Inventarizace Molekulární Biodiverzity Vybraných Druhů Ryb Čeledi Cyprinidae a Umbridae

MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV EXPERIMENTÁLNÍ BIOLOGIE

Inventarizace molekulární biodiverzity vybraných druhů ryb čeledi Cyprinidae a Umbridae

Disertační práce

Soňa Stierandová

Školitel: Mgr. Jan Mendel, Ph.D. Brno 2015

Bibliografický záznam

Autor: Mgr. Soňa Stierandová Přírodovědecká fakulta, Masarykova univerzita Ústav experimentální biologie

Inventarizace molekulární biodiverzity Název práce: vybraných druhů ryb čeledi Cyprinidae a Umbridae

Studijní program: Biologie

Studijní obor: Obecná a molekulární genetika

Mgr. Jan Mendel, Ph.D. Vedoucí práce: Ústav biologie obratlovců AV ČR, v.v.i

Akademický rok: 2015/2016

Počet stran: 97

Klíčová slova: barcoding, cytochrom b, čeleď Cyprinidae, čeleď Umbridae, fylogeografie, genetická diverzita, inventarizace, mikrosatelity, mtDNA, ochranářská genetika, rod Alburnoides, sekvenování

Bibliographic Entry

Author: Mgr. Soňa Stierandová Faculty of Science, Masaryk University Department of Experimental Biology

Molecular biodiversity inventory of selected Title of Thesis: fish species from families Cyprinidae and Umbridae Degree Biology Programme:

Field of Study: General and Molecular Genetics Mgr. Jan Mendel, Ph.D. Supervisor: Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, v.v.i Academic Year: 2015/2016

Number of Pages: 97

Keywords: barcoding, consevation genetics, cytochrome b, family Cyprinidae, family Umbridae, phylogeography, genetic diversity, genus Alburnoides, inventory, microsatellites, mtDNA, sequencing

Abstrakt

Doktorská práce se zabývá inventarizací molekulární diverzity vybraných taxonů dvou čeledí Cyprinidae a Umbridae na národní i evropské úrovni. Spojovacími prvky jsou rozsáhlá molekulárně-genetická analýza zahrnující analýzy jaderných i mitochondriálních markerů a vývoj mikrosatelitových lokusů. Práce je tematicky složená ze čtyř volně navazujících částí.

Inventarizace biodiverzity ichtyofauny ČR byla založena na sekvenační analýze mitochondriálního a jaderného markeru. Projekt byl zpracován pod záštitou iniciativy Barcode of Life metodou „DNA barcoding“ a významně rozšířil mezinárodní databázi BoLD. Poskytl důležité informace pro monitorovací systém NATURA 2000 i novou druhovou kolekci pro Národní muzeum ČR.

Fylogeografická studie vybraných druhů rodu Alburnoides odhalila 17 evropsko-asijských linií. Byl nalezen vhodný linijně-identifikační klíč složený z analýzy mitochondriálního markeru a indelové diagnostiky dvou jaderných genů. Byla potvrzena druhová podhodnocenost tohoto rodu. Byla podpořena validita 11 morfologicky uznaných druhů a čtyři nové linie byly předloženy jako „species-in-waiting“. Pro nominotypický druh Alburnoides bipunctatus s. stricto byl vymezen nový distribuční areál.

Pro populační studie rodu Alburnoides byla připravena nová knihovna polymorfních mikrosatelitových lokusů. Použitelnost těchto lokusů byla testována při cross-species amplifikacích zástupců rodu Alburnoides a dalších čtyř ohrožených cyprinidů. Při rozlišování vybraných druhů ouklejky se některé testované mikrosatelity projevily jako diagnostické.

Konstrukcí knihovny nových STR lokusů pro blatňáka tmavého jsme se významně podíleli na doplnění malého již publikovaného mikrosatelitového setu. Tyto mikrosatelitové lokusy jsou použitelné pro budoucí repatriační a populační studie na českém a evropském území.

Abstract

The doctoral thesis is focused on molecular biodiversity inventory of selected fish species from two families, Cyprinidae and Umbridae. Linking elements are extensive molecular- genetic analysis concluding testing of nuclear and mitochondrial markers and testing of microsatellite loci. This thesis is thematically composed of four freely follow-up parts.

The biodiversity inventory of ichthyofauna of the Czech Republic was based on analyses of the mitochondrial and nuclear markers. The project was processed under the auspices of the initiative Barcode of Life by method “DNA barcoding” and widened the database BoLD. This project also contributed to the monitoring system NATURA 2000 and for National Museum.

Phylogeographical study of selected species of the genus Alburnoides revealed 17 Eurasian lineages. A good lineage-identification key composed of mitochondrial marker and indel diagnostics of nuclear genes was determined. Species underestimation within this genus was confirmed. The validity of 11 morphological valid species of genus Alburnoides was supported. Four lineages are considered as “species-in-waiting”. A new distribution area was determined for nominotypical species Alburnoides bipunctatus s. stricto.

The new microsatellite library of polymorphic microsatellite loci for population studies was constructed. Usability of the loci was tested in the cross-species amplifications with individuals of genus Alburnoides and another four endangered cyprinids. Chosen species of spirlin are recognisable by using some microsatellites which were proved as diagnostic.

We constructed the library of STR loci from the genome of European mudminnow and enriched the published small set of microsatellite loci. These microsatellites will be possible to use for repatriation and population studies in the Czech Republic and also widely in Europe.

Poděkování Na tomto místě bych ráda poděkovala svému školiteli Mgr. Janu Mendelovi, Ph.D. za jeho ochotu a možnost získat rozsáhlé laboratorní dovednosti a životní zkušenosti. Nemalý dík patří Mgr. Blance Urbánkové za pomoc při formálním zpracování disertační práce. Manželovi a rodině za jejich morální podporu, cenné rady a optimismus.

OBSAH

1 ÚVOD 10 2 SOUČASNÝ STAV ŘEŠENÉ PROBLEMATIKY 11 2.1 Inventarizace ichtyofauny a DNA barcoding iniciativa 11 2.2 Taxonomický status vybraných druhů/poddruhů rodu Alburnoides v evropsko-asijském kontextu 12 2.3 Mikrosatelitové lokusy pro druhy rodu Alburnoides a Umbrides 14 3 CÍLE PRÁCE 15 4 MATERIÁL A METODIKA 16 4.1 Použitý materiál 16 4.1.1 Sběr vzorků vybraných druhů ichtyofauny ČR 16 4.1.2 Sběr vzorků rodu Alburnoides 17 4.1.3 Příprava a testování knihovny mikrosatelitů ouklejky pruhované a blatňáka tmavého 17 4.2 Analýza a hodnocení vnitrodruhové diverzity 17 4.2.1 Využití jaderného markeru 18 4.2.2 Využití mitochondriálního markeru 18 4.2.3 Využití mikrosatelitových lokusů 19 4.3 Použitá metodika 19 4.3.1 Metoda přímého sekvenování obecně 19 4.3.2 Metody použité při inventarizaci ichtyofauny ČR 20 4.3.3 Metody použité při inventarizaci evropských druhů rodu Alburnoides 20 4.3.4 Analýza mikrosatelitových lokusů obecně 21 4.3.5 Příprava knihovny mikrosatelitů 21 4.3.6 Zaklonování DNA řetězců heterozygotních jedinců u jaderných markerů 22 4.4 Použité statistické nástroje 23 4.4.1 Statistické nástroje použité při inventarizaci ichtyofauny ČR 23

4.4.2 Statistické nástroje pro vyhodnocení fylogeneze evropských ouklejek 23 4.4.3 Vyhodnocovací nástroje použité při přípravě mikrosatelitové knihovny 24 5 VÝSLEDKY 25 5.1 Inventarizace ichtyofauny České republiky 25 5.2 Fylogeneze a taxonomický status evropských ouklejek rodu Alburnoides 26 5.3 Mikrosatelitové lokusy využitelné pro studium ouklejky pruhované a dalších kriticky ohrožených cyprinidů 27 5.4 Mikrosatelitové lokusy pro populační studii rodu Umbra na území České republiky – nepublikovaný výsledek 27 6 DISKUZE 29 6.1 Inventarizace ichtyofauny České republiky 29 6.2 Taxonomický status evropských druhů rodu Alburnoides 30 6.3 Mikrosatelitové lokusy využitelné pro studium populací ouklejky pruhované a dalších cyprinidů 32 6.4 Mikrosatelitové lokusy využitelné pro repatriační program blatňáka tmavého 33 7 SHRNUTÍ 35 8 SEZNAM LITERATURY 37 9 SEZNAM ZKRATEK 42 10 PŘÍLOHY 44 Příloha I 44 Příloha II 73 Příloha III 86

1 ÚVOD

Genetická diverzita je jedním ze znaků všech živých organismů. Tento proces je přirozenou protiváhou neustále se měnícímu životnímu prostředí. Genetická variabilita se tak stává zásadním faktorem pro adaptaci a přežití organismů. Zástupci ryb jsou vázáni k vodním zdrojům. Nemohou se volně pohybovat napříč územími, jsou tedy limitováni koryty řek, jezery, tůněmi. Během prehistorického vývoje docházelo k oddělování či spojování vodních ploch. Tyto procesy probíhají kontinuálně. Důsledkem lidské činnosti a s nástupem umělé regulace vodních toků vzniká nový činitel působící na obyvatele vodní říše. Tyto a další faktory jsou nedílnou součástí vývoje prostředí a působí jak pozitivně tak i negativně na genofond populací. Je proto snahou vědců a výzkumných týmů zjistit, jaké zákonitosti platí a pokusit se zachytit co největší množství této variability. Získané informace slouží při záchranných projektech a udržování populací. Při populačních výzkumech se využívají metodické přístupy jako sekvenace jaderných a mitochondriálních markerů nebo fragmentační analýza. Sekvenační analýza se uplatňuje při fylogenetických a fylogeografických studiích, při mapování aktuální diverzity na úrovni druhů, rodů, atd. Zatímco fragmentační analýza se používá při pozorování populací a příbuzenských vztahů uvnitř. Tato metoda vychází z vyšší mutační četnosti mikrosatelitů ve srovnání s bodovými mutacemi u jaderných či mitochondriálních markerů. Ochranářské aktivity se realizují jak na lokální tak i na celosvětové úrovni. Dobrými příklady mohou být iniciativy NATURA 2000, která se snaží o periodický monitoring a ochranu lokálních biotopů a populací nebo také iniciativa iBOL (International Barcode of Life project) sdružující největší databázi genetické diverzity na světě. Udržování a zachování biodiverzity je klíčovou spojnicí všech níže popsaných a vypracovaných studií. Navazuje tak na celosvětový trend v oblasti poznávání životního prostředí a jeho flóry a fauny.

2 SOUČASNÝ STAV ŘEŠENÉ PROBLEMATIKY

2.1 Inventarizace ichtyofauny a DNA barcoding iniciativa

Studium a rozpoznávání genetické diverzity v České republice má dvacetiletou historii. Díky rozvoji molekulárně-genetických metod dochází k přesnějšímu mapování genetické diverzity na úrovni populací (Lusk a Hanel, 2008). Znalost současné ichtyofauny ČR je neustále prohlubována a zpřesňována. Naší vědeckou skupinou bylo v posledních 10 letech realizováno na Ústavu biologie obratlovců několik ichtyologických projektů, např. „Genetická diverzita ohrožených druhů ryb – nezbytný základ efektivní ochrany biodiverzity“, jehož vybrané výsledky byly prezentovány v „Modrém sešitě“ s názvem „Biodiverzita ichtyofauny České republiky (VII)“. V letech 2009 - 2011 realizoval rozsáhlý mezinárodní projekt s názvem „Inventarizace molekulární biodiverzity ichtyofauny České republiky“, který je součástí celosvětové, stále probíhající, iniciativy „Fish-BOL. Tato iniciativa si klade za cíl poznat a zmapovat diverzitu ryb na zeměkouli s využitím nové taxonomické metody „DNA barcoding“. Výsledky mapování biodiverzity připojených států a regionů jsou odesílány do volně přístupné databáze BoLD (Barcode of Life Database), jež je konstruována jako platforma pro ukládání, porovnávání a publikování záznamů „DNA čárových kódů“. Stejně jako unikátní čárové kódy identifikují například zboží, tak i DNA barkódy jsou založeny na standardizované metodě mapování jediného genu napříč všemi druhy ryb na Zemi (Hebert et al., 2003). Tímto genem byla nejen u ryb zvolena první podjednotka genu pro cytochrom c oxidázu (COI) díky své relativně krátké délce 650 bp, snadné PCR amplifikaci (malý set používaných primerů), přepisu do proteinového řetězce a jako součást dýchacího řetězce tak existuje i u fyziologicky vzdálených taxonů. Na konci roku 2015 je v databázi BoLD k dispozici přes 4,5 milionů barkódů napříč všemi živými organismy; v databázi Fish-BOL se pak nachází více než 110 000 barkódů. Kompletní barkódovací studie pochází z Kanady, dalšími zeměmi jsou Austrálie, Japonsko, Mexiko, Severní Amerika. Z evropských zemí se k České republice připojují s dokončenými projekty Velká Británie, Portugalsko, Německo.

2.2 Taxonomický status vybraných druhů/poddruhů rodu Alburnoides v evropsko-asijském kontextu

Nejprve je nutné se zmínit, jak se v průběhu let mění pohled na chápání druhů. Existuje několik obecně uznávaných konceptů, které se snaží definovat pojem druh, ale i v této oblasti dochází k vývoji a změnám.

Před vznikem publikace European freshwater fishes (Kottelat, 1997) se hojně používalo členění na druh a podruh. Tento heuristický seznam sladkovodních ryb Evropy se odkazuje na vymezení druhu podle fylogenetického druhového konceptu (PSC). Ten chápe druh jako soubor jedinců pocházejících ze společného předka, všichni tito jedinci mají unikátní soubor znaků odvozených právě od jejich společného předka.

Alburnoides bipunctatus (Bloch, 1782) byl jediným uznávaným druhem s několika poddruhy - A. bipunctatus rossicus, A. bipunctatus ohridanus, A. bipunctatus var. smyrnaea, A. bipunctatus rossicus natio kubanicus, A. bipunctatus tzanevi, A. bipunctatus strymonicus, A. bipunctatus v[ar]. thessalicus, A. bipunctatus armeniensis.

Navíc Kottelat zvažuje možnost existence oddělených populací v Řecku, ale právě na základě PSC to následně vyvrací.

Podle novější příručky evropských sladkovodních ryb (Handbook of European Freshwater Fishes, Kottelat a Freyhof, 2007) je distribuce rodu Alburnoides (Jeitteles, 1861) patřící do čeledi Cyprinidae (kaprovití) vymezena od Francie po Afganistán. V této příručce autoři popisují druhy na základě evolučního druhového konceptu (ESC), který říká, že druh se vyvíjí izolovaně v průběhu času a prostoru. Autoři také reagují na teorii biologického druhového konceptu (BSC) popisujícího druh jako reprodukčně izolovanou skupinu. Poznamenávají, že determinuje pouze druhy sympatricky se vyskytující, ale není funkční pro druhy žijící v alopatrii, fenoménu tak typickém pro vodní biodiverzitu. V této příručce jsou zaznamenány pouze tři v Evropě se vyskytující ouklejky: Alburnoides bipunctatus (Bloch, 1782) - typová lokalita německá řeka Vesera (Münden) s výskytem ve Francii, Německu, Polsku a České republice, v horním toku Dunaje. Alburnoides ohridanus (Karaman, 1928) - popsán v jezeře Prespa na hranicích Makedonie, Albánie a Řecka. 12

Alburnoides prespensis (Karaman, 1924) – popsán v jezeře Prespa na hranicích Makedonie, Albánie a Řecka. Autoři se však domnívají, že tento počet je podhodnocený a předpokládají na základě předběžných molekulárních studií výskyt nových druhů především na území Černé Hory, Řecka, Bulharska, Krymu a Kavkazu.

V databázi FishBase (Froese a Pauly, 2010) lze nalézt aktuální seznam validních druhů rodu Alburnoides. Tento nyní čítá již 24 validních druhů (11/2015). Níže je uveden přehled pouze těch, které se vyskytují v Evropě nebo jsou geograficky s Evropou propojeny.

Alburnoides bipunctatus (Bloch, 1782) – typová lokalita německá řeka Vesera (Münden) a vyskytuje se ve Francii, Německu, Polsku a České republice, v horním toku Dunaje. Alburnoides fasciatus (Nordman, 1840) – rozšířen na Krymu, v západním Zakavkazí a v úmoří Černého moře v Malé Asii. Alburnoides prespensis (Karaman, 1924) – popsán v jezeře Prespa na hranicích Makedonie, Albánie a Řecka. Alburnoides ohridanus (Karaman, 1928) – popsán v jezeře Ohrid na hranicích Albánie a Makedonie, ve Skadarském jezeře (Černá Hora, Albánie), v Drině. Později publikovali Zardoya a Doadrio (1999) výskyt A. ohridanus v řece Aoos a Talevski et al. (2009) v jezeře Skadar. Alburnoides rossicus (Berg, 1924) – typová lokalita řeka Kama, rozšířen v povodí Dněpru, Dněstru, Bugu, Donu, Kamy a Volhy (Ruchin et al., 2009) a podle Berga (1932) také v povodí Kubanu a Laby. Alburnoides bipunctatus tzanevi (Chichkoff, 1933) – rozšířen ve východním Bulharsku, v povodí Kamčije, Veleky a Rezovy. Alburnoides bipunctatus strymonicus (Chichkoff, 1940) – obývá bulharské řeky Marice, Mesta, Toplitza a Struma (Strymon). Alburnoides eichwaldii (De Filippi, 1863) – žijící v povodí Kury a Araksy, Giljanu, Mazanderánu, v povodí Atreku, Urminy, v řekách jižních svahů Elbrusu, v horním povodí toku Amudarji, Kašdaarji a v Zeravšenu, v Turkménii a jižním Dagestánu. Alburnoides thessalicus (Stephanidis, 1950) – vyskytuje se v povodí řek z území Řecka, Makedonie a Bulharska. Jako typové lokality se uvádí řeky Sperchios a Pinios.

Alburnoides devolli (Bogutskaya, 2010) – obývá řeku Devol (Albánie), která společně s řekou Osum tvoří tok Seman. Alburnoides fangfangae (Bogutskaya, 2010) – popsán v řece Osum. Alburnoides kubanicus (Banarescu, 1964) – rozšířen v povodích řek Kuban a Laba v Rusku. Alburnoides manyasensis (Turan et al., 2013) – popsán v Turecku, v povodí jezera Manyas, v řece Koca a v úmoří Marmarského moře. Alburnoides maculatus (Kessler, 1856) – žijící na Krymském poloostrově (Ukrajina), zaznamenán v řekách Chernaya, Bel’bek, Kacha, Al’ma a Salgir.

2.3 Mikrosatelitové lokusy pro druhy rodu Alburnoides a Umbrides

Čeleď Cyprinidae je jednou z nejpočetnějších skupin ryb, a proto je často středem vědeckého zájmu. Mikrosatelitových lokusů pro tuto skupinu bylo designováno mnoho, ale žádné nebyly získány přímo z genomu ouklejky pruhované. Dostupné jsou mikrosatelitové lokusy z „cross- species“ amplifikací - Vyskočilová et al. (2007) publikovala tyto na čtyřech jedincích ouklejky pruhované z České republiky a Dubut et al. (2010) na 30 jedincích z řeky Durance ve Francii.

Čeleď Umbridae (blatňákovití) stojí na opačné straně, co se týče druhové pestrosti. Zahrnuje tři rody (Dallia, Novoumbra, Umbra) s pěti druhy. V Evropě žije pouze blatňák tmavý (Umbra krameri), který je na seznamu IUNC zapsán jako ohrožený. Do povědomí se dostal především s jeho ubývajícím výskytem a snahou tento druh repatriovat do říčních toků. Existují dvě studie využívající mikrosatelitové lokusy blatňáka při studiu populací z rakouského úseku Dunaje (Winkler a Weiss, 2009) a ze Srbska - povodí Dunaje a Sávy (Marić et al., 2015).

3 CÍLE PRÁCE

- příprava DNA barkódů u osmi druhů čeledi Cyprinidae v národním projektu „Inventarizace molekulární biodiverzity ichtyofauny České republiky“, která je součástí probíhající mezinárodní iniciativy „Fish-BOL,

- na pozadí komplexního přístupu ověřit taxonomický status většiny druhů/poddruhů rodu Alburnoides v euro-asijském kontextu,

- vývoj knihovny mikrosatelitů u dvou druhů – ouklejka pruhovaná (Alburnoides bipunctatus) a blatňák tmavý (Umbra krameri) pro populační a repatriační studie.

4 MATERIÁL A METODIKA

4.1 Materiál

4.1.1 Sběr vzorků vybraných druhů ichtyofauny ČR

Za účelem zmapování genetické biodiverzity ichtyofauny ČR bylo shromážděno 72 druhů z 11 řádů a 17 čeledí. Byly pokryty všechny hlavní distribuční oblasti výskytu a molekulárně- genetickými metodami bylo analyzováno přes 1400 jedinců. Upřesnění lokalit je dále popsáno pouze u osmi druhů, na které je zaměřena tato disertační práce: - cejn perleťový (Ballerus sapa, Pallas 1811): Morava (Lanžhot), - cejn siný (Ballerus ballerus, Linné 1758): Dyje (Kyjovka; Břeclav), - cejn velký (Abramis brama, Linné 1758): Bečva, Blanice, Cidlina, Chrudimka (VN Hamry), Hlohovecký rybník, líheň Šlajza (Kroměříž), Morava (Tvrdonice), Odrava, Ohře (Terezín), Orlice (Hradec Králové), Sázava (Havlíčkův Brod), Svratka (Bystrc; Pouzdřanský rybník), Stará Dyje (Lednice), Štinkovka (Hustopeče), Úpa (Jaroměř), Žehrovka (Žďár), - cejnek malý (Blicca bjoerkna, Linné 1758): Blanice (Milenovice), Cidlina (Vysoké Veselí), Dyje, Lužnice (Holíčky), Morava (Lanžhot; Tvrdonice), Ohře (Cheb; Terezín), Pšovka (Mělník), Stará Dyje (Lanžhot; Lednice), Svratka (Bystrc), - ouklej obecná (Alburnus alburnus, Linné 1758): Doubrava (Dolní Bučice), Dyje (Podhradí), Bečva (Choryně), Hlohovecký rybník, líheň Šlajza (Kroměříž), Lužnice (Halámecký potok; Holíčky), Morava (Kvasice; Tvrdonice), Nová Kyjovka (Lanžhot), Odra (Bernartice), Ohře (Boč; Cheb; Kynšperk nad Ohří; Terezín), Olšava (Kunovice), Orlice (Albrechtice), Pšovka (Mělník), - ouklejka pruhovaná (Alburnoides bipunctatus, Bloch 1782): Bečva (Přerov), Dyje (Podhradí), Morava (Kvasice; Lanžhot), Odra (Bernartice), Svitava (Adamov), Vsetínská Bečva (Bystřička; Valašské Meziříčí), - plotice obecná (Rutilus rutilus, Linné 1758): Bečva (Přerov), Blanice (Milenovice), Doubrava (Dolní Bučice), Dyje (Břeclav; Podhradí; Tasovice), Cidlina (Vysoké Veselá), Chrudimka, Lužnice (Halámecký potok; Holíčky), Jizera (Přepeře), Kyjovka (Stibůrkovská jezera), Morava (Kvasice; Lanžhot), Odra (Bernartice; Dolní Polanka; Rychvaldská stružka; Staré Město), Ohře (Cheb; Kynšperk nad Ohří; Odrava; Terezín), Oskava (Chomoutov), 16

Orlice (Albrechtice), Sázava (Havlíčkův Brod), Stará Dyje (Poštorná), Svratka (Jimramov), Vltava (líheň Mydlovary), - perlín ostrobřichý (Scardinius erythrophthalmus, Linné 1758): Blanice, Cidlina (Vysoké Veselí), Doubrava (Milenovice), Dyje (Štinkovka), Hlohovecký rybník, Chrudimka (VN Hamry), Jizera (Žehrovka; Jordánka), Kyjovka (Stibůrkovská jezera), Lužnice (Halámecký potok; Holíčky), Morava (Hodonín), Odra (Rychvalská stružka), Svratka (Pouzdřanský rybník), Teplá (Bečov nad Teplou).

4.1.2 Sběr vzorků rodu Alburnoides

V průběhu šesti let (2008 - 2013) bylo získáno 343 jedinců ze 117 lokalit z 18 zemí. Byly obsaženy hlavní distribuční oblasti zástupců rodu Alburnoides, tj. souhrnně oblast od Francie až po úmoří Kaspického moře. Přehledová tabulka lokalit je uvedena v Příloze II.

4.1.3 Příprava a testování knihovny mikrosatelitů ouklejky pruhované a blatňáka tmavého

Jedinec pro přípravu knihovny ouklejky pruhované byl získán z lokality Bulhary z povodí Dyje; testovaná populace pocházela z řeky Moravy. Jedinec pro přípravu knihovny blatňáka tmavého pocházel ze Slovenska (Záhoří u Malacek, povodí Dunaje). Spolu s dalšími jedinci z této populace byli dále testováni. Pro posouzení polymorfismu nových lokusů byla přidána ještě populace blatňáka z Chorvatska (lokalita poblíž města Viribitica, povodí Drávy).

4.2 Analýza a hodnocení vnitrodruhové diverzity

Chápání životního prostředí se neustále mění a je modifikováno v návaznosti na získávání nových poznatků a ne jinak tomu je i v případě taxonomie. S rychlým rozvojem molekulárních metod dochází od konce 20. století k častějším změnám v taxonomické klasifikaci.

4.2.1 Využití jaderného markeru

Morfologická charakteristika, důležitý základ identifikace zástupců daných taxonomických kategorií, je čím dál častěji doplňována o identifikaci na základě genetické informace uložené v DNA (deoxyribonukleová kyselina). Jedním z hlavních používaných markerů jsou geny uložené v jaderné DNA (nDNA), které se na potomky přenášejí jak z mateřské, tak otcovské linie. Mohou být zachyceny diagnostické mutace, které napomáhají stanovit vzájemnou příbuznost zkoumaných taxonů. Na jaderné úrovni lze sledovat a účinně oddělit evolučně vzdálenější taxony, rody nebo druhy. Pro fylogenetické studie ryb se nejčastěji používají markery např. RAG1 (recombination activating gene 1) vhodný pro určování vzdálenějších druhů nebo rodů, 1. intron ribozomálního S7 r-proteinu (S7) (López et al., 2004; Perea et al., 2010; Robalo et al., 2006). Marker S7 jakožto i gen pro β-actin byly použity u ryb při odhalování hybridů (Robalo et al., 2006; Sousa-Santos et al., 2006). Existence indelových pozic je další diagnostickou vlastností těchto markerů (Mendel et al., 2008); díky nim lze získat různě dlouhé sekvence pro jednotlivé druhy společně s typickými deletovanými nebo inzertovanými úseky DNA. Velká ribosomální podjednotka (28S), rhodopsin (Rhod) a beta podjednotka genu pro adenosin trifosfát syntázu (atp-B) mohou být dalšími využitelnými markery pro fylogenetické studie ryb (Choleva et al., 2014; etc.).

4.2.2 Využití mitochondriálního markeru

Součástí každé živočišné buňky jsou také ve velkém množství se vyskytující mitochondrie, jejichž součástí je mitochondriální DNA (mtDNA). Na rozdíl od nDNA se mtDNA dědí především po mateřské linii a opravné mechanismy nejsou tak dokonalé - dochází k zařazování chybných nukleotidů, které jsou přenášeny do potomstva. Proto je sledování mitochondriálních genů účinný nástroj při zjišťování vztahů v nižších taxonomických kategoriích.

Z dostupné literatury vyplývá, že nejvhodnějšími jadernými markery pro fylogenetické studie ryb je především gen pro cytochrom b (cyt b) o celkové délce 1140 bp (Tang et al., 2006; Li a Orti, 2007) a dále pak nekódující oblast kontrolní region (Liu et al., 2002; Mendel et al., 2008).

4.2.3 Využití mikrosatelitových lokusů

Díky své vysoké variabilitě, mendelovské kodominantní dědičnosti a relativně jednoduchému a spolehlivému vyhodnocování jsou mikrosatelity jedním z nejčastěji používaných molekulárních markerů. Dříve byly využívány k mapování genomu a diagnostice některých lidských chorob. Své uplatnění však našly i při populačních a ekologických studiích, kde je sledován genový tok, efektivní velikost populací, míra migrace, atd. Důležité jsou také při určování příbuzenských vztahů a paternity stejně jako při studiu vlivů a míry příbuzenského křížení.

4.3 Použitá metodika

4.3.1 Metoda přímého sekvenování obecně

Tento způsob sekvenování je založen na enzymatické Sangerově metodě, která využívá speciální vlastnosti nukleotidů – 2´, 3´dideoxyribonukleotidtrifosfátů. Příslušné nukleotidy (ddATP, ddCTP, ddGTP, ddTTP) na sebe již nemohou vázat další nukleotid, protože místo OH skupiny na svém 3´uhlíku ribózy mají navázán pouze samotný vodík; tím je reakce ukončena. V sekvenační PCR jsou použity jak degenerované nukleotidy tak i normální deoxyribonukleotidtrifosfáty (dATP, dCTP, dGTP, dTTP) v poměru 1:99. Tím vznikají v reakci různě dlouhé oligonukleotidy, protože degenerované nukleotidy se do řetězců zařazují s menší pravděpodobností. Každý degenerovaný nukleotid je označen jinou flourescenční barvou. Vše probíhá v jediné reakci, kdy v kapiláře probíhá elektroforéza, během které jednotlivé fragmenty lišící se o jeden flourescenčně značený nukleotid prochází před CCD kamerou. Ta je schopna flourescenci vyvolanou laserovým paprskem zachytit a program převede emisní maxima do chromatogramu.

4.3.2 Metody použité při inventarizaci ichtyofauny ČR

Vzorky byly podrobeny dvou-genomové srovnávací analýze a jen sekvence mtDNA markeru byly zařazeny do mezinárodní databáze BoLD. Byla použita standardizovaná sekvenační metoda přípravy DNA barkodů (viz Příloha I). Stěžejním diagnostickým markerem byl COI (cytochrom c oxidáza podjednotka I). Pro komplexnost pohledu na českou ichtyofaunu byl navíc zařazen i jaderný marker RP1 (1. intron r-proteinu), díky němuž byla odhalována mimo jiné i míra hybridizace na českém území. Každý jedinec byl opatřen voucherem, který obsahoval délku, váhu, pohlaví, fotodokumentaci, popis lokality (včetně GPS souřadnic), datum sběru, jméno osoby, která jedince identifikovala, katalogové číslo a kde je dokladový materiál uložen. Sekvence COI a sekvence použitých primerů jsou uloženy v mezinárodní databázi BoLD.

4.3.3 Metody použité při inventarizaci evropských druhů rodu Alburnoides

Vzorky byly podrobeny dvou-genomové sekvenační analýze. Byl vybrán jeden mitochondriální marker - gen pro cytochrom b o velikosti 1140 bp a tři jaderné markery: RP1 o délce 1112 bp, RAG1 o délce 1497 bp a β-actin o délce 1062 bp.

Databáze GenBank poskytovala pro gen cyt b sekvence druhů: A. bipunctatus (2 sekvence - 330 bp, 1140 bp) A. eichwaldii (18 sekvencí - 774 bp), A. ohridanus (1 sekvence - 1140 bp), A. prespensis (1 sekvence - 992 bp), A. strymonicus (1 sekvence - 1140 bp). Z jaderných markerů byla k dispozici sekvence genu pro RAG1 (2 sekvence - 1470 bp) pouze pro A. bipunctatus stejně i sekvence genu pro RP1 (1 sekvence - 910 bp). Sekvence genu pro β-actin není k dispozici doposud pro žádný druh rodu Alburnoides.

4.3.4 Analýza mikrosatelitových lokusů obecně

Mikrosatelity, v literatuře označované jako jednoduché opakující se sekvence (simple sequence repeats - SSRs), krátké tandemové repetice (short tandem repeats - STRs) nebo tandemové repetice o variabilním počtu (variable number of tandem repeats - VNTRs), jsou tandemově se opakující úseky DNA o délce 2 - 6 párů bazí. Tyto kodominantní markery jsou rozloženy po celé délce genomu, nejčastěji však v nekódujících oblastech. Díky poměrně vysoké mutační rychlosti a délkovému polymorfismu slouží jako výborné identifikátory při populačních studiích, studiu příbuzenských vztahů, určování paternity a studiu parametrů populačně-genetické struktury. Délka mikrosatelitové repetice může být rozdílná, přesto jsou nejčastěji identifikovány dinukleotidové repetice, u obratlovců nejčastěji (AC)n a (AT)n; také lze identifikovat repetice tetranukleotidové, téměř výhradně (GATA)n a (GACA)n (Jarne a Lagoda, 1996). Strukturně jsou mikrosatelity děleny na dokonalé (repetice se neustále opakuje bez přerušení), nedokonalé (motiv přerušen jedním nukleotidem), přerušované (repetice přerušena inzercí malého počtu nukleotidů jiných než repetiční motiv) a složené (mikrosatelity složené ze dvou a více různých repeticí následujících za sebou).

4.3.5 Příprava knihovny mikrosatelitů

Jak je popsáno výše, fragmentační analýza mikrosatelitů je používanou metodou při hodnocení diverzity populací, druhů, atd. Mnohé mikrosatelitové lokusy již byly publikovány a lze tedy přímo pracovat s těmito. Ne vždy však je dostupné dostatečné množství polymorfních lokusů a ne vždy lze všechny lokusy amplifikovat u selektované populace. Proto bylo přistoupeno k vývoji unikátní mikrosatelitové knihovny pro ouklejku pruhovanou (Alburnoides bipunctatus) a blatňáka tmavého (Umbra krameri).

Příprava knihovny mikrosatelitů se obecně sestává z následujících bodů: 1. konstrukce genomové knihovny – izolace celogenomové DNA, tato DNA rozštípána na fragmenty, fragmenty zaklonovány do kompetentních buněk, selekce pozitivních klonů pomocí modro-bílého testu,

2. detekce pozitivních klonů pomocí hybridizace s mikrosatelitovou sondou – pozitivní klony jsou na nylonové membráně fialové, negativní světle hnědé, pozitivní kolonie inokulovány do tekutého média,

3. sekvenování pozitivních klonů – v sekvencích vyhledávány opakující se motivy,

4. navržení primerů pro amplifikaci mikrosatelitových lokusů – primery navrhovány v okolí repetic za zvolených podmínek,

5. testování primerů – sledování stupně polymorfismu, přítomnosti nulových alel a vazebné nerovnováhy.

V případě knihovny pro ouklejku pruhovanou první tři body již byly zpracovány jako součást diplomové práce [Soňa Urbánková: Ouklejka pruhovaná (Alburnoides bipunctatus) – genetická diverzita populací s ochranářskými aspekty (2010)] a jsou v ní podrobně rozepsány. Tvorba knihovny pro blatňáka probíhala zároveň s přípravou knihovny ouklejky stejným způsobem. Body 4. a 5. jsou detailně popsány v Příloze III.

4.3.6 Zaklonování DNA řetězců heterozygotních jedinců u jaderných markerů

V případě že jedinec je vnitrodruhový nebo mezidruhový heterozygot, může se výsledný chromatogram jevit velice nekvalitně. K tomu dochází především, když mateřský a otcovský řetězec mají různou délku způsobenou inzertovanými nebo deletovanými úseky. Na chromatogramu je patrný překryv čtecího rámce a sekvenci nelze spolehlivě identifikovat. Jako řešení se používá zaklonování zvolených úseků (markerů) do plasmidů. Ty jsou schopné do své DNA začlenit pouze jedno vlákno DNA. Následnou izolací a sekvenováním těchto jednovláknových řetězců lze získat jak mateřskou tak i otcovskou sekvenci heterozygota nebo hybrida.

4.4 Použité tatistické nástroje

4.4.1 Statistické nástroje použité při inventarizaci ichtyofauny ČR

Veškeré sekvence markeru COI a S7 byly vyhodnoceny v programu MEGA 4.0.4 (Kumar et al., 2004). Sekvence COI byly nahrány do mezinárodní databáze BoLD a statisticky vyhodnoceny podle společného návodu DNA barcoding iniciativy (http:// www.boldsystems.org/libhtml_v3/static/BOLD_Handbook_Oct2013.pdf).

4.4.2 Statistické nástroje pro vyhodnocení fylogeneze evropských ouklejek

Sekvence mitochondriálního (cyt b 1140 bp) i jaderných markerů (RP1: 564 - 573 bp, RAG1: 1111 bp, β-actin: 833 - 850 bp) byly upraveny v programu MEGA 4.0.4 do alignmentů a dále použity ve fylogenetických analýzách. Polymorfismus v rámci datového souboru, haplotypové a nukleotidové diverzity (Nei, 1987) a počet nonsynonimních substitucí byly vypočítány v programu DNA SP 5.10 (Librado a Rosas, 2009). Haplotypové sítě byly vytvořeny v programu TCS 1.21 (Clement et al., 2000); byl zadán parametr 10 kroků k oddělení jednotlivých linií. Konstrukce fylogenetických stromů probíhala na základě čtyř různých metod, aby bylo dosaženo co nejvyšší věrohodnosti. Topologie stromů byla zvolena na základě Bayesovské analýzy v programu MrBayes 3.12 (Ronquist a Huelsenbeck, 2005). Metody Neighbour-joining (Saitou a Nei, 1987) a Maximum parsimony byly počítány v programu PAUP* 4.0B.10 (Swofford, 2002). V programu PhyML (Guindon a Gascuel, 2003) byla počítána metoda Maximum likelihood. Nejlepší substituční model byl zvolen v programu jModelTest 2 (Darriba et al., 2002; Guindon a Gascuel, 2003). Stromy byly vizualizovány v programu FigTree v1.2.1 (Rambaut, 2009). Všechny analyzované sekvence jsou uloženy v databázi GenBank. Veškeré další podrobnosti jsou uvedeny v Příloze II.

4.4.3 Vyhodnocovací nástroje použité při přípravě mikrosatelitové knihovny

Primery byly designovány v programu OLIGO 7 (Rychlik, 2007), k vizualizaci byly použity programy GENESCAN and GENOTYPER v3.7. Počet alel na lokus, očekávaná a pozorovaná heterozygozita, odchylka od Hardy-Weinbergovy rovnováhy a vazebná nerovnováha, frekvence nulových alel byl zjištěn v programech GENALEX 6 (Peakall a Smouse, 2006), online verze GENEPOP 1.2 (Raymond a Rousset, 1995) a MICRO-CHECKER 2.2.3 (Van Oosterhout et al., 2004).

5 VÝSLEDKY

5.1 Inventarizace ichtyofauny České republiky

Mendel J., Papoušek I., Marešová E., Halačka K., Vetešník L., Šanda R., Koníčková M., Urbánková S. 2012. Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic, Analysis of Genetic Variation in Animals, edited by Mahmut Caliskan (kapitola v knize; 15/ 287 - 314; ISBN 978-953-51-0093-5).

Autorčin podíl na práci: zpracování databáze pro Ústav biologie obratlovců, v.v.i., laboratorní příprava DNA barkódů pro plotici obecnou (Rutilus rutilus), perlína ostrobřichého (Scardinius erythropthalmus), ouklejku pruhovanou (Alburnoides bipunctatus), ouklej obecnou (Alburnus alburnus), cejna malého (Blicca bjoerkna), cejna velkého (Abramis brama), cejna perleťového (Ballerus sapa) a cejna siného (Ballerus ballerus)

Abstrakt: V roce 2003 byl zahájen mezinárodní projekt na zmapování a ochranu biodiverzity využívající novou taxonomickou metodu „DNA barkoding“. Metoda založená na sekvenaci mitochondriálního markeru první podjednotky cytochrom c oxidázy (COI) prokázala vysokou užitečnost i při inventarizaci biodiverzity sladkovodních ryb ČR. Aby bylo možné identifikovat případné hybridy, český projekt byl navíc doplněn i o jaderný marker - první intron S7 ribosomálního proteinu (RP1). Bylo analyzováno 67 ze 72 druhů, tj. 93,1 % české ichtyofauny. Odběr vzorků byl proveden na 106 lokalitách na základě třístupňového systému. Nejvyšší haplotypová variabilita byla odhalena pro druh Barbatula barbatula, 27 jedinců /13 haplotypů divergujících do tří linií a Phoxinus phoxinus, 25 jedinců / 10 haplotypů divergujících do dvou linií. Další nejhlubší divergence byla zaznamenána u druhu Squalius cephalus kde mezi 28 jedinci byly pozorovány čtyři haplotypy divergující do dvou linií s vnitrodruhovou variabilitou 5,25 %. Byly odhaleny rovněž i dva druhy úhořů Anguilla anguilla a Anguilla rostrata, jeden původní evropský druh a druhý přivlečený z Ameriky. Tyto a mnohé další získané poznatky uvedené v předkládané publikaci přispívají v současnosti k přesnějšímu monitoringu systému NATURA 2000 a jako součást databáze Barcode of Life jsou k dispozici ke komplexnímu pohledu a ochraně biodiverzity na evropské kontinentu.

5.2 Fylogeneze a taxonomický status evropských ouklejek

rodu Alburnoides

Stierandová S., Vukič J., Vasil'eva E.D., Zogaris S., Shumka S., Halačka K., Vetešník L., Švátora M., Nowak M., Stefanov T., Koščo J., Mendel J. 2016. A multilocus assessment of nuclear and mitochondrial sequence data elucidates phylogenetic relationships among European spirlins (Alburnoides, Cyprinidae). Molecular Phylogenetics and Evolution, 94, 479-491. doi: 10.1016/j.ympev.2015.10.025. (IF 2015 - 3,916)

Autorčin podíl na práci: laboratorní práce, molekulárně-genetické zpracování datového souboru a jeho vyhodnocení, příprava manuskriptu

Abstrakt: Fylogenetické vztahy a taxonomie ouklejek (rod Alburnoides) byly zkoumány a porovnávány za použití sekvenační analýzy mitochondriálních a jaderných markerů. Molekulární analýza prokázala 17 euroasijských linií, které se rozdělily do dvou hlavních kládů, nazvaných na základě jejich rozšíření jako Ponto-Kaspický a Evropský. Indelová diagnostika (β-actin a RP1 marker) a aminokyselinový překlad genu pro cyt b byly shledány jako spolehlivé identifikační znaky pro většinu rozlišených linií. V mnoha případech je linijní bohatost úzce spojena s existencí glaciálních refugií. Byla potvrzena podhodnocenost druhové pestrosti v rámci rodu Alburnoides. Výsledky genetické analýzy podpořily validitu 11 v minulosti morfologicky určených druhů a kromě těchto byly rozpoznány čtyři další fylogenetické linie, jež byly předloženy pro posouzení jejich druhové validity. Distribuční areál nominotypického druhu A. bipunctus s. stricto byl nově vymezen. Dvě divergující linie A. ohridanus a A. prespensis complex byly pozorovány v jihovýchodním jadranském sladkovodním ekoregionu, který byl potvrzen jako “biodiversity hotspot”. A. ohridanus vykazuje vysokou odlišnost od A. prespensis komplexu, který zahrnuje tři sympatrické mitochondriální linie se stejnými jadernými haplotypy. Endemismus byl potvrzen nejméně u sedmi druhů tohoto rodu. Nedostatečná znalost mikroevoluce populací a komplikovaná situace v albánském říčním systému, stejně tak i v Ponto-Kaspické oblasti, vybízí k budoucímu důkladnějšímu prozkoumání těchto regionů.

5.3 Mikrosatelitové lokusy využitelné pro studium ouklejky

pruhované a dalších kriticky ohrožených cyprinidů

Urbánková S., Mendel J., Vyskočilová M. 2013. Microsatellite loci for population studies of the genus Alburnoides and four other critically endangered and vulnerable cyprinids in the Czech Republic. Molecular Ecology Resources, 13 (3), 546-549. (IF 2013 - 5,626)

Autorčin podíl na práci: příprava knihovny mikrosatelitů, testování mikrosatelitových primerů a cross-species amplifikací, příprava manuskriptu

Abstrakt: V genomu ouklejky pruhové byly nalezeny čtyři polymorfní mikrosatelitové lokusy. Na jeden lokus připadalo od 12 do 19 alel a očekávaná heterozygozita byla v rozmezí 0,832 - 0,927. Také bylo úspěšně otestováno sedm mikrosatelitových lokusů pocházejících z genomů Cyprinus carpio, Gobio gobio, Luxilus cornutus, Labeo rohita. Počet alel u těchto lokusů se pohyboval od tří do deseti. Jejich užitečnost byla otestována při cross-species amplifikaci u deseti zástupců rodu Alburnoides a čtyř dalších cyprinidů. Pomocí těchto mikrosatelitových lokusů lze identifikovat jednotlivé druhy, rozlišit interspecifické hybridy a provádět populační studie ohrožených druhů rodů Alburnoides, Carassius, Leucaspius, Pelecus a Vimba.

5.4 Mikrosatelitové lokusy pro populační studii rodu Umbra na

území České republiky – nepublikovaný výsledek

Autorčin podíl na práci: příprava knihovny mikrosatelitů, testování mikrosatelitových primerů a cross-species amplifikace, vyhodnocení výsledků.

O rodu Umbra je toho známo velice málo a pro populační monitoring je dostatek vhodných genetických nástrojů rovněž omezen; sledování na druhové úrovni vykazuje velice nízkou diverzitu (Hajdú, 2008). Příprava mikrosatelitových lokusů tak měla poskytnout potřebné markery pro budoucí populační studie. Bylo publikováno devět mikrosatelitových lokusů (Winkler a Weiss, 2008), ale tyto markery nebyly zcela optimální pro studium česko- slovenské populace blatňáka. Proto byla snaha vyvinout další polymorfní lokusy. 27

V rámci knihovny mikrosatelitů blatňáka byly nalezeny pouze čtyři vhodné lokusy, z čehož dva byly u česko - slovenské i chorvatské populace bohužel monomorfní. Byly provedeny i různé „cross-species“ amplifikace s ouklejkou (15 testovaných lokusů), hrouzkem (2 lokusy), kaprem (4 lokusy), jelcem tlouštěm (6 lokusů), Labeo rohita (1 lokus), ale bohužel se nepodařilo nalézt další vhodné mikrosatelitové lokusy. Ovšem cíl i přes tyto obtíže splněn byl (Tabulka 1).

Tabulka 1 Přehled použitých mikrosatelitových lokusů pro blatňáka tmavého

Produkt Lokus Sekvence primerů (5´-3´) Motiv Ta (°C) N/Na Reference (pb)

F: CCTTCCTCCGCTCTCTTCGTC (GT)3(TC)15T(ATCT)20 Ukra85 56 10/6 256-296 nepublikováno (TCTCTG) A(CT) C (TC) R: TGGCGACAACCCTTCTACCAG 6 5 3 5

F: ATGCAGAAACACCTGTCCG Ukra189 (ATCT)18 56 11/4 176-184 nepublikováno R: TGAAGGTTGGATGATCGATGG

F: GGGGGAATCATCAGTAAC

Ukra292 (CA)5C(CA)17 56 12/1 170 nepublikováno R: AGGCAATCTATTAGATATGGC

F: CTCTTCTGAAAACCTGCTAAG (AC)7ATAACC(AC)4C2 Ukra 28 56 11/1 185 nepublikováno (AC) G(CA) CGC(AC) R: ACTAATTTTCAGGCTTGACAC 5 4 5

F: GAGATGCCTGGGGAAGTCAC Crooijmans et MFW5 (CA)n* 59 8/1 169 al., (1997) R: AAAGAGAGCGGGGTAAAGGAG

F: GAATCCTATCATGCAAAC Crooijmans et MFW19 (CA)n* 55 12/1 188 al., (1997) R: GCACAAACTCCACATTGTGCC

F: ATC AGG TCA GGG GTG TCA CG Turner et al. LC04 [GT]5ATTTT[GT]5[GA]11 57 23/1 205 (2004) R: TGT TTA TTT GGG GTC TGT GT

F: CCTTCTGCATCCATCTCCTC Vyskočilová et LC32 (AC)16 53 22/1 226 al. (2007) R: TCAGGGGTTTTAGCTCATGG

* motiv v publikaci blíže nespecifikován; N/Na počet jedinců/počet alel.

6 DISKUZE

6.1 Inventarizace ichtyofauny České republiky

Jde o vůbec první inventarizaci molekulární biodiverzity ichtyofauny ČR založené na dvou- genomovém sekvenování a exon-intron designu. Jednalo se o unikátní spolupráci se zahraniční institucí (Biodiversity Institute of Ontario) a národními institucemi (agentura ochrany přírody, rybářské svazy, chovná zařízení, atd.). Cílem spolupráce bylo pokrýt maximálně druhovou pestrost a populační variabilitu.

Ve studii bylo zahrnuto 93 % českých druhů, zbývající druhy Micropterus salmoides, Romanogobio banaticus, Romanogobio belingi, Acipenser baerii a Ameiurus melas byly do databáze BoLD přidány později.

Důležitým bodem molekulární inventarizace bylo rovněž odhalování hybridních událostí v ČR. Analýzou jaderného regionu RP1 jsme prokazovali hybridizace, přirozeného i umělého původu. Tato byla zjištěna u několika druhů, např. nalezení haplotypů Blicca bjoerkna u Abramis brama, Gobio gobio u Romanogobio vladykovi, Acipenser gueldenstaedtii u A. ruthenus a byla potvrzena antropogenně řízená hybridizace u druhů Coregonus mareana a C. peled.

Níže uvádím diskutované výsledky a poznatky získané pro vybrané druhy čeledi Cyprinidae, jež byly nedílnou součástí předkládané disertace.

Pro cejna perleťového (Ballerus sapa) byla potvrzena validita rodového názvu Ballerus na místo dříve používaného Abramis. Pro kriticky ohrožený druh, který se vyskytuje vzácně pouze na Jižní Moravě (povodí řeky Moravy), byla zaznamenána nulová vnitrodruhová diverzita; to bylo dáno nízkým počtem testovaných jedinců.

Změna rodové příslušnosti byla potvrzena u cejna siného (Ballerus ballerus). Tento ohrožený druh se nehojně vyskytuje v povodí Moravy a vzácně v povodí Labe. Byla pozorována zcela nulová vnitrodruhová variabilita, která byla rovněž dána nízkým počtem testovaných jedinců.

Cejn velký (Abramis brama) byl testován ze všech šesti oblastí ČR. Byly popsány 4 haplotypy s vnitrodruhovou variabilitou do 0,62 %. Byli nalezeni dva mezidruhoví hybridi s perlínem (Scardinius erythropthalmus) v povodí Ohře.

Cejnek malý (Blicca bjoerkna) byl testován v pěti oblastech ČR. Byly popsány 4 haplotypy s vnitrodruhovou variabilitou do 0,31 %. Byli identifikováni dva mezidruhoví hybridi; jeden s perlínem (Scardinius erythropthalmus) v řece Moravě a druhý s cejnem velkým (Abramis brama) v řece Pšovka (povodí Labe).

Ouklej obecná (Alburnus alburnus) byla testována v šesti oblastech ČR. Byly popsány 4 mitochondriální haplotypy s vnitrodruhovou variabilitou do 0,31 %. Byla pozorována však zvýšená vnitrodruhová diverzita na jaderném markeru až 3,8 %. V povodí Vltavy, Labe a Dyje byly identifikovány tři odlišitelné linie a současně byli zachyceni mezilinijní heterozygoti v povodích Moravy, Odry a Ohře.

Ouklejka pruhovaná (Alburnoides bipunctatus) byla analyzována z povodí Dyje, Moravy a Ohře. Bylo rozlišeno 5 haplotypů s vnitrodruhovou diverzitou do 0,62 %.

Perlín ostrobřichý (Scardinius erythrophthalmus) byl testován ve všech šesti oblastech. Zaznamenali jsme nulovou diverzitu a popsali pouze 1 haplotyp. Rovněž jsme identifikovali tři mezidruhové hybridy; jeden s cejnkem malým v řece Moravě a dva s cejnem velkým v řece Ohři.

Plotice obecná (Rutilus rutilus) byla testována ve všech šesti oblastech. Bylo popsáno 7 haplotypů s vnitrodruhovou diverzitou do 0,80 %. V minulosti zaznamenaný výskyt plotice lesklé (R. pigus; Hanel a Lusk, 2005) v řece Dyji a Moravě nebyl potvrzen. Byl zachycen výskyt dvou hybridů; jeden s cejnem velkým v nádrži Hamry, druhý s ostroretkou stěhovavou v Rokytné.

6.2 Taxonomický status evropských druhů rodu Alburnoides

Rod Alburnoides čítá v současnosti 24 validních druhů (podle databáze FishBase k 11/2015) vyskytujících se na území Evropy a Asie. Podle příručky sladkovodních ryb (Kottelat a Freyhof, 2007) druh Alburnoides bipunctatus se vyskytuje od Francie po Afghánistán. Pro 30

takto rozsáhlé území by byl výskyt pouze jediného druhu velice ojedinělý, a proto se vycházelo z domněnky, že celkový počet druhů rodu Alburnoides pro Evropu a Asie byl spíše silně podhodnocen.

Předložili jsme veřejnosti první souhrnnou studii evropských druhů ouklejek s přesahem do asijské části. K analýze byla použita morfologická identifikace a molekulárně-genetické markery. Jako nejúčinnější byl shledán mitochondriální gen pro cytochrom b, dalším vhodným identifikátorem se ukázala indelová diagnostika nukleárních genů pro RP1 a β- actin. Dalším testovaným jaderným markerem byl gen RAG1, který neprokázal dostatečnou rozlišovací schopnost na úrovni druhů.

Důležité poznatky byly zjištěny v povodí Dunaje. Druh A. bipunctatus se kontinuálně nevyskytuje v celém povodí, jak se doposud uvádělo (Bloch, 1782; Kottelat a Freyhof, 2007), ale obývá pouze horní tok. Dále po proudu, ve střední části, se vyskytuje nová linie s prozatímním názvem A. sp. 1 a ve středním až dolním toku Dunaje jsme zaznamenali výskyt další doposud nepopsané linie A. sp. 2.

Území Albánie je považováno za „hotspot biodiversity“. Předpokládalo se, že druhová pestrost bude potvrzena; tuto domněnku podporovaly výsledky získané ve studii o parmách (Marková et al. 2010). Ukázalo se však, že některé popsané druhy tvoří spíše komplikovaný komplex bez jasně vymezené lokální distribuce. Jedinci i z dříve popsaných typových lokalit vykazovaly stejné nebo velmi obdobné mitochondriální i jaderné haplotypy bez zřetelnější druhové příslušnosti. Nebyla potvrzena existence dvou popsaných druhů A. devolli a A. fangfangae (Bogutskaya et al., 2010); tyto taxony byly navrženy jako součást A. prespensis komplexu.

Zajímavý fakt byl pozorován na území Řecka. Pro druh A. thessalicus byly stanoveny dvě typové lokality Sperchios a Pinios. Z našich výsledků ovšem jednoznačně vyplývá, že na těchto lokalitách se nacházejí dvě silně divergované linie druhové úrovně.

Z celkového pohledu je patrné, že rod Alburnoides tvoří dva geograficky oddělené klády Evropský a Ponto-Kaspický. Na základě této studie mohou být některé poddruhy povýšeny na validní druhy s vymezeným výskytovým areálem. Byly zachyceny tři zcela nové linie (A. sp. 1, A. sp. 2 a A. sp. 5), které předkládáme vědecké obci jako „species-in-waiting“, a u kterých bude zapotřebí dalšího zkoumání. U dvou linií A. sp. 3 a A. sp. 4 musí být vyřešen zjištěný 31

nomenklaturický problém, jež je spatřován v identifikaci taxonomického statusu jedinců z povodí řeky Sperchios. Lokalita je označována vedle řeky Pinios jako typová lokalita druhu A. thessalicus. Z tohoto důvodu jsme tuto egejskou linii označili pracovně jako A. thessalicus 2. Je ovšem zřejmé, že se jedná o dvě odlišné linie druhové úrovně. Tato lokalita mimo jiné ukazuje velkou variabilitu na intronu β-actinu s nálezem početných heterozygótních vzorů, vyskytující se pouze v rámci této linie (Group 3). Vedle značné mitochondriální odlišnosti byly identifikovány i 3 specifické delece, které se vyskytovaly pouze v této linii. Na základě prokázané odlišnosti obou linií a chybění druhové monofylie bude nezbytné, jednak stanovit pro jakou populaci zůstane název A. thessalicus, a poté připravit neotyp a druhový popis pro druhou linii.

6.3 Mikrosatelitové lokusy využitelné pro studium populací ouklejky

pruhované a dalších cyprinidů

Výsledky zjištěné v souhrnné práci o druzích rodu Alburnoides byly z části již k dispozici při přípravě mikrosatelitové knihovny ouklejky pruhované. Podařilo se identifikovat tři diagnostické mikrosatelitové lokusy - Albi61, Mfw5 a Gob28. Tyto by se mohly stát rychlým a levným diagnostickým markerem při rozlišování některých druhů tohoto rodu (např. A. thessalisus, A. rossicus a A. fasciatus). Je nutno podotknout, že práce na mikrosatelitových lokusech byla zpracována dříve než finální podoba souhrnné fylogeografická studie, proto je možné, že diagnostická schopnost uvedených markerů je podhodnocená.

Cross-species amplifikace se čtyřmi dalšími cyprinidy (Carassius carassius, Leucaspius delineatus, Vimba vimba a Pelecus cultratus) odhalily nové možnosti jejich identifikace. Z dostupné literatury nejsou žádné informace o vhodných mikrosatelitových lokusech pro slunku obecnou a ostruchu křivočarou. Mikrosatelitové lokusy pro karase obecného a podoustev říční již byly připraveny a publikovány (Yue a Orban, 2002; Crooijmaset et al., 1997 a Mohamadian et al., 2012). Vzhledem k ochranářskému statusu těchto čtyř druhů, je zjištění nových lokusů velice důležité a může efektivně pomoci při dalších studiích.

6.4 Mikrosatelitové lokusy využitelné pro repatriační program

blatňáka tmavého

Blatňák tmavý Umbra krameri je jediný zástupce rodu blatňák v Evropě. Dva příbuzné druhy žijí v severní Americe – Umbra limi a Umbra pygmaea. Blatňák tmavý se vyskytuje v pomalu tekoucích nebo stojatých nížinných vodách dolního a středního toku Dunaje, Dniestru a Prutu (Wanzenböck, 1995a). S rozvojem vodohospodářství však docházelo k významnému úbytku výskytových lokalit (Keresztessy, 1995; Wanzenböck, 1995a; Sekeulic et al., 1998; Trombitsky et al., 2001). Blatňák je dobře adaptován na život v zarostlých vodách s nedostatkem kyslíku. Na červeném seznamu (IUCN) je v kategorii ohrožených.

V České republice se vedou diskuse o prokázaném výskytu blatňáka na našem území v minulosti. Jsou ichtyologové, kteří považují blatňáka za nepůvodní druh české ichtyofauny a jiní předpokládají výskyt blatňáka na hranicích se Slovenskem v dobách společného státu a vyvíjejí určité snahy zahájit program na repatriaci tohoto druhu do českých vod. V roce 2006 vznikl na Slovensku záchranný program mapující výskyt a genetickou diverzitu blatňáka (Hajdú, 2008).

Z těchto důvodů byla snaha vytvořit knihovnu polymorfních mikrosatelitových lokusů. Bylo získáno 74 pozitivních klonů, které byly dále sekvenovány. Z toho bylo detekováno 51 sekvencí obsahujících repetitivní oblasti. Ovšem v některých případech byl velmi obtížný nebo zcela nemožný design vhodných primerů.

Nakonec bylo testováno devět lokusů se značenými primery, ovšem pouze čtyři lokusy byly shledány jako vhodné pro spolehlivou PCR amplifikaci. Zkoušeli jsme i cross-species amplifikace, s nevalným úspěchem.

Ve výsledku jsme připravili z naší mikrosatelitové knihovny a cross-amplifikací celkem 8 lokusů, z nichž bylo šest monomorfních - Ukra292, Ukra28, LC04, LC32, Mfw19 a Mfw5 na zkoumané populaci. A pouze lokusy Ukra85a Ukra189 byly prokazatelně polymorfní (Tabulka 1).

Protože populace, na které byly mikrosatelitové lokusy testovány, neměla dostatečný počet jedinců pro populační statistiky (počet alel na lokus, pozorované a očekávané heterozygozity, odchylky od Hardy-Weinbergovi rovnováhy, očekávané vazebné nerovnováhy a frekvence nulových alel), byly do analýzy přidány vzorky populace z Chorvatska. I přes tuto skutečnost se monomorfismus mikrosatelitových lokusů nezměnil a nepodařilo se tak získat více polymorfních lokusů s dostatečně vypovídající hodnotou.

Nově identifikované mikrosatelitové lokusy doplňují sestavu mikrosatelitů získaných v roce 2009 (Winkler a Weiss) v populacích slovenských a maďarských blatňáků. Autoři získali 29 pozitivních klonů a z nich devět se ukázalo jako vhodných; tyto lokusy měly počet alel v rozmezí 6 – 12. Výsledky této práce a studie Marić et al. (2015) zaznamenávají vysokou diverzitu nejen mezi populacemi ale i v rámci jednotlivých populací ze Slovenska, Maďarska, Bosny a Hercegoviny, Srbska.

K zamyšlení se nabízí otázka, jak je možné, že v těchto dvou studiích autoři hovoří o silných životaschopných populacích blatňáků, ale v naší české a chorvatské populaci byla variabilita velmi nízká. Zdůvodnění vidíme ve velmi malém počtu jedinců (10 - 12) a zřejmě ve „family samplingu“. Literární záznamy také hovoří o nízké až nulové genetické variabilitě slovenských populací (Hajdú, 2008), které se vyskytují ostrůvkovitě a mají různou početnost (Ráb, 1998). Ovšem cíl doktorské práce - příprava mikrosatelitových lokusů a rozšíření dosavadní velmi omezené STR knihovny založené na 9 lokusech ze studie Winkler a Weiss (2009) byl splněn.

7 SHRNUTÍ

Společným tématem, které pojí jednotlivé části doktorské práce je poznání biodiverzity jak na národní, tak i evropské úrovni. Moderními molekulárními přístupy jednak inventarizovat populační i druhovou diverzitu vybraných druhů čeledi Cyprinidae (DNA barcoding, exon- intron sekvenování), tak i připravit genetické nástroje pro budoucí populační studie různých endemitů rodu Alburnoides a případnou repatriaci druhu Umbra krameri (klonování, vývoj mikrosatelitových knihoven).

Katalogizace biodiverzity české ichtyofauny je ukázkovým příkladem multidisciplinárního přístupu. Tímto projektem se Česká republika připojila k mezinárodní iniciativě Fish-BOL, která je součástí největší biodiverzitní studie v lidských dějinách. V rámci společné platformy jsou získané DNA barkódy porovnávány s výsledky z různých zemí a po dostatečném naplnění databáze BoLD dojde k finálnímu mezikontinentálnímu srovnávání diverzity jednotlivých skupin živočichů, rostlin, atd. Získané výsledky významně rozšířily znalosti vnitrodruhové diverzity řady taxonů ichtyofauny ČR.

Výsledky naší skupiny již nyní slouží jako klíčové informace při biomonitoringu systému NATURA 2000 a jako podkladový materiál pro Agenturu ochrany přírody a krajiny ČR. Nový design druhových kolekcí typových jedinců a sestavení podrobného voucheru je velkým přínosem pro Národní muzeum ČR.

Připravená knihovna nových mikrosatelitových lokusů ouklejky pruhované přispěje při identifikování rozmanitosti na úrovni populací a poslouží při mapování stávajících i nově identifikovaných druhů.

Knihovna nových mikrosatelitů pro blatňáka tmavého může posloužit, v případě shody vědecké ichtyologické obce, k repatriaci „živoucí fosílie“ starobylých pravých kostnatých ryb (Euteleostei) do českých vod. Podařilo se doplnit publikovaný malý set mikrosatelitových lokusů (9) o další, které budou snadno využitelné pro budoucí populační studie na jiných evropských územích.

Fylogeografická studie rodu Alburnoides přinesla neočekávané výsledky o statusu mnoha jeho druhů. Evropsko-asijský rozměr studie prokázal dosavadní podhodnocenost tohoto rodu a poukázala mimo jiné i na endemismus některých druhů. Dokázali jsme mimo jiné upřesnit druhovou distribuci a vyhodnotit míru hybridizace na tak rozsáhlém území.

Tato studie je vůbec první souhrnnou fylogenetickou studií ouklejek v rámci Evropy. A proto může být dobrým podkladem v ochranářském managementu a zároveň je jistě motivujícím prvkem pro zahraniční vědecké týmy k přezkoumání situace v jejich národních ichtyofaunách.

8 SEZNAM LITERATURY

Bogutskaya, N.G., Zupančič, P., Naseka, A.M., 2010. Two new species of freshwater fishes of the genus Alburnoides, A. fangfangae and A. devolli (Actinopterygii: Cyprinidae), from the Adriatic Sea basin in Albania. Proceedings of the Zoological Institute RAS, 314 (4), 448-468.

Clement, M., Posada, D., Crandall, K. 2000: TCS: a computer program to estimate gene genealogies. Mol. Ecol., 9 (10), 1657-1660.

Crooijmans, R.P.M.A., Bierbooms, V.A.F., Komen, J., Van der Poel, J.J., Groenen, M.A.M., 1997. Microsatellite markers in common carp (Cyprinus carpio L.). Anim. Genet., 28, 129- 134.

Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods, 9 (8), 772.

Dubut, V., Sinama, M., Martin, J.F., Meglécz, E., Fernandez, J., Chappaz, R., Gilles, A., Costedoat, C., 2010. Cross-species amplification of 41 microsatellites in European cyprinids: A tool for evolutionary, population genetics and hybridization studies. BMC Res. Notes, 2010, 3, 135. doi:10.1186/1756-0500-3-135.

Froese, R., Pauly, D. (eds.), 2015. FishBase. World Wide Web electronic publication. www.fishbase.org, version (11/2015).

Hajdú, J., 2008. Záchrana blatniaka tmavého (Umbra krameri) na Slovensku. Vydala Štátna ochrana prírody SR v roku 2008 v rámci projektu Záchrana európsky významného druhu blatniak tmavý (Umbra krameri Walbaum, 1792) v chránených územiach Slovenska prostredníctvom realizácie opatrení vyplývajúcich z programu záchrany“.

Hanel, L., Lusk, S., 2005. Ryby a mihule České republiky, rozšíření a ochrana. ČSOP Vlašim, ISBN 80-86327-49-3,Vlašim.

Hebert, P.D.N., Cywinska, A., Ball, S.L. and deWaard, J.R., 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Science, 270, 313- 321.

Choleva, M., Musilova, Z., Kohoutova-Sediva, A., Paces, J., Rab, P., Janko, K., 2014. Distinguishing between Incomplete Lineage Sorting and Genomic Introgressions: Complete Fixation of Allospecific Mitochondrial DNA in a Sexually Reproducing Fish (Cobitis; Teleostei), despite Clonal Reproduction of Hybrids. PLoS ONE, 9 (6), e80641. doi: 10.1371/journal.pone.0080641. 37

Guindon, S., Gascuel, O. 2003: PhyML 3.0: new algorithms, methods and utilities. Syst. Biol. 52 (5), 696–704.

Jarne, P., Lagoda, P.J., 1996. Microsatellites, from molecules to populations and back. Trends Ecol. Evol., 11 (10), 424-9.

Keresztessy, K., 1995. Recent fish faunistical investigations in Hungary with special reference to Umbra krameri Walbaum, 1972. (Proceedings of the first international workshop on Umbra krameri) Ann. Naturhist. Mus. Wien, 97B, 458–465.

Kottelat, M., 1997. European freswater fishes. An heuristic checklist of the freshwater fishes of Europe (exklusive of USSR), with an introduction for non-systematics on nomenclature and conservation. Biologia, Bratislava, Secion Zoology, 52 (Suppl. 5), 1-271.

Kottelat, M., Freyhof, J., 2007. Handbook of European freshwater fishes. Kottelat, Cornol, Switzerland and Freyhof, Berlin, Germany.

Kumar, S., Tamura, K., Nei, M. 2004: MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics, 5, 150- 163.

Li Ch., Ortí, G., 2007: Molecular phylogeny of Clupeiformes (Actinopterygii) inferred from nuclear and mitochondrial DNA sequences. Mol. Phylogen. Evol., 44, 386-398.

Librado P., Rozas J. 2009: DNASP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451-1452.

Liu, H., Tzeng, C.S., Teng, H.Y., 2002. Sequence variations in the mitochondrial DNA control region and their implications for the phylogeny of the Cypriniformes. Can. J Zool., 80 (3), 569-581. doi: 10.1139/z02-035.

López, J. A., Chen W., Ortí G., 2004: Esociform Phylogeny. Copeia, 3, 449-464.

Lusk, S., Hanel, L., 2008. Foreword. In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 3-5, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno.

Marić, S., Snoj, A., Sekulić, N., Krpo-Ćetković, J., Šanda, R., Jojić, V., 2015. Genetic and morphological variability of the European mudminnow Umbra krameri (Teleostei, Umbridae) in Serbia and in Bosnia and Herzegovina, a basis for future conservation activities. J Fish Biol., 86, 1534-1548. doi: 10.1111/jfb.12657.

Marková, S., Šanda, R., Crivelli, A. et al., 2010. Nuclear and mitochondrial DNA sequence data reveal the evolutionary history of Barbus (Cyprinidae) in the ancient lake systems of the Balkans. Mol. Phylogenet. Evol., 55, 488-500. doi:10.1016/j.ympev.2010.01.030.

Mendel, J., Lusk, S., Vasileva, E.D. et al., 2008. Molecular phylogeny of the genus Gobio Cuvier, 1816 (Teleostei: Cyprinidae) and its contribution to taxonomy. Mol. Phylogenet. Evol., 47, 1061-1075. doi:10.1016/j.ympev.2008.03.005.

Mohamadian, S., Rezvani Gilkolaie, S., Rouhollahi, Sh., Taghavi, M. J., Nayerani, M., Shirzad, E., Mirghaed Taheri, A., 2012. Genetic characterization of Vimba vimba persa (Pallas, 1814) in Southern part of the Caspian Sea using microsatellite markers. Iran. J Fish. Sci., 1, 347-357.

Nei, M. 1987: Molecular Evolutionary Genetics. Columbia University Press, New York.

Peakall, R., Smouse, P.E., 2006. Genalex 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes, 6, 288–295.

Perea, S., Bohme, M., Zupancic, P., Freyhof, J., Sanda, R., Ozulug, M., Abdoli, A. and Doadrio, I., 2010. Phylogenetic relationships and biogeographical patterns in Circum- Mediterranean Subfamily Leuciscinae (Teleostei, Cyprinidae) inferred from both mitochondrial and nuclear data. BMC Evol. Biol., 10, 265.

Ráb, P., 1998. Blatňáci – ryby, které zapomněly vymřít. Živa, 2, 81-84.

Rambaut, A. 2009: FigTree: tree figure drawing tool, v1.2.1. university of Edinburgh, UK.

Raymond, M., Rousset, F., 1995. Genepop (version 1.2): population genetics software for exact tests and ecumenicism. J Hered., 86, 248–249.

Robalo, J.I., Sousa Santos, C., Levy, A., Almada, V.C., 2006. Molecular insights on the taxonomic position of the paternal ancestor of the Squalius alburnoides hybridogenetic complex. Mol. Phylogenet. Evol., 39, 276-281. doi:10.1016/j.ympev.2005.08.009. 39

Ronquist, F., Huelsenbeck, J. P., 2005. Bayesian analysis of molecular evolution using MrBayes. In: Nielsen R. (eds), Statistical Methods in Molecular Evolution. Springer, New York.

Ruchin, A. B., Shlyakhtin, G. V., Artaev, O. N. 2009: Species composition and quantitative representation of fishes in biotopes with the riffle minnow Alburnoides bipunctatus. Russ. J. Ecol., 3 (40), 194-198.

Rychlik, W., 2007. OLIGO 7 Primer Analysis Software. Methods Mol. Biol., 402, 35–60. doi:10.1007/978-1-59745-528-2_2.

Saitou, M., Nei, M. 1987: The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4 (4), 406-425.

Sekeulic, N., Budakov, L., Brankovic, D., 1998. The distribution of the European mudminnow Umbra krameri (Umbridae) in Serbia. Ital. J. Zool. (Modena), 65, 381-382.

Sousa-Santos, C., Robalo, J.I., Collarrs-Pereira, M.J., Almada, V.C., 2006. Heterozygous indels as useful tools in the reconstruction of DNA sequences and in the assessment of ploidy level and genomic constitution of hybrid organisms. DNA Seq, 16, 462-467. doi: 10.1080/10425170500356065.

Swofford, D. L., Selander, R. B. 2002: PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods). Sinauer Associates, Sunderland, MA.

Talevski, T., Milosevic, D., Maric, D., Petrovic, D., Talevska, M. and Talevska, A., 2009. Biodiversity of ichthyofauna from lake Prespa, lake Ohrid and lake Skadar. Biotechnol. Biotechnol. Equip., 23, 400-404.

Tang, Q., Liu, H., Mayden, R., Xiong, B. 2006: Comparison of evolutionary rates in the mitochondrial DNA cytochrome b gene and control region and their implications for phylogeny of the Cobitoidea (Teleostei: Cypriniformes). Mol. Phylogenet. Evol., 39, 347-357.

Trombitsky, O., Lobcenco, V., Moshu, A., Strugulea, O., 2001. The European mudminnow, Umbra krameri still populates the Dniester River in Moldava. Folia Zool. (Brno), 50 (2), 159- 160.

Turan, D., Kaya, C., Ekmekçi, F., Güçlü, S., 2013. Alburnoides manyasensis (Actinopterygii, Cyprinidae), a new species of cyprinid fish from Manyas Lake basin, Turkey. ZooKeys, 276, 85-102. doi: 10.3897/zookeys.276.4107.

Turner, T.F., Dowling, T.E., Broughton, R.E., Gold, J.R., 2004. Variable microsatellite markers amplify across divergent lineages of cyprinid fishes (subfamily Leuciscinae) Conserv. Genet., 5, 279-281.

Valdez-Moreno, M., Ivanova, N.V., Elías-Gutiérrez, M., Contreras-Balderas, S. and Hebert, P.D.N., 2009. Probing diversity in freshwater fishes from Mexico and Guatemala with DNA barcodes. J. Fish Biol., 74 (2), 377-402, ISSN 1095-8649.

Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M, Shipley, P., 2004. Microchecker: software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes, 4, 535–538.

Vyskocilova, M., Simkova, A., Martin, J.F., 2007. Isolation and characterization of microsatellites in Leuciscus cephalus (Cypriniformes, Cyprinidae) and cross-species amplification within the family Cyprinidae. Mol. Ecol. Notes, 7, 1150-1154.

Wanzenböck J., 1995. Current knowledge on the European mudminnow Umbra krameri Walbaum, 1792. (Proceedings of the first international workshop on Umbra krameri) Ann. Naturhist. Mus. Wien, 97B, 439-449.

Winkler, K.A., Weiss, S., 2008. Nine new tetranucleotide microsatellite DNA markers for the European mudminnow Umbra krameri. Conserv. Genet., 10, 1155-1157. doi:10.1007/s10592-008-9731-x.

Yue, G.H., Orban, L., 2002. Microsatellites from genes show polymorphism in two related Oreochromis species. Mol. Ecol. Notes, 2, 99–100.

Zardoya, R., Doadrio, I., 1999. Molecular evidence on the evolutionary and biogeographical patterns of European Cyprinids. J. Mol. Evol., 49 (2), 227-237.

9 SEZNAM ZKRATEK

28S velká ribosomální podjednotka atp-B beta podjednotka genu pro adenosin trifosfát syntázu

BoLD Barcode of Life Database bp párů bází (base pair)

BSC biologický druhový koncept (biological species concept)

COI cytochrom c oxidáza cyt b cytochrom b

DNA deoxyribonukleová kyselina (deoxyribonucleic acid)

ESC evoluční druhový koncept (evolutionary species concept)

Fish-BOL The Fish Barcode of Life Iniciative iBoL International Barcode of Life project

IUCN Mezinárodní svaz ochrany přírody (International Union for

Conservation of Nature) mtDNA mitochondriální DNA (mitochondrial DNA) nDNA jaderná DNA (nuclear DNA)

PCR polymerázová řetězová reakce (polymerase chain rection)

PSC fylogenetický druhový koncept (phylogenetic species concept)

Rhod rhodopsin

RP1 1. intron ribozomálního S7 r-proteinu

S7 viz RP1

SSRs jednoduché opakující se sekvence (simple sequence repeats)

STRs krátké tandemové repetice (short tandem repeats)

VNTRs tandemové repetice o variabilním počtu (variable number of tandem

repeats)

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic

Jan Mendel et al.* Institute of Vertebrate Biology Academy of Sciences of the Czech Republic, Brno Czech Republic

1. Introduction The term biological diversity (biodiversity) covers the variability of life on Earth. In 1989, the World Wildlife Fund defined biodiversity as “the richness of life on Earth – millions of plants, animals and microorganisms, including the genes which they carry, and complex ecosystems that create the environment” (Primack et al., 2001). The degree of biodiversity was dynamically changing during the centuries and millennia, according to available resources it was gradually growing. In the course of evolution the periods of intensive speciation and relative “speciation rest“ were alternating, with five major episodes of mass extinction (Wilson, 1989; Raup, 1992). The worst extinction event took place at the end of the Permian period, 250 million years ago (Primack et al., 2001), the most recent and also the best known mass extinction event occurred in the late Cretaceous period, i. e. 65 million years ago (Freeland, 2005). From then on, the rate of speciation was in equilibrium with the rate of extinction, or was even higher. Currently, the rate of extinction is 100-1000 times higher, namely almost exclusively in consequence of human activity. Therefore a lot of experts call the present situation the sixth mass extinction (Primack et al., 2001). At present, only approximately 1.5 million species are described, of which the majority is represented by insects and plants (Wilson, 1992). According to various estimates the number of non-described species amounts to 10 million or even 30-150 million (Hammond, 1992). In recent years, when the effort to map and at the same time to protect global biodiversity has been intesifying, it is becoming clear that the existing morphological approach to species classification is not sufficient. Therefore, interest has focused on the methods of molecular genetics. In 2003, a global project aimed at the mapping and protection of global biodiversity using a new taxonomic method called “DNA barcoding” was started. The key personality in this

* Eva Marešová1, Ivo Papoušek1, Karel Halačka1, Lukáš Vetešník1, Radek Šanda2, Milena Koníčková1 and Soňa Urbánková1 1Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, v.v.i. Brno 2Department of Zoology, National Museum, Prague Czech Republic

www.intechopen.com Page 44

288 Analysis of Genetic Variation in Animals initiative was Canadian professor Paul D. N. Hebert from the Biodiversity Institute of Ontario (BIO), who proposed the creation of a global public library of DNA barcodes for all living organisms, also known as BoLD (Barcode of Life Database). The Barcode of Life Data Systems is an informatics workbench for the acquisition, storage, intercontinental comparison and publication of DNA barcode records (Fig. 1).

Visualize Interpret Identify

Browse Share Publish

Fig. 1. Multifunctionality of the BoLD database (adopted from http://ibol.org/resources/barcode-library/) At the same time it bridges a long-standing bioinformatics chasm between molecular, morphological and distributional data. BoLD is freely available to anyone interested in these problems, the identification and preservation of all life on Earth.

2. DNA barcoding The basic assumption behind this method is that every biological species has a short sequence in its genome which is unique to that species, like a fingerprint to every human being. Its mutation rate should be sufficiently fast to enable the divergence of the sequences of closely related species and at the same time slow enough to enable the minimization of the differences between members of the same species. The implementation of a comparative sequence analysis of this carefully selected sequence should enable mutual identification of the individual species. The term DNA barcoding is based on the analogy with EAN barcodes on goods which enable safe identification of the individual products (Hebert et al., 2003a). EAN barcode (Fig. 2) is composed of 10 digits at 11 positions, which gives 1011 possible combinations. The genetic code has only 4 letters (DNA bases) for one position, but the length of that code is incomparably longer. Only with the sequence length of 15 nucleotides, theoretically 415 various combinations are available, which is a number of unique combinations far exceeding even the boldest estimates of the number of biological species living on Earth (Hebert et al., 2003a).

www.intechopen.com Page 45

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 289

The technique of DNA barcoding provides a standardized method based on the mapping of a single gene in all the species on Earth (Hebert et al., 2003a). At present, the fragment of the gene for the first cytochrome c oxidase (COI) subunit appears to be the major marker for species of the animal kingdom. This segment is approximately 650 bp long and the protein it codes is part of the respiration chain. The results suggest that this global standard can also be easily obtained from phylogenetically very distant taxa by using a relatively small set of primers and that it is effective in the differentiation of closely related animal species belonging to a great number of groups of invertebrates and vertebrates (Hajibabaei et al., 2007; Hebert et al., 2003a, 2003 ; Hebert & Barett, 2005; Ivanova et al., 2007).

Fig. 2. EAN barcode (adopted from Brian Krueger).

Hebert et al. (2003b) proposed a limit of a 2% deviation in the barcode sequence for the identification of intraspecific variability. The intraspecific deviation only rarely exceeds 2% and in most cases does not reach 1% (Avise, 2000). They also proposed an experiential rule that the divergence between the species sequences should be 10 times higher than that within one species (Hebert et al., 2004). For the identification of samples with degraded DNA, Hajibabaei et al. (2006) and Meusnier et al. (2008) proposed using shorter COI segments, the so-called “universal mini-barcodes“ of a length smaller than 150 bp. Thus they provided a reliable solution for the identification of older tissues, badly preserved museum specimens, partly digested pieces of food in animal stomachs, etc. The results indicate that although the selection of a concrete position of the mini-barcode plays an important role concerning the success of identification, generally it can be stated that the mini-barcodes analysis provides virtually the same results as the specific full-barcode analysis.

2.1 Global progression of DNA barcoding In April 2004, the Consortium for Barcode of Life (CBOL) was established (Schindel & Miller, 2005). It is an international collaborative effort of more than 160 member organizations from more than 50 countries on six continents (http://barcoding.si.edu, Hebert et al., 2004). CBOL´s mission is to develop the potential of DNA barcoding as a practical and financially affordable tool for taxonomic research, the study and preservation of biodiversity and the development of applications which will utilize the taxonomic information for the benefit of science and society. Since 2004, a number of campaigns and projects striving to map global biodiversity of all life on Earth have been started (http://ibol.org/about-us/campaigns/):

 Formicidae Barcode of Life – a campaign aimed at barcoding all of the world’s more than 12,000 ant species.  Bee Barcode of Life Initiative (Bee-BOL) – a global effort to assembly the barcodes of all 20,000 bee species.

www.intechopen.com Page 46

290 Analysis of Genetic Variation in Animals

 All Birds Barcoding Initiative (ABBI) – the aim is to collect DNA barcodes of all of the approximately 10,000 known bird species. The genetic analyses made within the project show that there are hundreds of bird species which have not been described yet.  Trichoptera Barcode of Life – the aim of the project is to barcode the world’s approximately 13,000 species of caddisflies.  Coral Reef Barcode of Life – a detailed study of fishes living at one site of the Great Barrier Reef.  Fish Barcode of Life Initiative (FISH-BOL) – a project aimed at the mapping of global ichthyofauna involving 31,200 known fish species (Ward et al., 2009). This initiative also includes the Czech project „Molecular biodiversity inventory of the ichthyofauna of the Czech Republic” which has been introduced here.  All Fungi Barcoding – a project associating initiatives mapping the global diversity of fungi.  HealthBOL – an initiative coordinating the barcoding of vectors, pathogens, and parasites for the improvement of human health around the world.  Lepidoptera Barcode of Life – a campaign mapping all butterflies, with an associated sub-campaign for selected families of Australia and North America.  Mammal Barcode of Life – a project studying global mammal fauna is part of the initiative encompassing all vertebrates.  Mosquito Barcoding Initiative – an international effort aimed at the identification of approximately 3,200 known mosquito species, the disease-bearing species being the priority.  Marine Barcode of Life campaign (MarBOL) – a joint project of the Consortium for the Barcode of Life (CBOL) and the Census of Marine Life (CoML) is aimed at the comprehensive mapping of the diversity of the world’s oceans.  Polar Barcode of Life campaign – a campaign studying the biodiversity of the Arctic and Antarctic. It includes marine, freshwater and terrestrial ecosystems.  Shark Barcode of Life – a project aimed at the barcoding of sharks. It plans for 1,000 marine and 100 freshwater shark species.  Sponge Barcoding Project – it is the first global project studying diploblastic species using DNA barcoding. It covers the complete taxonomic range of Porifera. The existing projects proceed successfully and have already brought the first results regarding various groups of plants and animals, e. g., birds (Hebert et al., 2004), gorillas (Thalmann et al., 2004), tropical beetles (Monaghan et al., 2005), spiders (Barrett & Hebert., 2005), ants (Fisher, 2006), flowering plants (Kress et al., 2005), amphibians (Vences et al., 2005), fishes (Ward et al., 2005), etc. Currently, as many as 1,371,809 DNA barcodes are identified and stored, which corresponds to approximately 113,435 denominated species (as of September 30, 2011). The collaborating scientific teams have set a goal by 2015 to collect 5 million barcodes/specimens for 500,000 species.

2.1.1 Fish DNA barcoding In 2005, the FISH-BOL initiative was established. It is an expression of the global effort to develop and coordinate a standardised library of sequences for all fish species. For this

www.intechopen.com Page 47

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 291 purpose a guideline containing DNA barcodes, photographs of the studied specimens, geospatial coordinates of the locations of the finds, etc. was issued. It also contains references to type specimens, information on species distribution, nomenclature, author taxonomic information, literature citations, etc. Thus, it complements and enhances the information resources available so far – the genome databases (GenBank, EMBL, DDBJ), including the internet encyclopaedia FishBase. Barcoding in fish has multiple usages, of which we select only some:

 Identifying endangered and protected species (Ward et al., 2008)  Identifying historical and museum material (Meusnier et al., 2008)  Identifying new and cryptic species and possible fusions of existing taxa, and insight into phylogenetic relationships (Pyle et al., 2008)  The development of a reference library for known species (Ratnasingham & Hebert, 2007) Fishes are the most diversified group of vertebrates; at present, there are about 30,000 known species, including 15,758 (53.3%) marine species, 13,779 (46.4%) freshwater species and 86 (0.3%) brackish species (Ward et al., 2005). By September 2011, DNA barcodes were obtained from 8,293 species (27%) in the world, and from 503 species (25%) in Europe (http://www.fishbol.org/progress.php). Some of the best-known projects utilizing the DNA barcoding in fishes are: 1. “Barcoding Marine Fishes: A Three-Ocean Perspective Project”. The goal of this project is to obtain DNA barcodes of all marine species in the Pacific, Indian and Atlantic oceans. Participating countries include Canada, Australia, South Africa and Portugal. 2. “Planetary Biodiversity Inventories – Catfishes”. It incorporates 300 participants from 40 countries whose work is taking an inventory of catfishes (Siluriformes). 3. “The Cypriniformes Tree of Life Initiative” (CToL), an American initiative aimed at the collection and analysis of DNA samples and reference specimens of nearly all North American freshwater species (~ 1100 species).

2.1.2 The state of the molecular biodiversity inventory of the ichthyofauna of the Czech Republic and introduction of the project The study and recognition of genetic diversity in the Czech Republic has an approximately twenty-year history. Although the methods of biochemical genetics which were used in the past brought significant knowledge, only the application of molecular-genetic methods allowed significant detailed recognition and disclosure of the genetic diversity of species at the level of populations (Lusk & Hanel, 2008). Existing information about the genetic diversity of the individual species of the native ichthyofauna of the Czech Republic was and still is insufficient. The result of the research project VaV – SM/6/3/05 “Genetic diversity of endangered fish species - the essential basis for effective biodiversity protection” brought a breakthrough in the recognition of genetic diversity, especially of the protected and endangered species. The project was conducted in 2005-2007 in cooperation between our department and the research workers from the Institute of Animal Physiology and Genetics, v.v.i., Liběchov. This allowed the presentation of the first taxonomic approaches to some species of the Czech ichthyofauna (Bartoňová et al., 2008; Mendel et al., 2005; Mendel et al.,

www.intechopen.com Page 48

292 Analysis of Genetic Variation in Animals

2008a; Papoušek et al., 2008a, 2008b; Vetešník et al., 2007). Other taxonomic studies of our team are included in the proceedings “Biodiversity of fishes in the Czech Republic VII”, which paid attention to the problems of the genetic diversity of some protected and rare fish species of the Czech Republic. Apart from the study of actual intra-species diversity, attention in this book was also paid to the distribution or specification of the occurrence of the studied species (Bartoňová et al., 2008; Lusk et al., 2008a, 2008b; Lusková et al., 2008a, 2008b; Mendel et al., 2008b, 2008c; Papoušek et al., 2008b). The main goal of the presented project is the mapping and inventory making of all Czech ichthyofauna using the DNA barcoding technique. In addition to that, in the case of archived specimens forming new museum type series a comprehensive approach was used (morphology and nuclear genome analysis). A study of this type has been lacking in the Czech Republic. It is unique due to its comprehensiveness using both the classical and the newest taxonomic tools and due to its future potential – the intercontinental mapping of the diversity of life on Earth. Thanks to our cooperation with the Biodiversity Institute of Ontario the Czech Republic became actively involved in the international iBOL project (International Barcode of Life Project), namely in its part which was already mentioned above – FISH-BOL (Fish Barcode of Life Initiative). Thus, the Czech study took the side of already finished or currently running studies which take place within whole countries and continents, e. g.: - Fishes of Australia (Ward et al., 2005) - Barcoding of Canadian freshwater fishes (Hubert et. al., 2008) - DNA barcoding of fish of the Antarctic Scotia Sea (Rock et al., 2008) - Freshwater fishes from Mexico and Guatemala (Valdez-Moreno et al., 2009) - Aquarium Imports (Steinke et al., 2009) - Fishes of Alaska and the Pacific Arctic (Mecklenburg et al., 2011) - Amazon fishes (Ardura et al., 2010) - DNA Barcoding of Indian Marine Fish (Lakra et al., 2011) - Fishes of Japan (Zhang & Hanner 2011) - Freshwater Fishes of North America (April et al., 2011) - Barcoding Fishes of Eastern Nigeria (Nwani et al., 2011) - Fishes of Argentina (running project) - Fishes from South China Sea (running project) - Etc. More information can be found at: http://www.boldsystems.org/views/projectlist.php

3. Material and methods The inventory and subsequent cataloguing were focused on recent indigenous and non- indigenous fishes and lampreys living in the natural waters of the Czech Republic. It concerned 11 orders, 17 families and 72 species. The selection of collection localities covered the main distribution areas of the studied taxa according to comprehensive surveys and the most recent taxonomic and phylogenetic studies (Baruš & Oliva, 1995; Hanel & Lusk, 2005; Kottelat & Freyhof, 2007; Janko et al., 2007; Mendel et al., 2008d, etc). The collection of samples was divided into three levels:

www.intechopen.com Page 49

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 293

- classification of the first level is based on the hydrologic position of the Czech Republic (Fig. 3) Concerning hydrologic division, the Czech Republic belongs to three sea drainage areas (the North Sea, Baltic Sea and Black Sea drainage areas).

Fig. 3. Collection localities – 1st level of classification.

- classification of the second level (Fig. 4) The hydrologic network of the Czech Republic was further divided into six areas, which for the most part correspond with the division of state administration: I. the Ohře River basin (the North Sea drainage area, the actual Ohře River basin and parts of other tributaries of the Elbe), II. the Vltava River basin (the North Sea drainage area, without the Ohře and the Elbe River basins), III. the Elbe River basin (the North Sea drainage area, without the Ohře and the Vltava River basins), IV. the Dyje River basin and the lower course of the Morava River, V. the Morava River basin (the Black Sea drainage area, the upper and middle courses of the Morava River), VI. the Odra River basin (the Baltic Sea drainage area).

Fig. 4. Collection localities – 2nd level of classification.

- classification of the third level The selection of the sampling localities for the given species was further specified according to up-to-date information concerning its distribution, according to the specific features of the given species (for example, the Natura 2000 localities, etc.) and with regard to the

www.intechopen.com Page 50

294 Analysis of Genetic Variation in Animals elimination of “family sampling”. In the case of threatened and critically endangered fish species (Pelecus cultratus, Zingel zingel, Zingel streber, etc.) the database of the tissue samples collected by our workplace in the past was used. The capturing of adult specimens was done using electro-fishing gear (direct pulsed current) in collaboration with the Czech and Moravian Fishing Unions and the representatives of the Agency for Nature Conservation and Landscape Protection of the Czech Republic. Approximately 1,400 specimens were taken for subsequent molecular-genetic analyses. From the captured specimens (about five individuals per location) a part of the pectoral fin (fin border) was taken and then they were released back into the stream. Only an indispensable number of complete type specimens were taken for morphological description and museum collections. The identification of the individual species was made on the background of the study of morphological characteristics of the species using a multilocus and two-genome comparative approach (analysis of both mt and nDNA markers). Thus some limitations of the DNA barcoding method were eliminated, e. g. a) occurrence of hybrids; b) maternal contribution to COI marker as only one part of the information necessary for a valid description of a species. For reasons of saving space we do not present here the morphological characteristics of the individual species and the detailed results of the analyses of the nuclear marker – 1st intron of the S7 r-protein (RP1). The preparation of the DNA barcodes conformed to the standardized protocols developed by the CCDB Centre, the FISH-BOL initiative and the BoLD database (http://www.ccdb.ca/ pa/ge/research/protocols; Ratnasingham & Hebert, 2007; Hajibabaei et al., 2005; deWaard et al., 2008). DNA isolation was performed by using a commercial kit - the Genomic DNA Mini kit (KRD) – according to the instructions for use. Cocktails of primers from the genetic study (Ivanova et al., 2007) were used for PCR amplification of the COI gene fragment (Fig. 5). For sequencing PCR, mainly M13F and M13R primers (Messing, 1983) were used, in a small number of cases the primers described by Ivanova et al. (2007) were used.

Fig. 5. Mitochondrial DNA – the area of the COI marker – adopted from http://www.barcodeoflife.org.

www.intechopen.com Page 51

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 295

At the Canadian workplace, the subsequent steps were performed according to the above mentioned protocol. At the Czech workplace, the PCR products were re-purified by precipitation with PEG/Mg/NaAc solution (26% Polyethylene glycol, 6.5 mM MgCl2 . 6H2O, 0.6 M NaAc.3H2O) and subsequently used for the sequencing reaction using BigDyeTM Terminator Cycle Sequencing kit v 1.1. (Applied Biosystems), performed according to the manufacturer´s instructions. The products of the sequencing reaction were re-purified with ethanol precipitation. For the COI sequencing, the instrumentation of the Canadian BIO workplace (ABI 3730XL; Applied Biosystems) was used and for test and complementary COI sequencing and nuclear marker analysis also the instrument ABI PRISM 310 (Applied Biosystems) at the Czech workplace was used. Also, commercial sequencing (Macrogen, Korea) was used in optimized samples. The analyzed fragment of mitochondrial DNA from each sample was sequenced from both directions. Chromatograms were adjusted and developed using the computer module SeqManII (part of the program package Lasergene v. 6.0; DNASTAR Inc.) and MEGA software. The developed sequences were visually checked for errors and subsequently compared using the ClustalW algorithm. The correct taxonomic classification of the sequences was confirmed using comparison with the GenBank and BoLD databases. An electropherogram depicting the order of nucleotides in the sequence was obtained through sequencing. With its subsequent processing the DNA barcode was produced (Fig. 6).

Fig. 6. DNA barcode.

The individual steps of the barcoding process are shown in Figure 7. The morphologic characteristics were identified in selected adult specimens to enable the establishment of a reference type series. A holotype was selected as a nomenclatoric type and other specimens from the described group were assigned to it as the documentary material (paratypes). For the purpose of the cataloguing of the taxa of the ichthyofauna of the Czech Republic using the DNA barcoding method, the basic data concerning each specimen were collected and completed, including the body length (SL), weight and sex, photo documentation, locality description (including the GPS coordinates), date of collection and the person who caught or identified the specimen, the catalogue number and place of storage. The COI sequences of a length of at least 500 bp and the sequences of used PCR primers were recorded as well. For further details see the instructions of the National Museum and the standardized protocol of the BoLD database (http://www.boldsystems.org/docs/ boldmas.html; Ratnasingham & Hebert, 2007). In all archived specimens of each species a sequencing of RP1 marker from nuclear genome was also performed in order to exclude the presence of hybrid specimens. The correct nuclear identification is ensured by sequence comparison with the results of various studies from both domestic and foreign workplaces (e. g., He et al., 2008; Mayden et al., 2008; Mendel et al., 2008d; etc.) and international initiatives (Cypriniformes Tree of Life; Assembling the Tree of Life; etc.)

www.intechopen.com Page 52

296 Analysis of Genetic Variation in Animals

Fig. 7. The barcoding pipeline (http://www.barcodeoflife.org/content/about/what-dna barcoding).

The platform of the BoLD system (http://www. barcodinglife.org) with three identification- statistical modules - MAS, IDS and ECS - was used for the organization of the results. The obtained sequences are saved by the CBOL consortium primarily in the BoLD datasystem and then automatically sent, within INSDC (International Nucleotide Sequence Database Collaboration), to the interconnected databases: GenBank, EMBL and DDBJ. For more information see the standardized protocol of the CBOL consortium: http:// www.dnabarcoding.ca/pa/ge/research/protocols/.

4. Results An analysis of the COI gene sequences of 500-652 bp in length was performed on 820 individuals from 67 species, which represent 93.1% of the Czech ichthyofauna (Table 1). The map of sampling distribution (Fig. 8) clearly shows that we have evenly sampled the whole territory of the Czech Republic. Altogether, 109 localities were sampled. The number of individuals per species ranged from 1 to 31, with an average number of 12 individuals per species. Out of a total number of 72 species, the following species, which occur very rarely, were not analysed: Micropterus salmoides, Romanogobio banaticus, Romanogobio belingi, Ameirus melas and Acipenser baeri. Only one or two individuals were analysed in some critically endangered (Zingel zingel, Zingel streber, Sabanejewia balcanica, Eudontomyzon mariae, Pelecus cultratus, Ballerus sapa, Gymnocephalus schraetser), and endangered (Misgurnus fossilis) species. Neither insertions/deletions nor stop codons were found, thus encouraging the view that all amplified sequences represent functional COI gene sequences.

www.intechopen.com Page 53

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 297

No of Intraspecies Family Species N haplotypes difference range (%) Acipenser gueldenstaedtii 3 (+1) 1 (+1)* 0 (4.484) Acipenseridae Acipenser ruthenus 4 1 0 Acipenser stellatus 5 1 0 Anguillidae Anguilla anguilla 5 5 0.154 – 3.494 Balitoridae Barbatula barbatula 27 13 0 – 5.967 Centrarchidae Lepomis gibbosus 10 1 0 Cobitis sp. 3 2 0 – 0.677 Cobitidae Misgurnus fossilis 1 1 - Sabanejewia balcanica 1 1 - Cottus gobio 21 4 0 – 0.773 Cottidae Cottus poecilopus 15 6 0 – 2.681 Abramis brama 29 4 0 – 0.617 Alburnoides bipunctatus 14 5 0 – 0.617 Alburnus alburnus 26 4 0 – 0.308 Aspius aspius 14 2 0 – 0.308 Ballerus ballerus 3 1 0 Ballerus sapa 2 1 0 Barbus barbus 25 2 0 – 0.163 Blicca bjoerkna 14 (+1) 4 (+1)** 0 – 0.308 (4.316) Carassius carassius 16 5 0 – 1.266 Carassius gibelio 27 6 0 – 0.621 Carassius langsdorfii 3 1 0 Ctenopharyngodon idella 3 1 0 Cyprinus carpio 10 2 0 – 0.31 Gobio gobio 27 (+1) 3 (+1)*** 0 – 0.308 (11.420) Gobio obtusirostris 5 3 0 – 0.308 Cyprinidae Hypophthalmichthys molitrix 3 1 0 Chondrostoma nasus 25 5 0 – 0.308 Leucaspius delineatus 5 2 0 – 3.808 Leuciscus idus 13 4 0 – 0.621 Leuciscus leuciscus 21 (+5) 2 (+1) † 0 – 0.161 (0.933) Pelecus cultratus 2 1 0 Phoxinus phoxinus 25 10 0 – 3.973 Pseudorasbora parva 22 7 0 – 1.084 Rhodeus amarus 18 7 0 – 1.244 Romanogobio vladykovi 7 3 0 – 0.618 Rutilus rutilus 31 7 0 – 0.795 Scardinius erythrophthalmus 16 1 0 Squalius cephalus 28 4 0 – 5.252 Tinca tinca 24 3 0 – 1.521 Vimba vimba 4 1 0 Esocidae Esox lucius 22 4 0 - 0.772 Gasterosteidae Gasterosteus aculeatus 2 1 0 Neogobius melanostomus 5 1 0 Gobiidae Proterorhinus semilunaris 6 2 0 – 1.087 Ictaluridae Ameiurus nebulosus 2 1 0 Lotidae Lota lota 16 3 0 – 0.308

www.intechopen.com Page 54

298 Analysis of Genetic Variation in Animals

Gymnocephalus baloni 1 1 - Gymnocephalus cernua 16 5 0 – 0.798 Gymnocephalus schraetser 2 1 0 Perca fluviatilis 29 5 0 – 0.772 Percidae Sander lucioperca 16 1 0 Sander volgensis 2 1 0 Zingel streber 1 1 - Zingel zingel 1 1 - Eudontomyzon mariae 2 2 0.197 Petromyzontidae Lampetra planeri 14 3 0 – 0.308 Coregonus maraena 4 (+1) 1 (+1)†† 0 (1.558) Coregonus peled 5 4 0 – 0.618 Hucho hucho 2 1 0 Oncorhynchus mykiss 24 5 0 – 0.308 Salmonidae Salmo salar 3 2 0 – 0.154 Salmo trutta 31 4 0 – 1.087 Salvelinus fontinalis 16 4 0 – 0.617 Thymallus thymallus 16 2 0 – 0.155 Siluridae Silurus glanis 11 1 0 Umbridae Umbra krameri 5 1 0 Table 1. List of species analysed in the current study. N - number of studied individuals (further individuals with haplotypes shared with another species in parentheses). No of haplotypes - number of COI haplotypes found (further haplotypes shared with another species in parentheses). * - shared haplotype with Acipenser ruthenus. ** - shared haplotype with Abramis brama. *** - shared haplotype with Romanogobio vladykovi. † - shared haplotype with Leuciscus idus. †† - shared haplotype with Coregonus peled. Intraspecies difference range - range of intraspecific genetic distances excluding haplotypes shared with another species (maximum genetic distance including shared haplotypes in parentheses).

Fig. 8. Overview of sampling localities in the Czech Republic. The borders of the Czech Republic are schematically drawn in red.

www.intechopen.com Page 55

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 299

As we expected, we found a growing genetic divergence with raising taxonomical level. On the intra-species level, the distances ranged 0-5.97% (Fig. 9), not including inter-specific shared haplotypes (hybrids, misidentifications etc.). Intra-specific diversities exceeding 5% were detected in Barbatula barbatula (the highest value of 5.97% was found here), and in Squalius cephalus (0-5.25%), values exceeding 2% were found in Phoxinus phoxinus (0-3.97%), Anguilla anguilla (0.15-3.49%), Leucaspius delineatus (0-3.81%) and Cottus poecilopus (0-2.68%). In these six mentioned species, there was an apparent deep divergence of the lineages that had been assigned to a single species. Two or three (B. barbatula, S. cephalus) lineages were distinguished in each species, both from the phylogenetic tree (Fig. 10) and the list of variable sites (Fig. 11). Two lineages can also be distinguished in the following species, although they possess lower genetic distances: Tinca tinca (0-1.52%) and Carassius carassius (0-1.27%). In Rhodeus amarus, a single individual diverges from all other, which raises the mean intra-species diversity from 0.46 to 1.09%.

Fig. 9. Plot of an average intraspecific divergence. Species that exceeded 2% are listed.

An analysis of distribution of the nearest-neighbour distance (NND, the minimum distance between a species and it closest – usually congeneric – relative, Table 2) has shown that only a single species pair exhibited NND lower than 1%, that being namely: Leuciscus leuciscus and L. idus. The NND averaged 9.67%, which was 40 times higher than the mean within species distance (ca. 0.25%) and 14 times higher than the mean maximum intraspecific distance (0.70%). We have detected altogether nine cases of shared barcode haplotypes: one Acipenser gueldenstaedtii individual possessed an A. ruthenus haplotype, one Blicca bjoerkna individual possessed an Abramis brama haplotype, one Gobio gobio individual possessed a R. vladykovi haplotype, one Coregonus maraena possessed a C. peled haplotype, and five Leuciscus leuciscus carried a L. idus haplotype. A phylogenetic tree based on all sequences longer than 500 bp, employing the Kimura-2- parametr (K2P) model is available on http://www.ivb.cz/projects-molecular-

www.intechopen.com Page 56

300 Analysis of Genetic Variation in Animals biodiversity-inventory-of-the-ichthyofauna-of-the-czech-republic.html. Subsequently, we selected the representatives of all species or intra-species lineages with intra-species distance at least three times higher (1.176%) than the mean distance within the species (0.392%; Hubert et al., 2008). Based on these sequences, a reduced phylogenetic tree was constructed and put through a bootstrap analysis of 1000 replications. The reduced phylogenetic tree (Fig. 10) documents strong bootstrap support both on the level of genera and on family level. Only the most numerous family Cyprinidae has exhibited moderate support. The Neogobius and Proterorhinus genera were not supported in forming a single clade of the Gobiidae family. The phylogenetic tree supports the most recently proposed changes in the scientific taxonomical nomenclature. According to recent taxonomical opinions and studies (Froese & Pauly, 2010; Kottelat & Freyhof, 2007; Perea et al., 2010), A. sapa and A. ballerus have been currently sorted into the genus Ballerus; Abramis bjoerkna now belongs again to the Blicca genus, L. cephalus into Squalius and it is suggested that Aspius aspius be included into Leuciscus. All these proposales are reflected in the tree, as the above mentioned species always cluster together.

Order Family N < 0.1 0.1 - 1.0 1.0 - 2.7 > 2.7 Acipenseriformes Acipenseridae 3 3 Cypriniformes Cobitidae 3 3 Cyprinidae 30 2* 2** 26 Balitoridae 1 1 Scorpaeniformes Cottidae 2 2 Salmoniformes Salmonidae 8 2*** 6 Petromyzontiformes Petromyzontidae 2 2 Esociformes Umbridae 1 1 Esocidae 1 1 Perciformes Gobiidae 2 2 Percidae 8 8 Centrarchidae 1 1 Gadiformes Lotidae 1 1 Anguilliformes Anguillidae 1 1 Siluriformes Siluridae 1 1 Ictaluridae 1 1 Gasterosteiformes Gasterosteidae 1 1 Totals: 67 0 2 4 61 Table 2. Summary of Czech ichthyofauna diversity and distribution of genetic distance of each species analysed to nearest neighbour (in per cent). N - number of species in family. * - Leuciscus idus and Leuciscus leuciscus (0.62%). ** - Blicca bjoerkna and Vimba vimba (2.51%). *** - Coregonus peled and Coregonus maraena (1.4%).

www.intechopen.com Page 57

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 301

Fig. 10. K2P/NJ tree of representatives of each species, or lineage within species. Bootstrap values are listed near the nodes, only values ≥75% are shown. Families are listed in colour. Species showing an internal divergence more than three times higher than the mean distance within the species are listed in bold italics.

www.intechopen.com Page 58

302 Analysis of Genetic Variation in Animals

Fig. 11. Summary of variable sites in the COI gene in haplotypes of nine species showing an internal divergence more than three times higher than the mean distance within the species. Numbers show variable position of nucleotide in whole 652 bp sequence. Dots represent nucleotide identical with first sequence.

5. Discussion This study presents the first molecular screening of the whole Czech ichthyofauna. Indeed, the position of our project, „The Ichthyofauna of the Czech Republic“ (abbreviated IFCZE in the BoLD database), is in a certain sense unique. Table 3, which compares genetic divergences on various taxonomic levels in projects spanning countries across continents from North America to Asia, Australia and Africa, contains only a single project representing the European ichthyofauna – Czech project. It is the first and currently the only public project in BoLD database dealing with the barcoding of European ichthyofauna on this scale. Among the analyzed species, there was no species endemic to the Czech Republic. Aside from indigenous species, further 18 non-indigenous species introduced in the past to the Czech ichthyofauna were also tested. One species is considered to be regionally extinct in the wild, 12 species are considered to be critically endangered, five to be endangered and six to be vulnerable according to the IUCN classification (Lusk et al., 2011). Also included in the project was the Umbra krameri, while its indigenity to the Czech Republic is currently disputed.

www.intechopen.com Page 59

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 303

The amplification of the 5‘ region of the COI gene (up to 652 bp) was successful for all 820 tested individuals, while utilizing a single primer set for amplification of all tested species. No nuclear copies of the COI gene were detected, neither frame shifts nor mutations causing the emergence of stop codons. By means of DNA barcoding, all tested species could be successfully distinguished. The DNA barcodes were acquired for 67 species. An example of such a barcode record can be seen in Figure 12.

CAN MEX NorthAm. IND PHL NGA AUS CZE min% within species 0 0 0 0 0 0 0 0 within genus 0 0 0 0.10 10.0 1.80 0 0 within family 2.67 1.804 0.185 0.20 5.50 0.46 1.39 0 within order 14.25 17.24 14.53 8.00 16.20 15.52 9.55 18.07 within class 17.49 17.88 16.42 - - 18.46 14.33 18.36 mean dist% within species 0.27 0.45 2.52 0.30 0.60 0.30 0.39 0.39 within genus 8.37 5.10 14.10 6.60 11.70 1.90 9.93 5.00 within family 15.38 13.57 16.00 9.91 17.67 17.19 15.46 14.85 within order 20.60 23.38 21.50 16.00 24.80 21.62 22.18 24.62 within class 24.57 25.34 24.80 - - 25.40 23.27 24.87 max dist% S.E. within species 7.42 2.11 15.45 0.30 9.30 22.38 14.80 11.61 0.013 within genus 19.33 16.67 23.68 11.90 15.30 36.61 20.63 11.20 0.067 within family 23.22 28.48 29.92 23.10 22.60 24.82 35.7 24.46 0.011 within order 29.44 28.77 30.95 23.40 31.50 28.12 37.52 28.84 0.013 within class 31.20 31.16 37.50 - - 31.90 37.39 30.77 0.004

species 190 76 605 98 23 59 207 61 genus 85 56 134 78 21 33 122 51 family 28 32 36 53 17 19 ? 17 order 20 11 18 24 9 8 ? 11 class 2 2 2 4 - 2 ? 2 Table 3. Comparison of genetic divergences (K2P model used) within various taxonomic levels among selected freshwater and marine fishes BoLD projects. (CAN-Barcoding of Canadian freshwater fishes, MEX-Freshwater Fishes of Mexico, NorthAm-Freshwater Fishes of North America, IND-Marine Fishes of India, PHL-Freshwater Fish of Taal Lake, Philippines, NGA- Barcoding Freshwater Fishes of Eastern Nigeria, AUS-Marine Fishes of Australia, CZE-Ichthyofauna of the Czech Republic).

The barcoding of the Czech ichthyofauna has not ended yet: several further species (M. salmoides, R. banaticus, R. belingi, A. baerii, and A. melas) are currently being tested as well. Therefore, the analyzed sample set currently covers 67 of 72 species, or 93.1% of the Czech ichthyofauna. Certain species are present in all six investigated regions and were therefore analysed in greater numbers and in some cases exhibited greater haplotype variability (e.g. B. barbatula, 27 individuals/13 haplotypes or P. phoxinus, 25 individuals/10 haplotypes. For more details see Table 1.

www.intechopen.com Page 60

304 Analysis of Genetic Variation in Animals

Overall, the mean congeneric divergence was ca. 13 times higher than the mean conspecific divergence (5.00 vs 0.39%, Table 3). These values are in good concordance with the results of Valdez-Moreno et al. (2009), which studied the diversity of ichthyofauna in Mexico and Guatemala (5.10 vs 0.45%, Table 3). The divergence ratio was higher in studies dealing with the ichthyofauna of Australia (25x, Ward et al., 2005), Canada (31x, Hubert et al., 2008) and the Philippines (19x, Aquilino et al., 2011) (Table 3). Such a low divergence in our project is probably caused by overall more recent speciation of the freshwater species in comparison to their marine counterparts (which are included in the mentioned projects). This is also supported by the results of the marine project from India (27x, Lakra et al., 2011), China (50x, a running project) and Japan (59x, Zhang & Hanner, 2011). The overlapping of conspecific and congeneric levels of divergence was minimal: only two genera have shown inter-specific distance between the nearest neighbours lower than 2.7%: Leuciscus – L. leuciscus and L. idus (0.62%) and Coregonus – C. peled and C. maraena (1.4%). Interestingly, in one case an inter-specific distance lower than 2.7% occurred between two non-congeneric species: B. bjoerkna and Vimba vimba (2.51%, Table 2). Zardoya & Doadrio (1999) and Cunha et al. (2002) observed the same effect, based on the sequencing of a different marker. All congeneric species always clustered together in the phylogenetic analysis. Furthermore, several species pairs (not always congeneric) have been shown to possess shared haplotypes. In most cases, a single individual of one species bore a haplotype typical of a close (sister) species. Such was the case of a single B. bjoerkna among A. brama, G. gobio among R. vladykovi, C. maraena among C. peled, and A. gueldenstaedtii among A. ruthenus. All these cases can be easily explained as simple hybridization, in the case of Coregonus even human-driven intentional hybridization, (with the second species being the maternal one due to the maternal inheritance of mtDNA), which was confirmed by the sequencing of the nuclear marker (first intron of the S7 ribosomal protein gene). The last species pair, L. leuciscus and L. idus, represented an exception. We found five individuals classified as L. leuciscus bearing the haplotype of L. idus. These two species also presented the lowest mutual genetic distance from all analyzed species pairs (0.62%). We therefore conclude that in these two species, not only hybridization (as confirmed by the sequencing of S7) but also probably recent speciation might have taken place in the genetic similarity of both species. Analyses have revealed a significant deep intraspecies divergence in several taxa. In most cases, those are species with large areas (Kottelat & Freyhof, 2007), such as B. barbatula, L. delineatus, P. phoxinus or S. cephalus. The most pronounced example is the stone loach (B. barbatula). The DNA barcoding technique has revealed high intra-specific divergence (up to 5.97%, Table 1). We have tested 27 individuals from six regions and we found 13 haplotypes diverging into three lineages (Table 1, Fig. 10, Fig. 11). Šedivá et al. (2008) has described the presence of the lineage V in the Labe River basin and the sublineage Va in the Morava River basin, both of the lineages belonging to the Danubian clade. Our results are in good concordance with these findings. Furthermore, we have distinguished a third, the most divergent lineage, occurring in the Odra River basin. This lineage possibly belongs to the Eastern clade similarly to previously detected individuals from the same basin in Poland (Šedivá et al., 2008).

www.intechopen.com Page 61

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 305

Fig. 12. An example of barcode record of the species.

The second deepest divergence has been detected in chub (S. cephalus). We have tested 28 individuals and found four haplotypes, diverging into two lineages (Table 1, Fig. 10, Fig. 11), separated by 5.25%. The less abundant lineage occurred only in the North Sea drainage area (Labe and Vltava River basins), the second, more numerous lineage was found across all river basins. Seifertová et al. (2008) in their large study of phylogenetic diversity of chub across its European range distinguished four different haplogroups, corresponding to four lineages, i.e. the Western, Eastern, Aegean and Adriatic (sensu

www.intechopen.com Page 62

306 Analysis of Genetic Variation in Animals

Durand et al., 1999) ones, with the populations collected in the Czech Republic belonging to the Western Lineage. It is probable that our more prevalent lineage corresponds to the Western lineage, sharing its distribution pattern. It is unclear, but possible that the second of our lineages corresponds to the Eastern lineage. However, the Eastern lineage was not found by Seifertova et al. (2008) in the North Sea basin, but in populations from the Vistula River basin in Poland and in Finland. Therefore we cannot exclude the possibility that we have found a new, fifth lineage. A definite conclusion about the identity of lineages can not be drawn due to different markers utilized in both studies. The existence of other deeply divergent lineages of chub is also evident e.g. in Perea et al. (2010), who found two lineages of chub in their study of phylogenetic relationships in the Circum-Mediterranean subfamily Leuciscinae. It is clear that the taxonomy of S. cephalus needs to be further addressed; both on the level of additional samples, which we have already collected, and by the unification of utilized markers. The DNA barcoding further discriminated two deep lineages in two other cyprinid species, P. phoxinus (lineages separated by 3.97%) and L. delineatus (lineages separated by 3.81%). In the most recent Red List of the Czech Republic, the minnow (P. phoxinus) is classified as vulnerable (Lusk et al., 2011). The priority task in the protection of minnow lies in the long- term sustenance of water quality, the segmentation of river bed and banks together with thoughtful fishing and angling management (Hanel & Lusk 2005). We have tested 25 individuals from six regions and we distinguished 10 haplotypes diverging into two lineages (Table 1, Fig. 10, Fig. 11). Lineage I is located in water courses flowing into the North and Black Sea drainage areas and the lineage II is located in the Baltic Sea drainage area (including the Bečva River). While the Bečva River currently belongs to the Black Sea drainage area, here we can consider an ancient proximity or identical origin of the two populations, as during the Pleistocene (e.g. the Elster glaciation) the waters of the Odra flowed towards the south into the drainage area of the river Bečva (Czudek, 1997). The systematics of the genus Phoxinus has not been solved yet. The belica (L. delineatus) is currently classified among the critically endangered species in the Red List of the Czech Republic (Lusk et al., 2011). Apart from food competition and the continuous forcing out of original localities by invasive species, its vanishing is also probably influenced by the spread of a disease caused by the pathogen Sphaerothecum destruens, which came to Europe through an invasion the invasive fish species Pseudorasbora parva with the import of herbivorous fish fry (Gozlan et al., 2005; Hanel & Lusk 2005). Interestingly, both our lineages of the belica coexist in the same locality. Those five tested individuals came from one fish hatchery in the Ohře River basin. Currently, there is no detailed phylogenetic study of this species. Only Perea et al. (2010) dealt with the taxonomy and systematics of this genus, but based on two individuals only and in the context of general phylogenetic relationships and biogeographical patterns in the Circum- Mediterranean subfamily Leuciscinae. Our studies of this species continue in order to collect individuals from further localities. We also aim to evaluate hybrid events in the scope of uncovered lineages based on a nuclear marker. Two separate lineages were also detected in eel (A. anguilla) (3.49%) and Siberian bullhead (C. poecilopus) (2.68%). The intra-specific diversity of eel on a molecular level has not been studied yet. Both of our two lineages were found in North Sea and Baltic Sea drainage areas. However, when performing a comparison of our sequences with other sequences stored in

www.intechopen.com Page 63

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 307

BoLD, one of these lineages is identical to samples of the American eel (A. rostrata). Kottelat & Freyhof (2007) mention that the American eel has been stocked in Eastern Europe; our findings confirm their suspicion that the presence of isolated individuals of American eel cannot be ruled out in our free waters. In order to confirm these findings, further samples will be evaluated. In the Siberian bullhead, Lusk et al. (2008a) distinguished two complexes based on the sequencing of the cyt b gene and mitochondrial control region: the “baltica“ complex, which consists of the populations from the Baltic Sea drainage area, and the “danubialis“ complex, which consists of the populations from the Black Sea drainage area. An existence of the lineages uncovered in this study further supports these findings: our tested populations from the Odra River basin fall into the “baltica“ complex, the individuals from the Morava and Dyje River basins fall into the “danubialis“ complex. Lusk et al. (2008a) also further discuss the necessity of a more complex genetic analysis (utilizing a nuclear marker in combination with morphological characteristics) in order to properly evaluate the possible taxonomic status of these complexes. All these findings (visualized in a bootstrapped NJ tree, Fig. 10) are based on the sequencing of a single marker. Thus they are not per se a sufficient tool and criterion for a definitive taxonomical and phylogenetic consequences. For this reason, our project has employed a more complex approach: based on these findings, a sequencing analysis of a nuclear marker must be performed, and comparisons of the morphological characteristics of the lineages must be evaluated. Such complex evaluations will subsequently serve for the definitive confirmation of taxonomic conclusions, and also for the reference collection of the fish which will be stored in the National Museum of Natural History, Prague.

6. Conclusion The presented study provides a clear example of the usefulness and suitability of DNA barcoding for the cataloguing of the biodiversity of the Czech freshwater fishes. The lineages newly uncovered in our study are being subjected to further detailed research in order to evaluate their correct taxonomical status and systematic position. Definitive results of the project, once obtained, can probably serve as a good starting point for subsequent comparatory phylogenetic studies in an Euroasian context. The presented project also enabled us to focus our attention also on taxa which have never been in the scope of molecular-genetic investigation (e.g. L. delineatus, P. phoxinus, Gasterosteus aculeatus, A. anguilla, etc.). New taxonomically and systematically important knowledge may (and hopefully will) contribute to the updating of the background information for the monitoring of the NATURA 2000 system. It also brings crucial information and recommendations to the Agency for Nature Conservation and Landscape Protection of the Czech Republic. A new design of the species collection of type individuals, constructed on the basis of most recent molecular methods and including morphological data, as well as organizing a unified voucher, is also a great benefit for the National Museum of Natural Science in Prague. By employing a complex approach (analysis of both the nuclear and mitochondrial genomes plus morphological analyses) we were able to eliminate the danger of including a hybrid individual as a representative of a particular species into the type series. Combined

www.intechopen.com Page 64

308 Analysis of Genetic Variation in Animals preservation approaches (whole individuals stored in formaldehyde, fin clippings in ethanol, DNA isolates) targeted at individuals from the new type collections will also enable possible comparative DNA analyses in future, whenever needed. All the results are clearly and concisely assembled in the BoLD database, which allows very simple and quick on-line access to informations for the broadest scientific and for the general public. The UN has declared the year, 2010, to be the International Year of Biodiversity. Let us all wish much success to all future projects and initiatives dealing with biodiversity; for every successful project will bring us closer to the ultimate goal of the knowledge and understanding of the biodiversity.

7. Acknowledgement This study was carried out within the framework of research projects no. M200930901 supported by the Program of Internal Support for International Collaborative Projects of the Academy of Sciences of the Czech Republic and no. 206/09/P608 supported by the Grant Agency of the Czech Republic. We would like to thank our colleagues from the Biodiversity Institute of Ontario, University of Guelph for their financial, laboratory and informatics support, the Czech and Moravian Fishing Unions, the representatives of the water- resources authorities (pond management companies, river basin management agencies), the management of the Protected Landscape Areas, our colleagues from universities and other people for their help with sample collection. Data accessibility Cytochrome c oxidase subunit I gene sequences, trace files, digital images of fish and other metadata were submitted to Barcoding of Life Data systems (BoLD – http:// www.barcodinglife.com) and were given BoLD Process ID’s IFCZE001-10 to IFCZE701-10 and IFCZE702-11 to IFCZE852-11, all being part of the project „The ichthyofauna of the Czech Republic (IFCZE). The complete NJ/K2P tree can be found on the website of IVB on http://www.ivb.cz/projects-molecular-biodiversity-inventory-of-the-ichthyofauna-of-the- czech-republic.html. Acquired DNA sequences are also being stored in GenBank with accession numbers HQ960417-HQ961093.

8. References April, J., Mayden, R. L., Hanner, R. H. & Bernatchez, L. (2011). Genetic calibration of species diversity among North America`s freshwater fishes. Proceedings of the National Academy of Sciences of the United States of America, In Press Aquilino, S. L., Tango, J. M., Fontanilla, I. C., Pagulayan, R. C., Basiao, Z. U., Ong, P. S. & Quilang, J. P. (2011). DNAbarcoding of the ichthyofauna of Taal Lake, Philippines. Molecular Ecology Resources, Vol. 11, No. 4, pp. 612–619, ISSN 1755-0998 Ardura, A., Linde, A. R., Moreira, J. C. & Garcia-Vazquez, E. (2010). DNA barcoding for conservation and management of Amazonian commercial fish. Biological Conservation, Vol. 143, No. 6, pp. 1438-1443, ISSN 0006-3207 Avise, J. C. (2000). Phylogeography. The history and formation of species. Harvard University Press, ISBN 978-0674666382, Cambridge

www.intechopen.com Page 65

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 309

Barrett, R. D. H. & Hebert, P. D. N. (2005). Identifying spiders through DNA barcodes. Canadian Journal of Zoology, Vol. 83, No. 3, pp. 481-491, ISSN 1480-3283 Bartoňová, E., Papoušek, I., Lusková, V., Koščo, J., Lusk, S., Halačka, K., Švátora, M. & Vetešník, L. (2008). Genetic diversity and taxonomy of Sabanejewia balcanica (Osteichthyes: Cobitidae) in the waters of the Czech Republic and Slovakia. Folia Zoologica, Vol. 57, No. 1-2, pp. 60-70, ISSN 0139-7893 Baruš, V. & Oliva, O. (1995). Mihulovci a Ryby. Academia, ISBN 80-200-0501-3, Praha Cunha, C., Mesquita, N., Dowling, T. E., Gilles, A. & Coelho, M. M. (2002). Phylogenetic relationships of Eurasian and American cyprinnids using cytochrome b sequences. Journal of Fish Biology Vol. 61, No. 4, pp. 929-944. ISSN 1095-8649 Czudek, T. (1997). Reliéf Moravy a Slezska v kvartéru. Sursum, ISBN 80-85799-27-8, Tišnov, (in Czech) deWaard, J. R., Ivanova, N. V., Hajibabaei, M. & Hebert, P. D. N. (2008). Assembling DNA barcodes. Analytical protocols. Methods in Molecular Biology, Vol. 410, pp. 275-293, ISSN 1064-3745 Durand, J. D., Persat, H. & Bouvet, Y. (1999). Phylogeography and postglacial dispersion of the chub (Leuciscus cephalus) in Europe. Molecular Ecology, Vol. 8, No. 6, pp. 989-997, ISSN 0962-1083 Fisher, B. L. (2006). DNA Barcoding: Tomorrow Is Too Late. California Wild, Vol. 59, No. 1, pp. 1-3 Freeland, J. R. (2005). Molecular ecology. John Wiley & Sons Ltd, ISBN 978-0-470-09062-6, Chichester Froese, R. & Pauly, D. (2010). FishBase. World Wide Web electronic publication. Available from: www.fishbase.org Gozlan, R. E., St-Hilaire, S., Feist, S. W., Martin, P. & Kent, M. L. (2005). Biodiversity: Disease threat to European fish. Nature, Vol. 435, No. 7045, p. 1046, ISSN 0028-0836 Hajibabaei, M., deWaard, J. R., Ivanova, N. V., Ratnasingham, S., Dooh, R. T., Kirk, S. L., Mackie, P. M. & Hebert, P. D. N. (2005). Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society B: Biological Science, Vol. 360, No. 1462, pp. 1959-1967, ISSN 1471-2970 Hajibabaei, M., Smith, M. A., Janzen, D. H, Rodriguez, J. J., Whitfield, J. B. & Hebert, P. D. N. (2006). A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes, Vol. 6, No. 4, pp. 959–964, ISSN 1471-8286 Hajibabaei, M., Singer, G. A. C., Hebert, P. D. N. & Hickey, D. A. (2007). DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics, Vol. 23, No. 4, pp. 167-172, ISSN 0168-9525 Hammond, P. M. (1992). Species inventory, In: Global Biodiversity: status of the Earth's living resources, B. Groombridge (ed.), pp. 17–39, Chapman and Hall, ISBN 0-41247240-6, London Hanel, L. & Lusk, S. (2005). Ryby a mihule České republiky, rozšíření a ochrana. ČSOP Vlašim, ISBN 80-86327-49-3,Vlašim He, S., Mayden, R. L., Wang, X., Wang, W., Tang, K. L., Chen, W. J. & Chen, Y. (2008). Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein- coding gene: Further evidence from a nuclear gene of the systematic chaos in the

www.intechopen.com Page 66

310 Analysis of Genetic Variation in Animals

family. Molecular Phylogenetics and Evolution, Vol. 46, No. 3, pp. 818-829, ISSN 1055- 7903 Hebert, P. D. N., Cywinska, A., Ball, S. L & deWaard, J. R. (2003a). Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Science, Vol. 270, pp. 313-321 Hebert, P. D. N., Ratsingham, S. & Dewaard, J. R. (2003b). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Science, Vol. 270 (Suppl 1), pp. 96-99, ISSN 0962-8452 Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S. & Francis, Ch. M. (2004). Identification of Birds through DNA Barcodes. PLoS Biology, Vol. 2, No. 10, pp. e312, ISSN 1545-7885 Hebert, P. D. N. & Barrett, R. D. H. (2005). Reply to the comment by L. Prendini on “Identifying spiders through DNA barcodes”. Canadian Journal of Zoology, Vol. 83, No.3, pp. 505–506, ISSN 1480-3283 Hubert, N., Hanner, R., Holm, E., Mandrak, N. E., Taylor, E., Burridge, M., Watkinson, D., Dumont, P., Curry, A., Bentzen, P., Zhang, J., April, J. & Bernatchez, L. (2008). Identifying Canadian Freshwater Fishes through DNA Barcodes. PloS One, Vol. 3, No. 6, pp. e2490, ISSN 1932-6203 Ivanova, N. V., Zemlak, T. S., Hanner, R. H. & Hebert, P. D. N. (2007). Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes, Vol. 7, No. 4, pp. 544-548, ISSN 1471-8286 Janko, K., Flajšhans, M.., Choleva, L., Bohlen, J., Šlechtová, V., Rábová, M.., Lajbner, Z., Šlechta, V., Ivanova, P., Dobrovolov, I., Culling, M., Persat, H. Kotusz, J. & Ráb, P. (2007). Diversity of European spined loaches (genus Cobitis L.): an update of the geographic distribution of the Cobitis taenia hybrid complex with a description of new molecular tools for species and hybrid determination. Journal of Fish Biology, Vol. 71, No. 2, pp. 387- 408, ISSN 1095-8649 Kottelat, M. & Freyhof, J. (2007). Handbook of European freshwater fishes. Kottelat, Cornol, Switzerland and Freyhof, ISBN 978-2-8399-0298-4, Berlin Kress, W. J., Wurdack, K. J., Zimmer, E. A., Weigt, L. A. & Janzen, D. H. (2005). Use of DNA barcodes to identify flowering plants. PNAS, Vol. 102, No. 23, pp. 8369-8374, ISSN 0027-8424 Lakra, W., Verma, M. & Goswami, M. (2011). DNA barcoding Indian marine fishes. Molecular Ecology Resources, Vol. 11, No. 1, pp. 60–71, ISSN 1755-0998 Lusk, S., Bartoňová E., Lusková, V., Lojkásek, B. & Koščo, J. (2008a). Vranka pruhoploutvá Cottus poecilopus – rozšíření a genetická diverzita v povodí řek Morava, Odra (Česká republika) a Hornád (Slovensko) [Siberian sculpin Cottus poecilopus: distribution and genetic diversity in the Morava, Odra (Czech Republic), and Hornád (Slovakia) drainage areas], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 67-80, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80- 87189-01-6, Brno, (in Czech with English summary) Lusk, S. & Hanel, L. (2008). Foreword. In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 3-5, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189- 01-6, Brno Lusk, S., Papousek, I., Lusková, V., Halačka,K. & Koščo, J. (2008b). Výskyt a genetická diverzita drska menšího a drska většího v povodí Moravy (Česká republika)

www.intechopen.com Page 67

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 311

[Occurrence and genetic diversity of Streber Zingel streber and Zingel Zingel zingel in the Morava river drainage area (Czech Republic)], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 81-87, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno. (in Czech with English summary) Lusk, S., Lusková, V., Hanel, L., Lojkásek, B. & Hartvich, P. (2011). Červený seznam mihulí a ryb České republiky – verze 2010, [Red List of lampreys and fishes of the Czech Republic – Version 2010], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 68-78, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-08-5, Brno, (in Czech with English summary) Lusková, V., Bartoňová, E. & Lusk, S. (2008a). Ostrucha křivočará Pelecus cultratus – vzácný objekt ochrany v České republice [The Ziege Pelecus cultratus, a rare object of protection in the Czech Republic], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 38-45, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80- 87189-01-6, Brno. (in Czech with English summary) Lusková, V., Bartoňová, E. & Lusk, S. (2008b). Karas obecný Carassius carassius Linnaeus, 1758 v minulosti obecně rozšířený a v současnosti ohrožený druh v České republice [Crucian carp, Carassius carassius Linnaeus, 1758, a common species in the Czech Republic in the past yet endangered at present], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 46-53, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno. (in Czech with English summary) Mayden, R. L., Tang, K. L., Wood, R. M., Chen, W.-J., Agnew, M. K., Conway, K. W., Yang, L., Simons, A. M., Bart, H. L., Harris, P. M., Li, J., Wang, X., Saitoh, K., He, S., Liu, H., Chen, Y., Nishida, M. & Miya, M. (2008). Inferring the Tree of Life of the order Cypriniformes, the earth’s most diverse clade of freshwater fishes: Implications of varied taxon and character sampling. Journal of Systematics and Evolution, Vol. 46, No. 3, pp. 424-438, ISSN 1759-6831 Mecklenburg, C. W., Moller, P. R. & Steinke, D. (2011). Biodiversity of arctic marine fishes: taxonomy and zoogeography. Marine Biodiversity, Vol. 41, No. 1, pp. 109–140, ISSN 1867-1624 Mendel, J., Lusková, V., Halačka, K, Lusk, S. & Vetešník, L. (2005). Genetic diversity of Gobio gobio populations in the Czech Republic and Slovakia, based on RAPD markers. Folia Zoologica, Vol. 54, No. 1, pp. 13-24, ISSN 0139-7893 Mendel, J., Lusk, S., Halačka, K., Lusková, V., Vetešník, L., Ćaleta M. & Ruchin, A. (2008b). Genetická diverzita a poznámky k výskytu ouklejky pruhované Alburnoides bipunctatus [Genetic diversity of Spirlin, Alburnoides bipunctatus, with notes on its occurrence]. In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 25- 37, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno. (in Czech with English summary) Mendel, J., Lusk, S., Koščo, J., Vetešník, L., Halačka, K. & Papoušek, I. (2008a). Genetic diversity of Misgurnus fossilis populations from the Czech Republic and Slovakia. Folia zoologica, Vol. 57, No. 1-2, pp. 90-99, ISSN 0139-7893 Mendel, J., Lusk, S., Lusková, V., Koščo, J., Vetešník, L., Halačka, K. (2008c). Druhová pestrost hrouzků rodů Gobio a Romanogobio na území České republiky a Slovenska [The species diversity of gudgeon of the genera Gobio and Romanogobio in the territory of the Czech Republic and Slovakia], In: Biodiverzita ichtyofauny ČR (VII), S.

www.intechopen.com Page 68

312 Analysis of Genetic Variation in Animals

Lusk, V. Lusková (Ed.), pp. 17-24, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno, (in Czech with English summary) Mendel, J., Lusk, S., Vasil'eva, E. D., Vasil'ev, V. P., Lusková, V., Ekmekci, F. G., Erk'akan, F., Ruchin, A., Koščo, J., Vetešník, L., Halačka, K., Šanda, R., Pashkov, A. N. & Reshetnikov, S. I. (2008d). Molecular phylogeny of the genus Gobio Cuvier, 1816 (Teleostei: Cyprinidae) and its contribution to taxonomy. Molecular Phylogenetics and Evolution, Vol. 47, No. 3, pp. 1061-1075, ISSN 1055-7903 Messing, J. (1983). New M13 vectors for cloning. Methods in Enzymology, Vol. 101, pp. 20-78 Meusnier, I., Singer, G. A. C., Landry, J. F., Hickey, D. A., Hebert, P. D. N. & Hajibabaei, M. (2008). A universal DNA mini-barcode for biodiversity analysis. BMC Genomics, Vol. 9, pp. 214, ISSN 1471-2164 Monaghan, M. T., Balke, M., Gregory, T. R. & Vogler, A. P. (2005). DNA-based species delineation in tropical beetles using mitochondrial and nuclear markers In: Philosophical Transactions of the Royal Society B: Biological Science, Avalible from: doi:10.1098/rstb.2005.172.4 Nwani, D. W., Becker, S., Braid, H. E., Ude, E. F., Okogwu, O. I. & Hanner R. (2011). DNA barcoding discriminates freshwater fishes from southeastern Nigeria and provides river system-level phylogeographic resolution within some species. Mitochondrial DNA, In Press Papoušek, I., Lusková, V., Koščo, J., Lusk, S., Halačka, K., Povž, M. & Šumer, Z. (2008a). Genetic diversity of Cobitis spp. (Cypriniformes: Cobitidae) from different drainage areas. Folia Zoologica , Vol. 57, No. 1–2, pp. 83–89, ISSN 0139-7893 Papoušek, I., Lusková, V., Lusk, S. & Koščo, J. (2008b). Výskyt a genetická diverzita ježdíka žlutého a ježdíka dunajského v České republice. [Occurrence and genetic diversity of Stripped ruffe Gymnocephalus schraetser and Danube ruffe Gymnocephalus baloni in the Czech Republic], In: Biodiverzita ichtyofauny ČR (VII), S. Lusk, V. Lusková (Ed.), pp. 88-95, Ústav biologie obratlovců AV ČR, v.v.i, ISBN 978-80-87189-01-6, Brno, (in Czech with English summary) Perea, S., Böhme, M., Zupančič, P., Freyhof, J., Šanda, R., Özuluğ, M., Abdoli, A. & Doadrio, I. (2010). Phylogenetic relationships and biogeographical patterns in Circum- Mediterranean subfamily Leuciscinae (Teleostei, Cyprinidae) inferred from both mitochondrial and nuclear data. BMC Evolutionary Biology. Vol. 10, pp. 265, ISSN 1471-2148 Primack, R. B., Kindlmann, P. & Jersáková, J. (2001). Biological principles of nature conservation, Portál, ISBN 80-7178-552-0, Praha Pyle, R. L., Earle, J. L. & Greene, B. D. (2008). Five new species of the damselfish genus Chromis (Perciformes: Labroidei: Pomacentridae) from deep coral reefs in the tropical western Pacific. Zootaxa, Vol. 1671, pp. 3–31, ISSN 1175-5334 Ratnasingham, S. & Hebert, P. D. N. (2007). BOLD: the Barcode of Life Data System (www.barcodinglife.org). Molecular Ecology Notes, Vol. 7, No. 3, pp. 355-364, ISSN 1471-8286 Raup, D. M. (1992). Extinction: bad genes or bad luck? W. W. Norton & Company, ISBN: 978- 0393309270, New York Rock, J., Costa, F. O., Walker, D. I., North, A. W., Hutchinson, W. F. & Carvalho, G. R. (2008). DNA barcodes of fish of the Scotia Sea, Antarctica indicate priority groups for

www.intechopen.com Page 69

Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic 313

taxonomic and systematice focus. Antarctic Science, Vol. 20, No. 3, pp. 253–262, ISSN 1365-2079 Schindel, D. E. & Miller, S. E. (2005). DNA barcoding a useful tool for taxonomists. Nature, Vol. 435, pp. 17, ISSN 1476-4687 Seifertová, M., Vyskočilová, M., Morand, S. & Šimková, A. (2008). Metazoan parasites of freshwater cyprinid fish (Leuciscus cephalus): testing biogeographical hypotheses of species diversity. Parasitology Vol. 135, No. 12, pp. 1417-35, ISSN 0031-1820. Steinke, D., Zemlak, T. S. & Hebert, P. D. N. (2009). Barcoding Nemo: DNA-Based identifications for the ornamental fish Trade. PLos One, Vol. 4, No. 7, pp. e6300, ISSN 1932-6203 Šedivá, A., Janko, K., Šlechtová, V., Kotlík, P., Simonović, P. Delic, A. & Vassilev, M. (2008). Around or across the Carpathians: colonization model of the Danube basin inferred from genetic diversification of stone loach (Barbatula barbatula) populations. Molecular Ecology, Vol. 17, No. 5, pp. 1277-1292, ISSN 0962-1083 Thalmann, O., Hebler, J., Poinar, H. N., Pääbo, S. & Vigilant, L. (2004). Unreliable mtDNA data due to nuclear insertions: a cautionary tale from analysis of humans and other great apes. Molecular Ecology, Vol. 13, No. 2, pp. 321–335, ISSN 0962- 1083 Valdez-Moreno, M., Ivanova, N. V., Elías-Gutiérrez, M., Contreras-Balderas, S. & Hebert, P. D. N. (2009). Probing diversity in freshwater fishes from Mexico and Guatemala with DNA barcodes. Journal of Fish Biology, Vol. 74, No. 2, pp. 377-402, ISSN 1095- 8649 Vences, M., Thomas, M., van der Meijden, A., Chiari, Y. & Vieites, D. R. (2005). Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology, Vol. 2, pp. 5, ISSN 1742-9994 Vetešník, L., Papoušek, I., Halačka, K., Lusková, V. & Mendel, J. (2007). Morphometric and genetic analysis of the Carassius auratus complex from an artificial wetland in floodplain of the Morava River (Czech Republic). Fisheries Science, Vol. 73, No. 4, pp. 817-822, ISSN 1444-2906 Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. & Hebert, P. D. N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Science, Vol. 360, pp. 1847-1857, ISSN 1471-2970 Ward, R. D., Holmes, B. H. & Yearsley, G. K. (2008). DNA barcoding reveals a likely second species of Asian seabass (barramundi) (Lates calcarifer). Journal of Fish Biology, Vol. 72, No. 2, pp. 458–463, ISSN 1095-8649 Ward, R. D., Hanner, R. & Hebert, P. D. N. (2009). The campaign to DNA barcode all fishes, FISH-BOL. Journal of Fish Biology, Vol. 74, No. 2, pp. 329–356, ISSN 1095-8649 Wilson, E. O. (1989). Threats to biodiversity. Scientific American, Vol. 261, pp. 108-116, ISSN 0036-8733 Wilson, E. O. (1992). The Diversity of Life. The Belknap Press of Harvard University Press, ISBN 978-0393319408, Cambridge Zardoya, R. & Doadrio, I. (1999). Molecular Evidence on the Evolutionary and Biogeographical Patterns of European Cyprinids. Journal of Molecular Biology, Vol. 49, pp. 227-237, ISSN 0022-2836

www.intechopen.com Page 70

314 Analysis of Genetic Variation in Animals

Zhang, J. & Hanner, R. (2011). DNA barcoding is a useful tool for the identification of marine fishes from Japan. Biochemical Systematics and Ecology, Vol. 39, No. 1, pp. 31–42, ISSN 0305-1978

www.intechopen.com Page 71 Analysis of Genetic Variation in Animals Edited by Prof. Mahmut Caliskan

ISBN 978-953-51-0093-5 Hard cover, 360 pages Publisher InTech Published online 29, February, 2012 Published in print edition February, 2012

Analysis of Genetic Variation in Animals includes chapters revealing the magnitude of genetic variation existing in animal populations. The genetic diversity between and within populations displayed by molecular markers receive extensive interest due to the usefulness of this information in breeding and conservation programs. In this concept molecular markers give valuable information. The increasing availability of PCR-based molecular markers allows the detailed analyses and evaluation of genetic diversity in animals and also, the detection of genes influencing economically important traits. The purpose of the book is to provide a glimpse into the dynamic process of genetic variation in animals by presenting the thoughts of scientists who are engaged in the generation of new idea and techniques employed for the assessment of genetic diversity, often from very different perspectives. The book should prove useful to students, researchers, and experts in the area of conservation biology, genetic diversity, and molecular biology.

How to reference In order to correctly reference this scholarly work, feel free to copy and paste the following:

Jan Mendel, Eva Marešová, Ivo Papoušek, Karel Halačka, Lukáš Vetešník, Radek Šanda, Milena Koníčková and Soňa Urbánková (2012). Molecular Biodiversity Inventory of the Ichthyofauna of the Czech Republic, Analysis of Genetic Variation in Animals, Prof. Mahmut Caliskan (Ed.), ISBN: 978-953-51-0093-5, InTech, Available from: http://www.intechopen.com/books/analysis-of-genetic-variation-in-animals/molecular- biodiversity-inventory-of-the-ichthyofauna-of-the-czech-republic

InTech Europe InTech China University Campus STeP Ri Unit 405, Office Block, Hotel Equatorial Shanghai Slavka Krautzeka 83/A No.65, Yan An Road (West), Shanghai, 200040, China 51000 Rijeka, Croatia Phone: +385 (51) 770 447 Phone: +86-21-62489820 Fax: +385 (51) 686 166 Fax: +86-21-62489821 www.intechopen.com

Page 72 Page 73 Page 74 Page 75 Page 76 Page 77 Page 78 Page 79 Page 80 Page 81 Page 82 Page 83 Page 84 Page 85 Page 1 of 12 Molecular Ecology Resources

1 Microsatellite loci for population studies of the genus Alburnoides and four

2 other critically endangered and vulnerable cyprinids in the Czech Republic

4 Soňa Urbánková,* Jan Mendel,* and Martina Vyskočilová†

5 *Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, v.v.i, Květná

6 8, 60365 Brno, Czech Republic

7 †Department of Botany and Zoology, Faculty of Science, Masaryk University, Kotlářská 2,

8 61137 Brno, Czech Republic

10 Keywords: Alburnoides, Carassius, Leucaspius, Vimba, Pelecus, microsatellites

12 Corresponding author: Jan Mendel, Květná 8, 603 65 Brno, Fax: +420 543 211 346; Email:

13 [email protected]

15 Running title: Microsatellites for spirlin

17 Abstract

18 Four polymorphic microsatellite loci were isolated from Alburnoides bipunctatus . The

19 number of alleles per locus varied from twelve to nineteen, and the expected heterozygosities

20 ranged from 0.832 – 0.927. In order to increase the number of microsatellite markers, seven

21 additional loci that were originally developed for Cyprinus carpio , Gobio gobio , Luxilus

22 cornutus , Labeo rohita were successfully crossamplified. The number of alleles per locus

23 varied from three to ten. Their usefulness was demonstrated by the successful cross

24 amplification for 10 members of the genus Alburnoides and four other cyprinids. The

Page 86 Molecular Ecology Resources Page 2 of 12

25 applicability of these markers was confirmed for species identification, for discriminating

26 between interspecific hybrids and for population investigations of endangered species from

27 the genera Alburnoides , Carassius , Leucaspius , Pelecus and Vimba .

29 The representatives of the genus Alburnoides belong to the family Cyprinidae. This

30 widespread genus includes small freshwater fishes from France to Afghanistan. Alburnoides

31 bipunctatus is rated among the species that indicate watercourse quality in the regions

32 containing salmon and carp waters, in coenoses of the “Barbus – Chondrostoma” type (Lusk

33 et al. 1998).

34 Our main motivation was based on an ongoing phylogenetic study of spirlin in the Eurasian

35 context (Urbánková 2010), in which species underestimation of this genus was demonstrated

36 using mitochondrial analysis, and on top of that, at least three unique lineages were identified

37 for which the species level has been considered. However, it became apparent that sequencing

38 analyses of nuclear markers provide a weak phylogenetic signal for the unambiguous

39 discrimination of individual lineages (unpublished). Therefore, we proceeded to the

40 preparation of more variable microsatellite markers. Sufficient knowledge of population

41 parameters, both in previously identified and newly described lineages of the genus

42 Alburnoides , is indispensable for the evaluation of their endangerment and for establishing

43 suitable measures of conservation management. In addition to the preparation of polymorphic

44 microsatellite markers for the endangered species Alburnoides bipunctatus and its 9

45 congeneric taxa, we used the presented microsatellite loci to test their suitability for the other

46 4 cyprinids: for the three critically endangered species – Carassius carassius , Leucaspius

47 delineatus , Pelecus cultratus and a vulnerable species Vimba vimba . No suitable polymorphic

48 microsatellite loci were prepared in the majority of them as of yet. The endangerment status

Page 87 Page 3 of 12 Molecular Ecology Resources

49 was taken from the latest Red List of Lampreys and Fishes of the Czech Republic, the

50 COUNCIL DIRECTIVE 92/43/EEC of 1992, and Order 166/2005 Coll.

51 To develop microsatellite primers, we employed a modified enrichment protocol developed

52 by Estoup & Martin (1996). Genomic (g) DNA was extracted (Genomic DNA Mini kit, KRD)

53 from an ethanolpreserved fin of a single spirlin collected in 2008 from the Morava River

54 (Czech Republic). Total gDNA was digested with an Rsa I restriction enzyme (Promega).

55 Following the restriction digest, Mlu I oligo adaptors ( RSA 21 and phosphorylated RSA 25) that

56 serve as priming sites for the PCR were ligated onto the ends of gDNA fragments. Two

57 biotinylated probes [dinucleotide (TG) 10 and tetranucleotide (ATCT) 5 ] were hybridized to the

58 ligated DNA and selected using streptavidin magnetic particles (Promega). PCRs were

59 performed on the microsatelliteenriched eluate using one of the oligo adaptors ( Rsa I) as a

60 primer. The amplification products were purified (QIAquick PCR Purification Kit, QIAGEN)

61 and ligated into a plasmid vector (pGEMT Easy Vector system II, Promega), transformed

62 into JM109 competent cells (Promega), and plated onto LuriaBertani (LB) agar medium with

63 ampicillin (0.05 mg/ml). Recombinant plasmids were identified by bluewhite screening.

64 Positivetransformed cells were grown on LB agar, transferred onto HybondN + membranes

65 (Amersham), screened using dioxigeninendlabelled (TC) 10 and (ATCT) 5 probes (DIG

66 Oligonucleotide Tailing Kit, Roche) and visualised using a DIG Nucleic Acid Detection Kit

67 (Roche). We obtained 123 positive clones from the two libraries and each clone was

68 sequenced by Macrogen (South Korea). The sequences from 105 clones were of high quality

69 and contained repeat regions. The primers were developed from flanking sequences using

70 Oligo (Rychlik 2007). Successful amplifications were detected with four unlabelled primer

71 pairs based on PCR tests with 11 14 reference specimens. PCR conditions were optimized to

Page 88 Molecular Ecology Resources Page 4 of 12

72 produce clear bands on agarose gels and four lociforward primers were labelled with a

73 fluorescent dye (Applied Biosystems; Table 1).

74 PCRs were performed on Mastercycler pro (Eppendorf) in a total volume of 10 µL containing

75 75mM TrisHCl (pH 8.8), 20mM (NH 4)2SO 4, 0.01% Tween 20, 1.5 mM MgCl 2, 0.2 mM of

76 each dNTP, 1 pmol of each primer, 0.6U Taq polymerase (Fermentas) and ~30 ng of genomic

77 DNA. The PCR consisted of an initial denaturation cycle of 95°C for 3 min; 38 cycles at 95°C

78 for 1 min; 4860°C for 50 s, elongation at 72°C for 1 min; and final extension at 72°C for 10

79 min (loci Mfw17 and Lro12 20 min) (Tables 1). The amplified products were diluted, of

80 which 1 µL was added to 12 µL of formamide and 500 LIZ Size Standard (Life Technologies)

81 and electrophoresed by ABI PRISM 310 Genetic Analyzer (Applied Biosystems) and

82 visualized and scored using GENESCAN and GENOTYPER version 3.7. The conditions and

83 characteristics of the loci are given in Tables 1 and 2. We calculated the number of alleles per

84 locus, observed and expected heterozygosities, the deviation from HardyWeinberg

85 equilibrium and linkage disequilibrium expectations, and the frequency of null alleles using

86 GENALEX 6 ( Peakall & Smouse 2006 ), online version of GENEPOP 1.2 (Raymond &

87 Rousset 1995 ) and MICROCHECKER 2.2.3 (Van Oosterhout et al. 2004).

88 Our study developed 4 unique polymorphic dinucleotide microsatellite loci isolated from A.

89 bipunctatus (Albi; Table 1). At the same time, using crossspecies amplification, we

90 confirmed the applicability of the polymorphic loci for 9 other species of the genus

91 Alburnoides (Table 2a) and four cyprinid species – C. carassius , L. delineatus , P. cultratus

92 and V. vimba (Table 2b).

93 We evaluated the amplification patterns in 10 members of the genus Alburnoides , including

94 A. bipunctatus (Morava River, Czech Republic), A. tzanevi (Veleka River, Bulgaria), A.

95 ohridanus (Erzen River, Albania), A. prespensis (Prespa Lake, Albania), A. thessalicus

Page 89 Page 5 of 12 Molecular Ecology Resources

96 (Vardar River, FYROM), A. strymonicus (Struma River, Greece), A. kubanicus (Abin River,

97 Russia), A. maculatus (Alma River, Ukraine), A. rossicus (Protva River, Russia) and A.

98 fasciatus (Shakhe River, Russia). All species had previously been both morphologically and

99 molecularly identified (Mendel et al. 2008; Urbánková 2010). The species names were taken

100 from Kottelat 1997 and Kottelat & Freyhof 2007.

101 The microsatellite loci in A. bipunctatus revealed both none (Albi31, Albi42, Albi652,

102 Albi712, Albi722, Albi942; primers and conditions for monomorphic markers have been

103 submitted to the MER database ), and a high genetic variation (Albi22, Albi61, Albi462A,

104 Albi462B). Genotypes of fin samples from the natural population (Morava River) showed

105 polymorphisms with twelve to nineteen alleles per locus among 36 individuals (Table 1).

106 These loci were at HardyWeinberg equilibrium, unlinked (based on GENALEX and

107 GENEPOP results) and the frequency of null alleles was recorded between 0.032 – 0.118

108 (based on MICROCHECKER results).

109 In order to supplement the design of the microsatellite panel for the genus Alburnoides , we

110 proved the usefulness of seven additional loci (Mfw1, Mfw5, Mfw11, Mfw17, Mfw18,

111 Mfw19, Mfw26) from the microsatellite library of Cyprinus carpio (Crooijmans et al. 1997),

112 four loci (Lco1, Lco3, Lco5, Lco7) from the microsatellite library of Luxilus cornutus (Turner

113 et al. 2004), six loci (Lro2, Lro3, Lro11, Lro12, Lro17, Lro35) from the microsatellite library

114 of Labeo rohita (Gheyas 2006), six loci (Rvla21144, Rvla21177, Rvla22114I, Rvla22114II,

115 Rvla22211, Rvla21030) from the microsatellite library of Romanogobio vladykovi (Mendel et

116 al. 2012) and five loci (Gob3, Gob12, Gob15, Gob22, Gob28) from the microsatellite library

117 of Gobio gobio (Knapen et al. 2006). The crossspecies loci Mfw1, Mfw5, Mfw17, Mfw19,

118 Lco5, Lro12 and Gob28 revealed a high genetic variation in A. bipunctatus with three to ten

119 alleles per locus among 36 individuals from the Morava River. All the loci were at Hardy

Page 90 Molecular Ecology Resources Page 6 of 12

120 Weinberg equilibrium, unlinked and the frequency of null alleles was recorded between 0 –

121 0.121 (Table 1). The loci Lco3, Lro17, Rvla21144, Gob15 and Gob22 were monomorphic and

122 no amplification took place at in the remaining analyzed loci.

123 Tables 2a and 2b provide the crossspecies amplification results for nine species from the

124 genus Alburnoides and four other cyprinid species in various degrees of endangerment. From

125 the 11 primer pairs crossamplified in this study, nine resulted in an amplified PCR product

126 for all the tested species.

127 The detected allele length and chosen combination of fluorescent labelling enables the

128 employment of the entire developed panel of eleven polymorphic microsatellite loci in the

129 multiplex PCR analysis (while observing the rule that markers Albi22 and Mfw1, as well as

130 Albi61 and Lro12, will be in another multiplex PCR set).

131 Due to different allelic variation and also to nonamplification of alleles (in case of some

132 loci), at least six loci (Albi22, Albi61, Albi462A, Albi462B, Gob28 and Mfw19) seem to be

133 more suitable for the species identification and for the easier detection of interspecific

134 hybridization in the genus Alburnoides . Further analyses of a greater number of specimens

135 from the individual species will be required for the evaluation of the applicability of the

136 developed loci.

137 In conclusion, our study suggests that these loci may be helpful for species identification, for

138 the discrimination of interspecific hybrids of the genus Alburnoides and for population

139 genetic investigations of disappearing and endangered species of the genera Alburnoides ,

140 Carassius , Leucaspius , Pelecus and Vimba .

141

142 Acknowledgements

Page 91 Page 7 of 12 Molecular Ecology Resources

143 This study was carried out with institutional support RVO: 68081766 within the framework of

144 research projects no. M200930901 supported by the Program of Internal Support for

145 International Collaborative Projects of the Academy of Sciences of the Czech Republic and

146 no. 206/09/P608 supported by the Grant Agency of the Czech Republic. The project was

147 partly carried out at the Institute of Aquaculture in Stirling and was supported by the

148 European Community – Access to Research Infrastructures (ARI) Action of the Improving

149 Human Potential (IHP) Programme (contract no. HPRICT200100180). We are grateful to

150 B. J. McAndrew, A. A. Gheyas, H. Whitaker, J. Taggart, E. Marešová for their advice and

151 technical assistance, and E. D. Vasileva, R. Šanda, T. Stefanov, K. Halačka, L. Vetešník for

152 their help in obtaining the samples. The authors express gratitude to G. Speas for language

153 correction.

154

155 References

156 Crooijmans R, Bierbooms VAF, Komen J, VanderPoel JJ, Groenen MAM (1997)

157 Microsatellite markers in common carp ( Cyprinus carpio L.). Animal Genetics 28 , 129–134.

158 Estoup A, Martin O (1996) Marqueurs microsatellites: isolement a`l’aide de sondes non

159 radioactives, caracte´risation et mise au point. Personal communication, protocols available in

160 the web at http://www.agroparistech.fr/svs/genere/microsat/microsat.htm .

161 Gheyas AA (2006) Applications of Microsatellite Markers to Genetic Management of Carps

162 in Aquaculture. Thesis , Stirling, pp 214–220.

163 Knapen D, Taylor MI, Blust R, Verheyen E (2006) Isolation and charakterization of

164 polymorphic microsatellite loci in the gudgeon, Gobio gobio (Cyprinidae). Molecular

165 Ecology Notes , 6, 387 –389.

166 Kottelat M (1997) European freshwater fishes. Biologia, 52 /Suppl . 5, 44–45.

Page 92 Molecular Ecology Resources Page 8 of 12

167 Kottelat M, Freyhof J (2007) Handbook of European freshwater fishes. Kottelat, Cornol,

168 Switzerland and Freyhof, Berlin, Germany, pp 158–160.

169 Lusk S, Luskova V, Halacka K, Slechta V, Slechtova V (1998) Trends and production of a

170 fish communities of the barbel zone in a stream of the Czech Republic. Folia Zoologica , 47

171 (Suppl. 1), 67–72.

172 Mendel J, Lusk S, Halačka K, Lusková V, Vetešník L, Caleta M, Ruchin A (2008) Genetic

173 diversity of spirlin, Alburnoides bipunctatus , with notes on its occurrence. Biodiverzita

174 ichtyofauny CR (VII), 25–37.

175 Mendel J, Papoušek I, Marešová E, Vetešník L, Halačka K, Nowak M, Čížková D: Permanent

176 Genetic Resources added to Molecular Ecology Resources Database 1 April 2012 – 31 May

177 2012: Microsatellite loci for Palaearctic gudgeons: markers for identifying intergeneric

178 hybrids between Romanogobio and Gobio , Molecular Ecology Resources , 12 , 972 –974.

179 Peakall R, Smouse PE (2006) Genalex 6: genetic analysis in Excel. Population genetic

180 software for teaching and research . Molecular Ecology Notes , 6, 288–295.

181 Raymond M, Rousset F (1995) Genepop (version 1.2): population genetics software for exact

182 tests and ecumenicism. Journal of Heredity , 86 , 248–249.

183 Rychlik W (2007) Oligo 7 primer analysis software. In: Yuryev A(ed). Methods in molecular

184 biology vol. 402: PCR primer design. Humana Press Inc., Totowa, pp 35–59.

185 Turner TF, Dowling TE, Broughton RE, Gold JR (2004) Variable microsatellite markers

186 amplify across divergent lineages cyprinid fishes (subfamily Leusicinae). Conservation

187 Genetics 5, 279–281.

188 Urbánková S, (2010) Alburnoides bipunctatus – genetic diversity of populations and

189 conservation implications. Thesis , Brno, 61pp. (in Czech with English summary)

Page 93 Page 9 of 12 Molecular Ecology Resources

190 Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) Microchecker: software

191 for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology

192 Notes , 4, 535 –538.

Page 94 Molecular Ecology Resources Page 10 of 12

Table 1 Characteristics of four microsatellite loci isolated from Alburnoides bipunctatus and seven loci prepared from crossspecies amplification P Null Ta

Locus Repeat motif Primer sequence Size (bp) N Na HO/H E value Dye freq. (°C) References / Accession no.

Albi22 (AC) 31 (AA) 1 CAG GAG CCA CTG TAG TGC 137-219 36 19 0.864/0.927 0.125 NED 0.032 58 JX228956 GGG ACT GGT GGA TTC ATA GAC

Albi61 (AC) 30 AAC TCC CTC GCG TGC C 79-105 36 12 0.782/0.863 0.600 6-FAM 0.038 52 JX228957 ATA TTG ATC AGC GCT TTG TCG

Albi462A (AC) 23 CTC CAT TGT GCC CAC ATA CAC 242-296 36 12 0.694/0.832 0.145 6-FAM 0.062 58 KC161205 CCA GAG ATC AGC GCT CAG

Albi462B (CA) 49 (TA) 1 CTC CAT TGT GCC CAC ATA CAC 301-381 36 17 0.689/0.904 0.087 6-FAM 0.118 58 KC161206 CCA GAG ATC AGC GCT CAG

Gob28† (GT) 9(GA) 4(GT) 3 CGC ACA AAC AGC TCA GAC TC 227-231 36 3 0.500/0.648 0.435 VIC 0.043 60 DQ207805 CGGTATGTACAAGCCAGATGAA

Lco5† (CAGA) 2(CA) 14 TTA CAC AGC CAA GAC TAT GT 138-150 36 6 0.417/0.628 0.082 VIC 0.091 57 Turner et al., 2004 CAA GTG ATT TTG CTT ACT GC

Lro12† (CA) 3CT(CA) 15 CAG CGC TGG AAC GAC ACC A 69-83 36 7 0.694/0.780 0.750 6-FAM 0.047 50 AM184136 TGC TGC GGG TCA TTA GTA TTC ATC

Mfw1† (CA) 22 * GTC CAG ACT GTT CAT CAG GAG 165-197 36 6 0.583/0.633 0.919 NED 0.030 52 Crooijmans et al., 1997 GAG GTG TAC ACT GAG TCA CG

Mfw5† (CA) 19 * GAG ATG CCT GGG GAA GTC AC 168-182 36 7 0.485/0.608 0.081 VIC 0.121 57 Crooijmans et al., 1997 AAA GAG AGC GGG GTA AAG GAG

Mfw17† (CA) 11TAAA(CA) 4* CAA CTA CAG AGA AAT TTC ATC 180-194 36 7 0.694/0.690 0.710 6-FAM 0.000 48 Crooijmans et al., 1997 GAA ATG GTA CAT GAC CTC AA

Mfw19† (CA) 16 * GAA TCC TAT CAT GCA AAC 174-206 36 10 0.722/0.857 0.072 PET 0.068 55 Crooijmans et al., 1997 GCA CAA ACT CCA CAT TGT GCC 1 N, number of analyzed specimens; N a, number of alleles; H O/H E, average observed/expected heterozygosities; P value for HardyWeinberg 2 Equilibrium; Dye, 5' fluorescent label; Null freq., frequency of null alleles; Ta, annealing temperature; *no detailed information was given in the 3 paper (Crooijmans et al. 1997), therefore the number of repeats was reported from the sequence of spirlin; †indicates homologous crossspecies 4 amplified loci. 10

Page 95 Page 11 of 12 Molecular Ecology Resources

Table 2a Characteristics of eleven microsatellite loci for the genus Alburnoides A. tzanevi A. ohridanus A. prespensis A. thessalicus A. strymonicus A. kubanicus A. maculatus A. rossicus A. fasciatus Size Size Size Size Size Size Size Size Size

Locus N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) N/N a (bp) Albi22 2/4 135-161 2/4 102-152 2/3 122-134 2/2 94-126 2/2 92-94 2/3 124-210 2/4 90-194 2/1 94 2/3 140-156 Albi61 2/2 81-93 2/4 92-112 2/4 95-133 2/3 121-135 2/3 117-139 2/4 80-140 2/4 86-140 2/3 109-133 2/4 156-178 Albi462A 2/2 229-266 2/3 254-282 2/1 282 2/2 286-288 2/2 264-270 2/4 252-282 2/- — 2/- — 2/1 254 Albi462B 2/2 334 2/2 334-372 2/2 316-322 2/1 358 2/3 326-368 2/- — 2/3 326-372 2/3 314-372 2/- — Gob28 2/2 185-231 2/1 321 2/1 231 2/1 201-233 2/1 199-231 2/4 197-231 2/2 199-231 2/2 195-225 2/2 197-229 Lco5 2/2 139-155 2/1 139 2/1 140 2/1 140 2/1 140 2/2 137-139 2/2 139-147 2/1 137 2/2 138-140 Lro12 2/2 67-75 2/3 67-79 2/1 69 2/2 69-75 2/1 65 2/2 67-73 2/2 67-69 2/1 67 2/2 67-77 Mfw1 2/2 167-211 2/3 167-211 2/1 167 2/2 175-211 2/3 173-195 2/2 169-181 2/3 166-225 2/1 182 2/2 167-231 Mfw5 2/2 169-177 2/4 172-178 2/1 180 2/3 175-181 2/1 165 2/1 175 2/3 178-198 2/1 201 2/3 160-192 Mfw17 2/3 164-180 2/2 176-178 2/1 176 2/3 176-182 2/2 176-180 2/2 166-176 2/3 176-186 2/1 182 2/1 180 Mfw19 2/2 214-220 2/2 186-200 2/4 180-230 2/4 224-282 2/3 248-340 2/4 222-246 2/4 200-306 2/1 200 2/3 204-222 1 N, number of analyzed specimens; N a, number of alleles; —, indicates no amplification.

Page 96 Molecular Ecology Resources Page 12 of 12

Table 2b Characteristics of eleven microsatellite loci for four cyprinids C. carassius , L. delineatus , V. vimba and P. cultratus C. carassius L. delineatus V. vimba P. cultratus Size Size Size

Locus N/N a (bp) N/N a (bp) N/N a (bp) N/N a Size (bp) Albi22 2/2 93-103 2/1 107 2/2 151-153 2/3 109-115 Albi61 2/3 90-96 2/2 104-116 2/2 102-110 2/2 100-108 Albi462A 2/2 250-254 2/2 262-274 2/2 260-268 2/3 257-265 Albi462B 2/- — 2/- — 2/- — 2/- — Gob28 2/4 225-264 2/2 201-233 2/2 205-237 2/2 199-231 Lco5 2/3 171-199 2/2 133-149 2/1 142 2/2 135-157 Lro12 2/4 82-108 2/3 71-81 2/2 57-67 2/2 57-67 Mfw1 2/3 168-184 2/2 161-179 2/2 167-171 2/3 165-179 Mfw5 2/3 156-204 2/3 93-115 2/3 139-167 2/1 167 Mfw17 2/4 143-241 2/1 172 2/1 176 2/1 176 Mfw19 2/3 176-204 2/2 293-300 2/1 248 2/2 80-90 1 N, number of analyzed specimens; N a, number of alleles; —, indicates 2 no amplification.

Page 97