagosome acidification is crucial for picornavirus particle maturation (58). We began with siRNA knockdown of SNAP47 both alone and in combination with SNAP29. Due to the high level of homology between these two proteins, we confirmed siRNA specificity (Figure 20A). Autophagic activity was assessed by LC3-II formation and SQSTM1 steady-state levels (Figure 20B).

Surprisingly, the data show that loss of SNAP47 inhibits autophagic degradation to a greater degree than loss of SNAP29, as monitored by both LC3-II formation and

SQSTM1 degradation. We find that loss of SNAP47 inhibits virus production by more than two logs (Figure 20C) and extracellular virus by more than one log (Figure 20D).

We conclude that SNAP47 plays a major role in producing infectious virions, but inhibits release of virus from cells.

During a time course of infection of H1-HeLa cells, there is a modest reduction in

SNAP47 protein levels by five hours post infection (Figure 20E). While not a complete loss of detectable protein, as observed for SNAP29, it is reproducible and we investigated the mechanism of protein loss. Co-expression of EV-D68 proteases and SNAP47 provided no detection of apparent cleavage products (Figure 21A). We also tested

Figure 20. SNAP47 is essential for degradative autophagy and negatively affects viral exit. H1-HeLa cells were transfected with siControl, siSNAP29 or siSNAP47 40 hours prior to infection. (A) Immunoblot for SNAP29 and SNAP47. (B) Transfected cells were either starved for five hours, infected at an MOI of 25 with EV-D68 or untreated as control. Samples were immunoblotted for LC3 and SQSTM1. Densitometry is taken from three independent experiments. (C, D) Transfected cells were infected at an MOI of 0.1 for five hours, and collected for plaque assay analysis. Cell-associated (C) (p=0.00021) and extracellular virus (D) (p=0.0051) were analyzed via plaque assay. Viral titers are represented as the mean ± SEM. Statistical tests were done using an unpaired Student’s T- test with statistical significance set at ***p < 0.001; **p < 0.01; *p ≤ 0.05. (E) H1-HeLa cells were infected with EV-D68 at an MOI of 25 for five hours. Samples were collected each hour, and a mock sample collected at five hours. Samples were immunoblotted for SNAP47.

65 whether it was a classical, cell-mediated method of degradation, utilizing the lysosome or proteasome, or if the cap-dependent translation shut-off was enough to affect SNAP47 protein levels. There is a statistically significant drop in SNAP47 levels when cells are treated with cycloheximide. This implicates virus-mediated translation inhibition, although little is known about the half-life of SNAP47 protein and more investigation is yet required to support this conclusion (Figure 21B-C). We conclude SNAP47 plays a significant role in both autophagy and EV-D68 replication and speculate that these roles are connected.

Figure 21. SNAP47 reduction is not due to EV-D68 protease cleavage, but may be due to protein turnover. (A) 293T cells were transfected with pcDNA or GFP-SNAP47 for 24 hours, then transfected again with EV-D68 2A or EV-D68 3C for 24 hours, a total of 48 hours. Cells were collected and samples were immunoblotted for SNAP47. (B) 293T cells were treated with 10μg/mL Pepstatin A and 100μM E64D, 20μM MG132, 100μM cycloheximide or vehicle. Cells were infected at an MOI of 25 with EV-D68 for five hours, then were collected. Samples were subjected to western blot analysis and immunoblotted for SNAP47. (C) Densitometry analysis of B, from three independent experiments. P=0.0078. Statistical tests were done using an unpaired Student’s t test with statistical significance set at *p ≤ 0.05, **p ≤0.01.

C. Discussion

In general, positive-strand RNA viruses have been shown to either benefit from, or be indifferent to, the autophagy pathway (125). Here, we demonstrate, through use of pharmacological agents and genetic knockdown, that activating the autophagy pathway promotes replication of EV-D68. Inhibition of autophagosome acidification and cargo delivery to lysosomes using BafA1 reduced cell-associated EV-D68 titers by more than one log. Silencing of ATG7 to disrupt proper autophagic membrane formation also significantly decreased viral titers. Induction of autophagy through cell starvation increased cell-associated virus by more than two-fold, but reduced extracellular titers to approximately the same degree (Figure 8). Autophagic signaling is, therefore, is a positive force for virus replication.

We therefore expected that the virus induces the autophagy pathway during infection, and we have identified multiple hallmarks of autophagic activation. Double- membraned vesicular structures resembling autophagosomes are generated during infection (Figure 11). These vesicles have apparent cytosolic contents and are approximately 100-300nm in diameter, which is consistent with autophagic structures.

The LC3 protein is lipidated during infection, a hallmark of autophagy signaling, and

GFP-LC3 puncta are observed, consistent with autophagosome formation (Figure 12).

We conclude that infection promotes signaling to the autophagy pathway and generation of autophagic structures.

Autophagy is regulated at multiple steps, and induction of the pathway does not necessarily mean degradation will be induced. Delivery of cargo to autophagosomes,

68 autophagosome acidification into amphisomes, and fusion of amphisomes with lysosomes can all be regulated. Autophagic degradation is commonly assayed by monitoring the steady-state levels of SQSTM1, a primary cargo adaptor for contents destined for the autophagosome. As seen in Figure 12, SQSTM1 is cleaved during infection by multiple picornaviruses, including PV, RV1A, and EV-D68. This was previously shown for CVB3 by the Luo lab, but here we demonstrate that this is a common viral mechanism (127).

This significance of SQSTM1 cleavage is two-fold. First, because SQSTM1 is the most common assay for autophagic degradation, loss of the full-length protein can be misinterpreted if a relatively minor 34kDa species is missed. In our previous work on PV, we misinterpreted loss of SQSTM1 as induction of autophagic degradation (58). At the time we were puzzled: if non-infectious particles were maturing into infectious virions inside amphisomes, how is autophagic degradation occurring without a loss of titer?

Here, this issue is resolved with the realization that loss of full length SQSTM1 during infection does not in this case indicate autophagic degradation. Second, cleavage of

SQSTM1 indicates that cargo is not being delivered to autophagosomes. Not only is this a false positive for degradation, it actually means the opposite is taking place: an inhibition of degradation.

To further investigate EV-D68 inhibition of the degradative step of autophagy, examination of a SNARE complex, which mediates fusion events of autophagic vesicles, was carried out. The three members of the complex, STX17, SNAP29, and VAMP8, each contribute coiled-coil domains to form a tight complex mediating the membrane fusion steps between autophagosomes, amphisomes and autolysosomes (119). SNAP29 interacts

69 with Enterovirus A71 2BC protein, making it a known target for picornavirus regulation

(123). As seen in Figure 14, we observe a distinct loss of full-length SNAP29 during infection and an apparent increase in detectable STX17. A loss of SNAP29 should result in inhibition of fusion, halting degradative autophagy.

Given our data regarding SQSTM1, we wanted to investigate the mechanism of

SNAP29 loss. We demonstrate an EV-D68 3C-mediated proteolytic cleavage of SNAP29 at Q161 (Figure 16). Based on size and potential cleavage sites, the data predict that the

N-terminal coiled-coil domain of SNAP29 (aa 50–132) would be separated from the C- terminal coiled-coil domain (aa 197–258) by this cleavage event (133). The two halves should independently interact with STX17 and VAMP8, preventing formation of the membrane-fusion complex. It has been reported that in non-starvation conditions,

SNAP29 is O-GlcNac-modified on residues Ser2, Ser61, Thr130 and Ser153, and these modifications inhibit the autophagosome-lysosome fusion process (47). These modifications are all N-terminal to the two putative cleavage sites, creating a N-terminal cleavage fragment that may inhibit fusion. It is possible, as with SQSTM1, the relatively minor cleaved species could act as dominant negatives, preventing autophagic cargo delivery to lysosomes. Our data support this model. The endosomal marker LAMP1 partially co-localizes with LC3 during infection, while CTSB does not co-localize with

LC3 (Figure 13). This indicates that endosome-autophagosome fusion can occur, delivering LAMP1 and acidifying vacuolar ATPases, but the subsequent lysosome fusion step is blocked. We hypothesize this block is due to SNAP29 cleavage.

SNAP29 promotes both virus replication and virion exit from cells (Figure 18). There is a slight delay in an early step, possibly virus entry, translation, or host-shutoff, in the absence of SNAP29, as seen in Figure 18H. This difference is reproducible, and we plan to investigate the role of SNAP29 early in EV-D68 infection. Overexpression of SNAP29 only slightly decreased cell-associated virus. Surprisingly, overexpression increased virus release significantly. It is possible that SNAP29 may be able to bind to target SNAREs on the plasma membrane to promote exit in a non-physiological situation, such as overexpression, where full-length SNAP29 persists through viral replication. SNAP29 has been shown to interact with Enterovirus A71 capsid protein (123).

The family of Snap Qbc SNAREs is relatively small: the neuron-specific

SNAP25; the plasma-membrane localized SNAP23; cytosolic SNAP29; and the less- characterized membrane-associated SNAP47. We were interested in determining if

SNAP47, which is largely cytosolic but associates with endosome- and Golgi-resident

VAMP proteins, plays a role in EV-D68 replication (48, 49). We found that knockdown of SNAP47 had a larger inhibitory effect on EV-D68 growth than SNAP29 knockdown

(Figure 20). In addition, there was a significant increase in released virus, despite the loss of cell-associated virus. We analyzed autophagy in cells knocked down for SNAP47 and found a major reduction in degradation, with little change in signaling, as would be expected for a SNARE protein with a role in autophagy. In fact, our data indicate that knockdown of SNAP47 has a more significant effect on autophagy that knockdown of

SNAP29, paralleling the relative effects of knockdown of these proteins on EV-D68 replication. Our data indicates that SNAP47 is a major SNARE in the autophagic pathway, and the specific role of SNAP47 in autophagy is being investigated.

We hypothesize that, while both SNAP29 and SNAP47 play roles during EV-

D68’s viral cycle, they participate at different stages. In Figure 14, we see that SNAP29 protein levels are reduced late in infection, which is, as shown in Figure 16 likely to be the result of cleavage by a viral protease such as 3C. However, when SNAP29 protein levels are reduced by siRNA knockdown prior to infection, resulting viral titers significantly dropped (Figure 18A, 18B). We conclude that SNAP29 plays a positive role early in infection but is not required late in infection. How SNAP29 promotes EV-D68 replication early in the virus life cycle is still being determined.

The importance of acidification to EV-D68 made us question how the endosome and lysosome were able to fuse with the autophagosome in the viral-mediated absence of

SNAP29. The potential role of SNAP47 in endosome trafficking led us to investigate

SNAP47 in autophagy and EV-D68’s life cycle. After we observed the inhibition of

SQSTM1 degradation in the absence of SNAP47, we concluded that there may be more than one SNAP involved with the autophagic process. A previous study on SNAP47 showed subcellular localization to be throughout the cytosol, yet often punctate. The same study also showed the ability for SNAP47 to substitute for another SNARE,

SNAP25, forming an active fusion complex (48). SNAP47 itself interacts with VAMP7 and VAMP4, which are associated with the endosome and trans-Golgi, respectively (49).

During an infection with EV-D68, a modest decrease of SNAP47 occurs (Figure 21) which may be due to the relatively short half-life of the protein and the presence of a translational shut-off during infection, common among picornaviruses, but which we demonstrate here for EV-D68 (Figure 18H). We hypothesize SNAP47 is able promote autophagosome acidification, which benefits EV-D68.

In summary, we have identified a major role for autophagic signaling and autophagic membrane rearrangements in EV-D68 replication. However, the virus inhibits the downstream, degradative aspects of autophagy at multiple levels, by cleaving a major cargo adaptor and a SNARE protein, SNAP29, reported to be important for delivering amphisome cargo to the lysosome. We have demonstrated that a second SNARE,

SNAP47, has major effects on autophagic degradation and EV-D68 growth. We suggest that EV-D68 reshapes the autophagic pathway to prevent degradation of virus and promote virus replication and exit from the cell. In the last several years, it has been demonstrated that multiple picornaviruses exit cells in membraned form, and in some cases these membranes are derived from the autophagy pathway (60, 134, 135). We suggest that EV-D68 may be reshaping the autophagy pathway to allow autophagosome- like vesicles filled with infectious virus to exit the cell instead of being targeted to the lysosome, and are currently testing this model. We believe that this may be a general model for picornavirus egress from cells, (136) from the Luo lab, showing similar data for coxsackievirus B3, demonstrates the wide potential for understanding the roles of autophagic SNAREs in replication of positive strand RNA viruses.

Chapter 4: Snap47 – The Amphisomal Qbc SNARE.

A. Introduction

SNAP47 is a Qbc SNARE that was first described in 2006 (48). In its discovery paper, the authors describe a protein with homology to SNAP25 protein family members and general expression detectable throughout the body. It reported that SNAP47 can substitute for SNAP25 in a VAMP2-Syntaxin1 bundle, albeit with slower fusion kinetics than those of SNAP25. The authors noted that while this was true, SNAP47 was not concentrated on the plasma membrane as seen by immunostaining, but on unknown structures within the cell (48). Another group investigated the role of SNAP47 in the hippocampus. The localization of SNAP47 in mouse and rat brains appears not to be consistent and suggests that there may be species specific nuances to localization (137).

SNAP47 is a poorly understood SNARE protein. The initial discovery paper noted that it fractionates with membranes, but does not have a classic membrane modification, palmitoylation, such as SNAP25 and SNAP23 (48). SNAP47 interacts with

VAMP7, a VAMP protein that is typically found along the endosomal system, after ectopically expressed VAMP7 and looking for interacting partners from by mass spectrometry (49). Though this group has previously reported that overexpressed

SNAP47 localizes to endoplasmic reticulum, we sought to better define the localization in our system.

In the previous chapter, we observed in Figure 20 that knockdown of SNAP47 inhibits cell-associated EV-D68 growth and degradation of SQSTM1 during a starvation experiment. We concluded at the end of that chapter that these two phenomena could be

74 linked in the context of the autophagy process, and hypothesized that SNAP47 may have an integral role in one of the fusion stages of the autophagy process. Based on existing data from Kuster et. al. regarding overexpression of SNAP47 interactions with certain endosomal VAMP proteins (49), we hypothesized that the role for SNAP47 in autophagy may be at the stage of amphisome formation. In this chapter, we have characterized endogenous SNAP47 for localization and interaction in the autophagy pathway. We used these data to create a novel assay to allow the detection of the amphisome using fluorescence microscopy and characterize how the vesicle profile of cells change when

SNAP47 is removed. We report here that SNAP47 is required for amphisome formation and autophagic degradation.

B. Results

SNAP47 is required for autophagic degradation

To confirm our results from the EV-D68 based work of the previous chapter, we repeated the transfection of H1-HeLa cells with siRNAs targeting SNAP29, SNAP47 or negative control siRNA. In Figure 22, cells were starved for four hours and then collected and subjected to western blotting to analyze the autophagy markers LC3 and

SQSTM1, as well as the knockdown efficiencies. LC3 I appears to decrease, or convert to

LC3 II, in starvation conditions in the three knockdown conditions. This suggests that autophagy has been initiated. SQSTM1 levels drop in response to the starvation treatment in the siControl lanes by decreasing in intensity. This is expected, as cargo adaptors are degraded upon completion of the autophagy path. In the SNAP29 knockdown lanes,

SQSTM1 levels also respond as in the control conditions, as was previously shown in

Figure 20B. This suggests that the absence of SNAP29 is not significantly detrimental to the integrity of the autophagy pathway, because autophagic flux can still occur. In the

SNAP47 knockdown lanes, SQSTM1 levels do not respond to the starvation treatment, suggesting that absence of SNAP47 halts autophagy progression in between LC3 lipidation and cargo degradation.

Figure 22. SNAP47 is required for autophagic degradation. H1-HeLa cells were transfected with siRNAs of scramble, or targeting SNAP29 or SNAP47. 40 hours post-transfection, cells were placed in complete or starvation medium for four hours and then collected. Samples were prepared and subjected to western blotting analysis and then immunoblotted for SQSTM1, LC3, SNAP47, and SNAP29.

SNAP47 Relocalizes in the Cell under Starvation Conditions

In order to understand what function SNAP47 could play during autophagy, more detailed analysis of SNAP47 localization was needed. Limited research has been performed on endogenous SNAP47’s localization or functions, while minimal studies

76 have used overexpression constructs to give insights into roles for SNAP47. In initial studies with SNAP47, our use of the GFP-SNAP47 construct seemed to alter the localization of the protein when compared to the endogenously stained SNAP47 (data not shown). For this reason, we have extended effort to study endogenous protein localization and function for the length of this work.

If SNAP47 has a role in autophagy, as demonstrated in Figure 22, we could hypothesize that the protein distribution in the cell may respond to autophagy-inducing signals, such as starvation. Using H1-HeLa cells, we stained for SNAP47 protein in mock or starvation conditions at two hours, four hours and six hours post-treatment (Figure

23). Under mock conditions, SNAP47 appears cytosolic in a loose, yet structured form, it does not appear uniformly diffused throughout the cell. Over the time course of the starvation treatment, a portion of SNAP47 appears to condense, step-wise, into continuous lengths of protein, reminiscent of strands of protein, while other more punctate-looking structures appear unchanged. It is also observed that by six hours post- starvation treatment, the cells have slightly shrunken. This is a common phenotype for starvation of these cells for 4-6 hours, and could be contributing to the condensation of the SNAP47 protein.

Figure 23. Snap47 relocalizes in the cell under starvation conditions. H1-HeLa cells were either untreated/mock or treated with starvation medium for two, four or six hours. Cells were then fixed in 4% paraformaldehyde and stained for endogenous SNAP47 (green) and DAPI (blue). Cells were imaged for Alexa-Fluor 488 and DAPI fluorescence. Representative images shown.

To characterize the localization of SNAP47 observed in starved cells (Figure 23), we fractionated whole cell lysates over a density gradient of 2-28% iodixanol. Fractions were collected top to bottom, where lightest fractions were collected prior to denser fractions. Fractions were then run on SDS-PAGE, and immunoblotted for SNAP47

(Figure 24). SNAP47 eluted primarily in a less dense to mid-density range, between fraction 4 and 14. We also tested a series of organelle markers to look for co-fractionation between SNAP47 and mitochondria (COXIV), autophagosomes (LC3 and SQSTM1), late endosomes/lysosomes (LAMP1) and endoplasmic reticulum (Calnexin). Because of the broad range of fractions SNAP47 is contained in, we observe partial co-fractionation with each of these markers. SNAP47 seems to co-fractionate least with endoplasmic reticulum, but have a higher fractional overlap with mitochondria, autophagosomes and

78 late endosomes/lysosomes. This suggests that SNAP47 may be found in multiple organelle membranes in the cell.

Figure 24. SNAP47 cofractionates with mitochondria, autophagy cargo adaptor SQSTM1 and lysosomes. H1-HeLa cells were collected and dounced for lysis. Lysates were centrifuged in an ultracentrifuge over a 2-28% iodixanol gradient for 18 hours. Fractions were then collected and subjected to western blotting analysis and then immunoblotted for SNAP47, SQSTM1, COXIV, LC3, LAMP1 and Calnexin.

To increase the resolution of our localization studies, we turned to immunofluorescence to visually evaluate colocalization with the markers that showed increased cofractionation in Figure 24. To visualize mitochondria, we used a plasmid that contains a blue fluorescent protein (BFP) attached to a mitochondria targeting sequence. Using Mander’s Correlation Coefficient, we calculated the percentage of the

SNAP47 signal-positive pixels of the image that also contained mitoBFP signal. It was

79 found that 43% of SNAP47 colocalizes with the mitochondrial marker (Figure 25). To visualize lysosomes, we used a protease that is targeted to lysosomes, Cathepsin B

(CTSB). It was found that that 25% of SNAP47 colocalizes with lysosomes, which is significantly different than the approximately 8% found to colocalizes with the late endosome marker and lysosome marker LAMP1 (Figure 25). More research may be needed to parse specific subsets of endosomes and lysosomes that contain CTSB and//or

LAMP1 before the significance of this result can be fully realized. Additionally, 8% of

SNAP47 colocalizes with autophagic vesicles, using LC3 as a label (Figure 25). VAMP7 is an R-SNARE cited to be localized along the endosomal pathway (138), and has been previously studied for its interaction with SNAP47 in a dual overexpression capacity

(49). It has previously been linked to autophagy regulation in a knockout mouse that showed defects in autophagosome generation (139). Here, we shown that 52% of endogenous SNAP47 is found to colocalize with endogenous VAMP7, and likewise, 67% of endogenous VAMP7 colocalizes with endogenous SNAP47 (Figure 25). This result both supports the results that have previously been published, but also supports the possibility of meaningful findings using overexpression of SNARE proteins, which are a famously challenging protein family to study.

Figure 25. SNAP47 Colocalizes with Mitochondria, Endosomes and Lysosomes. A. H1-HeLa cells were transfected with a mitoBFP construct 24 hours prior to fixation. Cells fixed in 4% paraformaldehyde and blocked in 5% goat serum/ 0.15% Triton-X100/ 1xPBS. Samples were stained for SNAP47, Vamp7, LC3, Lamp1 and/or CTSB. B. 30 cells per condition across three replicate experiments were analyzed by Mander’s Correlation Coefficient ± Standard Error.

SNAP47 interacts with VAMP7

The result of significant colocalization between SNAP47 and VAMP7 was very interesting because as an endosomal SNARE, VAMP7 could link SNAP47 to autophagy via an amphisome. We looked for an endogenous interaction by immunoprecipitation, which would confirm a reported interaction during over-expression conditions (49). Good reagents for both VAMP7 and SNAP47 are limited and therefore it was necessary to design an immunoprecipitation (IP) protocol that would allow both the immunoprecipitating and the immunoblotting anitbodies to share the animal host, rabbit in this case. In a typical IP, the sharing of an animal host between the two antibodies would lead to strong heavy chain and light chain bands on a western blot, at approximately 50kDa and 25kDa, respectively. In an IP between VAMP7 (25kDa) and

SNAP47 (47kDa), bands at the expected molecular masses of the targeted proteins would be obscured by the heavy chain and light chain bands while using an anti-Rabbit secondary antibody. We approached this technical challenge by conjugating the SNAP47 and VAMP7 immunoblotting primary antibodies to horseradish peroxidase (HRP). This allows for the use of a second primary antibody to recognize the tertiary structure of HRP

(such as an antibody designed for immunofluorescence or IPs) from another animal host, in this case mouse. By using an anti-mouse-HRP secondary antibody, we were able to eliminate detection issues from obfuscation of our desired bands without compromising on the amplification of signal resulting from the use of a secondary antibody, as diagrammed in Figure 26A.

Using the strategy described, we immunoprecipitated mock and four hour starved

H1-HeLa lysates with either SNAP47 or VAMP7 native antibodies, and then used the

82 conjugated primary antibodies of the putative interacting partner to investigate the existence of an interaction between SNAP47 and VAMP7 (Figure 26B). We were able to observe interacting bands in the IP lanes for both mock and starved cell lysate, but not the nonspecific (NS), flow through (FT) or wash lanes (W1 and W2). This suggests that there is a physical interaction between SNAP47 and VAMP7, independent of experimental autophagy induction. For additional controls, we performed the IP with either VAMP7 or a matched rabbit IgG control antibody. Once again, in both mock and starved cell lysates, we were able to observe an interaction by detection of SNAP47 in the IP lanes, whereas there was an absence of an interaction detected by the control IgG antibody (Figure

26C). Of note, the input lanes of both mock and starved cells have a faint band of appropriate size as well, though much less intense than the IP lanes.

To determine where along the endosomal pathway VAMP7 resides, we performed a colocalization study using Rab5 (early endosome), Rab7 (late endosome and autophagosome), Rab11 (recycling endosome) and Lamp1 (late endosome/lysosome)

(Figure 27A). Using Mander’s Correlation Coefficient, it was determined that Rab7 and

Rab11 had the highest percentages of VAMP7 overlapping with the markers, with 57% and 52% respectively (Figure 27B). Noteably, there was also a high percentage of Rab7 and Rab11 signal that colocalized with VAMP7, with nearly 87% of Rab7 colocalizing with VAMP7 (Figure 27B). This suggests that VAMP7 primarily localizes to late endosomes and recycling endosomes.

Figure 26. Endogenous SNAP47 interacts with endogenous VAMP7. A. Detection and signal amplification method for SNAP47 and VAMP7. The initial primary antibody is the suspected interacting partner rabbit antibody (SNAP47 for VAMP7 immunoprecipitations and VAMP7 for SNAP47 immunoprecipitations) conjugated to a functional HRP. The second step is a second mouse primary antibody that recognizes the foreign conjugation group of the first interacting partner. The third step is to use a traditional polyclonal secondary antibody conjugated to HRP. B. Cells were collected and lysed in NP40 non-denaturing lysis buffer. Lysates were precleared and the nonspecific fraction (NS) saved. Lysates were incubated in primary antibody overnight at 4°C. Protein A magnetic beads were bound to antibody and pulled down, with the flow through saved (FT). Wash fractions were saved (W1-W2). Resultant immunoprecipitate (IP) and fractions were subjected to western analysis and blotted for the interacting partner using the detection scheme described in A. C. Immunoprecipitation as described above, with 5% input loaded in first lane and using an additional matched IgG negative control antibody in the center lane.

Figure 27. VAMP7 colocalizes with late endosomes and recycling endosomes. A. H1-HeLa cells were fixed in 4% paraformaldehyde and blocked in 5% goat serum/ 0.15% Triton-X100/ 1xPBS. Samples were stained for Vamp7 and either Rab5, Rab7, Rab11 or Lamp1. B. 10 cells per condition across three replicate experiments were analyzed by Mander’s Correlation Coefficient ± Standard Error.

SNAP47 facilitates the formation of the amphisome

The amphisome is an intermediate structure on the autophagy pathway that results when an endosome fuses with an autophagosome (see Figure 1). This results in an acidified autophagic vesicle that is not yet degradative because of the lack of lysosomal enzymes. Both the transient nature of this compartment and its biochemical similarity to

85 an autolysosome makes an amphisome a perplexing target for researchers. However, based on these data presented within this chapter, we hypothesized that SNAP47 may interact with VAMP7 in order to form amphisomes. In order to test this hypothesis, we needed to develop a method to be able to characterize the stages of autophagic vesicles independently from one another.

We designed a novel immunofluorescent assay that identifies endosomes, autophagosomes and lysosomes, with the capacity to label fusion events between these different compartments. Our approach was to identify what is unique about each compartment for labeling purposes (Figure 28A). To label endosomes, we use a commercially available Streptavidin-labeled EGF molecule complexed with Alexa Fluor

555. EGF added to cell culture medium will bind to EGFR and stimulate its endocytosis into the cell. The red label on this molecule is acid resistant and continues to fluoresce as it progresses from early endosome to lysosome, and it will be transferred to any resultant fusion vesicle the endosome becomes. This is added and allowed to bind to the membrane at 4° for 15 minutes in a low volume to allow synchronous entry of EGF into the cell when warmed back to 37°. Cell are incubated for an experimentally determined

60 minutes to allow the EGF to cycle through to be seen in lysosomes (Data not shown).

Post-fixation, we stain for endogenous LC3 to label autophagic vesicles in green and then we stain for endogenous CTSB to label lysosomes, exclusively, in magenta (work flow described in Figure 28B). Figure 28C summarizes the distinguishable compartments by use of this assay, in the colors that have been chosen for this application. Images are acquired, deconvolved and then gently processed prior to analysis for background removal. Figure 28D shows the result of the uniform background subtraction methods

86 used in all processing, showing a small difference in haziness from the unprocessed to the processed image. The method of analysis chosen for this assay involved using plot intensity profiles off of line tools and defined thresholds to describe which channels had signal. Sample profiles have been shown in Figure 28E.

Figure 28. Amphisome detection methodology. A. Description of vesicle characteristics used to create the amphisome labeling methodology. B. Schematic of novel method to visualize intermediary amphisome structures. Streptavidin-tagged epidermal growth factor (EGF) conjugated to biotinylated Alexa-Fluor 555 is added to H1-HeLa cells in low volume and allowed to bind at 4° for 15 minutes. Cell plates were placed in a shallow 37° water bath, to facilitate rapid warming, for 60 minutes. 4% Paraformaldehyde was added to cells on ice, then cells were blocked and stained for LC3 with a secondary of Alexa-Fluor 488 and Cathepsin B with a secondary antibody of Alexa-Fluor 647. Coverslips were mounted using Prolong Glass mounting medium containing NucBlue and imaged on a spinning disk confocal microscope. C. Reference list of resultant vesicles and stains. D. Demonstration of the background subtraction methodology showing two untransfected control images of the same cell. The processing on the bottom image is rolling ball subtraction in Fiji on 8-bit images using a 10 pixel ball and use of sliding parabola background subtraction, as well as, a subtraction of half-max global background measured outside the boundary of the cell. E. Sample intensity plot profiles for an amphisome and autolysosome based on gray value intensities. Peaks above 10 gray values were considered for vesicle characterization. Peaks measured within 100nm of each other were considered the same structure based on the physical limits of light microscopy. Comparative intensity of the signal was not considered in vesicle characterization.

Figure 28.

Using this newly developed method, we were able to analyze for the first time if

SNAP29, the traditional autophagic Qbc SNARE, or SNAP47 have a role in the formation of specific classes of autophagic vesicles. H1-HeLa cells were transfected with a scrambled siRNA, or siRNAs targeting SNAP29 or SNAP47. Forty-eight hours post- transfection, cells were fed labeled EGF for one hour, fixed and then stained for LC3 and

CTSB. Fifteen cells from each conditions were analyzed for characterization of present vesicles as described (Figure 29). The SNAP29 knockdown yielded no significant changes to the vesicle proportions within the cells, when compared to the control. This supports data in the previous chapter, as well as our finding that SNAP29 is not a required SNARE protein for the progression of the autophagy pathway (Figure 22). The

SNAP47 knockdown yielded a significant decrease in only the amphisome compartment, supporting the hypothesis that SNAP47 facilitates the formation of the amphisomal compartment. While only 50% of the autolysosomes remain in the SNAP47 knockdown cells, this decrease in not statistically significant. These data taken as a whole suggest that

SNAP47 is the first described amphisomal SNARE protein.

Figure 29. SNAP47 facilitates the formation of the amphisome. A. H1-HeLa cells were transfected with siRNAs targeting scramble, SNAP29, or SNAP47. 48 hours post transfection, cells were treated with Alexa-Fluor-labelled EGF and stained as described in Figure 28B. Shown are representative images that were analyzed. B. Characterization of vesicles present in siControl, siSNAP29 or siSNAP47 treated cells. For each condition, 30 puncta were characterized from 15 cells across three independent experiments. C. Comparative histogram of siControl, siSNAP29 and siSNAP47 treated cells for percentage of vesicles found per cell. Statistical analysis shown using Student’s t- Test comparative to siControl per vesicle set. ****p=0.00009.

Figure 29.

C. Discussion

The autophagy pathway is a basal, homeostatic process that is required for survival. Autophagy is ubiquitous in eukaryotes and yet, the understanding of how the process functions is still poorly understood. This chapter focused on describing a new regulator of autophagy, SNAP47. It is currently understood that there are two SNARE complexes that facilitate the progression of the autophagosome through the maturation stages, to form the amphisome or the autolysosome. The canonical complex of SNAP29-

STX17-VAMP8 has been referenced numerous times since its discovery (26), but a newly recognized complex, YKT6-SNAP29-STX7 has been the focus of autophagic

SNARE research more recently (27, 140, 141). Both of these complexes include SNAP29 as a binding partner.

Here, we demonstrate that SNAP29 is not required for starvation-induced autophagy, but that SNAP47 is required (Figure 22). While this result seemingly contradicts evidence in the literature that SNAP29 interacts with the autophagic SNARE complexes (26, 27, 140, 141), the functional role of SNAP29 in autophagy has not been fully elucidated. It is worth noting that the lack of requirement for SNAP29 does not mean the protein plays no role in autophagic flux. It may be that there are substitutions, such as SNAP47, that are also acceptable for the cell.

We tested if SNAP47 localization would respond in a cell under starvation conditions and expected to see it move to a more punctate structure, such as an autophagosome, given its role in autophagic flux. We based this hypothesis on the evidence for STX17 relocalizing to the autophagosome after autophagy induction (26).

However, in contrast to our hypothesis, SNAP47 appeared to become more structured in beaded strands (Figure 23), that we now believe to fall along a mitochondrion, based on the colocalization data in Figure 25. Using an online targeting sequence prediction software, iPSORT.hgc.jp, we were able to further validate this surprising result by locating a predicted mitochondrial targeting sequence in the first 30 amino acid residues.

There are contested theories about the source of autophagic membranes, with evidence for endoplasmic reticulum, Golgi and mitochondrial sources (10, 11, 142).

SNAP47 does not appear to entirely coat the surface of mitochondria, but rather exist in small clumps along the surface. This suggests to us that these must be specialized structures, such as ER-mitochondrial contact sites or localized areas of specific lipids.

Both of these proposed structures could nucleate phagophores upon induction. This would allow access of SNAP47 to traffic to an autophagic vesicle by proximity to the initiating membrane. However, data presented within do confound this possibility. We demonstrate in Figure 25 that only approximately 8% of SNAP47 colocalizes with LC3 in mock cells, and conversely about 12% of LC3 signal also colocalized with SNAP47 signal. A possible explanation for this could be that we analyzed the composition of vesicles in cells under complete medium and not in a starvation-based autophagy induction.

In addition to finding a high percentage of colocalization with a mitochondrial marker, we reported that over 50% of endogenous SNAP47 signal was found to colocalize with endogenous VAMP7 (Figure 25). This result is congruent with an ectopic expression finding currently in the literature (49). We were also able to demonstrate an interaction through immunoprecipitation of the endogenous proteins

SNAP47 and VAMP7 (Figure 26). The significance of this finding is that absence of

VAMP7 causes the accumulation of damaged mitochondria and a decrease in starvation- induced autophagosome generation in mice (139). Taken together with our data, there is strong evidence for a coordinated role for autophagosome fusion events. We would like to note that VAMP7 is an R SNARE and SNAP47 is a Qbc SNARE, so there is an unknown Qa SNARE of this permissive fusion bundle yet to be identified. Qa SNAREs encompass the Syntaxin protein family (143), so it is conceivable that STX17 or STX7, which already have cited roles in autophagy, may fill this gap.

Besides the role for VAMP7 on mitochondria, VAMP7 is perhaps more well known as a functional SNARE in the endolysosomal pathway (138). This second function may also contribute to a combined role for SNAP47 and VAMP7 in autophagic flux, by way of an amphisome formation. We demonstrate here that VAMP7 is found preferentially on late endosomes and recycling endosomes/multivesicular bodies (MVB) by Rab7 and Rab11 staining, respectively (Figure 27). Autophagosomes and amphisomes have been reported to have Rab7 on their membranes (144), whereas Rab11 has been reported on amphisomes following a fusion from an MVB (145). These caveats are important to note because the stains reveal a mixed population of vesicles.

A priority for the autophagic flux field of study would be to elucidate at which point the amphisome compartment is being affected. Many studies currently describe autophagosome-lysosome fusion, but use tools that are unable to identify what percentage of the data generated include amphisome formation, the fusion between the autophagosome and endosome, or the fusion of the amphisome to the lysosome. Despite evidence of the importance of this intermediate step in the pathway, it is largely

93 overlooked. The tandem-fluorophore LC3 autophagic flux tool is often used in the literature to show autolysosome formation by measure of acidification. However, amphisomes, which are acidified compartments, cannot be distinguished from autolysosomes through use of the tandem-fluorophore LC3 construct alone. We have designed a method to distinguish these vesicles with more granularity using immunofluorescence microscopy.

Autophagosomes, amphisomes and autolysosomes all share characteristics that make these classes of autophagic vesicles difficult to differentiate. However, using the few differences that exist, we have developed a multiplex protein staining assay so that for the first time, we are able identify amphisomes from other types of autophagic vesicles (Figure 28). In this chapter, we were able to utilize the assay to look at how the absence of SNAP29 or SNAP47 proteins affect the composition of autophagic vesicles in the cell. SNAP29 does not play a significant role in the vesicle distribution, but SNAP47 is required for normal amphisome formation (Figure 29). Interestingly, though amphisome formation was decreased 75%, autolysosome formation was not decreased in a statistically significant manner. This result suggests that an amphisome might not be the required step of the pathway as it has been previously posited (146), though cell specific differences in regulation are to be expected.

In summary, in this chapter, we have expanded the current knowledge base for both SNAP47 and VAMP7. We describe the interaction between these two SNAREs and have demonstrated that SNAP47 is required for autophagic flux and amphisome formation. These findings develop our understanding of the autophagic pathway progression from a linear pathway to a more complicated path containing different fusion

94 options for an autophagosome to navigate on its path to maturity. Continued studies on the basic cell biology of the regulation of autophagic flux will aid scientists looking for therapeutics for diseases that stem from abhorrent autophagy.

Chapter 5: Discussion

Over the past many decades of picornavirus studies, poliovirus research has dominated the field. Previous work in this lab has provided evidence for the link between autophagy and the poliovirus lifecycle (58, 95). In this dissertation, we have expanded the research to a reemerging pathogen from the same family, Enterovirus D68. EV-D68 has been known for over 50 years, but recently the virus has been increasing in number of outbreaks and severity of cases (147). The virus has been disproportionately affecting children under five years of age, with a large percentage of children needing to seek hospitalization treatment for severe respiratory symptoms (82). Studying the lifecycle of

EV-D68 in a basic research capacity should lead to cellular and viral targets for antiviral therapies.

Previously, we have studied the specifics of how poliovirus interacts with the autophagy process. It was shown that poliovirus initiates autophagy to benefit its replication, and specifically to promote its own capsid maturation (58). Poliovirus has been shown by electron microscopy to be found inside of double membrane vesicles that more recently have been recognized as autophagic vesicles (92, 95). We demonstrated that, in poliovirus infection, the virus inside the autophagosome may be using the acidified nature of the pathway to facilitate a maturation cleavage of the structural capsid proteins. Without this modification, the capsid remains noninfectious, and this modification is dependent on late-stage acidification during the virus lifecycle. While these data support the hypothesis that poliovirus is using the autophagic pathway

96 acidification for its replication, we questioned how the virus was surviving a degradative compartment, such as an autolysosome.

Research among picornaviruses often show similar lifecycle strategies among highly related family members, so we opted to apply this question to a currently medically relevant virus pathogen, EV-D68. Initial studies into the relationship between this virus and autophagy demonstrated that both poliovirus and EV-D68 hijacked this cellular pathway for its own replication (Figures 8, 11-12). With these data, it was reasonable to hypothesize that EV-D68 also required acidification from the autophagy pathway, in the same way as poliovirus.

The autophagy pathway progresses from a cytosol-neutral autophagosome to an acidified, proteolytically degradative autolysosome. Survival of a non-enveloped capsid within this environment seems unlikely, though the evidence at the time of this publication supported this model. We demonstrated here that EV-D68 may be modifying the internal and surrounding environment of the autophagic vesicle to protect itself from the harshness of the autolysosome. Our first evidence was the cleavage of SQSTM1 by virally-encoded protease 2A. SQSTM1 is a cargo adaptor that facilitates the recognition of ubiquitinated cargo for macroautophagy degradation and binds the cargo to a LC3 molecule on an expanding phagosome. The point of cleavage within the SQSTM1 protein is between the cargo binding domain and the LC3 interacting region, usually referred to as an LIR. It has been demonstrated that this particular cleavage forms two dominant negative pieces that functionally inhibit the would-be cargo from binding to the nascent phagophore (102, 127). We hypothesize that this is a mechanism to remove other items from entering the autophagosome, where we have observed the virus to be located.

The second evidence shown here demonstrates the virus modification of the autophagy pathway is the cleavage of SNAP29. Figure 16 shows that we are able to detect the virally-mediated cleavage approximately three hours into the lifecycle. For EV-

D68, that is about the halfway point of the lifecycle. Halfway through the lifecycle, by picornavirus lifecycle convention, the incoming virus has uncoated, replicated its genome and started translating its own proteins. This is also demonstrated by Figure 18H, where we observe EV-D68 shutting down cap-dependent translation, a picornavirus virulence strategy mediated by virally encoded proteases, at approximately the same time. This event requires translation of the virus proteins, and gives us a marker to measure the progression of the lifecycle. After determining the site of the 3C protease cleavage, which is located between its dual SNARE domains, we hypothesized that the separated SNARE domains may be repeating the dominant negative trope and functionally separating the

STX17-laden autophagosome and the VAMP8-laden lysosome. Though the damaged

SNARE proteins should be immediately targeted for degradation, we are able to detect both halves of this cleavage throughout the course of the virus lifecycle. It is, therefore, likely that the virus infection disrupts the typical mechanism of action of SNARE proteins targeted for degradation, which can be tested in future studies by measuring proteasome function in infected cells.

When we removed SNAP29 from the virus infection prior to that cleavage point, we expected a positive effect on virus replication. When we received the opposite result

(Figure 18AB), it was clear that SNAP29 must have multiple roles in the virus lifecycle.

We confirmed this hypothesis by observing the timing of the shutdown of cap-dependent host translation by radiolabeling proteins being synthesized in one hour increments. In

98 cells treated with a siRNA targeting SNAP29, the shutdown of translation was delayed by one hour. An hour difference may not seem like a significant change for many pathogens, but that is 15-20% of a lifecycle for this virus, equivalent to a 20 hour delay for a five day pathogen’s lifecycle. This suggests that there is a yet undiscovered role for SNAP29 during virus entry, genome replication or translation. Preliminary data shows a deficit in

RNA replication at three hours into the lifecycle, alluding to a role at or prior to RNA replication. Future experiments to address this remaining question should use neutral red- based entry assays or an earlier time point for the RNA replication qPCR assay to localize the effect of SNAP29 during early virus replication. It should be considered that the conferred effect of SNAP29 may not be a direct action on the virus, but as a trafficking protein, have an effect on the appropriate delivery of a required component of the viral lifecycle.

Using the acidification monitor system tandem-fluorophore LC3 to observe the progression of autophagosomes to final autophagy structures, we detected that during

EV-D68 infection, autophagosomes were still acidifying (Data not shown). We had two reactions to this observation. The initial reaction was that progression to acidification was expected because of the previous data demonstrating the acidification requirement from our lab. The second reaction was that, based on current literature definitions of proteins involved in autophagosome-lysosome fusion, it was not possible for autophagosomes to progress unless there was a piece of the pathway that was missing. Using the literature to search for potential proteins to fulfilling the missing-piece role in autophagy, we decided

SNAP47 was a likely candidate to have a yet uncharacterized role in autophagy.

SNAP47 is an understudied SNAP25 protein family member with a high degree of structural homology to SNAP29. To initially test if SNAP47 was worth exploring scientifically, we tested the protein’s effect on EV-D68 replication. We used a siRNA targeted against SNAP47 and the result, shown in Figure 20, was a two-log decrease in cell-associated virus titers. The effect for the absence of SNAP47 was more severe than the effect for the absence of SNAP29. In order to pursue the protein function further, it was necessary to characterize SNAP47 in a cell biology and autophagy background, before investigating how the virus may or may not alter it.

We focused on a role for SNAP47 in autophagy. While previous studies have attempted to identify the cellular localization of SNAP47, these data present an inconclusive story for the audience. We used endogenous SNARE proteins for nearly all work presented here, based on discussions with SNARE cell biologists about the unreliability of conclusions drawn from ectopic expression experiments. We have also observed this phenomenon first-hand when comparing the differences in localization of

GFP-SNAP47 to stained endogenous SNAP47 in an H1-HeLa cell. We report here that

SNAP47 co-fractionates by density with mitochondrial, endosome and autophagy markers (Figure 24), as well as colocalization of the same compartments by immunofluorescence microscopy (Figure 25). We were encouraged by this localization pattern that SNAP47 would have a role in autophagy because of the associated autophagic roles of mitochondria (a potential source of autophagic membranes) and endosomes (a component of the amphisome) in the autophagy pathways.

When we tested for a role in autophagy for SNAP47, we compared the absence of

SNAP29 versus SNAP47 and monitored autophagic flux by western blot. It was observed

100 that without SNAP29, autophagy could still progress to degradation, however, the presence of SNAP47 was required to reach the same point (Figures 20-22). The implication of this result is that the current literature presents an incomplete story. While it is possible that SNAP29 can still function in autophagy, but it is not a required component as the current literature suggests. To our knowledge, we are the first to suggest any role in autophagy for SNAP47, let alone an absolute requirement for this protein for autophagic flux.

When we examined the autophagy pathway for a specific role for SNAP47, we noted using the tandem-fluorophore LC3 acidification probe, that there were few to no acidified vesicles (data not shown). This suggests that SNAP47 functioned at either the formation of the amphisome, or at an earlier point in the pathway. As a member of the

SNAP25 family fusion SNARE proteins, we hypothesized that the role was at the fusion of the autophagosome to the endosome, to form an amphisome. To support this hypothesis, we decided to look at endosomal R-SNARE proteins for interactions with

SNAP47. Data exist that suggests that in an overexpression system, SNAP47 can interact with endosomal SNAREs VAMP4, VAMP7 and VAMP8. Based on the band intensity of the interactions demonstrated previously, we opted to test endogenous VAMP7 for an interaction with endogenous SNAP47. We found that SNAP47 does colocalize with

VAMP7, as well as interact with SNAP47 under mock and autophagy-induction conditions (Figures 25-26). We hypothesized that these two proteins provide three of the four necessary SNARE domains for the amphisome fusion SNARE bundles. Further experimentation is needed to determine the role of the other mentioned VAMP proteins.

This would help determine if VAMP7 is the exclusive amphisomal VAMP protein, or if

101 it can be a shared function across related proteins. Preliminary experiments with limited commercial reagents for VAMP7 have been inconclusive as to whether VAMP7 is required for amphisome formation (data not shown).

The role for SNAP47 in amphisome formation was further exposed using our amphisome detection assay, where we were able to show a significant decrease in the percentage of amphisomes in cells without SNAP47 protein levels. Based on the function of SNAP47 elucidated in our cell biological-based study, we can speculate that

SNAP47’s role in EV-D68 infection is at the stage of amphisome formation.

Considering all that is known on poliovirus and autophagy’s role in its lifecycle, it is reasonable to hypothesize that the acidified compartment required by poliovirus could be an amphisome. Acidification of cellular compartments late in EV-D68 infection is also required for replication (data not shown). The parallels between poliovirus and EV-D68 infections suggest that EV-D68 may also require an amphisome required for virus maturation, in a SNAP47 dependent manner. This hypothesis can be tested for EV-D68 using density gradient centrifugation, as it was for poliovirus (58). The expected result would be that in cells without SNAP47, there would be an increased percentage of immature capsids, detectable by a decrease in the viral capsid protein products from the maturation cleavage.

The remaining stage of a picornavirus’s lifecycle after maturation is exit of the host cell. Traditionally, picornaviruses have been described as viruses that exit cells by lysis. However, recent work in hepatitis A virus, coxsackievirus B3 and poliovirus has suggested that picornaviruses may exit cells in host-derived membrane-bound vesicles

102

(60, 61, 148). These data for coxsackievirus B3 and poliovirus suggests that the host membrane comes from an autophagic source (135, 148). We have conducted preliminary experiments that show that infectious EV-D68 can be isolated using exosome (50-

200nm) extraction protocols from cell supernatant. When these extracts are probed for autophagy related proteins, LC3, CD81 and SNAP23 were detected (data not shown). We hypothesize that EV-D68 is using the amphisome not only for maturation of its capsid proteins, but additionally as an exit mechanism from the cell.

Clues about the pathway to the cell surface for a virus-laden amphisome may be in data already presented here. An amphisome, by definition, is an autophagosome that has fused with an endosome. It has been cited that these endosomes can be either Rab7+, found on late endosomes, or Rab11+, found on recycling endosomes and multivesicular bodies. Rab11+ endosomes are known to function with the ESCRT pathway proteins to return vesicles to the surface of the cell (149). We have already found ESCRT protein

CD81 in the same fraction as our quasi-enveloped virus and Hepatitis A virus has been reported previously to use the ESCRT protein pathway for exit of its virus (60). These data suggest that the ESCRT pathway could be worth investigation as its role in EV-D68 infection.

An alternate hypothesis for if a Rab7+ vesicle fused to create the amphisome could be the use of SNAP23, a third member of the SNAP25 protein family that is plasma membrane bound and used in exocytosis. SNAP23 was also detected in the same fraction as our quasi-enveloped virus and preliminary data suggests a role for SNAP23 in both cell-associated and released virus. More detailed studies are needed to be able to distinguish the virus and our probed markers from co-fractionation to co-existence on the

103 same vesicle, and perhaps then, either the ESCRT pathway or the SNAP23 mechanism hypotheses may be testable.

In conclusion, we have sought an understanding of new details of the lifecycle of an emerging childhood pathogen. EV-D68 may have an association to acute flaccid myelitis, but it does not have a wealth of knowledge behind its viral replication strategies.

We have hypothesized and demonstrated a link between EV-D68 replication and autophagic exit of the virus. We submit that future studies of SNARE protein regulation of viral pathogenesis will yield a newly targetable class of proteins for development of therapeutics to limit virus transmission.

104

References 1. WHO | The world health report 1996 - Fighting disease, fostering development.

WHO.

2. Yin Z, Pascual C, Klionsky DJ. Autophagy: machinery and regulation. Microb Cell

3:588–596.

3. Dooley HC, Razi M, Polson HEJ, Girardin SE, Wilson MI, Tooze SA. 2014. WIPI2

Links LC3 Conjugation with PI3P, Autophagosome Formation, and Pathogen

Clearance by Recruiting Atg12–5-16L1. Mol Cell 55:238–252.

4. Puri C, Vicinanza M, Ashkenazi A, Gratian MJ, Zhang Q, Bento CF, Renna M,

Menzies FM, Rubinsztein DC. 2018. The RAB11A-Positive Compartment Is a

Primary Platform for Autophagosome Assembly Mediated by WIPI2 Recognition of

PI3P-RAB11A. Dev Cell 45:114-131.e8.

5. Carlsson SR, Simonsen A. 2015. Membrane dynamics in autophagosome

biogenesis. J Cell Sci 128:193–205.

6. Tsuyuki S, Takabayashi M, Kawazu M, Kudo K, Watanabe A, Nagata Y, Kusama

Y, Yoshida K. 2014. Detection of WIPI1 mRNA as an indicator of autophagosome

formation. Autophagy 10:497–513.

7. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Arozena AA,

Adachi H, Adams CM, Adams PD, Adeli K, Adhihetty PJ, Adler SG, Agam G,

Agarwal R, Aghi MK, Agnello M, Agostinis P, Aguilar PV, Aguirre-Ghiso J,

Airoldi EM, Ait-Si-Ali S, Akematsu T, Akporiaye ET, Al-Rubeai M, Albaiceta GM,

105

Albanese C, Albani D, Albert ML, Aldudo J, Algül H, Alirezaei M, Alloza I,

Almasan A, Almonte-Beceril M, Alnemri ES, Alonso C, Altan-Bonnet N, Altieri

DC, Alvarez S, Alvarez-Erviti L, Alves S, Amadoro G, Amano A, Amantini C,

Ambrosio S, Amelio I, Amer AO, Amessou M, Amon A, An Z, Anania FA,

Andersen SU, Andley UP, Andreadi CK, Andrieu-Abadie N, Anel A, Ann DK,

Anoopkumar-Dukie S, Antonioli M, Aoki H, Apostolova N, Aquila S, Aquilano K,

Araki K, Arama E, Aranda A, Araya J, Arcaro A, Arias E, Arimoto H, Ariosa AR,

Armstrong JL, Arnould T, Arsov I, Asanuma K, Askanas V, Asselin E, Atarashi R,

Atherton SS, Atkin JD, Attardi LD, Auberger P, Auburger G, Aurelian L, Autelli R,

Avagliano L, Avantaggiati ML, Avrahami L, Awale S, Azad N, Bachetti T, Backer

JM, Bae D-H, Bae J, Bae O-N, Bae SH, Baehrecke EH, Baek S-H, Baghdiguian S,

Bagniewska-Zadworna A, Bai H, Bai J, Bai X-Y, Bailly Y, Balaji KN, Balduini W,

Ballabio A, Balzan R, Banerjee R, Bánhegyi G, Bao H, Barbeau B, Barrachina MD,

Barreiro E, Bartel B, Bartolomé A, Bassham DC, Bassi MT, Jr RCB, Basu A,

Batista MT, Batoko H, Battino M, Bauckman K, Baumgarner BL, Bayer KU, Beale

R, Beaulieu J-F, Jr GRB, Becker C, Beckham JD, Bédard P-A, Bednarski PJ,

Begley TJ, Behl C, Behrends C, Behrens GM, Behrns KE, Bejarano E, Belaid A,

Belleudi F, Bénard G, Berchem G, Bergamaschi D, Bergami M, Berkhout B,

Berliocchi L, Bernard A, Bernard M, Bernassola F, Bertolotti A, Bess AS, Besteiro

S, Bettuzzi S, Bhalla S, Bhattacharyya S, Bhutia SK, Biagosch C, Bianchi MW,

Biard-Piechaczyk M, Billes V, Bincoletto C, Bingol B, Bird SW, Bitoun M, Bjedov

I, Blackstone C, Blanc L, Blanco GA, Blomhoff HK, Boada-Romero E, Böckler S,

Boes M, Boesze-Battaglia K, Boise LH, Bolino A, Boman A, Bonaldo P, Bordi M,

106

Bosch J, Botana LM, Botti J, Bou G, Bouché M, Bouchecareilh M, Boucher M-J,

Boulton ME, Bouret SG, Boya P, Boyer-Guittaut M, Bozhkov PV, Brady N, Braga

VM, Brancolini C, Braus GH, Pedro JMB-S, Brennan LA, Bresnick EH, Brest P,

Bridges D, Bringer M-A, Brini M, Brito GC, Brodin B, Brookes PS, Brown EJ,

Brown K, Broxmeyer HE, Bruhat A, Brum PC, Brumell JH, Brunetti-Pierri N,

Bryson-Richardson RJ, Buch S, Buchan AM, Budak H, Bulavin DV, Bultman SJ,

Bultynck G, Bumbasirevic V, Burelle Y, Burke RE, Burmeister M, Bütikofer P,

Caberlotto L, Cadwell K, Cahova M, Cai D, Cai J, Cai Q, Calatayud S, Camougrand

N, Campanella M, Campbell GR, Campbell M, Campello S, Candau R, Caniggia I,

Cantoni L, Cao L, Caplan AB, Caraglia M, Cardinali C, Cardoso SM, Carew JS,

Carleton LA, Carlin CR, Carloni S, Carlsson SR, Carmona-Gutierrez D, Carneiro

LA, Carnevali O, Carra S, Carrier A, Carroll B, Casas C, Casas J, Cassinelli G,

Castets P, Castro-Obregon S, Cavallini G, Ceccherini I, Cecconi F, Cederbaum AI,

Ceña V, Cenci S, Cerella C, Cervia D, Cetrullo S, Chaachouay H, Chae H-J, Chagin

AS, Chai C-Y, Chakrabarti G, Chamilos G, Chan EY, Chan MT, Chandra D,

Chandra P, Chang C-P, Chang RC-C, Chang TY, Chatham JC, Chatterjee S,

Chauhan S, Che Y, Cheetham ME, Cheluvappa R, Chen C-J, Chen G, Chen G-C,

Chen G, Chen H, Chen JW, Chen J-K, Chen M, Chen M, Chen P, Chen Q, Chen Q,

Chen S-D, Chen S, Chen SS-L, Chen W, Chen W-J, Chen WQ, Chen W, Chen X,

Chen Y-H, Chen Y-G, Chen Y, Chen Y, Chen Y, Chen Y-J, Chen Y-Q, Chen Y,

Chen Z, Chen Z, Cheng A, Cheng CH, Cheng H, Cheong H, Cherry S, Chesney J,

Cheung CHA, Chevet E, Chi HC, Chi S-G, Chiacchiera F, Chiang H-L, Chiarelli R,

Chiariello M, Chieppa M, Chin L-S, Chiong M, Chiu GN, Cho D-H, Cho S-G, Cho

107

WC, Cho Y-Y, Cho Y-S, Choi AM, Choi E-J, Choi E-K, Choi J, Choi ME, Choi S-

I, Chou T-F, Chouaib S, Choubey D, Choubey V, Chow K-C, Chowdhury K, Chu

CT, Chuang T-H, Chun T, Chung H, Chung T, Chung Y-L, Chwae Y-J, Cianfanelli

V, Ciarcia R, Ciechomska IA, Ciriolo MR, Cirone M, Claerhout S, Clague MJ,

Clària J, Clarke PG, Clarke R, Clementi E, Cleyrat C, Cnop M, Coccia EM, Cocco

T, Codogno P, Coers J, Cohen EE, Colecchia D, Coletto L, Coll NS, Colucci-Guyon

E, Comincini S, Condello M, Cook KL, Coombs GH, Cooper CD, Cooper JM,

Coppens I, Corasaniti MT, Corazzari M, Corbalan R, Corcelle-Termeau E, Cordero

MD, Corral-Ramos C, Corti O, Cossarizza A, Costelli P, Costes S, Cotman SL,

Coto-Montes A, Cottet S, Couve E, Covey LR, Cowart LA, Cox JS, Coxon FP,

Coyne CB, Cragg MS, Craven RJ, Crepaldi T, Crespo JL, Criollo A, Crippa V, Cruz

MT, Cuervo AM, Cuezva JM, Cui T, Cutillas PR, Czaja MJ, Czyzyk-Krzeska MF,

Dagda RK, Dahmen U, Dai C, Dai W, Dai Y, Dalby KN, Valle LD, Dalmasso G,

D’Amelio M, Damme M, Darfeuille-Michaud A, Dargemont C, Darley-Usmar VM,

Dasarathy S, Dasgupta B, Dash S, Dass CR, Davey HM, Davids LM, Dávila D,

Davis RJ, Dawson TM, Dawson VL, Daza P, Belleroche J de, Figueiredo P de,

Figueiredo RCBQ de, Fuente J de la, Martino LD, Matteis AD, Meyer GRD, Milito

AD, Santi MD, Souza W de, Tata VD, Zio DD, Debnath J, Dechant R, Decuypere J-

P, Deegan S, Dehay B, Bello BD, Re DPD, Delage-Mourroux R, Delbridge LM,

Deldicque L, Delorme-Axford E, Deng Y, Dengjel J, Denizot M, Dent P, Der CJ,

Deretic V, Derrien B, Deutsch E, Devarenne TP, Devenish RJ, Bartolomeo SD,

Daniele ND, Domenico FD, Nardo AD, Paola SD, Pietro AD, Renzo LD,

DiAntonio A, Díaz-Araya G, Díaz-Laviada I, Diaz-Meco MT, Diaz-Nido J, Dickey

108

CA, Dickson RC, Diederich M, Digard P, Dikic I, Dinesh-Kumar SP, Ding C, Ding

W-X, Ding Z, Dini L, Distler JH, Diwan A, Djavaheri-Mergny M, Dmytruk K,

Dobson RC, Doetsch V, Dokladny K, Dokudovskaya S, Donadelli M, Dong XC,

Dong X, Dong Z, Jr TMD, Doran KS, D’Orazi G, II GWD, Dosenko V, Dridi S,

Drucker L, Du J, Du L-L, Du L, Toit A du, Dua P, Duan L, Duann P, Dubey VK,

Duchen MR, Duchosal MA, Duez H, Dugail I, Dumit VI, Duncan MC, Dunlop EA,

Jr WAD, Dupont N, Dupuis L, Durán RV, Durcan TM, Duvezin-Caubet S, Duvvuri

U, Eapen V, Ebrahimi-Fakhari D, Echard A, Eckhart L, Edelstein CL, Edinger AL,

Eichinger L, Eisenberg T, Eisenberg-Lerner A, Eissa NT, El-Deiry WS, El-Khoury

V, Elazar Z, Eldar-Finkelman H, Elliott CJ, Emanuele E, Emmenegger U, Engedal

N, Engelbrecht A-M, Engelender S, Enserink JM, Erdmann R, Erenpreisa J, Eri R,

Eriksen JL, Erman A, Escalante R, Eskelinen E-L, Espert L, Esteban-Martínez L,

Evans TJ, Fabri M, Fabrias G, Fabrizi C, Facchiano A, Færgeman NJ, Faggioni A,

Fairlie WD, Fan C, Fan D, Fan J, Fang S, Fanto M, Fanzani A, Farkas T, Faure M,

Favier FB, Fearnhead H, Federici M, Fei E, Felizardo TC, Feng H, Feng Y, Feng Y,

Ferguson TA, Fernández ÁF, Fernandez-Barrena MG, Fernandez-Checa JC,

Fernández-López A, Fernandez-Zapico ME, Feron O, Ferraro E, Ferreira-Halder

CV, Fesus L, Feuer R, Fiesel FC, Filippi-Chiela EC, Filomeni G, Fimia GM, Fingert

JH, Finkbeiner S, Finkel T, Fiorito F, Fisher PB, Flajolet M, Flamigni F, Florey O,

Florio S, Floto RA, Folini M, Follo C, Fon EA, Fornai F, Fortunato F, Fraldi A,

Franco R, Francois A, François A, Frankel LB, Fraser ID, Frey N, Freyssenet DG,

Frezza C, Friedman SL, Frigo DE, Fu D, Fuentes JM, Fueyo J, Fujitani Y, Fujiwara

Y, Fujiya M, Fukuda M, Fulda S, Fusco C, Gabryel B, Gaestel M, Gailly P,

109

Gajewska M, Galadari S, Galili G, Galindo I, Galindo MF, Galliciotti G, Galluzzi L,

Galluzzi L, Galy V, Gammoh N, Gandy S, Ganesan AK, Ganesan S, Ganley IG,

Gannagé M, Gao F-B, Gao F, Gao J-X, Nannig LG, Véscovi EG, Garcia-Macía M,

Garcia-Ruiz C, Garg AD, Garg PK, Gargini R, Gassen NC, Gatica D, Gatti E,

Gavard J, Gavathiotis E, Ge L, Ge P, Ge S, Gean P-W, Gelmetti V, Genazzani AA,

Geng J, Genschik P, Gerner L, Gestwicki JE, Gewirtz DA, Ghavami S, Ghigo E,

Ghosh D, Giammarioli AM, Giampieri F, Giampietri C, Giatromanolaki A,

Gibbings DJ, Gibellini L, Gibson SB, Ginet V, Giordano A, Giorgini F, Giovannetti

E, Girardin SE, Gispert S, Giuliano S, Gladson CL, Glavic A, Gleave M, Godefroy

N, Jr RMG, Gokulan K, Goldman GH, Goletti D, Goligorsky MS, Gomes AV,

Gomes LC, Gomez H, Gomez-Manzano C, Gómez-Sánchez R, Gonçalves DA,

Goncu E, Gong Q, Gongora C, Gonzalez CB, Gonzalez-Alegre P, Gonzalez-Cabo

P, González-Polo RA, Goping IS, Gorbea C, Gorbunov NV, Goring DR, Gorman

AM, Gorski SM, Goruppi S, Goto-Yamada S, Gotor C, Gottlieb RA, Gozes I,

Gozuacik D, Graba Y, Graef M, Granato GE, Grant GD, Grant S, Gravina GL,

Green DR, Greenhough A, Greenwood MT, Grimaldi B, Gros F, Grose C, Groulx J-

F, Gruber F, Grumati P, Grune T, Guan J-L, Guan K-L, Guerra B, Guillen C,

Gulshan K, Gunst J, Guo C, Guo L, Guo M, Guo W, Guo X-G, Gust AA,

Gustafsson ÅB, Gutierrez E, Gutierrez MG, Gwak H-S, Haas A, Haber JE, Hadano

S, Hagedorn M, Hahn DR, Halayko AJ, Hamacher-Brady A, Hamada K, Hamai A,

Hamann A, Hamasaki M, Hamer I, Hamid Q, Hammond EM, Han F, Han W,

Handa JT, Hanover JA, Hansen M, Harada M, Harhaji-Trajkovic L, Harper JW,

Harrath AH, Harris AL, Harris J, Hasler U, Hasselblatt P, Hasui K, Hawley RG,

110

Hawley TS, He C, He CY, He F, He G, He R-R, He X-H, He Y-W, He Y-Y, Heath

JK, Hébert M-J, Heinzen RA, Helgason GV, Hensel M, Henske EP, Her C, Herman

PK, Hernández A, Hernandez C, Hernández-Tiedra S, Hetz C, Hiesinger PR, Higaki

K, Hilfiker S, Hill BG, Hill JA, Hill WD, Hino K, Hofius D, Hofman P, Höglinger

GU, Höhfeld J, Holz MK, Hong Y, Hood DA, Hoozemans JJ, Hoppe T, Hsu C, Hsu

C-Y, Hsu L-C, Hu D, Hu G, Hu H-M, Hu H, Hu MC, Hu Y-C, Hu Z-W, Hua F,

Hua Y, Huang C, Huang H-L, Huang K-H, Huang K-Y, Huang S, Huang S, Huang

W-P, Huang Y-R, Huang Y, Huang Y, Huber TB, Huebbe P, Huh W-K, Hulmi JJ,

Hur GM, Hurley JH, Husak Z, Hussain SN, Hussain S, Hwang JJ, Hwang S, Hwang

TI, Ichihara A, Imai Y, Imbriano C, Inomata M, Into T, Iovane V, Iovanna JL, Iozzo

RV, Ip NY, Irazoqui JE, Iribarren P, Isaka Y, Isakovic AJ, Ischiropoulos H,

Isenberg JS, Ishaq M, Ishida H, Ishii I, Ishmael JE, Isidoro C, Isobe K, Isono E,

Issazadeh-Navikas S, Itahana K, Itakura E, Ivanov AI, Iyer AKV, Izquierdo JM,

Izumi Y, Izzo V, Jäättelä M, Jaber N, Jackson DJ, Jackson WT, Jacob TG, Jacques

TS, Jagannath C, Jain A, Jana NR, Jang BK, Jani A, Janji B, Jannig PR, Jansson PJ,

Jean S, Jendrach M, Jeon J-H, Jessen N, Jeung E-B, Jia K, Jia L, Jiang H, Jiang H,

Jiang L, Jiang T, Jiang X, Jiang X, Jiang X, Jiang Y, Jiang Y, Jiménez A, Jin C, Jin

H, Jin L, Jin M, Jin S, Jinwal UK, Jo E-K, Johansen T, Johnson DE, Johnson GV,

Johnson JD, Jonasch E, Jones C, Joosten LA, Jordan J, Joseph A-M, Joseph B,

Joubert AM, Ju D, Ju J, Juan H-F, Juenemann K, Juhász G, Jung HS, Jung JU, Jung

Y-K, Jungbluth H, Justice MJ, Jutten B, Kaakoush NO, Kaarniranta K, Kaasik A,

Kabuta T, Kaeffer B, Kågedal K, Kahana A, Kajimura S, Kakhlon O, Kalia M,

Kalvakolanu DV, Kamada Y, Kambas K, Kaminskyy VO, Kampinga HH, Kandouz

111

M, Kang C, Kang R, Kang T-C, Kanki T, Kanneganti T-D, Kanno H, Kanthasamy

AG, Kantorow M, Kaparakis-Liaskos M, Kapuy O, Karantza V, Karim MR,

Karmakar P, Kaser A, Kaushik S, Kawula T, Kaynar AM, Ke P-Y, Ke Z-J, Kehrl

JH, Keller KE, Kemper JK, Kenworthy AK, Kepp O, Kern A, Kesari S, Kessel D,

Ketteler R, Kettelhut I do C, Khambu B, Khan MM, Khandelwal VK, Khare S,

Kiang JG, Kiger AA, Kihara A, Kim AL, Kim CH, Kim DR, Kim D-H, Kim EK,

Kim HY, Kim H-R, Kim J-S, Kim JH, Kim JC, Kim JH, Kim KW, Kim MD, Kim

M-M, Kim PK, Kim SW, Kim S-Y, Kim Y-S, Kim Y, Kimchi A, Kimmelman AC,

Kimura T, King JS, Kirkegaard K, Kirkin V, Kirshenbaum LA, Kishi S, Kitajima Y,

Kitamoto K, Kitaoka Y, Kitazato K, Kley RA, Klimecki WT, Klinkenberg M,

Klucken J, Knævelsrud H, Knecht E, Knuppertz L, Ko J-L, Kobayashi S, Koch JC,

Koechlin-Ramonatxo C, Koenig U, Koh YH, Köhler K, Kohlwein SD, Koike M,

Komatsu M, Kominami E, Kong D, Kong HJ, Konstantakou EG, Kopp BT,

Korcsmaros T, Korhonen L, Korolchuk VI, Koshkina NV, Kou Y, Koukourakis MI,

Koumenis C, Kovács AL, Kovács T, Kovacs WJ, Koya D, Kraft C, Krainc D,

Kramer H, Kravic-Stevovic T, Krek W, Kretz-Remy C, Krick R, Krishnamurthy M,

Kriston-Vizi J, Kroemer G, Kruer MC, Kruger R, Ktistakis NT, Kuchitsu K, Kuhn

C, Kumar AP, Kumar A, Kumar A, Kumar D, Kumar D, Kumar R, Kumar S,

Kundu M, Kung H-J, Kuno A, Kuo S-H, Kuret J, Kurz T, Kwok T, Kwon TK,

Kwon YT, Kyrmizi I, Spada ARL, Lafont F, Lahm T, Lakkaraju A, Lam T, Lamark

T, Lancel S, Landowski TH, Lane DJ, Lane JD, Lanzi C, Lapaquette P, Lapierre

LR, Laporte J, Laukkarinen J, Laurie GW, Lavandero S, Lavie L, LaVoie MJ, Law

BYK, Law HK, Law KB, Layfield R, Lazo PA, Cam LL, Roch KGL, Stunff HL,

112

Leardkamolkarn V, Lecuit M, Lee B-H, Lee C-H, Lee EF, Lee GM, Lee H-J, Lee

H, Lee JK, Lee J, Lee J, Lee JH, Lee M, Lee M-S, Lee PJ, Lee SW, Lee S-J, Lee S-

J, Lee SY, Lee SH, Lee SS, Lee S-J, Lee S, Lee Y-R, Lee YJ, Lee YH,

Leeuwenburgh C, Lefort S, Legouis R, Lei J, Lei Q-Y, Leib DA, Leibowitz G, Lekli

I, Lemaire SD, Lemasters JJ, Lemberg MK, Lemoine A, Leng S, Lenz G, Lenzi P,

Lerman LO, Barbato DL, Leu JI-J, Leung HY, Levine B, Lewis PA, Lezoualc’h F,

Li C, Li F, Li F-J, Li J, Li K, Li L, Li M, Li M, Li Q, Li R, Li S, Li W, Li W, Li X,

Li Y, Lian J, Liang C, Liang Q, Liao Y, Liberal J, Liberski PP, Lie P, Lieberman

AP, Lim HJ, Lim K-L, Lim K, Lima RT, Lin C-S, Lin C-F, Lin F, Lin F, Lin F-C,

Lin K, Lin K-H, Lin P-H, Lin T, Lin W-W, Lin Y-S, Lin Y, Linden R, Lindholm D,

Lindqvist LM, Lingor P, Linkermann A, Liotta LA, Lipinski MM, Lira VA, Lisanti

MP, Liton PB, Liu B, Liu C, Liu C-F, Liu F, Liu H-J, Liu J, Liu J-J, Liu J-L, Liu K,

Liu L, Liu L, Liu Q, Liu R-Y, Liu S, Liu S, Liu W, Liu X-D, Liu X, Liu X-H, Liu

X, Liu X, Liu X, Liu Y, Liu Y, Liu Z, Liu Z, Liuzzi JP, Lizard G, Ljujic M, Lodhi

IJ, Logue SE, Lokeshwar BL, Long YC, Lonial S, Loos B, López-Otín C, López-

Vicario C, Lorente M, Lorenzi PL, Lõrincz P, Los M, Lotze MT, Lovat PE, Lu B,

Lu B, Lu J, Lu Q, Lu S-M, Lu S, Lu Y, Luciano F, Luckhart S, Lucocq JM,

Ludovico P, Lugea A, Lukacs NW, Lum JJ, Lund AH, Luo H, Luo J, Luo S,

Luparello C, Lyons T, Ma J, Ma Y, Ma Y, Ma Z, Machado J, Machado-Santelli

GM, Macian F, MacIntosh GC, MacKeigan JP, Macleod KF, MacMicking JD,

MacMillan-Crow LA, Madeo F, Madesh M, Madrigal-Matute J, Maeda A, Maeda

T, Maegawa G, Maellaro E, Maes H, Magariños M, Maiese K, Maiti TK, Maiuri L,

Maiuri MC, Maki CG, Malli R, Malorni W, Maloyan A, Mami-Chouaib F, Man N,

113

Mancias JD, Mandelkow E-M, Mandell MA, Manfredi AA, Manié SN, Manzoni C,

Mao K, Mao Z, Mao Z-W, Marambaud P, Marconi AM, Marelja Z, Marfe G,

Margeta M, Margittai E, Mari M, Mariani FV, Marin C, Marinelli S, Mariño G,

Markovic I, Marquez R, Martelli AM, Martens S, Martin KR, Martin SJ, Martin S,

Martin-Acebes MA, Martín-Sanz P, Martinand-Mari C, Martinet W, Martinez J,

Martinez-Lopez N, Martinez-Outschoorn U, Martínez-Velázquez M, Martinez-

Vicente M, Martins WK, Mashima H, Mastrianni JA, Matarese G, Matarrese P,

Mateo R, Matoba S, Matsumoto N, Matsushita T, Matsuura A, Matsuzawa T,

Mattson MP, Matus S, Maugeri N, Mauvezin C, Mayer A, Maysinger D, Mazzolini

GD, McBrayer MK, McCall K, McCormick C, McInerney GM, McIver SC,

McKenna S, McMahon JJ, McNeish IA, Mechta-Grigoriou F, Medema JP, Medina

DL, Megyeri K, Mehrpour M, Mehta JL, Mei Y, Meier U-C, Meijer AJ, Meléndez

A, Melino G, Melino S, Melo EJT de, Mena MA, Meneghini MD, Menendez JA,

Menezes R, Meng L, Meng L, Meng S, Menghini R, Menko AS, Menna-Barreto

RF, Menon MB, Meraz-Ríos MA, Merla G, Merlini L, Merlot AM, Meryk A,

Meschini S, Meyer JN, Mi M, Miao C-Y, Micale L, Michaeli S, Michiels C,

Migliaccio AR, Mihailidou AS, Mijaljica D, Mikoshiba K, Milan E, Miller-Fleming

L, Mills GB, Mills IG, Minakaki G, Minassian BA, Ming X-F, Minibayeva F,

Minina EA, Mintern JD, Minucci S, Miranda-Vizuete A, Mitchell CH, Miyamoto S,

Miyazawa K, Mizushima N, Mnich K, Mograbi B, Mohseni S, Moita LF, Molinari

M, Molinari M, Møller AB, Mollereau B, Mollinedo F, Mongillo M, Monick MM,

Montagnaro S, Montell C, Moore DJ, Moore MN, Mora-Rodriguez R, Moreira PI,

Morel E, Morelli MB, Moreno S, Morgan MJ, Moris A, Moriyasu Y, Morrison JL,

114

Morrison LA, Morselli E, Moscat J, Moseley PL, Mostowy S, Motori E, Mottet D,

Mottram JC, Moussa CE-H, Mpakou VE, Mukhtar H, Levy JMM, Muller S,

Muñoz-Moreno R, Muñoz-Pinedo C, Münz C, Murphy ME, Murray JT, Murthy A,

Mysorekar IU, Nabi IR, Nabissi M, Nader GA, Nagahara Y, Nagai Y, Nagata K,

Nagelkerke A, Nagy P, Naidu SR, Nair S, Nakano H, Nakatogawa H, Nanjundan M,

Napolitano G, Naqvi NI, Nardacci R, Narendra DP, Narita M, Nascimbeni AC,

Natarajan R, Navegantes LC, Nawrocki ST, Nazarko TY, Nazarko VY, Neill T,

Neri LM, Netea MG, Netea-Maier RT, Neves BM, Ney PA, Nezis IP, Nguyen HT,

Nguyen HP, Nicot A-S, Nilsen H, Nilsson P, Nishimura M, Nishino I, Niso-Santano

M, Niu H, Nixon RA, Njar VC, Noda T, Noegel AA, Nolte EM, Norberg E, Norga

KK, Noureini SK, Notomi S, Notterpek L, Nowikovsky K, Nukina N, Nürnberger

T, O’Donnell VB, O’Donovan T, O’Dwyer PJ, Oehme I, Oeste CL, Ogawa M,

Ogretmen B, Ogura Y, Oh YJ, Ohmuraya M, Ohshima T, Ojha R, Okamoto K,

Okazaki T, Oliver FJ, Ollinger K, Olsson S, Orban DP, Ordonez P, Orhon I, Orosz

L, O’Rourke EJ, Orozco H, Ortega AL, Ortona E, Osellame LD, Oshima J, Oshima

S, Osiewacz HD, Otomo T, Otsu K, Ou JJ, Outeiro TF, Ouyang D, Ouyang H,

Overholtzer M, Ozbun MA, Ozdinler PH, Ozpolat B, Pacelli C, Paganetti P, Page G,

Pages G, Pagnini U, Pajak B, Pak SC, Pakos-Zebrucka K, Pakpour N, Palková Z,

Palladino F, Pallauf K, Pallet N, Palmieri M, Paludan SR, Palumbo C, Palumbo S,

Pampliega O, Pan H, Pan W, Panaretakis T, Pandey A, Pantazopoulou A,

Papackova Z, Papademetrio DL, Papassideri I, Papini A, Parajuli N, Pardo J, Parekh

VV, Parenti G, Park J-I, Park J, Park OK, Parker R, Parlato R, Parys JB, Parzych

KR, Pasquet J-M, Pasquier B, Pasumarthi KB, Patschan D, Patterson C, Pattingre S,

115

Pattison S, Pause A, Pavenstädt H, Pavone F, Pedrozo Z, Peña FJ, Peñalva MA,

Pende M, Peng J, Penna F, Penninger JM, Pensalfini A, Pepe S, Pereira GJ, Pereira

PC, Cruz VP la, Pérez-Pérez ME, Pérez-Rodríguez D, Pérez-Sala D, Perier C, Perl

A, Perlmutter DH, Perrotta I, Pervaiz S, Pesonen M, Pessin JE, Peters GJ, Petersen

M, Petrache I, Petrof BJ, Petrovski G, Phang JM, Piacentini M, Pierdominici M,

Pierre P, Pierrefite-Carle V, Pietrocola F, Pimentel-Muiños FX, Pinar M, Pineda B,

Pinkas-Kramarski R, Pinti M, Pinton P, Piperdi B, Piret JM, Platanias LC, Platta

HW, Plowey ED, Pöggeler S, Poirot M, Polčic P, Poletti A, Poon AH, Popelka H,

Popova B, Poprawa I, Poulose SM, Poulton J, Powers SK, Powers T, Pozuelo-Rubio

M, Prak K, Prange R, Prescott M, Priault M, Prince S, Proia RL, Proikas-Cezanne

T, Prokisch H, Promponas VJ, Przyklenk K, Puertollano R, Pugazhenthi S, Puglielli

L, Pujol A, Puyal J, Pyeon D, Qi X, Qian W, Qin Z-H, Qiu Y, Qu Z, Quadrilatero J,

Quinn F, Raben N, Rabinowich H, Radogna F, Ragusa MJ, Rahmani M, Raina K,

Ramanadham S, Ramesh R, Rami A, Randall-Demllo S, Randow F, Rao H, Rao

VA, Rasmussen BB, Rasse TM, Ratovitski EA, Rautou P-E, Ray SK, Razani B,

Reed BH, Reggiori F, Rehm M, Reichert AS, Rein T, Reiner DJ, Reits E, Ren J,

Ren X, Renna M, Reusch JE, Revuelta JL, Reyes L, Rezaie AR, Richards RI,

Richardson DR, Richetta C, Riehle MA, Rihn BH, Rikihisa Y, Riley BE, Rimbach

G, Rippo MR, Ritis K, Rizzi F, Rizzo E, Roach PJ, Robbins J, Roberge M, Roca G,

Roccheri MC, Rocha S, Rodrigues CM, Rodríguez CI, Cordoba SR de, Rodriguez-

Muela N, Roelofs J, Rogov VV, Rohn TT, Rohrer B, Romanelli D, Romani L,

Romano PS, Roncero MIG, Rosa JL, Rosello A, Rosen KV, Rosenstiel P, Rost-

Roszkowska M, Roth KA, Roué G, Rouis M, Rouschop KM, Ruan DT, Ruano D,

116

Rubinsztein DC, III EBR, Rudich A, Rudolf E, Rudolf R, Ruegg MA, Ruiz-Roldan

C, Ruparelia AA, Rusmini P, Russ DW, Russo GL, Russo G, Russo R, Rusten TE,

Ryabovol V, Ryan KM, Ryter SW, Sabatini DM, Sacher M, Sachse C, Sack MN,

Sadoshima J, Saftig P, Sagi-Eisenberg R, Sahni S, Saikumar P, Saito T, Saitoh T,

Sakakura K, Sakoh-Nakatogawa M, Sakuraba Y, Salazar-Roa M, Salomoni P,

Saluja AK, Salvaterra PM, Salvioli R, Samali A, Sanchez AM, Sánchez-Alcázar JA,

Sanchez-Prieto R, Sandri M, Sanjuan MA, Santaguida S, Santambrogio L, Santoni

G, Santos CN dos, Saran S, Sardiello M, Sargent G, Sarkar P, Sarkar S, Sarrias MR,

Sarwal MM, Sasakawa C, Sasaki M, Sass M, Sato K, Sato M, Satriano J, Savaraj N,

Saveljeva S, Schaefer L, Schaible UE, Scharl M, Schatzl HM, Schekman R, Scheper

W, Schiavi A, Schipper HM, Schmeisser H, Schmidt J, Schmitz I, Schneider BE,

Schneider EM, Schneider JL, Schon EA, Schönenberger MJ, Schönthal AH,

Schorderet DF, Schröder B, Schuck S, Schulze RJ, Schwarten M, Schwarz TL,

Sciarretta S, Scotto K, Scovassi AI, Screaton RA, Screen M, Seca H, Sedej S,

Segatori L, Segev N, Seglen PO, Seguí-Simarro JM, Segura-Aguilar J, Seki E,

Seiliez I, Sell C, Semenkovich CF, Semenza GL, Sen U, Serra AL, Serrano-Puebla

A, Sesaki H, Setoguchi T, Settembre C, Shacka JJ, Shajahan-Haq AN, Shapiro IM,

Sharma S, She H, Shen C-KJ, Shen C-C, Shen H-M, Shen S, Shen W, Sheng R,

Sheng X, Sheng Z-H, Shepherd TG, Shi J, Shi Q, Shi Q, Shi Y, Shibutani S,

Shibuya K, Shidoji Y, Shieh J-J, Shih C-M, Shimada Y, Shimizu S, Shin DW,

Shinohara ML, Shintani M, Shintani T, Shioi T, Shirabe K, Shiri-Sverdlov R,

Shirihai O, Shore GC, Shu C-W, Shukla D, Sibirny AA, Sica V, Sigurdson CJ,

Sigurdsson EM, Sijwali PS, Sikorska B, Silveira WA, Silvente-Poirot S, Silverman

117

GA, Simak J, Simmet T, Simon AK, Simon H-U, Simone C, Simons M, Simonsen

A, Singh R, Singh SV, Singh SK, Sinha D, Sinha S, Sinicrope FA, Sirko A, Sirohi

K, Sishi BJ, Sittler A, Siu PM, Sivridis E, Skwarska A, Slack R, Slaninová I, Slavov

N, Smaili SS, Smalley KS, Smith DR, Soenen SJ, Soleimanpour SA, Solhaug A,

Somasundaram K, Son JH, Sonawane A, Song C, Song F, Song HK, Song J-X,

Song W, Soo KY, Sood AK, Soong TW, Soontornniyomkij V, Sorice M, Sotgia F,

Soto-Pantoja DR, Sotthibundhu A, Sousa MJ, Spaink HP, Span PN, Spang A,

Sparks JD, Speck PG, Spector SA, Spies CD, Springer W, Clair DS, Stacchiotti A,

Staels B, Stang MT, Starczynowski DT, Starokadomskyy P, Steegborn C, Steele

JW, Stefanis L, Steffan J, Stellrecht CM, Stenmark H, Stepkowski TM, Stern ST,

Stevens C, Stockwell BR, Stoka V, Storchova Z, Stork B, Stratoulias V, Stravopodis

DJ, Strnad P, Strohecker AM, Ström A-L, Stromhaug P, Stulik J, Su Y-X, Su Z,

Subauste CS, Subramaniam S, Sue CM, Suh SW, Sui X, Sukseree S, Sulzer D, Sun

F-L, Sun J, Sun J, Sun S-Y, Sun Y, Sun Y, Sun Y, Sundaramoorthy V, Sung J,

Suzuki H, Suzuki K, Suzuki N, Suzuki T, Suzuki YJ, Swanson MS, Swanton C,

Swärd K, Swarup G, Sweeney ST, Sylvester PW, Szatmari Z, Szegezdi E, Szlosarek

PW, Taegtmeyer H, Tafani M, Taillebourg E, Tait SW, Takacs-Vellai K, Takahashi

Y, Takáts S, Takemura G, Takigawa N, Talbot NJ, Tamagno E, Tamburini J, Tan

C-P, Tan L, Tan ML, Tan M, Tan Y-J, Tanaka K, Tanaka M, Tang D, Tang D, Tang

G, Tanida I, Tanji K, Tannous BA, Tapia JA, Tasset-Cuevas I, Tatar M, Tavassoly

I, Tavernarakis N, Taylor A, Taylor GS, Taylor GA, Taylor JP, Taylor MJ, Tchetina

EV, Tee AR, Teixeira-Clerc F, Telang S, Tencomnao T, Teng B-B, Teng R-J, Terro

F, Tettamanti G, Theiss AL, Theron AE, Thomas KJ, Thomé MP, Thomes PG,

118

Thorburn A, Thorner J, Thum T, Thumm M, Thurston TL, Tian L, Till A, Ting JP,

Titorenko VI, Toker L, Toldo S, Tooze SA, Topisirovic I, Torgersen ML,

Torosantucci L, Torriglia A, Torrisi MR, Tournier C, Towns R, Trajkovic V,

Travassos LH, Triola G, Tripathi DN, Trisciuoglio D, Troncoso R, Trougakos IP,

Truttmann AC, Tsai K-J, Tschan MP, Tseng Y-H, Tsukuba T, Tsung A, Tsvetkov

AS, Tu S, Tuan H-Y, Tucci M, Tumbarello DA, Turk B, Turk V, Turner RF, Tveita

AA, Tyagi SC, Ubukata M, Uchiyama Y, Udelnow A, Ueno T, Umekawa M,

Umemiya-Shirafuji R, Underwood BR, Ungermann C, Ureshino RP, Ushioda R,

Uversky VN, Uzcátegui NL, Vaccari T, Vaccaro MI, Váchová L, Vakifahmetoglu-

Norberg H, Valdor R, Valente EM, Vallette F, Valverde AM, Berghe GV den,

Bosch LVD, Brink GR van den, Goot FG van der, Klei IJ van der, Laan LJ van der,

Doorn WG van, Egmond M van, Golen KL van, Kaer LV, Campagne M van L,

Vandenabeele P, Vandenberghe W, Vanhorebeek I, Varela-Nieto I, Vasconcelos

MH, Vasko R, Vavvas DG, Vega-Naredo I, Velasco G, Velentzas AD, Velentzas

PD, Vellai T, Vellenga E, Vendelbo MH, Venkatachalam K, Ventura N, Ventura S,

Veras PS, Verdier M, Vertessy BG, Viale A, Vidal M, Vieira HL, Vierstra RD,

Vigneswaran N, Vij N, Vila M, Villar M, Villar VH, Villarroya J, Vindis C, Viola

G, Viscomi MT, Vitale G, Vogl DT, Voitsekhovskaja OV, Haefen C von,

Schwarzenberg K von, Voth DE, Vouret-Craviari V, Vuori K, Vyas JM, Waeber C,

Walker CL, Walker MJ, Walter J, Wan L, Wan X, Wang B, Wang C, Wang C-Y,

Wang C, Wang C, Wang C, Wang D, Wang F, Wang F, Wang G, Wang H, Wang

H, Wang H-G, Wang H, Wang H-D, Wang J, Wang J, Wang M, Wang M-Q, Wang

P-Y, Wang P, Wang RC, Wang S, Wang T-F, Wang X, Wang X, Wang X-W, Wang

119

X, Wang X, Wang Y, Wang Y, Wang Y, Wang Y-J, Wang Y, Wang Y, Wang YT,

Wang Y, Wang Z-N, Wappner P, Ward C, Ward DM, Warnes G, Watada H,

Watanabe Y, Watase K, Weaver TE, Weekes CD, Wei J, Weide T, Weihl CC,

Weindl G, Weis SN, Wen L, Wen X, Wen Y, Westermann B, Weyand CM, White

AR, White E, Whitton JL, Whitworth AJ, Wiels J, Wild F, Wildenberg ME,

Wileman T, Wilkinson DS, Wilkinson S, Willbold D, Williams C, Williams K,

Williamson PR, Winklhofer KF, Witkin SS, Wohlgemuth SE, Wollert T, Wolvetang

EJ, Wong E, Wong GW, Wong RW, Wong VKW, Woodcock EA, Wright KL, Wu

C, Wu D, Wu GS, Wu J, Wu J, Wu M, Wu M, Wu S, Wu WK, Wu Y, Wu Z,

Xavier CP, Xavier RJ, Xia G-X, Xia T, Xia W, Xia Y, Xiao H, Xiao J, Xiao S, Xiao

W, Xie C-M, Xie Z, Xie Z, Xilouri M, Xiong Y, Xu C, Xu C, Xu F, Xu H, Xu H,

Xu J, Xu J, Xu J, Xu L, Xu X, Xu Y, Xu Y, Xu Z-X, Xu Z, Xue Y, Yamada T,

Yamamoto A, Yamanaka K, Yamashina S, Yamashiro S, Yan B, Yan B, Yan X,

Yan Z, Yanagi Y, Yang D-S, Yang J-M, Yang L, Yang M, Yang P-M, Yang P,

Yang Q, Yang W, Yang WY, Yang X, Yang Y, Yang Y, Yang Z, Yang Z, Yao M-

C, Yao PJ, Yao X, Yao Z, Yao Z, Yasui LS, Ye M, Yedvobnick B, Yeganeh B, Yeh

ES, Yeyati PL, Yi F, Yi L, Yin X-M, Yip CK, Yoo Y-M, Yoo YH, Yoon S-Y,

Yoshida K-I, Yoshimori T, Young KH, Yu H, Yu JJ, Yu J-T, Yu J, Yu L, Yu WH,

Yu X-F, Yu Z, Yuan J, Yuan Z-M, Yue BY, Yue J, Yue Z, Zacks DN, Zacksenhaus

E, Zaffaroni N, Zaglia T, Zakeri Z, Zecchini V, Zeng J, Zeng M, Zeng Q, Zervos

AS, Zhang DD, Zhang F, Zhang G, Zhang G-C, Zhang H, Zhang H, Zhang H,

Zhang H, Zhang J, Zhang J, Zhang J, Zhang J, Zhang J, Zhang L, Zhang L, Zhang

L, Zhang L, Zhang M-Y, Zhang X, Zhang XD, Zhang Y, Zhang Y, Zhang Y, Zhang

120

Y, Zhang Y, Zhao M, Zhao W-L, Zhao X, Zhao YG, Zhao Y, Zhao Y, Zhao Y,

Zhao Z, Zhao ZJ, Zheng D, Zheng X-L, Zheng X, Zhivotovsky B, Zhong Q, Zhou

G-Z, Zhou G, Zhou H, Zhou S-F, Zhou X, Zhu H, Zhu H, Zhu W-G, Zhu W, Zhu

X-F, Zhu Y, Zhuang S-M, Zhuang X, Ziparo E, Zois CE, Zoladek T, Zong W-X,

Zorzano A, Zughaier SM. 2016. Guidelines for the use and interpretation of assays

for monitoring autophagy (3rd edition). Autophagy 12:1–222.

8. Rubinsztein DC, Shpilka T, Elazar Z. 2012. Mechanisms of Autophagosome

Biogenesis. Curr Biol 22:R29–R34.

9. Kawabata T, Yoshimori T. 2016. Beyond starvation: An update on the autophagic

machinery and its functions. J Mol Cell Cardiol 95:2–10.

10. Garofalo T, Matarrese P, Manganelli V, Marconi M, Tinari A, Gambardella L,

Faggioni A, Misasi R, Sorice M, Malorni W. 2016. Evidence for the involvement of

lipid rafts localized at the ER-mitochondria associated membranes in

autophagosome formation. Autophagy 12:917–935.

11. Tang Z, Takahashi Y, He H, Hattori T, Chen C, Liang X, Chen H, Young MM,

Wang H-G. 2019. TOM40 Targets Atg2 to Mitochondria-Associated ER

Membranes for Phagophore Expansion. Cell Rep 28:1744-1757.e5.

12. Graef M, Friedman JR, Graham C, Babu M, Nunnari J. 2013. ER exit sites are

physical and functional core autophagosome biogenesis components. Mol Biol Cell

24:2918–2931.

121

13. Berg TO, Fengsrud M, Strømhaug PE, Berg T, Seglen PO. 1998. Isolation and

Characterization of Rat Liver Amphisomes EVIDENCE FOR FUSION OF

AUTOPHAGOSOMES WITH BOTH EARLY AND LATE ENDOSOMES. J Biol

Chem 273:21883–21892.

14. Kimura S, Noda T, Yoshimori T. 2007. Dissection of the autophagosome

maturation process by a novel reporter protein, tandem fluorescent-tagged LC3.

Autophagy 3:452–460.

15. Bock JB, Matern HT, Peden AA, Scheller RH. 2001. A genomic perspective on

membrane compartment organization. Nature 409:839–841.

16. Lou X, Shin Y-K. 2016. SNARE zippering. Biosci Rep 36:e00327–e00327.

17. Fasshauer D, Sutton RB, Brunger AT, Jahn R. 1998. Conserved structural features

of the synaptic fusion complex: SNARE proteins reclassified as Q- and R-SNAREs.

Proc Natl Acad Sci U S A 95:15781–15786.

18. Bombardier JP, Munson M. 2015. Three steps forward, two steps back: mechanistic

insights into the assembly and disassembly of the SNARE complex. Curr Opin

Chem Biol 29:66–71.

19. Hong W. 2005. SNAREs and traffic. Biochim Biophys Acta BBA - Mol Cell Res

1744:120–144.

20. Atlas D. 2013. The Voltage-Gated Calcium Channel Functions as the Molecular

Switch of Synaptic Transmission. Annu Rev Biochem 82:607–635.

122

21. Simms BA, Zamponi GW. 2014. Neuronal Voltage-Gated Calcium Channels:

Structure, Function, and Dysfunction. Neuron 82:24–45.

22. Tian X, Gala U, Zhang Y, Shang W, Nagarkar Jaiswal S, di Ronza A, Jaiswal M,

Yamamoto S, Sandoval H, Duraine L, Sardiello M, Sillitoe RV, Venkatachalam K,

Fan H, Bellen HJ, Tong C. 2015. A Voltage-Gated Calcium Channel Regulates

Lysosomal Fusion with Endosomes and Autophagosomes and Is Required for

Neuronal Homeostasis. PLOS Biol 13:e1002103.

23. Sreetama SC, Takano T, Nedergaard M, Simon SM, Jaiswal JK. 2016. Injured

astrocytes are repaired by Synaptotagmin XI-regulated lysosome exocytosis. Cell

Death Differ 23:596–607.

24. Luo F, Südhof TC. 2017. Synaptotagmin-7-Mediated Asynchronous Release Boosts

High-Fidelity Synchronous Transmission at a Central Synapse. Neuron 94:826-

839.e3.

25. Takáts S, Nagy P, Varga Á, Pircs K, Kárpáti M, Varga K, Kovács AL, Hegedűs K,

Juhász G. 2013. Autophagosomal Syntaxin17-dependent lysosomal degradation

maintains neuronal function in Drosophila. J Cell Biol 201:531–539.

26. Itakura E, Kishi-Itakura C, Mizushima N. 2012. The Hairpin-type Tail-Anchored

SNARE Syntaxin 17 Targets to Autophagosomes for Fusion with

Endosomes/Lysosomes. Cell 151:1256–1269.

123

27. Matsui T, Jiang P, Nakano S, Sakamaki Y, Yamamoto H, Mizushima N. 2018.

Autophagosomal YKT6 is required for fusion with lysosomes independently of

syntaxin 17. J Cell Biol jcb.201712058.

28. Nicholson KL, Munson M, Miller RB, Filip TJ, Fairman R, Hughson FM. 1998.

Regulation of SNARE complex assembly by an N-terminal domain of the t-SNARE

Sso1p. Nat Struct Biol 5:793–802.

29. Parlati F, Weber T, McNew JA, Westermann B, Söllner TH, Rothman JE. 1999.

Rapid and efficient fusion of phospholipid vesicles by the alpha-helical core of a

SNARE complex in the absence of an N-terminal regulatory domain. Proc Natl

Acad Sci U S A 96:12565–12570.

30. Munson M, Chen X, Cocina AE, Schultz SM, Hughson FM. 2000. Interactions

within the yeast t-SNARE Sso1p that control SNARE complex assembly. Nat Struct

Biol 7:894–902.

31. Hubert V, Peschel A, Langer B, Gröger M, Rees A, Kain R. 2016. LAMP-2 is

required for incorporating syntaxin-17 into autophagosomes and for their fusion

with lysosomes. Biol Open 5:1516–1529.

32. Kumar S, Jain A, Farzam F, Jia J, Gu Y, Choi SW, Mudd MH, Claude-Taupin A,

Wester MJ, Lidke KA, Rusten T-E, Deretic V. 2018. Mechanism of Stx17

recruitment to autophagosomes via IRGM and mammalian Atg8 proteins. J Cell

Biol jcb.201708039.

124

33. Antonin W, Dulubova I, Arac D, Pabst S, Plitzner J, Rizo J, Jahn R. 2002. The N-

terminal domains of syntaxin 7 and vti1b form three-helix bundles that differ in

their ability to regulate SNARE complex assembly. J Biol Chem 277:36449–36456.

34. Antonin W, Fasshauer D, Becker S, Jahn R, Schneider TR. 2002. Crystal structure

of the endosomal SNARE complex reveals common structural principles of all

SNAREs. Nat Struct Biol 9:107–111.

35. Rossi V, Picco R, Vacca M, D’Esposito M, D’Urso M, Galli T, Filippini F. 2004.

VAMP subfamilies identified by specific R-SNARE motifs. Biol Cell 96:251–256.

36. Filippini F, Rossi V, Galli T, Budillon A, D’Urso M, D’Esposito M. 2001. Longins:

a new evolutionary conserved VAMP family sharing a novel SNARE domain.

Trends Biochem Sci 26:407–409.

37. Martinez-Arca S, Coco S, Mainguy G, Schenk U, Alberts P, Bouillé P, Mezzina M,

Prochiantz A, Matteoli M, Louvard D, Galli T. 2001. A common exocytotic

mechanism mediates axonal and dendritic outgrowth. J Neurosci Off J Soc Neurosci

21:3830–3838.

38. Martinez-Arca S, Alberts P, Zahraoui A, Louvard D, Galli T. 2000. Role of tetanus

neurotoxin insensitive vesicle-associated membrane protein (TI-VAMP) in vesicular

transport mediating neurite outgrowth. J Cell Biol 149:889–900.

39. Hasegawa H, Zinsser S, Rhee Y, Vik-Mo EO, Davanger S, Hay JC. 2003.

Mammalian ykt6 is a neuronal SNARE targeted to a specialized compartment by its

profilin-like amino terminal domain. Mol Biol Cell 14:698–720.

125

40. Wong SH, Zhang T, Xu Y, Subramaniam VN, Griffiths G, Hong W. 1998.

Endobrevin, a novel synaptobrevin/VAMP-like protein preferentially associated

with the early endosome. Mol Biol Cell 9:1549–1563.

41. Furuta N, Fujita N, Noda T, Yoshimori T, Amano A. 2010. Combinational soluble

N-ethylmaleimide-sensitive factor attachment protein receptor proteins VAMP8 and

Vti1b mediate fusion of antimicrobial and canonical autophagosomes with

lysosomes. Mol Biol Cell 21:1001–1010.

42. Jean S, Cox S, Nassari S, Kiger AA. 2015. Starvation-induced MTMR13 and

RAB21 activity regulates VAMP8 to promote autophagosome-lysosome fusion.

EMBO Rep 16:297–311.

43. Hohenstein AC, Roche PA. 2001. SNAP-29 Is a Promiscuous Syntaxin-Binding

SNARE. Biochem Biophys Res Commun 285:167–171.

44. Schiller SA, Seebode C, Wieser GL, Goebbels S, Möbius W, Horowitz M, Sarig O,

Sprecher E, Emmert S. 2016. Establishment of Two Mouse Models for CEDNIK

Syndrome Reveals the Pivotal Role of SNAP29 in Epidermal Differentiation. J

Invest Dermatol 136:672–679.

45. Sprecher E, Ishida-Yamamoto A, Mizrahi-Koren M, Rapaport D, Goldsher D,

Indelman M, Topaz O, Chefetz I, Keren H, O’Brien TJ. 2005. A mutation in

SNAP29, coding for a SNARE protein involved in intracellular trafficking, causes a

novel neurocutaneous syndrome characterized by cerebral dysgenesis, neuropathy,

ichthyosis, and palmoplantar keratoderma. Am J Hum Genet 77:242–251.

126

46. Morelli E, Ginefra P, Mastrodonato V, Beznoussenko GV, Rusten TE, Bilder D,

Stenmark H, Mironov AA, Vaccari T. 2014. Multiple functions of the SNARE

protein Snap29 in autophagy, endocytic, and exocytic trafficking during epithelial

formation in Drosophila. Autophagy 10:2251–2268.

47. Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z,

Feng D, Chen S, Zhang H. 2014. O-GlcNAc-modification of SNAP-29 regulates

autophagosome maturation. Nat Cell Biol 16:1215–1226.

48. Holt M, Varoqueaux F, Wiederhold K, Takamori S, Urlaub H, Fasshauer D, Jahn R.

2006. Identification of SNAP-47, a Novel Qbc-SNARE with Ubiquitous

Expression. J Biol Chem 281:17076–17083.

49. Kuster A, Nola S, Dingli F, Vacca B, Gauchy C, Beaujouan J-C, Nunez M,

Moncion T, Loew D, Formstecher E, Galli T, Proux-Gillardeaux V. 2015. The Q-

soluble N -Ethylmaleimide-sensitive Factor Attachment Protein Receptor (Q-

SNARE) SNAP-47 Regulates Trafficking of Selected Vesicle-associated Membrane

Proteins (VAMPs). J Biol Chem 290:28056–28069.

50. Jiang P, Liu Y, Ma H-C, Paul AV, Wimmer E. 2014. Picornavirus morphogenesis.

Microbiol Mol Biol Rev MMBR 78:418–437.

51. Liu Y, Sheng J, Fokine A, Meng G, Shin W-H, Long F, Kuhn RJ, Kihara D,

Rossmann MG. 2015. Structure and inhibition of EV-D68, a virus that causes

respiratory illness in children. Science 347:71–74.

127

52. Wolthers KC, Susi P, Jochmans D, Koskinen J, Landt O, Sanchez N, Palm K, Neyts

J, Butcher SJ. 2019. Progress in human picornavirus research: New findings from

the AIROPico consortium. Antiviral Res 161:100–107.

53. Fricks CE, Hogle JM. 1990. Cell-induced conformational change in poliovirus:

externalization of the amino terminus of VP1 is responsible for liposome binding. J

Virol 64:1934–1945.

54. de Sena J, Mandel B. 1977. Studies on the in vitro uncoating of poliovirus II.

Characteristics of the membrane-modified particle. Virology 78:554–566.

55. Crowell RL, Philipson L. 1971. Specific Alterations of Coxsackievirus B3 Eluted

from Hela Cells 1. J Virol 8:509–515.

56. Baggen J, Thibaut HJ, Strating JRPM, van Kuppeveld FJM. 2018. The life cycle of

non-polio enteroviruses and how to target it. Nat Rev Microbiol 16:368–381.

57. Curry S, Fry E, Blakemore W, Abu-Ghazaleh R, Jackson T, King A, Lea S,

Newman J, Stuart D. 1997. Dissecting the roles of VP0 cleavage and RNA

packaging in picornavirus capsid stabilization: the structure of empty capsids of

foot-and-mouth disease virus. J Virol 71:9743–9752.

58. Richards AL, Jackson WT. 2012. Intracellular Vesicle Acidification Promotes

Maturation of Infectious Poliovirus Particles. PLoS Pathog 8:e1003046.

128

59. Zhang Y-X, Huang Y-M, Li Q-J, Li X-Y, Zhou Y-D, Guo F, Zhou J-M, Cen S.

2017. A highly conserved amino acid in VP1 regulates maturation of enterovirus 71.

PLoS Pathog 13.

60. Feng Z, Hensley L, McKnight KL, Hu F, Madden V, Ping L, Jeong S-H, Walker C,

Lanford RE, Lemon SM. 2013. A pathogenic picornavirus acquires an envelope by

hijacking cellular membranes. Nature 496:367–371.

61. Sin J, McIntyre L, Stotland A, Feuer R, Gottlieb RA. 2017. Coxsackievirus B

Escapes the Infected Cell in Ejected Mitophagosomes. J Virol 91.

62. Kräusslich HG, Nicklin MJ, Toyoda H, Etchison D, Wimmer E. 1987. Poliovirus

proteinase 2A induces cleavage of eucaryotic initiation factor 4F polypeptide p220.

J Virol 61:2711–2718.

63. Urzainqui A, Carrasco L. 1989. Degradation of cellular proteins during poliovirus

infection: studies by two-dimensional gel electrophoresis. J Virol 63:4729–4735.

64. Park N, Skern T, Gustin KE. 2010. Specific cleavage of the nuclear pore complex

protein Nup62 by a viral protease. J Biol Chem 285:28796–28805.

65. Dial CN, Tate PM, Kicmal TM, Mounce BC. 2019. Coxsackievirus B3 Responds to

Polyamine Depletion via Enhancement of 2A and 3C Protease Activity. Viruses 11.

66. Aldabe R, Barco A, Carrasco L. 1996. Membrane permeabilization by poliovirus

proteins 2B and 2BC. J Biol Chem 271:23134–23137.

129

67. Taylor MP, Kirkegaard K. 2007. Modification of Cellular Autophagy Protein LC3

by Poliovirus. J Virol 81:12543–12553.

68. Li Z, Zou Z, Jiang Z, Huang X, Liu Q. 2019. Biological Function and Application

of Picornaviral 2B Protein: A New Target for Antiviral Drug Development. Viruses

11.

69. Madan V, Castelló A, Carrasco L. 2008. Viroporins from RNA viruses induce

caspase-dependent apoptosis. Cell Microbiol 10:437–451.

70. Xia H, Wang P, Wang G-C, Yang J, Sun X, Wu W, Qiu Y, Shu T, Zhao X, Yin L,

Qin C-F, Hu Y, Zhou X. 2015. Human Enterovirus Nonstructural Protein

2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA

Chaperone. PLoS Pathog 11.

71. Belov GA, Feng Q, Nikovics K, Jackson CL, Ehrenfeld E. 2008. A critical role of a

cellular membrane traffic protein in poliovirus RNA replication. PLoS Pathog

4:e1000216.

72. Choe SS, Dodd DA, Kirkegaard K. 2005. Inhibition of cellular protein secretion by

picornaviral 3A proteins. Virology 337:18–29.

73. Pathak HB, Oh HS, Goodfellow IG, Arnold JJ, Cameron CE. 2008. Picornavirus

genome replication: roles of precursor proteins and rate-limiting steps in oriI-

dependent VPg uridylylation. J Biol Chem 283:30677–30688.

130

74. Yalamanchili P, Datta U, Dasgupta A. 1997. Inhibition of host cell transcription by

poliovirus: cleavage of transcription factor CREB by poliovirus-encoded protease

3Cpro. J Virol 71:1220–1226.

75. Farag NH, Wadood MZ, Safdar RM, Ahmed N, Hamdi S, Tangermann RH,

Ehrhardt D. 2015. Progress towards poliomyelitis eradication: Pakistan, January

2014– September 2015. Wkly Epidemiol Rec 8.

76. Yalamanchili P, Harris K, Wimmer E, Dasgupta A. 1996. Inhibition of basal

transcription by poliovirus: a virus- encoded protease (3Cpro) inhibits formation of

TBP-TATA box complex in vitro. J Virol 70:2922–2929.

77. Liu T, Li X, Wu M, Qin L, Chen H, Qian P. 2019. Seneca Valley Virus 2C and

3Cpro Induce Apoptosis via Mitochondrion-Mediated Intrinsic Pathway. Front

Microbiol 10:1202.

78. Calandria C, Irurzun A, Barco A, Carrasco L. 2004. Individual expression of

poliovirus 2Apro and 3Cpro induces activation of caspase-3 and PARP cleavage in

HeLa cells. Virus Res 104:39–49.

79. Walker E, Jensen L, Croft S, Wei K, Fulcher AJ, Jans DA, Ghildyal R. 2016.

Rhinovirus 16 2A Protease Affects Nuclear Localization of 3CD during Infection. J

Virol 90:11032–11042.

80. Blomqvist S, Savolainen C, Råman L, Roivainen M, Hovi T. 2002. Human

Rhinovirus 87 and Enterovirus 68 Represent a Unique Serotype with Rhinovirus

and Enterovirus Features. J Clin Microbiol 40:4218–4223.

131

81. Khetsuriani N, Lamonte-Fowlkes A, Oberst S, Pallansch MA, Centers for Disease

Control and Prevention. 2006. Enterovirus surveillance--United States, 1970-2005.

Morb Mortal Wkly Rep Surveill Summ Wash DC 2002 55:1–20.

82. Oermann CM, Schuster JE, Conners GP, Newland JG, Selvarangan R, Jackson MA.

2015. Enterovirus D68. A Focused Review and Clinical Highlights from the 2014

U.S. Outbreak. Ann Am Thorac Soc 12:775–781.

83. Hixon AM, Frost J, Rudy MJ, Messacar K, Clarke P, Tyler KL. 2019.

Understanding Enterovirus D68-Induced Neurologic Disease: A Basic Science

Review. Viruses 11.

84. Messacar K, Schreiner TL, Haren KV, Yang M, Glaser CA, Tyler KL, Dominguez

SR. 2016. Acute flaccid myelitis: A clinical review of US cases 2012–2015. Ann

Neurol 80:326–338.

85. Hixon AM, Clarke P, Tyler KL. 2019. Contemporary Circulating Enterovirus D68

Strains Infect and Undergo Retrograde Axonal Transport in Spinal Motor Neurons

Independent of Sialic Acid. J Virol 93.

86. Wei W, Guo H, Chang J, Yu Y, Liu G, Zhang N, Willard SH, Zheng S, Yu X-F.

2016. ICAM-5/Telencephalin Is a Functional Entry Receptor for Enterovirus D68.

Cell Host Microbe 20:631–641.

87. Hixon AM, Yu G, Leser JS, Yagi S, Clarke P, Chiu CY, Tyler KL. 2017. A mouse

model of paralytic myelitis caused by enterovirus D68. PLoS Pathog 13.

132

88. Messacar K, Asturias EJ, Hixon AM, Van Leer-Buter C, Niesters HGM, Tyler KL,

Abzug MJ, Dominguez SR. 2018. Enterovirus D68 and acute flaccid myelitis—

evaluating the evidence for causality. Lancet Infect Dis 18:e239–e247.

89. Liu Y, Sheng J, Baggen J, Meng G, Xiao C, Thibaut HJ, van Kuppeveld FJM,

Rossmann MG. 2015. Sialic acid-dependent cell entry of human enterovirus D68.

Nat Commun 6.

90. Diep J, Ooi YS, Wilkinson AW, Peters CE, Foy E, Johnson JR, Zengel J, Ding S,

Weng K-F, Laufman O, Jang G, Xu J, Young T, Verschueren E, Kobluk KJ, Elias

JE, Sarnow P, Greenberg HB, Hüttenhain R, Nagamine CM, Andino R, Krogan NJ,

Gozani O, Carette JE. 2019. Enterovirus pathogenesis requires the host

methyltransferase SETD3. Nat Microbiol.

91. Xiang Z, Liu L, Lei X, Zhou Z, He B, Wang J. 2016. 3C Protease of Enterovirus

D68 Inhibits Cellular Defense Mediated by Interferon Regulatory Factor 7. J Virol

90:1613–1621.

92. Dales S, Eggers HJ, Tamm I, Palade GE. 1965. Electron microscopic study of the

formation of poliovirus. Virology 26:379–389.

93. Klionsky DJ. 2008. Autophagy revisited: A conversation with Christian de Duve.

Autophagy 4:740–743.

94. Suhy DA, Giddings TH, Kirkegaard K. 2000. Remodeling the Endoplasmic

Reticulum by Poliovirus Infection and by Individual Viral Proteins: an Autophagy-

Like Origin for Virus-Induced Vesicles. J Virol 74:8953–8965.

133

95. Jackson WT, Giddings TH, Taylor MP, Mulinyawe S, Rabinovitch M, Kopito RR,

Kirkegaard K. 2005. Subversion of cellular autophagosomal machinery by RNA

viruses. PLoS Biol 3:e156.

96. Klein KA, Jackson WT. 2011. Picornavirus Subversion of the Autophagy Pathway.

Viruses 3:1549–1561.

97. Lai J, Sam I-C, Verlhac P, Baguet J, Eskelinen E-L, Faure M, Chan Y. 2017. 2BC

Non-Structural Protein of Enterovirus A71 Interacts with SNARE Proteins to

Trigger Autolysosome Formation. Viruses 9:169.

98. Feuer R, Mena I, Pagarigan R, Slifka MK, Whitton JL. 2002. Cell Cycle Status

Affects Coxsackievirus Replication, Persistence, and Reactivation In Vitro. J Virol

76:4430–4440.

99. Maynell LA, Kirkegaard K, Klymkowsky MW. 1992. Inhibition of poliovirus RNA

synthesis by brefeldin A. J Virol 66:1985–1994.

100. Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, Habermann A,

Griffiths G, Ktistakis NT. 2008. Autophagosome formation from membrane

compartments enriched in phosphatidylinositol 3-phosphate and dynamically

connected to the endoplasmic reticulum. J Cell Biol 182:685–701.

101. Zhang L, Yu J, Pan H, Hu P, Hao Y, Cai W, Zhu H, Yu AD, Xie X, Ma D, Yuan J.

2007. Small molecule regulators of autophagy identified by an image-based high-

throughput screen. Proc Natl Acad Sci U S A 104:19023–19028.

134

102. Shi J, Wong J, Piesik P, Fung G, Zhang J, Jagdeo J, Li X, Jan E, Luo H. 2013.

Cleavage of sequestosome 1/p62 by an enteroviral protease results in disrupted

selective autophagy and impaired NFKB signaling. Autophagy 9:1591–1603.

103. Mostoslavsky G, Fabian AJ, Rooney S, Alt FW, Mulligan RC. 2006. Complete

correction of murine Artemis immunodeficiency by lentiviral vector-mediated gene

transfer. Proc Natl Acad Sci U S A 103:16406–16411.

104. Corona AK, Saulsbery HM, Corona Velazquez AF, Jackson WT. 2018.

Enteroviruses Remodel Autophagic Trafficking through Regulation of Host SNARE

Proteins to Promote Virus Replication and Cell Exit. Cell Rep 22:3304–3314.

105. Esposito S, Bosis S, Niesters H, Principi N. 2015. Enterovirus D68 Infection.

Viruses 7:6043–6050.

106. Schieble JH, Fox VL, Lennette EH. 1967. A probable new human picornavirus

associated with respiratory diseases. Am J Epidemiol 85:297–310.

107. Midgley CM, Watson JT, Nix WA, Curns AT, Rogers SL, Brown BA, Conover C,

Dominguez SR, Feikin DR, Gray S, Hassan F, Hoferka S, Jackson MA, Johnson D,

Leshem E, Miller L, Nichols JB, Nyquist A-C, Obringer E, Patel A, Patel M, Rha B,

Schneider E, Schuster JE, Selvarangan R, Seward JF, Turabelidze G, Oberste MS,

Pallansch MA, Gerber SI. 2015. Severe respiratory illness associated with a

nationwide outbreak of enterovirus D68 in the USA (2014): a descriptive

epidemiological investigation. Lancet Respir Med 3:879–887.

135

108. Wang G, Zhuge J, Huang W, Nolan SM, Gilrane VL, Yin C, Dimitrova N, Fallon

JT. 2017. Enterovirus D68 Subclade B3 Strain Circulating and Causing an Outbreak

in the United States in 2016. Sci Rep 7:1242.

109. Oberste MS. 2004. Enterovirus 68 is associated with respiratory illness and shares

biological features with both the enteroviruses and the rhinoviruses. J Gen Virol

85:2577–2584.

110. Aliabadi N, Messacar K, Pastula DM, Robinson CC, Leshem E, Sejvar JJ, Nix WA,

Oberste MS, Feikin DR, Dominguez SR. 2016. Enterovirus D68 Infection in

Children with Acute Flaccid Myelitis, Colorado, USA, 2014. Emerg Infect Dis

22:1387–1394.

111. Messacar K, Schreiner TL, Maloney JA, Wallace A, Ludke J, Oberste MS, Nix WA,

Robinson CC, Glodé MP, Abzug MJ, Dominguez SR. 2015. A cluster of acute

flaccid paralysis and cranial nerve dysfunction temporally associated with an

outbreak of enterovirus D68 in children in Colorado, USA. Lancet Lond Engl

385:1662–1671.

112. Andersen EW, Kornberg AJ, Freeman JL, Leventer RJ, Ryan MM. 2017. Acute

flaccid myelitis in childhood: a retrospective cohort study. Eur J Neurol 24:1077–

1083.

113. Oster I, Horneff G, Stücklin A, Müller K. 2017. Acute Flaccid Myelitis (AFM)

Associated with Enterovirus: A Distinct Clinical Entity?, p. OP25. In

Neuropediatrics. Georg Thieme Verlag KG.

136

114. Autophagy at the Cell, Tissue and Organismal Level | Eleftherios Karanasios |

Springer.

115. Nakatogawa H. 2013. Two ubiquitin-like conjugation systems that mediate

membrane formation during autophagy. Essays Biochem 55:39–50.

116. Landajuela A, Hervás JH, Antón Z, Montes LR, Gil D, Valle M, Rodriguez JF,

Goñi FM, Alonso A. 2016. Lipid Geometry and Bilayer Curvature Modulate

LC3/GABARAP-Mediated Model Autophagosomal Elongation. Biophys J

110:411–422.

117. Seglen PO. 2008. Where endocytosis and autophagy meet: The amphisome., p. 61–

100. In Hepatic Endocytosis. Transworld Research Network, Trivandrum, India.

118. Ni H-M, Bockus A, Wozniak AL, Jones K, Weinman S, Yin X-M, Ding W-X.

2011. Dissecting the dynamic turnover of GFP-LC3 in the autolysosome.

Autophagy 7:188–204.

119. Wang Y, Li L, Hou C, Lai Y, Long J, Liu J, Zhong Q, Diao J. 2016. SNARE-

mediated membrane fusion in autophagy. Semin Cell Dev Biol 60:97–104.

120. Rizo J. 2003. SNARE function revisited. Nat Struct Biol 10:417–419.

121. Diao J, Liu R, Rong Y, Zhao M, Zhang J, Lai Y, Zhou Q, Wilz LM, Li J, Vivona S,

Pfuetzner RA, Brunger AT, Zhong Q. 2015. ATG14 promotes membrane tethering

and fusion of autophagosomes to endolysosomes. Nature 520:563–566.

137

122. Kloepper TH, Kienle CN, Fasshauer D. 2007. An elaborate classification of SNARE

proteins sheds light on the conservation of the eukaryotic endomembrane system.

Mol Biol Cell 18:3463–3471.

123. Lai JKF, Sam I-C, Verlhac P, Baguet J, Eskelinen E-L, Faure M, Chan YF. 2017.

2BC Non-Structural Protein of Enterovirus A71 Interacts with SNARE Proteins to

Trigger Autolysosome Formation. Viruses 9.

124. Jackson WT. 2014. Poliovirus-induced changes in cellular membranes throughout

infection. Curr Opin Virol 9:67–73.

125. Shi J, Luo H. 2012. Interplay between the cellular autophagy machinery and

positive-stranded RNA viruses. Acta Biochim Biophys Sin 44:375–384.

126. Alirezaei M, Flynn CT, Wood MR, Harkins S, Whitton JL. 2015. Coxsackievirus

can exploit LC3 in both autophagy-dependent and -independent manners in vivo.

Autophagy 11:1389–1407.

127. Shi J, Fung G, Piesik P, Zhang J, Luo H. 2014. Dominant-negative function of the

C-terminal fragments of NBR1 and SQSTM1 generated during enteroviral infection.

Cell Death Differ 21:1432.

128. Wong J, Zhang J, Si X, Gao G, Mao I, McManus BM, Luo H. 2008.

Autophagosome Supports Coxsackievirus B3 Replication in Host Cells. J Virol

82:9143–9153.

138

129. Yamamoto A, Tagawa Y, Yoshimori T, Moriyama Y, Masaki R, Tashiro Y. 1998.

Bafilomycin A1 Prevents Maturation of Autophagic Vacuoles by Inhibiting Fusion

between Autophagosomes and Lysosomes in Rat Hepatoma Cell Line, H-4-II-E

Cells. Cell Struct Funct 23:33–42.

130. Belov GA, Nair V, Hansen BT, Hoyt FH, Fischer ER, Ehrenfeld E. 2012. Complex

dynamic development of poliovirus membranous replication complexes. J Virol

86:302–312.

131. Yu HB, Kielczewska A, Rozek A, Takenaka S, Li Y, Thorson L, Hancock REW,

Guarna MM, North JR, Foster LJ, Donini O, Finlay BB. 2009. Sequestosome-1/p62

is the key intracellular target of innate defense regulator peptide. J Biol Chem

284:36007–36011.

132. Quiner CA, Jackson WT. 2010. Fragmentation of the Golgi apparatus provides

replication membranes for human rhinovirus 1A. Virology 407:185–195.

133. Scales SJ, Chen YA, Yoo BY, Patel SM, Doung Y-C, Scheller RH. 2000. SNAREs

contribute to the specificity of membrane fusion. Neuron 26:457–464.

134. Chen Y, Meng D, Wang H, Sun R, Wang D, Wang S, Fan J, Zhao Y, Wang J, Yang

S, Huai C, Song X, Qin R, Xu T, Yun D, Hu L, Yang J, Zhang X, Chen H, Chen J,

Chen H, Lu D. 2015. VAMP8 facilitates cellular proliferation and temozolomide

resistance in human glioma cells. Neuro-Oncol 17:407–418.

135. Robinson SM, Tsueng G, Sin J, Mangale V, Rahawi S, McIntyre LL, Williams W,

Kha N, Cruz C, Hancock BM, Nguyen DP, Sayen MR, Hilton BJ, Doran KS, Segall

139

AM, Wolkowicz R, Cornell CT, Whitton JL, Gottlieb RA, Feuer R. 2014.

Coxsackievirus B exits the host cell in shed microvesicles displaying

autophagosomal markers. PLoS Pathog 10:e1004045.

136. Mohamud Y, Shi J, Qu J, Poon T, Xue YC, Deng H, Zhang J, Luo H. 2018.

Enteroviral Infection Inhibits Autophagic Flux via Disruption of the SNARE

Complex to Enhance Viral Replication. Cell Rep 22:3292–3303.

137. Münster-Wandowski A, Heilmann H, Bolduan F, Trimbuch T, Yanagawa Y, Vida I.

2017. Distinct Localization of SNAP47 Protein in GABAergic and Glutamatergic

Neurons in the Mouse and the Rat Hippocampus. Front Neuroanat 11.

138. Fukuda M. 2016. Multiple Roles of VARP in Endosomal Trafficking: Rabs,

Retromer Components and R-SNARE VAMP7 Meet on VARP. Traffic Cph Den

17:709–719.

139. Aoyagi K, Ohara-Imaizumi M, Itakura M, Torii S, Akimoto Y, Nishiwaki C,

Nakamichi Y, Kishimoto T, Kawakami H, Harada A, Takahashi M, Nagamatsu S.

2016. VAMP7 Regulates Autophagy to Maintain Mitochondrial Homeostasis and to

Control Insulin Secretion in Pancreatic β-Cells. Diabetes 65:1648–1659.

140. Gao J, Reggiori F, Ungermann C. 2018. A novel in vitro assay reveals SNARE

topology and the role of Ykt6 in autophagosome fusion with vacuoles. J Cell Biol

jcb.201804039.

140

141. Takáts S, Glatz G, Szenci G, Boda A, Horváth GV, Hegedűs K, Kovács AL, Juhász

G. 2018. Non-canonical role of the SNARE protein Ykt6 in autophagosome-

lysosome fusion. PLoS Genet 14.

142. Hamasaki M, Furuta N, Matsuda A, Nezu A, Yamamoto A, Fujita N, Oomori H,

Noda T, Haraguchi T, Hiraoka Y, Amano A, Yoshimori T. 2013. Autophagosomes

form at ER–mitochondria contact sites. Nature 495:389–393.

143. Teng FYH, Wang Y, Tang BL. 2001. The syntaxins. Genome Biol 2:reviews3012–

144. Hyttinen JMT, Niittykoski M, Salminen A, Kaarniranta K. 2013. Maturation of

autophagosomes and endosomes: A key role for Rab7. Biochim Biophys Acta BBA

- Mol Cell Res 1833:503–510.

145. Fader CM, Sánchez D, Furlán M, Colombo MI. 2008. Induction of Autophagy

Promotes Fusion of Multivesicular Bodies with Autophagic Vacuoles in K562

Cells. Traffic 9:230–250.

146. Cheng X-T, Zhou B, Lin M-Y, Cai Q, Sheng Z-H. 2015. Axonal autophagosomes

recruit dynein for retrograde transport through fusion with late endosomes. J Cell

Biol 209:377–386.

147. Holm-Hansen CC, Midgley SE, Fischer TK. 2016. Global emergence of enterovirus

D68: a systematic review. Lancet Infect Dis 16:e64–e75.

141

148. Chen Y-H, Du W, Hagemeijer MC, Takvorian PM, Pau C, Cali A, Brantner CA,

Stempinski ES, Connelly PS, Ma H-C, Jiang P, Wimmer E, Altan-Bonnet G, Altan-

Bonnet N. 2015. Phosphatidylserine Vesicles Enable Efficient En Bloc

Transmission of Enteroviruses. Cell 160:619–630.

149. Schuh AL, Audhya A. 2014. The ESCRT machinery: From the plasma membrane to

endosomes and back again. Crit Rev Biochem Mol Biol 49:242–261.

142