UvA-DARE (Digital Academic Repository)

Developing species recognition and diagnostics of rare opportunistic fungi

Zeng, J.

Publication date 2007 Document Version Final published version

Link to publication

Citation for published version (APA): Zeng, J. (2007). Developing species recognition and diagnostics of rare opportunistic fungi. IBED.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:01 Oct 2021 Developing Species Recognition and Diagnostics of Rare Opportunistic Fungi

Developing Species Recognition and Diagnostics of Rare Opportunistic Fungi Jingsi Zeng Jingsi Zeng

Developing Species Recognition and Diagnostics of Rare Opportunistic Fungi

Jingsi Zeng

Promotor Prof. Dr. G.S. de Hoog Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Royal Netherlands Academy of Arts and Sciences Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam Co-promotor Dr. Y. Gräser Humboldt University, Germany

Promotiecommissie W. Admiraal (IBED, Amsterdam) S. Menken (IBED, Amsterdam) M. Sabelis (IBED, Amsterdam) J. Meis (Canisinus-Wilhelmina Ziekenhuis, Nijmegen) G. Haase (RWTH, Aachen)

Developing Species Recognition and Diagnostics of Rare Opportunistic Fungi

Jingsi Zeng

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. J. W. Zwemmer ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Aula der Universiteit op dinsdag 18 september 2007, te 10.00 uur

Printed by Ponsen & Looijen B.V., Wageningen, the Netherlands

The work was financially supported by the joint research project ‘Comparative genomics in search of origins of human pathogenicity in the fungal Tree of Life focusing on species with high morbidity and mortality in Chinese patients’, Scientific cooperation between China and the Netherlands, China Exchange Programme, Royal Netherlands Academy of Arts and Sciences (KNAW).

This thesis is dedicated to

my dear parents, husband and daughter,

my tutors for Master’s degree Prof. Zhaoru Zhu and Prof. Yuechen Zheng

谨献给我亲爱的父母、丈夫及女儿， 以及恩师祝兆如教授和郑岳臣教授

Contents

Page Chapter 1 Introduction and outline of thesis 1

Chapter 2 Intraspecific diversity of species of 25 complex

Chapter 3 xenobiotica sp. nov., an opportunistic black 45 inhabiting environments rich in hydrocarbons

Chapter 4 Spectrum of clinically relevant Exophiala species in the U.S.A. 65

Chapter 5 Phylogeny of the Exophiala spinifera clade using multilocus 85 sequence data and exploring phylogenetic species concept

Chapter 6 Exophiala spinifera and its allies: diagnostics from 109 morphology to DNA barcoding

Chapter 7 Susceptibility of Pseudallescheria boydii and Scedosporium 133 apiospermum to new antifungal agents

Chapter 8 General dicussion 139

Appendix Summary 151 List of publications and abstracts 155 Acknowledgements 158 Curriculum vitae 161

Chapter 1

Introduction and outline of thesis

1 Chapter 1

Historical overview of species recognition in Pseudallescheria and Exophiala The fungal genera Pseudallescheria and Exophiala include agents of opportunistic infection in humans. They are potentially able to cause a wide diversity of mycoses, varying from cutaneous infections to disseminated syndromes. Most infections are noted in otherwise healthy individuals and are of traumatic nature or concern colonization of cavities or the intestinal tract. Most are typical opportunists in that they expand or disseminate when the innate immunity of the host is impaired. However, some Exophiala species are repeatedly observed to cause fatal, systemic or disseminated infections in patients without any immune disorder. The pathology of these fungi is poorly understood since development of the knowledge was long time hampered by inadequate diagnostics. Although they are among the first fungi reported from deep human infections [1], their flourished only since the application of molecular methods [2;3]. In the routine laboratory, species recognition is still problematic.

Pseudallescheria Negroni et Fischer The lineage of the genus Pseudallescheria (anamorph Scedosporium) is Eukaryota, Fungi, , Euascomycetes, Microascales, Microascaceae. The species thus far established in the genus are listed in Table 1. Colonies on cornmeal agar are rapid growing, floccose or lanose, initially whitish or grey, becoming grey or brown; ascomata are usually submerged, globose, nonostiolate, 100-200 μm in diameter width; peridium composed of flattened, brown, pseudoparenchymatous cells, 2-3 cells thick; asci are globose to ellipsoidal, symmetrical or slightly flattened, with 2 germ pores, light brown to yellowish; homothallic. Scedosporium, Graphium, or both anamorphs may be formed [4]. In 1893, Costantin described a species Eurotiopsis gayoni Cost. [5]. As the name Eurotiopsis had already been used for an entirely different , Saccardo substituted the generic name Allescheria in 1899 [6]. Based on Costantin’s illustration and descriptions of E. gayoni, Malloch [7] concluded that it should be classified in the genus Monascus van Tiegh., 1884. Thus the genera Allescheria and Eurotiopsis became later synonyms of the genus Monascus. In 1922, a strain, isolated by M. F. Boyd from a patient with mycetoma, was considered to be closely related to but different from Eurotiopsis gayoni. It was described as a

2 Introduction new species, Allescheria boydii Shear in 1922 [8]. When the members of the ascomycete family Microascaceae were studied by Malloch, the ascomata and produced by A. boydii were found to be significantly different from those produced by either the other species of Monascus or any other genus of cleistothecial ascomycetes [7]. Malloch proposed the new genus Petriellidium in the family Microascaceae for A. boydii. Consequently, six other Petriellidium (Pe. africanum Arx & G. Franz, 1973, Pe. angustum Malloch & Cain, 1972, Pe. desertorum Arx & Moustafa, 1973, Pe. ellipsoideum Arx & Fassatiová, 1973, Pe. fimeti Arx, Mukerji & Singh, 1978 and Pe. fusoideum Arx, 1973) (throughout this chapter Pe will be used for Petriellidium, Ps for Pseudallescheria) were described in this genus [9-11]. In 1943 and again in 1944, Negroni & Fischer described the genus and species Pseudallescheria shearii (as ‘sheari’) for a cleistothecial ascomycete [12;13]. Comparing the type specimens of Petriellidium Malloch and Pseudallescheria Negroni et Fischer, McGinnis et al. indicated that these 2 genera were congeneric [4]. Because of priority, the proper name of this genus is Pseudallescheria. At that moment, a total of 7 Petriellidium species were reclassified on the basis of morphology as distinct species of Pseudallescheria (Ps. boydii, Ps. africana, Ps. angusta, Ps. desertorum, Ps. ellipsoidea, Ps. fimeti and Ps. fusoidea). Members of the genus Pseudallescheria typically produce Scedosporium or Graphimu anamorphs, or both. Until 1991, 2 anamorph species of Pseudallescheria had been accepted, which are Scedosporium apiospermum Sacc. ex Castell. & Chalmers [14] and Scedosporium prolificans (Hennebert & B.G. Desai) Guého & de Hoog [15]. The morphological circumscriptions of Ps. boydii, Ps. angusta, Ps. ellipsoidea and Ps. fusoidea are narrow. A part of isolates maintained as Ps. boydii failed to produce cleistothecia upon inspection from collection strains regardless of growth conditions. Ps. angusta, Ps. fusoidea and Ps. ellipsoidea were later reduced to synonymy with Ps. boydii (Ps. boydii complex) on the basis of identical Internal Transcribed Spacer (ITS) sequences of ribosomal DNA (rDNA) [16] and a ~300 bp fragment of the D1/D2 Large Subunit (LSU) region of rDNA [17]. The recently described species Ps. minutispora Gilgado et al., S. aurantiacum Gilgado et al. [2], and two more species proposed by Gilgado and co-workers [18] have been segregated from Ps. boydii on the basis of genealogical concordance of calmodulin, β-tubulin and ITS region of rDNA genes and phenotypic characters. At this moment, 9 species are accepted in the ascomycete genus Pseudallescheria, but thus far only few outstanding

3 Chapter 1 differences have been found in features of pathogenicity, ecology and antifungal susceptibility between the new species and Ps. boydii [2;19;20]. Excluding molecular data, species recognition still is difficult in the routine lab, and as a result existing differences may be overlooked. Therefore it is essential that more tools become available to recognize species in the genus Pseudallescheria.

Exophiala J.W. Carmichael Exophiala is the main genus of black , characterised by annellidic conidiogenesis. Colonies are mostly restricted, slimy at the centre due to yeast-like growth. Some cultures appear entirely yeast-like (synanam. Phaeococcomyces), or form phialidic collarettes (synanam. Phialophora), sympodial conidiophores (synanam. Rhinocladiella without conidiophores, Ramichloridium with conidiophores) or dry conidial chains (synanam. Cladophialophora). The genus Exophiala was established in 1966 by J. W. Carmichael on the basis of Exophiala salmonis J.W. Carmichael, which type strain was isolated from cerebral mycetoma of Salmo clarkia [21]. The primarily described phialide-like sporogenous cells of this genus were recognized as annellides later [22-24]. The annellated zones are the main diagnostic feature of this genus. With this morphological criterion erected, a number of Exophiala species were consequently defined or re-classified, e. g. E. jeanselmei (Langeron) McGinnis & A.A. Padhye (including three morphological varieties), E. dermatitidis (Kano) de Hoog, E. pisciphila McGinnis & Ajello, E. mansonii (Castell.) de Hoog, E. moniliae de Hoog, E. spinifera (H.S. Nielsen & Conant) McGinnis, etc. [22;23;25-28]. The genus Wangiella McGinnis [29] was proposed for the dematiaceous hyphomycete originally invalidly published as Hormiscium dernatitidis Kano [30] and subsequently placed in the genera Fonsecaea [31], Hormodendrum [32]and Phialophora [33]. McGinnis placed in the genus Wangiella as W. dermatitidis according to that the species formed conidia predominantly from phialides without collarettes. However, Nishmura et al. confirmed by scanning electron microscopy that the conidia of E. dermatitidis arised mostly from annellides, but annellated zones were limited [34]. Until 1996, a total of twelve accepted Exophiala species were identified morphologically[35], including 6 known opportunists in humans. Table 2 gives the name list of Exophiala species.

4 Introduction

In the past, taxonomic and diagnostic schemes for Exophiala were morphological, while later some physiological parameters proved to be useful [36;37]. Morphology is rather unreliable for species identification due to variable appearance. Their taxonomic coherence has been proven by sequencing of the ribosomal gene [38-41]. During the last ten years, taxonomic schemes have become re-ordered supplemented by molecular data, particularly sequences of the rDNA ITS regions [42-44]. Most species were redefined, re-designated or initially described mainly depending on genetic characteristics, combined with morphological, physiological and ecological features [39;44-46]. Only phenetically recognizable taxa such as E. dermatitidis and E. spinifera remained largely unaltered. Thus far, 26 species of the genus Exophiala have been erected (including 15 opportunists in humans), followed by several new species to be described soon (including 3 opportunists in humans) [PhD thesis, M. J. Harrak, 2008]. In the mean time, phylogenetic knowledge of the genus developed. Though the anamorphs of major teleomorphs can be predicted to belong to Exophiala [34;47-51], the number of described species of Exophiala with a proven Capronia teleomorph, conspecific to or even close in morphological and physiological parameters [38;40;52;53] is very small.

A new tool for species recognition: GCPSR Historically there are four prevalent species concepts [54]. These are Evolutionary Species Concept (ESC), Morphological Species Concept (MSC), Biological Species Concept (BSC) and Phylogenetic Species Concept (PSC). ESC defines a species as, “ . . . a single lineage of ancestor-descendent populations which maintains its identity from other such lineages and which has its own evolutionary tendencies and historical fate” [55]. When ESC comes to identifying species, it is not helpful because it has no recognition criteria. In contrast, the other 3 species concept do specify criteria for recognizing species, therefore the term ‘species recognition’ was proposed to replace ‘species concept’, namely Morphological Species Recognition (MSR), Biological Species Recognition (BSR) and Phylogenetic Species Recognition (PSR) [56]. Among these types of species recognition, PSR performs best. Once the evolutionary species has formed from an ancestor, changes in gene sequences occur and can be recognized before changes have occurred in mating behavior or morphology [56]. With fungi, Harrington & Rizzo proposed a type of PSR that diagnoses species as “ . . . the

5 Chapter 1 smallest aggregation of populations with a common lineage that share unique, diagnosable phenotypic characters” [57]. With PSR, fungal species are diagnosed based on the concordance of gene genealogies and phenotypic features. Some fungal studies demonstrate that PSR is well suited to fungi [58-60]. But it is difficult to place the limit of the species when a gene is polymorphic within a species or fix on for alternate alleles in more than one species. Given additional information, e.g. ability to interbreed, this difficulty could be solved [61]. PSR can avoid the subjectivity of determining the limits of a species by replying on the concordance of more than one gene genealogy [62]. This type of PSC was named as Genealogical Concordance Concept (GCC) by Mayden [54]. Later, Taylor et al. used the term ‘Genealogical Concordance Phylogenetic Species Recognition’ (GCPSR) to indicate this principle related to operational species concept [56]. With GCPSR, more than one gene lineages need to be investigated and compared. When conflict occurs among lineages, the transition from concordance to conflict determines the limits of species [56]. However this transition can not occur for clonal populations. In this case, the boundary of species is determined by diagnosable phenotypic characters in morphology, physiology, ecology, pathogenicity and antifungal susceptibility; or as suggested by Taylor et al., clonal species could be accommodated via the GCPSR by defining them in relation to their recombining relatives [56]. Techniques for measuring and testing the significance of phylogenetic incongruence are used widely in systematic biology, and are necessary when considering multiple genes that may or may not have different histories [63-71]. One of the most intuitive measures of incongruence is the Incongruence Length Difference test (ILD) [63-64]. The version of the test available in the popular phylogenetic analysis program PAUP* [72] is called the ‘Partition Homogeneity Test’ (PHT). Incongruence found by ILD indicates evolutionary historical heterogeneity among lineages. Normally evolutionary historical heterogeneity includes differences in evolutionary processes, such as different rates of evolution, or alternative evolutionary history. The latter mostly concerns non-vertical inheritance, e.g. gene duplication, loss, horizontal gene transfer, hybridization or recombination. ILD is meant to be an overall measure of incongruence between datasets. Though tests for locating incongruence among loci are available [65;71], most of them are not thoroughly tested and insufficiently understood. Detailed localization is

6 Introduction time consuming. Of the above mentioned historical events, recombination is most closely related to species recognition with GCPSR. One of methods to detect recombination with multi-locus data sets is to calculate the

Index of Association (IA, a measure of multi-locus linkage disequilibrium) for a reproductively isolated population. Detecting population differentiation (index: ө) and computing IA and can be performed with Multilocus v. 1.2.2 (http://www.bio.ic.ac.uk/evolve/software/multilocus) software. Population structure can be inferred from phylogenetic analysis and from clustering analysis of genotype data sets with

STRUCTURE software v. 2. [http://pritch.bsd.uchicago.edu]. The scheme for recognizing fungal species with the criterion of GCPSR in my studies is summarised in Figure 1.

Diagnostics of etiologic fungi Conventional methods to identify etiologic fungi often rely on identification of disease symptoms, isolation and culturing of organisms, and laboratory identification by morphology and biochemical tests. These methods rely on experienced, skilled laboratory staff, the ability of the organism to be cultured, are time consuming, non-quantitative, and prone to contamination. Although they are the cornerstone of fungal diagnostics, they can lead to problems in identification, resulting in incorrect interpretation, diagnosis and ultimately treatment. New, rapid screening methods are being developed and increasingly used in all aspects of fungal diagnostics. These methods include immunological methods, DNA/RNA probe technology and Polymerase Chain Reaction (PCR) technology. Based on PCR and probe technology, micro-array technology and real-time PCR methods bring a bright future for the development of accurate, quantitative diagnostic tools. DNA barcoding as a standardized approach to identify species by a short gene sequence from a uniform region in the genome [http://www.barcoding.si.edu] was advocated several years ago. Barcoding provides tools that allow rapid and unambiguous definition and recognition, and has phylogenetical implications as it is directly based upon the evolutionary history of life.

7 Chapter 1 A ) (genetic isolation) isolation) (genetic Clonality for each cluster(measure I genotype dataset genotype ) ө According to GCPSC Recombination Inferpopulation (or cluster) number (using software) Structure Compare clustering obtained with different methods, methods, different with obtained clustering Compare in distribution and individual numbers cluster decide each cluster Assess reproductive modeAssess reproductive with Linkage Disequilibrium Analysis in Multilocus software) Detect population differentiation population Detect among clustersPopulation (using Differentiation Analysis in Multilocus, Define genotypesfor each locus ( Species Species may be assigned to recombining clusters sequencesets data Multilocus Incongruent Detect reproductive reproductive Detect modes of clades the in trees Groupingphenotypicon based preference, host g. (e. features distribution, geographical antifungal pathogenicity, susceptibility) Construct MP treeeach of gene Detect congruenceDetect among gene lineages (performed with Partition Homogeneity Test in program) PAUP Detect homoplasy within locus (calculate CI,HI in PAUP) Species may Species be assigned to monophyletic clades Congruent (clonality) Fig. 1. The scheme for recognizing fungal species with the criterion of PSR and GCPSR GCPSR and PSR of criterion the with species fungal recognizing for scheme The 1. Fig. Reconstruct phylogenetic multilocus combined of tree data sets

According to PSR to According criterion

8 Introduction

Outline of this thesis The diagnoses which can leads to ultimately efficient treatment are based on correct recognition of species. Therefore, it is important to investigate not only genetic characteristics but also phenotypic features obtained by traditional taxonomic methods to gain a full understanding of the species at hand. This involves at least morphology, physiology, detailed ecology (including route of infection and predilection), pathogenicity and antifungal susceptibility of species. Chapter 2 of this Thesis delineates variability within the Ps. boydii complex which was investigated at different levels of diversity by multilocus gene sequencing and Restriction Fragment Length Polymorphism (RFLP) analysis. In order to explore new species and try to find more evidence supporting recently described species with the criterion of GCPSR, concordance among multi-locus lineages was tested by PHT; population differentiation among clusters and recombination within partial clusters were detected in evolutional history of the complex. Chapter 3 contains a novel species E. xenobiotica, separated from E. jeanselmei on the basis of the divergency of ITS region of rDNA, partial elongation factor 1-α and β-tubulin genes with supporting by distinct ecology. The species is found to have a predilection in human infection (Chapter 4), in addition to occurrence with xenobiotic aromates. With re-identification of 188 clinical isolates of Exophiala from the USA by sequencing the ITS region of rDNA gene, the spectrum of clinically relevant Exophiala species was investigated for the first time (Chapter 4). The involved Exophiala species showed different pathogenic predilections ranging from superficial infection to systemic mycoses. The main species are found to be clonal (Chapter 5), and the data largely support the present taxonomy of Exophiala species in the clinics. Because taxonomy of Exophiala recently has been mainly based on sequence diversity of the ITS region of rDNA gene, it is necessary to know if the diversity of the ITS region is concordant with those of other genes, and if sequencing the ITS region can be used as a reliable tool for species identification. As a representative of the genus Exophiala, species in the E. spinifera clade were chosen for this research (Chapter 5). Sequences of four independent genes were analysed and phylogenetic trees were reconstructed using different

9 Chapter 1 algorithms. To find specific borderlines with GCPSR, reproductive isolation within the clade and reproductive modes of the species were also determined. Summarizing diagnostic features of morphology, physiology, immunology and genetics of species belonging to the E. spinifera clade, it is concluded that sequencing the ITS region is reliable method for identification of the species in this clade, and the ITS region is therefore a good candidate for barcodes of Exophiala (Chapter 6). Having reliably identified the opportunistic taxa, tools should be developed to aid the clinician to provide an optimal therapy to the patients. To this aim, methods for antifungal susceptibility testing were adjusted to Pseudallescheria (Chapter 7).

Reference

1. Siebenmann F. DIE SCHIMMELMYKOSEN DES MENSCHLICHEN OHRES [THE MYCOSES OF THE HUMAN EAR]. Wiesbaden: 1899.

2. Gilgado F, Cano J, Gené J, et al. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J Clin Microbiol 2005; 43: 4930-4942.

3. Uijthof JM, de Hoog GS. PCR-ribotyping of type isolates of currently accepted Exophiala and Phaeococcomyces species. Antonie Leeuwenhoek 1995; 68: 35-42.

4. McGinnis MR, Padhye AA, Ajello L. Pseudallescheria Negroni et Fischer, 1943 and its later synonym Petriellidium Malloch, 1970. Mycotaxon 1982; 14: 94-102.

5. Costantin MJ. Eurotiopsis, nouveau genre d'ascomycètes. Bull Soc Bot France 1893; 40: 236-238.

6. Saccardo PA, Sydow P. Sylloge Fungorum XIV. 1899: 464.

7. Malloch D. New concept in the Microascaceae illustrated by two new species. Mycologia 1970; 62: 727-740.

8. Shear CL. Life history of an undescribed ascomycete isolated from a granular mycetoma of man. Mycologia 1922; 14: 239-243.

10 Introduction

9. Malloch D, Cain RF. New species and combinations of cleistothecial Ascomycetes. Can J Bot 1972; 50: 61-72.

10. Arx JAv. Notes on Microascaceae with the description of two new species. Persoonia 1978; 10: 23-31.

11. Arx JAv. The genera Petriellidium amd Pithoascus (Microascaceae). Persoonia 1973; 7: 367-375.

12. Negroni P, Fischer I. Pseudallescheria sheari n. gen., n. sp. aislada de un paramicetoma de la rodilla. Rev Inst Bacteriol Buenos Aires 1944; 12: 195-204.

13. Negroni P, Herrmann H, Fischer I. Artritis aguda purulenta producida por el Ascomycete Pseudallescheria sheari n.g n. sp. Prensa Med Argent 1943; 30: 2389-2399.

14. Castellani A, Chalmers AJ. MANUAL OF TROPICAL MEDICINE, 3rd. London: Baillie're Tindall & Cox, 1919.

15. Guého E, de Hoog GS. Taxonomy of the medical species of Pseudallecheria and Secedosporium. J Mycol Méd 1991; 1: 3-9.

16. Rainer J, de Hoog GS, Wedde M, et al. Molecular variability of Pseudallescheria boydii, a neurotropic opportunist. J Clin Microbiol 2000; 38: 3267-3273.

17. Issakainen J, Jalava J, Hyvonen J, et al. Relationships of Scopulariopsis based on LSU rDNA sequences. Med Mycol 2003; 41: 31-42.

18. Gilgado, F., Cano, J., Gene, J., and Guarro, J. Characterization of Scedosporium frequentans: the most common species of the P. boydii complex. 2006. Paris, France, the 16th Congress of the International Society for Human and Animal Mycology. 25-6- 2006.

19. Gilgado F, Serena C, Cano J, et al. Antifungal susceptibilities of the species of the Pseudallescheria boydii complex. Antimicrob Agents Chemother 2006; 50: 4211-4213.

20. Zeng J, Kamei K, Zheng Y, et al. Susceptibility of Pseudallescheria boydii and Scedosporium apiospermum to new antifungal agents. Nippon Ishinkin Gakkai Zasshi 2004; 45: 101-104.

21. Carmichael JW. Cerebral mycetoma of trout due to a Phialophora-like fungus. Sabouraudia 1966; 5: 120-123.

22. de Hoog GS. Rhinocladiella and allied genera. Stud Mycol 1977; 15: 1-140.

23. McGinnis MR. Exophiala spinifera, a new combination for Phialophora spinifera. Mycotaxon 1977; 5: 337-340.

24. McGinnis MR. Taxonomy of (Langeron) McGinnis and Padhye. Mycopathologia 1978; 65: 79-87.

11 Chapter 1

25. McGinnis MR, Padhye AA. Exophiala jeanselmei, a new combination for Phialophora jeanselmei. Mycotaxon 2007; 5: 341-352.

26. McGinnis MR, Ajello L. A new species of Exophiala isolated from channel catfish. Mycologia 1974; 66: 518-520.

27. McGinnis MR. Human pathogenic species of Exophiala, Phialophora and Wangiella. PAHO Sci Pub 1978; 356: 37-59.

28. Katz B, McGinnis MR. A new species of Exophiala recovered from loblolly pine litter. Mycotaxon 1980; 11: 182-184.

29. McGinnis MR. Wangiella, a new genus to accomodate Hormiscium dermatitidis. Mycotaxon 1977; 5: 353-363.

30. Kano K. Über die chromoblastomykose durch einen noch nicht als pathogen beschriebnen Pilz: Hormiscium dermatitidis n. sp. Aichi Igakkai Zasshi 1934; 41: 1657- 1674.

31. Yeastlike dematiaceous fungi infectionthe human skin. Arch Dermatol Syph (Chicago) 1950; 61: 996-1009.

32. Conant NF, Smith DT, Baker RD, et al. MANUAL OF CLINICAL MYCOLOGY, 2nd. Philadelphia: W. B. Saunders Co., 2007.

33. Emmons CW, Binford CH, UTZ JP. MEDICAL MYCOLOGY. Philadelphia: Lea and Febiger, 1963.

34. Nishimura K, Miyaji M. Annellated conidiogenous cells in Exophiala dermatitidis, agent of . Mycologia 1981; 73: 1181-1183.

35. Uijthof JMJ. Relationships within the genus Exophiala based on ITS1 sequences. Mycol Res 1996; 100: 1265-1271.

36. de Hoog GS, Haase G. Nutritional physiology and selective isolation of Exophiala dermatitidis. Antonie Leeuwenhoek 1993; 64: 17-26.

37. de Hoog GS, Gerrits van den Ende AHG, Uijthof JM, et al. Nutritional physiology of type isolates of currently accepted species of Exophiala and Phaeococcomyces. Antonie Leeuwenhoek 1995; 68: 43-49.

38. Haase G, Sonntag L, van de Peer Y, et al. Phylogenetic analysis of ten black yeast species using nuclear small subunit rRNA gene sequences. Antonie Leeuwenhoek 1995; 68: 19-33.

39. Haase G, Sonntag L, Melzer-Krick B, et al. Phylogenetic interference by SSU-gene analysis of members of the with spcial reference to human pathogenic species. Stud Mycol 1999; 43: 80-97.

12 Introduction

40. Masclaux F, Guého E, de Hoog GS, et al. Phylogenetic relationships of human- pathogenic (Xylohypha) species inferred from partial LSU rRNA sequences. J Med Vet Mycol 1995; 33: 327-338.

41. Spatafora JW, Mitchell TG, Vilgalys R. Analysis of genes coding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. J Clin Microbiol 1995; 33: 1322-1326.

42. Tintelnot K, de Hoog GS, Thomas E, et al. Cerebral phaeohyphomycosis caused by an Exophiala species. Mycoses 1991; 34: 239-244.

43. de Hoog GS, Poonwan N, Gerrits van den Ende AHG. Taxonomy of Exophiala spinifera and its relationship to E. jeanselmei. Stud Mycol 1999; 43: 133-142.

44. de Hoog GS, Vicente V, Caligiorne RB, et al. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J Clin Microbiol 2003; 41: 4767-4778.

45. Vitale RG, Afeltra J, de Hoog GS, et al. In vitro activity of and in combination with , sulfadiazine and quinolones against Exophiala spinifera. J Antimicrob Chemother 2003; 51: 1297-1300.

46. de Hoog GS, Zeng JS, Harrak MJ, et al. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie Leeuwenhoek 2006; 90: 257-268.

47. Schol-Schwarz MB. Rhinocladiella, its synonym Fonsecaea and its relation to Phialophora. Antonie Leeuwenhoek 1968; 34: 119-152.

48. Samuels GJ, Müller E. Life-history studies of Brazilian ascomycetes. 3. Melonomma radicans sp. nov. and its Aipiosphaeria anamorph, Trematosphaeria perrumpens sp. nov. and Berlesiella fungicola sp. nov. and its Ramichloridium anamorph. Sydowia 1978; 31: 142-156.

49. Müller E, Pitrini O, Fisher PJ, et al. Taxonomy and anamorphs of the Herpotrichiellaceae with notes on genetic synonymy. Trans Brit Mycol Soc 1987; 88: 63-74.

50. Untereiner WA. Fruiting studies in species of Capronia (Herpotrichiellaceae). Antonie Leeuwenhoek 1995; 68: 3-17.

51. Untereiner WA. Taxonomy of selected members of the ascomycete genus Capronia with notes on anamorph-teleomorph connections. Mycologia 1997; 89: 120-131.

52. Haase G, Sonntag L, Melzer-Krick B, et al. Phylogenetic interference by SSU-gene analysis of members of the Herpotrichiellaceae with special reference to human pathogenic species. Stud Mycol 1999; 43: 80-97.

13 Chapter 1

53. Untereiner WA, Gerrits van den Ende AHG, de Hoog GS. Nutritional physiology of species of Capronia. Stud Mycol 1999; 43: 98-106.

54. Mayden RL. A hierarchy of species concept: The denouement in the saga of the species problem. In: Claridge MF, Dawah HA, Wilson MR eds. SPECIES: THE UNITS OF BIODIVERSITY. London: Chapman & Hall, 1997: 381-424.

55. Wiley EO. The evolutionary species concept reconsidered. Syst Zool 1978; 27: 17-26.

56. Taylor JW, Jacobson DJ, Kroken S, et al. Phylogenetic Species Recognition and Species Concepts in Fungi. Fungal Genet Biol 2000; 31: 21-32.

57. Harrington TC, Rizzo DM. Defining species in the fungi. In: Worrall JJ ed. STRUCTURE AND DYNAMICS OF FUNGAL POPULATIONS. Dordrecht: Kluwer Academic, 1999: 43-71.

58. Geiser DM, Pitt JI, Taylor JW. Cryptic speciation and recombination in the aflatoxin- producing fungus Aspergillus flavus. Proc Natl Acad Sci USA 1998; 95: 388-393.

59. Kasuga T, Taylor JW, White TJ. Phylogenetic relationships of varieties and geographical groups of the human Histoplasma capsulatum Darling. J Clin Microbiol 1999; 37: 653-663.

60. Koufopanou V, Burt A, Taylor JW. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus immitis. Proc Natl Acad Sci USA 1997; 94: 5478-5482.

61. Baum DA, Donoghue MJ. Choosing among alternative "phylogenetic" species concepts. Syst Bot 1995; 20: 560-573.

62. Avise JC, Ball RMJ. Principles of genealogical concordance in species concepts and biological taxonomy. In: Futuyma D, Antonovis J eds. OXFORD SURVEYS IN EVOLUTIONARY BIOLOGY. Oxford: Oxford Univ.Press, 1990: 45-67.

63. Mickevich MF, Farris JS. The implications of congruence in Menidia. Syst Zool 1981; 30: 351-370.

64. Farris JS, Kallersjo M, Kluge AG, et al. Testing the significance of incongruence. Cladistics 1994; 10: 315-319.

65. Templeton AR. Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and the apes. Evolution 1983; 37: 221-244.

66. Zelwer M, Daubin V. Detecting phylogenetic incongruence using BIONJ: an improvement of the ILD test. Mol Phylogenet Evol 2004; 33: 687-693.

67. Faith DP. Clastic permutation tests for monophyly and nonmonophyly. Syst Zool 1991; 40: 366-375.

14 Introduction

68. Kishino H, Hasegawa M. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea. J Mol Evol 1989; 29: 170-179.

69. Hasegawa M, Kishino H. Heterogeneity of tempo and mode of mitochondrial DNA evolution among mammalian orders. Jpn J Genet 1989; 64: 243-258.

70. Shimodaira H, Hasegawa M. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol Biol Evol 1999; 17: 1114-1116.

71. Thornton JW, DeSalle R. A new method to localize and test the significance of incongruence: detecting domain shuffling in the nuclear receptor superfamily. Syst Biol 2000; 49: 183-201.

72. Swofford DL. PAUP* 4.0: PHYLOGENETIC ANALYSIS USING PARSIMONY. Sunderland, MA, U.S.A.: Sinauer Associates, 2000.

15 Chapter 1

Table 1. Checklist of names in Pseudallecheria and Scedosporium with indication of type strains and cross reference numbers (The present names are printed in bold. Names are listed in alphabetic order of epithet.)

• Allescheria boydii Shear, 1922, Shear [Mycologia 14: 239] • ≡ Petriellidium boydii (Shear) Malloch, 1970 [Mycologia 62: 727] • ≡ Pseudallescheria boydii (Shear) McGinnis, A.A. Padhye & Ajello 1982 [Mycotaxon 14: 94] o Type strain: CBS 101.22 = IHEM 15933 = IMI 015407 = IP 1975.91 = JCM 7441 = NCPF 2216 = UAMH 3982man, isolated from mycetoma of a human patient in Galveston, Texas, USA by M.F. Boyd in 1921.

• Petriellidium africanum Arx & G. Franz, 1973 [Persoonia 7: 367] • ≡ Pseudallescheria africana (Arx & G. Franz) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94] o Type strai: CBS 311.72 = UAMH 4000, isolated from brown sandy soil, 25 km W of Tsintsabis , Namibia by G. Franz; herbarium: CBS H-15815.

• Petriellidium angustum Malloch & Cain, 1972 [Can. J. Bot. 50: 66] • ≡ Pseudallescheria angusta (Malloch & Cain) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94] o Type strain: CBS 254.72 = ATCC 22956 = IHEM 4429 = RV 57007 = TRTC 45321 = UAMH 3984, isolated from sewage half digestion tank in Dayton, Ohio, USA by W.B. Cooke.

• Petriellidium desertorum Arx & Moustafa, 1973 [Persoonia 7: 367] • ≡ Pseudallescheria desertorum (Arx & Moustafa) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94] o Type strain: CBS 489.72 = UAMH 3993, isolated from salt-marsh soil in Kuwait by A.F. Moustafa.

• Petriellidium ellipsoideum Arx & Fassatiová, 1973 [Persoonia 7: 367] • ≡ Pseudallescheria ellipsoidea (Arx & Fassatiová) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94]

16 Introduction

o Type strain: CBS 418.73 = UAMH 3987, isolated from soil in Tajikistan by O. Fassatiová.

• Petriellidium fimeti Arx, Mukerji & N. Singh, 1978 [Persoonia 10: 23] • ≡ Pseudallescheria fimeti (Arx, Mukerji & N. Singh) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94] o Type strain: CBS 129.78, isolated from dung of goat in Aligarh,India by K.G. Mukerji, 1976, herbarium: CBS H-7549.

• Petriellidium fusoideum Arx, 1973 [Persoonia 7: 367-375] • ≡ Pseudallescheria fusoidea (Arx) McGinnis, A.A. Padhye & Ajello, 1982 [Mycotaxon 14: 94] o Type strain: CBS 106.53 = ATCC 11657; CDC A-722; UAMH 3997, isolated from soil in Panama, Guipo by L. Ajello.

• Pseudallescheria minutispora Gilgado, Gené, Cano & Guarro, 2005 [J. Clin. Microbiol. 43: 4930] o Type strain: IMI 392887 = FMR 4072 = IHEM 21148 = CBS 116911, isolated from sediment of Tordera river, Barcelona, Spain.

• Scedosporium apiospermum Sacc. ex Castell. & Chalm., 1919 [Manual of Tropical Medicine. 3rd edn. p. 1122] • = Scedosporium sclerotiale (Pepere) Neveu-Lem., 1921 [Précis de Parasitologie humaine, ed 5, p. 86] • telemorph Pseudallescheria boydii (Shear) McGinnis, A.A. Padhye & Ajello 1982

• Scedosporium aurantiacum Gilgado, Gené, Cano & Guarro, 2005 [J. Clin. Microbiol. 43: 4930] o Type strain: IMI 392886 = FMR 8630 = IHEM 21147 = CBS 116910, isolated from ankle ulcer of a human patient by J.L. Taboada in Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain.

• Scedosporium magalhaesii H.P. Fröes [H.P. Fröes 1930, Mycet. Pedis Brazil: 49]

17 Chapter 1

• ≡ Monosporium magalhaesii (H.P. Fröes) C.W. Dodge, 1935 [Dodge, C.W. 1935, Medical mycology] o Type strain: probably not preserved

• Lomentospora prolificans Hennebert & B.G. Desai, 1974 [Mycotaxon 1: 45] • = Scedosporium inflatum Malloch & Salkin, 1984 [Mycotaxon 21: 247] • ≡ Scedosporium prolificans (Hennebert & B.G. Desai) E. Guého & de Hoog, 1991 [J. Mycol. Méd. 1: 8] o Type strain: CBS 467.74 = IHEM 5739 = IMI 188615 = MUCL 18141, isolated from greenhouse soil, from mixed forest litter in Heverlee, Belgium by B.G. Desai in 1971; herbarium: CBS H-7308 (isotype), herbarium: G.L.H. 18141 (holotype)

• Pseudallescheria mesopotamicum ined.(mentioned in database of the CBS collection)

• Scedosporium frequentans (Gilgado et al, in press)

• Scedosporium dehoogii (Gilgado et al, in press)

Table 2. Checklist of names in Exophiala (26 species) with indication of type strains (This list was made as a supplement to that from of J.M. J. Uijthof (Uijthof 1995). The present species names are printed in bold. Names are listed in alphabetic order of epithet.)

• Exophiala alcalophila Goto & Sugiy [Trans. Mycol. Soc. Japan 22: 430] o Type strain: CBS 520.82 = IAM 12519, isolated from soil in Hirose, Wako-shi, Saitama Pref., Japan.

• Exophiala angulospora Iwatsu, Udagawa & T. Takase [Mycotaxon 41: 321-328] o Type strain: CBS 482.92 = NHL 3101, isolated from drinking well water in Yokoyama-shi, Japan.

18 Introduction

• Exophiala attenuata Vitale & de Hoog, 2003 [Med. Mycol. 40: 554] o Type strain: CBS 101540 = IFM 46115, isolated from soil, Colombia.

• Torula bergeri Langeron in berger & langeron, 1949 [Annls Parasit. Hum. Comp. 24: 597] • ≡ Pullularia bergeri (Langeron) Seeliger, Silva Lacaz & Ulson, 1959 [Proc. Int. Congr. Trop. Med. Malar. 6: 641] • ≡ Exophiala bergeri Haase & de Hoog, 1999 [Stud. Mycol. 43: 91] o Type strain: CBS 353.52 = NCMH 159 = Duke 978, isolated from human chromomycosis in Canada.

• Exophiala salmonis J.W. Carmichael, 1966 [Sabouraudia 5: 120] • = Exophiala brunnea Papendorf, 1969 [Trans. Br. Mycol. Soc. 52: 487] • = Aureobasidium salmonis (J.W. Carmichael) Borelli, 1969 [ ? ] o Type strain: CBS 587.66 = ATCC 32288 = PRE 43729, isolated from Acacia karroo (Leguminosae-mimosoideae) leaf litter in Potchefstroom, South Africa; herbarium: CBS H-12618.

• Sporocybe calicioides Fr. 1832 [Syst. Mycol. (Lundae) 3: 342] • ≡ Periconia calicioides (Fr.) Berk. • ≡ Hypsotheca calicioides (Fr.) Ellis & Everh., 1885 • ≡ Graphium calicioides (Fr.) Cooke & Massee, 1887 [Grevillea 16: 11] • ≡ Exophiala calicioides (Fr.) G. Okada & Seifert, 2000 o Type strain: unknown

• Microsporum mansonii Castellani, 1905 [Brit. Med. J. 2: 1271] • ≡ Foxia mansonii (Castellani) Castellani, 1908 [J. Trop. Med. Hyg. 11: 261] • ≡ mansonii (Castellani) Verdun, 1912 [Précis Parasitol. Hum., éd 2,p. 698] • ≡ Cladosporium mansonii (Castellani) Castellani & Chalmers, 1919 [Man. Trop. Med. p. 1100] • ≡ Torula mansonii (Castellani) Vuillemin, 1929 [C. r. hebd. Séanc. Acad. Sci., Paris 89: 406] • ≡ Sporotrichum mansonii (Castellani) Toro, 1932 [Scient. Surv. P. Rico 8:222] • ≡ Dematium mansonii (Castellani) C.W. Dodge, 1935 [Med. Mycol. p. 678] • ≡ Aureobasidium mansonii (Castellani) W.B. Cooke, 1962 [Mycopath. Mycol. Appl. 17: 34]

19 Chapter 1

• ≡ Rhinocladiella mansonii (Castellani) Schol-Schwarz, 1968 [Antonie van Leeuwenhoek 34: 122] • ≡ Exophiala mansonii (Castellani) de Hoog, 1977 [Stud. Mycol. 15: 114] • ≡ Wangiella mansonii (Castellani) McGinnis ex Bièvre & Mariat, 1979 [Bull. Soc. Fr. Mycol. Méd. 8: 127] • ≡ Exophiala castellanii Iwatsu, Nishimura & Miyaji, 1984 [Mycotaxon 20: 307] • ≡ Exophiala jeanselmei var. castellanii (Iwatsu, Nishimura & Miyaji) Iwatsu & Udagawa, 1990 [Mycotaxon 37: 292] o Type strain: CBS 158.58 = ATCC 18657 = IFM 4702 = MUCL 10097, isolated from skin scrapings of human patient in Sri Lanka; herbarium: CBS H-7132 (isotype), CBS H-7133 (isotype)

• Exophiala crusticola Bates, Gundlapally & Garcia-Pichel, 2006 [Int. J. Syst. Evol. Microbiol. 56: 2697] o Type strain: CBS 119970 = ATCC MYA-3639 = DSM 16793, isolated from biological soil crust sample in Colorado Plateau by S.N.R. Gundlapally, USA; herbarium: UAMH 10686 (holotype); MycoBank number MB501062.

• Hormiscium dermatitidis Kano, 1934 [Aichi Igakukwai Zasshi 41: 1668] • ≡ Fonsecaea dermatitidis (Kano) Carrión, 1950 [Arch. Derm. Syphil. 61:1008] • ≡ Hormodendrum dermatitidis (Kano) Conant in Conant, 1954 [Man. Clin. Mtcol. ed. 2 p. 276] • ≡ Phialophora dermatitidis (Kano) Emmons, 1963 [Med. Mycol. p. 291] • ≡ Exophiala dermatitidis (Kano) de Hoog [Stud. Mycol. 15: 118] • ≡ Wangiella dermatitidis McGinnis, 1977 [Mycotaxon 5: 355] o Type strain: CBS 207.35 = ATCC 28869 = DUKE 2400 = IFO 6421 = IMI 093967 = LSHTM 1135 = NCPF 2422 = UAMH 3967, isolated from human facial chromomycosis in Japan; herbarium: CBS H-7131.

• Exophiala dopicola Katz & McGinnis [Mycotaxon 11: 182] o Type strain: CBS 537.94 = BAK 978, isolated from Pinus taeda litter (Pinaceae) in Duke forest, Orange County, North Carolina, USA by B. Katz in 1977.

• Phaeococcus exophialae de Hoog, 1977 [Stud. Mycol. 15: 127]

20 Introduction

• ≡ Phaeococcomyces exophialae (de Hoog) de Hoog, 1979 [Taxon 28: 348] • ≡ Exophiala exophialae (de Hoog) de Hoog, 2003 [J. Clin. Microbiol. 41: 4767] o Type strain: CBS 668.76 = ATCC 26088, isolated from straw in armadillo burrow (Dasypus septemcinctus), Uruguay by J.E. MacKinnon; herbarium: CBS H-7551

• Exophiala equina (still to be reported) o Exophiala pisciphila clade

• Trichosporum heteromorphum Nannfeldt, 1934 [Svenska Skogsv.-Fören. Tidskr. 32: 397] • = Margarinomyces heteromorphus (Nannfeldt) F. Mangenot, 1952 [Revue. Gén. Bot. 59: 391] • ≡ Phialophora heteromorpha (Nannfeldt) C.J.K. Wang, 1964 [Can. J. Bot. 42: 1011] • ≡ Exophiala jeanselmei var. heteromorpha (Nannfeldt) de Hoog, 1977 • ≡ Wangiella heteromorpha (Nannfeldt) McKemy, 1999 • ≡ Exophiala heteromorpha (Nannfeldt) de Hoog & Haase [J. Clin. Microbiol. 41: 4767] o Type strain: CBS 232.33 = CDC B-2823 = MUCL 9894 = NCMH 17 = VKM F-704, isolated from wood pulp in Sweden by E. Melin, herb CBS H-17795.

• Torula jeanselmei Langeron, 1928 [Ann. Paras. hum. Comp. 6: 385] • ≡ Torula sp., Jeanselma, 1928 [Bull. Soc. Fr. Dermatol. Syphiligr. 35: 369] • ≡ Pullularia jeanselmei (Langeron) C.W. Dodge, 1935 [Medical Mycology p. 675] • ≡ Phialophora jeanselmei (Langeron) C.W. Emmons, 1945 [Arch. Pathol. 39: 368] • ≡ Exophiala jeanselmei (Langeron) McGinnis & A.A. Padhye, 1977 [Mycotaxon 5: 345] • ≡ Exophiala jeanselmei var. jeanselmei, 1977 [Stud. Mycol. 15: 108] o Type strain: CBS 507.90 = ATCC 34123 = CBS 664.76 = DUKE 2405 = IAM 14677 = IHM 283 = NCMH 123 = NCPF 2439, isolated from human mycetoma in Uruguay.

• Torula lecanii-corni Benedek & G. Specht, 1933 [Zentbl. Bakt. Parasitkde, Abt. 1, 130: 74] • = Pullularia fermentans var. benedekii E.S. Wynne & Gott, 1956 [J. Gen. Microbiol. 14: 512] • ≡ Exophiala jeanselmei var. lecanii-corni (Benedek & G. Specht) de Hoog, 1977[Stud. Mycol. 15: 112] • ≡ Exophiala lecanii-corni (Benedek & G. Specht) Haase & de Hoog, 1999 [Stud. Mycol. 43: 80]

21 Chapter 1

o Type strain: CBS 123.33 = ATCC 12734 = IMI 062462, isolated as symbiont of Lecanium corni (scale bug).

• Exophiala mesophila Listemann & Freiesleben, 1996 [Mycoses 39: 1] o Type strain: CBS 402.95, isolated from silicone seal in shower room of hospital in Hamburg, Germany. o Exophiala lecanii-corni clade

• Exophiala moniliae de Hoog, 1997 [Stud. Mycol. 15: 120] o Type strain: CBS 520.76, isolated from twig of Quercus sp.(Fagaceae) in St. Petersburg, Russia; herb: CBS H-7134.

• Nadsoniella nigra Issatschenko, 1914 [Annu. Exped. Sci. Mourmansk, 1906, p. 273] • ≡ Exophiala nigra (Issatschenko) Haase & de Hoog, 1999 [Stud. Mycol. 43: 91] o Type strain: CBS 535.94, isolated from seawater (5-10 m), Kolskiy near Murmansk, Harbour Ekaterninskaya (naval base Poliarny), Russia.

• Exophiala nishimurae Vitale & de Hoog [Med. Mycol. 40: 545] o Type strain: CBS 101538 = IFM 41855, contaminant in Exophiala spinifera IFM 41855 from bark in Venezuela.

• Melanchlenus oligospermus Calendron, 1953 [C. R. Acad. Sci. 236: 1598]; invalid. o Type strain: CBS 265.49 = MUCL 9905, isolated from honey near St. Domineuc, Ille & Vilaine, France by A. Calandron. • ≡ Exophiala oligosperma Calendron ex de Hoog & Tintelnot, 2003 [J. Clin. Microbiol. 41: 4767] o Type strain: CBS 725.88, isolated from human patient of tumour of sphenoidal cavity, Germany, Würzburg by K. Tintelnot, 1988.

• Sarcinomyces phaeomuriformis Matsumoto, A.A. Padhye, Ajello & McGinnis, 1986 [J. Med. Vet. Mycol. 24: 395] • ≡ Exophiala phaeomuriformis (Matsumoto, A.A. Padhye, Ajello & McGinnis) Matos, Haase & de Hoog, 2003 [Antonie van Leeuwenhoek 83: 293]

22 Introduction

o Type strain: CBS 131.88 = CDC B-3558 = NCMH 1215 = UAMH 4278, isolated from human phaeohyphomycosis, Japan.

• Exophiala pisciphila McGinnis & Ajello, 1974 [Mycologia 66: 518] o Type strain: CBS 537.73 = ATCC 24901 = CDC B-1229 = IHEM 3404 = IMI 176060 = IP 1670.86 = NCMH 9 = UAMH 2981, isolated from Channel catfish (Ictalurus punctatus) in Central Alabama, Alabama, USA; herb: CBS H-7135.

• Pullularia prototropha Bulanov & Malama, 1965 [Vesci Akad. Naruk Belarus. SSR 4: 116] • ≡ Exophiala prototropha (Bulanov & Malama) Haase, Yurlova & de Hoog, 1999 [Stud. Mycol. 43: 93] o Type strain: CBS 534.94, source unknown.

• Exophiala psychrophila Pedersen & Langvad, 1989 [Mycol. Res. 92: 153] o Type strain: CBS 191.87 = ATCC 62848, isolated from kidney of Salmo salar.

• Exophiala salmonis J.W. Carmichael, 1966 [Sabouraudia 5: 120] • ≡ Aureobasidium salmonis (J.W. Carmichael) Borelli, 1969 [Medicina Cutanea 3: 588] • = Exophiala brunnea Papendorf, 1969 [Trans. Br. Mycol. Soc. 52: 487] o Type strain: isotype CBS 157.67 = ATCC 16986 = IHEM 3405 = IMI 124165 = MUCL 10078 = UAMH 34 = VKM F-3000, isolated from cerebral mycetoma of Salmo clarkia in Alberta hatchery, Calgary, Alberta, Canada; herb: CBS H-12617, CBS H-7136.

• Phialophora spinifera H.S. Nielsen & Conant, 1968 [Sabouraudia 6: 228] • ≡ Rhinocladiella spinifera (H.S. Nielsen & Conant) de Hoog, 1977 [Stud. Mycol. 15: 93] • ≡ Exophiala spinifera (H.S. Nielsen & Conant) McGinnis, 1977 [Mycotaxon 5: 337] o Type strain: CBS 899.68 = ATCC 18218 = DSM 1217 = DUKE 3342 = IHM 1767 = NCMH 152 = NCPF 2358, isolated from nasal granuloma of a human patient form USA.

• Exophiala xenobiotica de Hoog, 2006 [Antonie van Leeuwenhoek 90: 257] o Type strain: CBS 118157, isolated from oil-contaminated soil in Venezuela.

23 Chapter 1

Reference: J. M. J. Uijthof (1995). Taxonomy and phylogeny of the human pathogenic black yeast genus Exophiala Carmichael. PhD. Dissertation, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Royal Netherlands Academy of Arts and Sciences and Institute of Molecular Cell Biology, University of Amsterdam.

Collection acronyms: ATCC: American Type Culture Collection, Rockville, Maryland, USA CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands CDC: Centers for Disease Control and Prevention, Atlanta, Georgia, USA DSM: Deutsche Sammlung von Mikroorgannismen und Zellkulturen, Baunschweig, Germany DUKE: Duke Medical Center, North Carolina, USA IAM: Institute of Applied Microbiology, Tokyo, Japan IFM: Research Institute for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan IFO: Institute for Fermentation, Osaka, Japan IHEM: Institute of Hygiene and Epidemiology, Brussels, Belgium IMI: CAB International Mycological Institute, Egham, UK IP: Institute Pasteur, Paris, France LSHTM: London School of Hygiene and Tropical Medicine, London, UK MUCL: Mycothèque de l’Université Catholique de Louvain, louvain-la-Neuve, Belgium NCMH: North Carolina Memorial Hospital, Chapel Hill, USA NCPF: National Collection of Pathogenic Fungi, Public Health Laboratory Service, Mycological Reference Laboratory, London, UK NHL: national Hygiene laboratory, National Institute of Hygiene Services, Tokyo, Japan PRE: National Herbarium, Botanical Research Institute, Pretoria, South Africa UAMH: University of Alberta, Microfungus Herbarium and Collection, Edmonton, Canada VKM: All-Union Collection of Micro-organisms, Moscow, Russia

24 Chapter 2

Intraspecific diversity of species of the Pseudallescheria boydii complex

J.S. ZENG a,b,c,d, K. FUKUSHIMA a, , K. TAKIZAWA a, Y. C. ZHENG b, K. NISHIMURA a, Y. GRÄSER e & G. S. DE HOOG c,d a Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan; b Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, Wuhan, Hubei, P. R. China; c Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; d Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands; eInstitute for Microbiology and Hygiene, Department of Parasitology (Charité), Humboldt University, Berlin, Germany Accepted by Medical Mycology in May, 2007

Keywords: Pseudallescheria boydii, Scedosporium apiospermum, LSU, ITS, IGS, RFLP, elongation factor, phylogeny, population structure, recombination

25 Chapter 2

Summary In order to establish intraspecific diversity of Pseudallescheria boydii and Scedosporium apiospermum, and to develop tools for identification, variability within P. boydii and related species was investigated at different levels of diversity. Sequences of the D1/D2 region of large subunit (LSU) and of the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) gene were analyzed for a set of 57 strains, as well as partial sequences of the elongation factor 1-α (EF 1-α ) gene. Incongruence among 3 locus lineages was detected by partition homogeneity test (PHT). The maximum parsimony (MP) tree of the combined sequence data set, with the exception of strain CBS 499.90, formed 3 clades with high bootstrap support, correspondeding to previously described nuclear DNA (nDNA) /DNA reassociation groups. These groups are known to differ slightly in predilection and temperature relations. Using STRUCTURE software, population genetic analysis revealed 3 clusters within the complex on the basis of multi-locus genotype data set. Strain distribution in the clusters was concordant with that in the 3 clades of combined multi-locus MP tree. Recombination among individuals of a clade in evolutional history was found in 2 of the 3 clades. There was population differentiation among the 3 clades. Restriction fragment length polymorphism (RFLP) analysis of the intergenic spacer (IGS) region of rDNA gene was added to further characterize subspecific entities. When the IGS regions of 22 strains were digested with the restriction endonucleases Hae III and Mbo I, seven and five distinct patterns were detected, respectively. This subtyping did not reveal any correspondence with geographic origin or clinical appearance. Though we need more evidence to locate the 3 clades of the P. boydii complex at species or population level, the sequence of the D1/D2 region is sufficiently variable for identification of taxa belonging to the P. boydii complex.

Introduction Pseudallescheria boydii and the related anamorph Scedosporium apiospermum are among the emerging agents of opportunistic mycoses [1]. Longtime the complex had been listed as a single species as an agent of human mycetoma, but colonization of the airways in patients with is increasingly reported [2], as well as systemic disorders such as cerebral infections after near-drowning [3,4]. It may be difficult to recognize the species in the clinic

26 Intraspecific diversity of species of P. boydii complex because of its histopathological similarity to [5]. In vitro, considerable genetic variability within P. boydii is known, not only in data from genetic fingerprinting [6], but also in less variable genes such as small subunit (SSU) and large subunit (LSU) of ribosomal DNA (rDNA) [6-8] and genomic homology [9]. With the latter technique, three approximate intraspecific groups were recognized, but thus far these could not be confirmed unambiguously using other techniques [6]. Gilgado and coworkers [10] are in the process of attributing formal taxonomic entities to a number of these groups. The D1/D2 domain of LSU region of rDNA gene is considered to be relatively conserved, allowing identification of fungi at the species level. Issakainen and coworkers [11, 8] presented the phylogeny of P. boydii and related taxa on the basis of this region. Nevertheless intraspecific polymorphism was noted in the LSU region. In the present paper we will establish whether this variability is also expressed at lower levels of diversity by sequenceing the internal transcribed spacer (ITS) region of rDNA gene and the elongation factor 1-α (EF 1-α) gene, and by restriction fragment length polymorphism (RFLP) analysis of the intergenetic spacer (IGS) region of rDNA gene, and whether independent polymorphisms at these different levels of diversity are concordant. These data add to our understanding of breeding systems in the teleomorph species complex P. boydii that is known to produce different types of anamorph, morphologically classified in Scedosporium and Graphium.

Materials and Methods Strains Fifty seven strains analyzed are listed in Table 1, 38 of which were previously identified as P. boydii or S. apiospermum on the basis of morphology. Seven reference strains of P. boydii and 12 reference strains of related species were included for comparison. Some additional sequences were downloaded from GenBank.

DNA extraction DNA was prepared with 6% InstaGene matrix kit (Bio-Rad, Hercules, Calif.). A small amount of fungal pellet was suspended in 200 μl of InstaGene matrix and incubated at 56°C for 30 min. The mixture was heated at 100°C in a water bath for 8 min and centrifuged at 12,000 r.p.m. for 3 min at room temperature. The supernatant was transferred to a new tube.

27 Chapter 2

Table 1. Strains examined and results of sequencing and RFLP analysis. D1/D2 RFLP type of IGSc nDNA/D Species Strain a Source Geography groupb,# ITS groupb EF groupb Hae III Mbo I NA d P. boydii IFM 52858 patient China Clade 5A Clade 5 Clade 5A A A P. boydii IFM 52864 unknown Clade 5A Clade 5 Clade 5A A A P. boydii IFM 48461 pleural fluid Japan Clade 5A Clade 5 Clade 5A B B P. boydii IFM 52861 patient China Clade 5A Clade 5 Clade 5A B B P. boydii IFM 52865 unknown Clade 5A Clade 5 Clade 5A B B P. boydii IFM 47161 patient Japan Clade 5A Clade 5 Clade 5A C B P. boydii IFM 41911 soil Colombia Clade 5A C B P. boydii IFM 50914 bronchoalveolar lavage Japan Clade 5A Clade 5 Clade 5A D B P. boydii IFM 49724 lung Japan Clade 5A Clade 5 Clade 5A D B P. boydii IFM 52862 necrotic tissue of eye China Clade 5A Clade 5 Clade 5A D B P. boydii IFM 41901 soil Colombia Clade 5A D B P. boydii IFM 48046 unknown Clade 5A D B P. boydii IFM 50907 lung and brain tissues Japan Clade 5A Clade 5 Clade 5A P. boydii IFM 41585 patient Japan Clade 5A Clade 5 Clade 5A P. boydii IFM 52863 cerebrospinal fluid China Clade 5A Clade 5 Clade 5A P. boydii IFM 52875 patient Spain Clade 5A P. boydii CBS 116892 sputum France Clade 5A Clade 5 Clade 5A 1 P. boydii CBS 101.22 T mycetoma USA Clade 5A Clade 5* Clade 5A 1 P. ellipsoidea CBS 418.73 T soil Tajikistan Clade 5A Clade 5* Clade 5A P. boydii CBS 108.54 soil Zaire Clade 5B Clade 5 Clade 5B 3 P. boydii CBS 116894 soil Thailand Clade 5B Clade 5 Clade 5B 3 P. boydii IFM 52874 litter Brazil Clade 5B P. boydii IFM 52860 patient China Clade 5B Clade 5 Clade 5B P. boydii IFM 47302 skin Japan Clade 5B Clade 5 Clade 5B P, angusta CBS 254.72 T sewage half digestion tank USA Clade 5B Clade 5* Clade 5B P. fusoidea CBS 106.53 T soil Panama Clade 5B Clade 5* Clade 5B P. boydii IFM 52873 cerebrospinal fluid China Clade 4 Clade 5 Clade 4 E E P. boydii IFM 52859 paranasal sinus biopsy China Clade 4 Clade 4 Clade 4 E E P. boydii IFM 52928 necrosis tissue of eye China Clade 4 Clade 4 Clade 4 F D P. boydii IFM 52930 patient Italy Clade 4 G D P. boydii IFM 50000 synovia Japan Clade 4 Clade 4 Clade 4 G D P. boydii IFM 52028 paranasal sinus biopsy Japan Clade 4 Clade 4 Clade 4 G C P. boydii IFM 49770 sputum Japan Clade 4 Clade 4 Clade 4 G C P. boydii IFM 52929 patient Italy Clade 4 G C P. boydii IFM 49731 unknown Clade 4 Clade 4 Clade 4 G C P. boydii IFM 41921 soil Colombia Clade 4 G C P. boydii IFM 46992 bronchoalveolar lavage Japan Clade 4 Clade 4 Clade 4 P. boydii IFM 51940 pleural fluid Japan Clade 4 Clade 4 Clade 4 P. boydii IFM 46993 bronchial polyp brushing Japan Clade 4 Clade 4 Clade 4 P. boydii IFM 49188 bronchoalveolar lavage Japan Clade 4 Clade 4 Clade 4 P. boydii IFM 50256 corneal scraping Japan Clade 4 Clade 4 Clade 4 P. boydii IFM 50231 corneal scraping Japan Clade 4 Clade 4 Clade 4 P. boydii CBS 116779 sinus France Clade 4 Clade 4 Clade 4 2 P. boydii CBS 695.70 nasal cavity of pig Ukraine Clade 4 Clade 4* Clade 4 2 P. boydii IFM 40911 unknown Clade 4 Clade 4 Clade 4 P. boydii IFM 41595 unknown Clade 4 Clade 4 Clade 4 P. boydii IFM 41923 soil Colombia Clade 3 P. boydii CBS 499.90 mud of pond Netherlands Clade 3 Clade 3* Clade 3 2 G. tectonae CBS 127.84 T tectona grandis, seed Jamaica * P. desertorum CBS 489.72 T salt-marsh soil Kuwait * P. minutispora CBS 116911 T river sediment Spain * S. aurantiacum CBS 116910 T ulcer of ankle Spain * S. aurantiacum CBS 118934 leg biopsy Netherlands S. prolificans CBS 467.74 T soil Belgium * S. prolificans CBS 452.89 blood of patient France P, africana CBS 311.72 T soil Namibia * P. fimeti CBS 129.78 T dung India * a Abbreviations: IFM = Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan; CBS = CBS Fungal Biodiversity centre, Utrecht, The Netherlands; b Groups obtained by sequencing rDNA D1/D2, ITS region and partial EF 1-α gene; group names, Clades 3-5 followed those in Gilgado's research (2005); c Restriction pattern of IGS region obtained with HaeIII and MboI.; d Data from Guého & de Hoog (1991); # sub-groups Clades 5A and 5B based on substitutions in positions 140 and 406 in the alignment of D1/D2 region of rDNA gene; * ITS sequences were downloaded from GenBank. Accession number of strains CBS 101.22: AJ888435; CBS 418.73: AJ888426; CBS 254.72: AJ888414; CBS 106.53: AJ888428; CBS 695.70: AY877353; CBS 499.90: AY878952; CBS 127.84: AY228113; CBS 489.72: AY879798; CBS 116911: AJ888384; CBS 116910: AJ888440; CBS 467.74:AY228117; CBS 311.72: AY879797; CBS 129.78: AY879799

28 Intraspecific diversity of species of P. boydii complex

Sequencing and data analysis Three primer sets NL1 (5’-GCATATCAATAAGCGGAGGAAAAG-3’) and V3-12 (modified NL4, 5’-GGTCCGTGTTTCAAGACG-3’), ITS1 (5’-TCC GTA GGT GAA CCT GCG G-3’) and ITS4 (5’-TCC TCC GCT TAT TGA TAT GC-3’), EF1-728F (5’-CAT CGA GAA GTT CGA GAA GG-3’) and EF1-986R (5’-TAC TTG AAG GAA CCC TTA CC-3’) were used to amplify and sequence the D1/D2 and ITS regions of rDNA gene, and part of the EF 1-α gene, respectively. If no amplicon of the ITS region was obtained, the primers ITS1 and ITS4 were changed to V9G (5’-TTA CGT CCC TGC CCT TTG TA-3’) and LS266 (5’-GCAT TCC CAA ACA ACT CGA CTC-3’). Amplification of the D1/D2 region was performed as follows: 95°C for 4 min, followed by 35 cycles consisting of 94°C for 45 sec, 58°C for 30 sec and 72°C for 2 min. The annealing temperature was changed to 52 and 55°C, respectively when amplifying the ITS region and the partial EF 1-α genes. The amplified products were purified with

SUPRE-CTM-02 kit (Takara Shuzo Co., Shiga, Japan) and were subjected to direct sequencing TM with an ABI PRISM 3100 sequencer after labeled with ABI PRISM BigDye terminator cycle sequencing standard (Applied Biosystems, Tokyo, Japan).

Sequences were adjusted using SeqMan Π of Lasergene software (DNASTAR, Inc.). Then they were aligned iteratively and cluster analyses were performed using Ward’s averaging in the BioNumerics package v. 4.0 (Applied Maths, Kortrijk, Belgium). Nearest neighbours were found by local Blast searches. By using the DCSE program [12], the sequences of each locus and combined multi-locus data set were re-aligned. Maximum Parsimony (MP) trees of each gene and combined gene data were constructed using PAUP v. 4.0b10 [13]. A heuristic search was performed for each dataset with 100 random taxon additions and tree bisection and reconstruction (TBR) as the branch swapping algorithm. Branches of zero-length were collapsed and all multiple, equally parsimony trees were saved. The maximum of trees saved was set as 5000. The robustness of the resulting phylogenetic tree was evaluated by 100 bootstrap replications and every replication used a maximum of 500 trees. The phylogenetic tree was printed with TreeView v. 1.6.6 [14]. The congruence of genealogies was assessed using partition homogeneity test (PHT) in PAUP v. 4.0b10 [13] based on sequences of the D1/D2 and ITS regions of rDNA gene and on partial sequence of the EF 1-α gene.

29 Chapter 2

IGS RFLP analysis Amplification of the IGS region of 45 P. boydii strains was performed with KOD-Plus-DNA Polymerase (Toyobo Co., Osaka, Japan) with primers IGSL.fw (5'-TAG TAC GAG AGG AAC CGT-3') and IGSR.bw (5'-GCA TAT GAC TAC TGG CAG-3') [15]. The resulting amplicons were purified with ethanol and digested with the restriction endonucleases HaeIII and MboI (Takara Shuzo Co., Shiga, Japan) as recommended by the manufacturer. The corresponding products were electrophoresed in 3% agarose gel at 100 V for 70 min.

Population genetic analysis In order to confirm the intraspecific diversity shown in the MP trees, the number of populations in the P. boydii complex was inferred with STRUCTURE software v. 2. [http://pritch.bsd.uchicago.edu] using genotype data of the D1/D2 and ITS regions of rDNA gene and of the partial EF 1-α gene. Genotypes of these 3 loci of 38 isolates in the P. boydii complex were sorted on the basis of similarity of the sequences. The burning period length and number of MCMC repetitions after burning were set as 10000 and 100000, and admixture model and allele frequencies correlated model were chosen for analysis. The number of populations (K) was assumed from 2 to 5. To test for reproductive mode in each population, index of association (IA, a measure of multi-locus linkage disequilibrium) was calculated with

MULTILOCUS 1. 2. 2 [http://www.bio.ic.ac.uk/evolve/software/multilocus]. The null hypothesis for this analysis is complete panmixia. The values of IA were compared between observed and randomized datasets. The hypothesis would be rejected when p < 0.05. Population differentiation (index: ө) was also detected using the same software and a null hypothesis for this analysis is no population differentiation. When observed ө is statistically significantly different from those of random data sets (p < 0.05), population differentiation will be considered.

Results Sequencing and grouping based on phylogenetic analysis Thirty six of the newly generated sequences were deposited in DNA Data Bank of Japan (DDBJ) (accession numbers AB158065-AB158100) and 79 in GenBank (accession numbers

30 Intraspecific diversity of species of P. boydii complex

CBS 467.74 T S. prolificans CBS 452.89 S. prolificans CBS 101.22 T P. boydii (1) IFM 50914 IFM 41585 IFM 52861 IFM 41901 IFM 41911 IFM 52865 IFM 52864 IFM 52875 IFM 49724 51 IFM 48461 IFM 48046 IFM 47161 Clade 5 IFM 50907 IFM 52858 IFM 52862 IFM 52863 CBS 418.73 T P. ellipsoidea CBS 116892 (1) CBS 108.54 (3) CBS 106.53 T P. fusoidea IFM 52874 CBS 116894 (3) CBS 254.72 T P. angusta IFM 47302 IFM 52860 CBS 695.70 (2) CBS 116779 (2) IFM 46992 IFM 49770 IFM 46993 IFM 50256 IFM 52859 IFM 41921 Clade 4 IFM 49731 60 IFM 41595 IFM 52930 IFM 52929 IFM 52928 IFM 40911 IFM 49188 IFM 50000 100 IFM 50231 IFM 51940 IFM 52028 IFM 52873 CBS 116910 T S. aurantiacum 79 100 CBS118934 S. aurantiacum 55 CBS 116911 T P. minutispora CBS 489.72 T P. desertorum 96 CBS 499.90 (2) Clade 3 IFM 41923 74 CBS 127.84 T G. tectonae CBS 311.72 T P. africana 1

Figure 1. One of 26 most parsimonious trees obtained from a heuristic search with 100 random taxon additions of the D1/D2 rDNA of 56 strain sequence alignment. The scale bar shows 1 change; bootstrap support values (>50%) from 100 replicates are shown at the nodes. Thickened lines indicate the restrict consensus branches. The tree was rooted to S. prolificans CBS 467.74 T. Specise name of P.boydii isolates is omitted. Numbers in brackets are the group numbers based on nDNA homology data used by Guého & de Hoog (1991). Clade numbers follows those in Gilgado’s research (2005).

31 Chapter 2

EF151314-EF151410). A total of 56 D1/D2 region sequences (589 bp) were included in the comparison except that of P. fimeti CBS 129.78 T which amplicon of the D1/D2 region was not obtained. In one of 26 MP trees (Fig. 1), the isolates of P. boydii complex formed 3 clades corresponding to clades 3-5 (P. boydii complex) of a previous multi-locus study [16], respectively. We attributed the same indications to these clades as used by Gilgado et al. [2005]. On the basis of 4-6 polymorphic sites of the D1/D2 region (Table 2), the two groups, clades 5 and 4, could be differentiated though they were supported by low bootstrap values on the tree (Fig. 1). No additional polymorphisms were found in clade 4. Two sub-groups (clades 5A and 5B) were distinguishable within clade 5 based on substitutions in positions 140 and 406 in the alignment. Sharing the same D1/D2 sequence with P. ellipsoidea CBS 418.73, P. boydii CBS 101.22 was found in clade 5A. P. angusta CBS 254.72 and P. fusoidea CBS 106.53 were located in clade 5B at 99.3% similarity. This distribution corresponded to groups 1 and 3 found on nDNA/DNA data [8] (Table 1). Becaue the difference of D1/D2 sequences between the 2 sub-groups was limited (less than 1%), the strains of each sub-group did not form an indepentdent terminal branch separately (Fig. 1). Clade 3 comprised only 2 strains, CBS 499.90 and IFM 41923, and was distant from clades 5 and 4. The similarities of D1/D2 sequences of P. boydii complex to remaining Pseudallescheria species were below 93.7%. S. aurantiacum CBS 116910 and CBS 118943, P. minutispora CBS 116911 and P. desertorum CBS 489.72 composed a branch at 79% bootstrap support, separate from the P. boydii complex. Other Pseudallescheria species and Graphium tectonae were located at larger distances from P. boydii (Fig. 1). Clinical and environmental strains were found in every group of P. boydii, and no geographic clustering could be detected (Table 1).

Table 2. Informative nucleotide substitions in the sequence alignment of the D1/D2 region of rDNA gene of P. boydii complex (Clades 5 and 4) Position in the alignment Croups Species 140 358 406 428 488 489 Clade 5 P. boydii C(T) C C(T) T A T P. fusoidea C C T T A T P. angusta T C T T A T P. ellipsoidea C C C T A T Clade 4 P. boydii C T C C G C

32 Intraspecific diversity of species of P. boydii complex

Higher levels of diversity in P. boydii was found in ITS and partial EF 1-α gene sequences. The sequence of EF 1-α gene was most variable among 3 studied locus sequences. The total amount of characters in the sequence alignments of EF 1-α gene for phylogenetic analysis was 307, of which 83 characters were constant, 72 parsimony-uninformative and 152 parsimony-informative. A strict consensus tree of the 5000 MP trees of partial EF 1-α gene of 48 strains is shown in Fig. 2. Except CBS 499.90, the isolates in the P. boydii complex formed 3 clades. Clade 4 in the D1/D2 phylogenetic tree still existed in EF 1-α tree, while clade 5 was divided to 2 clusters (clades 5A and 5B, corresponding to the same named sub-groups based on the D1/D2 sequence). High bootstrap values supported clades 4 and 5A, but clade 5B was unsolved. The ex-type strains of P. boydii and P. ellipsoidea were located in clade 5A, and those of P. angusta and P. fusoidea in clade 5B. With the exception of IFM 52873, all strains of clade 4 on the D1/D2 or EF 1-α tree were concordant with those on the ITS tree (Table 1). P. boydii CBS 499.90 belonging to clade 3 on the D1/D2 tree was still out of clades 4 and 5 on the EF 1-α tree. On MP trees of ITS generated in this study, clade 4 was also recognizable with high bootstrap support, but clade 5 was unsolved. Since the topology of the ITS tree is similar to that based on Gilgado’s data [16], the ITS tree is not exhibited here. Though the result of partition homogeneity test (PHT) showed that 3 locus lineages were not congruent (P = 0.001), a strict consensus MP tree of the combined 3 multi-locus dataset (Fig. 3) revealed similar topology as that of the partial EF 1-α gene. It obviously uncovered 2 clusters, clades 5 and 4, and clade 5 consisted of clades 5A and 5B. Clade 5B was solved better than that in the EF 1-α gene tree and was supported by high bootstrap value.

Grouping based on rDNA IGS restriction analysis The IGS regions of 22 strains in the P. boydii complex were amplified successfully with the primer set IGSL.fw-IGSR.bw, while the remaining 23 strains were refractory to amplification despite many attempts with the same primer set. The pictures of the IGS RFLP patterns were exhibited in Fig. 4-5, and the results were summarized in Table 1. Identical size fragments of the IGS region (2.5 kb) were amplified. Digestion with HaeIII revealed more variability than with MboI (seven and five profiles, respectively). The strains of clade 5A were subdivided into four subtypes with HaeIII and two with MboI, while strains of clade 4 generated three subtypes with both enzymes. Combining the banding patterns obtained with

33 Chapter 2

IFM 49770 65 IFM 52873 IFM 40911 69 IFM 50256 IFM 52859 CBS 695.70 (2) IFM 52028 IFM 50231 Clade 4 IFM 50000 IFM 41595

84 IFM 49731 CBS 116779 (2) IFM 51940 IFM 49188 IFM 52928 IFM 46993 IFM 46992 IFM 52861 IFM 48461 IFM 52865 87 IFM 50914 83 IFM 49724 CBS 101.22 (T) P. boydii (1) CBS 116892 (1) 72 75 Clade 5A IFM 50907 IFM 41585 CBS 418.73 (T) P. ellipsoidea 94 96 IFM 52863 IFM 52862 IFM 47161 100 IFM 52864 93 IFM 52858 CBS 254.72 (T) P. angusta CBS 116894 (3) IFM 52860 IFM 47302 Clade 5B CBS 106.53 (T) P. fusoidea 65 CBS 108.54 (3) CBS 499.90 (2) Clade 3 CBS 116911 (T) P. minutispora 100 100 CBS118934 S. aurantiacum CBS 116910 (T) S. aurantiacum 100 CBS 489.72 (T) P. desertorum 100 CBS 311.72 (T) P. africana 69 CBS 127.84 (T) G. tectonae CBS 129.78 (T) P. fimeti CBS 452.89 S. prolificans CBS 467.74 (T) S. prolificans

Figure 2. Strict consensus tree of 5000 most parsimonious trees obtained from a heuristic search with 100 random taxon additions of the EF 1-α gene of 48 strains sequence alignment. Bootstrap support values (>65%) from 100 replicates are shown at the nodes. The tree was rooted to S. prolificans CBS 467.74 T. Specise name of P.boydii isolates is omitted. Numbers in brackets are the group numbers based on nDNA homology data used by Guého & de Hoog [1991]. Clade numbers follows those in Gilgado’s research (2005).

34 Intraspecific diversity of species of P. boydii complex

K =2 K =3

IFM 52861 88 IFM 48461 IFM 52865 82 IFM 50914 92 IFM 49724 CBS 101.22 (T) P. boydii (1) CBS 116892 (1) 73 IFM 50907 Clade 5A IFM 41585

65 IFM 52863 98 98 IFM 52862 IFM 47161 CBS 418.73 (T) P. ellipsoidea

100 IFM 52864 IFM 52858 84 73 CBS 254.72 (T) P. angusta IFM 47302

73 IFM 52860 CBS 108.54 (3) Clade 5B CBS 106.53 (T) P. fusoidea CBS 116894 (3) CBS 116779 (2) IFM 51940 IFM 41595 86 IFM 46992 CBS 695.70 (2) IFM 52028 IFM 50231 IFM 50000 Clade 4 74 IFM 49188 IFM 40911 99 IFM 52928 IFM 49731 91 IFM 52859 IFM 46993 85 IFM 50256 IFM 49770

72 IFM 52873 CBS 499.90 (2) Clade 3 CBS 116911 (T) P. minutispora 100 100 CBS 116910 (T) S. aurantiacum CBS 118934 S. aurantiacum 100 CBS 489.72 (T) P. desertorum 100 CBS 127.84 (T) G. tectonae CBS 311.72 (T) P. africana CBS 452.89 S. prolificans CBS 467.74 (T) S. prolificans

Figure 3. Strict consensus tree of 5000 most parsimonious trees of combined mutilocus data set obtained from a heuristic search with 100 random taxon additions of 47 strains sequence alignment. Bootstrap support values (>70%) from 100 replicates are shown at the nodes. The tree was rooted to S. prolificans CBS 467.74 T. Specise name of P.boydii isolates is omitted. Numbers in brackets are the group numbers based on nDNA homology data used by Guého & de Hoog [1991]. Clade numbers follows those in Gilgado’s research (2005). The blocks on the right is the plots of ancestry estimates of 38 strains in P. boydii complex based on 3 locus genotypes using STRUCTURE software v. 2. Each strain in the data set is represented by a single horizontal brick, which is partitioned in to 2 (k = 2) or 3 (k = 3) colored segments that represent that strain’s estimated membership fraction in each of the 2 or 3 inferred clusters. The position of each cluster is corresponding with that in the tree.

35 Chapter 2 the two enzymes, a total of eight rather than seven genotypes were distinguishable. This was due to the fact that strains of MboI group D corresponded with HaeIII groups F and G, while HaeIII G strains were either MboI C or D (Table 1). Each of clades 5A and 4 was subdivided into four IGS genotypes. The strains from Asian patients were attributed to all subtypes. Subtypes AA (subtypes derived from HaeIII and MboI digestion, respectively), EE and FD comprised isolates from China only, except for strain IFM 52864 of which the origin is unknown. Two strains from Italy were proved to be subtypes GC and GD. There was no apparent relation between the origins and genotypes of the isolates.

Population structure Only the genotype data derived from the strains in 2 main clades (clades 4 and 5) of the P. boydii complex were used for population genetic analysis. Comparing the plots of ancestry estimates derived from assumed states of K, the strains were most strongly assigned to different clusters when K was 2 (Fig. 3). Strain distribution in the clusters was almost the same as that in clades 5 and 4 except IFM 52928. The isolates in clade 5 were clonal (IA =

0.47, P < 0.01), while those in clade 4 were recombining (IA = 0.15, p = 0.07). There was population differentiation between these 2 clades (ө = 0.33, P < 0.01). When K was 3, most strains in the P. boydii complex were distributed in different clusters (Fig. 3). The distribution of strains in the 3 clusters was concordant with that in clades 4, 5A and 5B except IFM 52928,

CBS 116892 and CBS 116894. Reproductive mode of clade 5A strains was clonality (IA =

0.38, P < 0.01), and that of clade 5B strains was recombination (IA = 0.23, P = 0.31). Population differentiation existed among clades 4, 5A and 5B (ө = 0.39, p < 0.01).

Discussion Intraspecific polymorphisms Intraspecific polymorphisms of P. boydii are noted at different levels of diversity: in the D1/D2 region of LSU, in the ITS region, the partial EF 1-α gene and in the IGS region. Based on the sequence of the D1/D2 regions of P. boydii / S. apiospermum, the isolates could be divided into 2 large groups (clades 4 and 5) and 1 small group (clade 3). Using the combined data of partial sequences of β-tubulin and calmodulin genes and the ITS region of rRNA, the P.

36 Intraspecific diversity of species of P. boydii complex

1 2 3 4 5810146 7 9 11 12 13 15 16 17 18 19 20 21 22 23

bp

1517-

1000-

500-

100-

A A BGBDDB C C DD D E FG G G E G G G

Fig. 4 Electrophoretic patterns of IGS region of P. boydii strains tested with RFLP analysis with enzyme Hae Ⅲ Lane 1: DNA size marker (100 bp ladder); 2: IFM 52864; 3: IFM 52858; 4: IFM48461; 5: IFM 52861; 6: IFM 52865; 7: IFM 47161; 8: IFM 41901; 9: IFM 41911; 10: IFM 50914; 11: IFM 49724; 12: IFM 48046; 13: IFM 52862; 14: IFM 52873; 15: IFM 52928; 16: IFM 50000; 17: IFM 52929; 18: IFM 52930; 19: IFM 52859; 20: IFM 49770; 21: IFM 49731; 22: IFM 52028; 23: IFM 41921 A-G: electrophoretic patterns.

1 2 3 4 5810146 7 9 11 12 13 15 16 17 18 19 20 21 22 23 24

bp

1517-

1000-

500-

100-

A A BEBBBB B B BBB C CC C C D D D E Fig. 5 Electrophoretic patterns of IGS region of P. boydii strains tested with RFLP analysis with enzyme Mbo 1 Lanes 1 and 24: DNA size marker (100 bp ladder); 2: IFM 52864; 3: IFM 52858; 4: IFM 48461; 5: IFM 47161; 6: IFM 41901; 7: IFM 41911; 8: IFM 49724; 9:50914; 10: IFM 48046; 11: IFM 52862; 12: IFM 52861; 13: IFM 52865; 14: IFM49731; 15: IFM 52929; 16: IFM 52028; 17: IFM 49770; 18: IFM 41921; 19: IFM 52928; 20: IFM 50000; 21: IFM 52930; 22: IFM 52859; 23: IFM 52873 A-E: electrophoretic patterns

37 Chapter 2 boydii complex was also found to comprise 3 clades (clades 3-5) [16], corresponding to D1/D2 grouping in the present research. nDNA homology data, taken from Guého & de Hoog [1991] and determined with voucher strains from the CBS culture collection for comparison (Table 1), indicate that clade 5 contains two reassociation groups, 1 and 3 (group numbers used by Guého & de Hoog [1991]), which corresponded with clades 5A and 5B in this study. Most of strains of reassociation groups 1 and 3 initially displayed cleistothecia, while most strains of group 2 (corresponding with clades 3-4) did not [9]. This criterion is hard to reproduce, because isolates maintained as P. boydii failed to produce cleistothecia upon inspection from collection strains regardless of growth conditions [17]. In this research, cleistothecia were observed in 3 P. boydii isolates on potato dextrose agar (PDA), which were IFM 52862 in clade 5A, and IFM 52860 and IFM 47302 in clade 5B. These 3 strains were isolated from Chinese or Japanese patients. So, based on present data, no obvious predilection of the ability to develop cleistothecia was revealved among the individuals in clades 5A and 5B. The frequency of the Graphium anamorph in reassociation group 2 appeared higher than that in group 1 [9]. This tendency was also observed in the data of Gilgado et al. [16] and in the present research (data not shown). The reference strain of reassociation group 2, CBS 499.90, clustered in clade 3 far from clades 4 and 5. The strains belonging to clades 3 and 4 (reassociation group 2) will be described as 2 new species [10]. Though intraspecific polymorphisms of P. boydii are expressed at different levels of diversity, some of the independent polymorphisms are not concordant. Strains of reassociation groups 1-3 were not unambiguously supported, having similar ITS sequences (Table 1) [6]; the reference strain of reassociation group 2, CBS 499.90, clustered outside clade 4, in clade 3 (Fig. 3). IFM 52873 distributed to clade 4 in the D1/D2 and EF 1-α trees was found in clade 5 in the ITS tree rather than clade 4. PHT performed with the sequence datasets of D1/D2, ITS and EF 1-α indicated that the genealogies of these 3 loci were not congruent within Pseudallescheria. Recombination was also revealed among the isolates in clades 4 and 5B by linkage disequilibrium analysis. These evidences suggest that the incongruence among the independent polymorphisms would be related with gene flow having occurred in Pseudallescheria evolutionary history. Clonality was supposed in clade 5A. This is remarkable, as this clade contains the type strain of Pseudallescheria boydii, originally described to produce a teleomorph. We therefore assume that Pseudallescheria populations

38 Intraspecific diversity of species of P. boydii complex may show a high degree of inbreeding. The genetics of Pseudallescheria are insufficiently understood to allow an interpretation of these data. RFLP of the IGS region may prove to be useful for monitoring intraspecific dispersal and evolution, and could be applied in population genetic studies. It has been applied e.g. in Aspergillus and [19,20]. IGS-RFLP analysis is known to generate a high degree of polymorphism. In the present research, IGS-typing detected a level of diversity between those of EF 1-α groups and individual strains. But the high variation of the IGS region also increased difficulty of amplication. The IGS amplicons of nearly half of the P. boydii strains failed to be obtained in this study. The most likely cause of the failure is that the sequences of the IGS region varied to mismatch the primers. Though the variability of P. boydii with IGS-RFLP analysis is lower than that with RAPD or MLEE [21, 22], the reliability of the data generated by IGS-RFLP analysis may be higher than that of RAPD, because banding patterns are likely to be stable. With the present set of strains we did not observe a clear pattern from the point of view of geography or ecology, suggesting a world wide distribution of P. boydii. For example, the closely related strains of IGS-types CB, DB and GC contained clinical strains from Japan and environmental ones from Colombia; strains of genotype GD were isolated from both Japan and Italy (Table 1). However, there may be differences in inhabiting predilection among strains of one IGS-type. Reassociation groups 1 and 2 were reported to comprise mainly invasive strains or involved in colonization of cavities, environmental strains being rare, while the infrequent group 3 was preponderantly environmental [9,23]. In the present research, 2 invasive strains were found in clade 5A, while preponderantly colonizers of cavities (pulmonary and maxillary) were found in clade 4, and isolation of clade 5B is mainly environmental. The suggestion that there are differences in virulence to humans between members of groups of P. boydii complex [16] thus is approximately confirmed.

Identification Nine species have been described in the ascomycete genus Pseudallescheria, of which P. angusta, P. fu s o i d e a and P. ellipsoidea have been reduced to synonymy with P. boydii on the basis of identical ITS sequences [6] and a ~300 bp fragment of the D1/D2 LSU region [8]. In contrast, P. africana, P. fimeti, S. prolificans, Graphium tectonae are different from P. boydii

39 Chapter 2 judging from LSU [6,8,17] and SSU sequence data [7]. The recently described species P. minutispora, S. aurantiacum [16], and two more species (clades 3 and 4) proposed by Gilgado and coworkers [10] have been segregated from P. boydii on the basis of genealogical concordance of calmodulin, β-tubulin and ITS sequences and phenotypic characters. Strains in clades 3 and 4 were assigned to Scedosporium frequentans and Secdosporium dehoogii, respectively. So far few outstanding differences have been found in features of pathogenicity, ecology and antifungal susceptibility among these new species and P. boydii [10,16,18,24]. Supplementary to molecular biological methods, unambiguous morphological and physiological characters available for identification in clinical laboratory are limited. Therefore, the establishment of these novel species needs more evidence to be confirmed. In the present research clade 5B was found to be recombining and included type strains of P. angusta CBS 254.72 and P. fusoidea CBS 106.53. Following the view of Genealogical Concordance Phylogenetic Species Recognition (GCPSR) [25], it is possible to recognize them as a single species. Since the number of individuals observed in this clade is small, it is early to draw a definitive conclusion. The ex-type culture of P. ellipsoidea, CBS 418.73, is located in clonal clade 5A, which mainly comprises P. boydii strains including the ex-type culture CBS 101.22. There are genetic barriers between clades 4, 5A and 5B, but it is difficult to judge if they formed among species of Pseudallescheria or among populations of P. boydii. Though taxonomy of Pseudallescheria is cryptic, based on our data, the intraspecific D1/D2 variation of P. boydii complex is large enough (up to 6 bp) to allow identification at the species level.

Acknowledgements A part of this study was supported by the National Bio-Resource Project "Pathogenic microbes" from the Ministry of Education, Culture, Sports, Science and Technology of the Japanese Government. We acknowledge all those who kindly sent strains to us, particularly the curator of the IFM Collection at Chiba, Japan. A. H. G. Gerrits van den Ende and K. F. Luijsterburg are thanked for technical assistance.

40 Intraspecific diversity of species of P. boydii complex

References 1 Guarro J, Kantarcioglu AS, Horré R, et al. Scedosporium apiospermum: changing clinical spectrum of a therapy-refractory opportunist. Med Mycol 2006; 44: 295-327. 2 Cimon B, Carrere J, Vinatier JF, et al. Clinical significance of Scedosporium apiospermum in patients with cystic fibrosis. Eur J Clin Microbiol Infect Dis 2000; 19: 53-56. 3 Rüchel R, Wilichowski E. Cerebral. Pseudallescheria after near-drowning. Mycoses 1995; 38: 473-475. 4 Kowacs PA, Soares Silvado CE, Monteiro de Almeida S, et al. Infection of the CNS by Scedosporium apiospermum after near drowning. Report of a fatal case and analysis of its confounding factors. J Clin Pathol 2004; 57: 205-207. 5 Kwon-Chung KJ, Bennett JE. Pseudallescheriasis and Scedosporium. In: Kwon-Chung KJ, Bennett JE eds. Medical Mycology. Philadelphia: Lea ＆ Febiger, 1992: 678-694. 6 Rainer J, De Hoog GS, Wedde M, et al. Molecular variability of Pseudallescheria boydii, a neurotropic opportunist. J Clin Microbiol 2000; 38: 3267-3273. 7 Issakainen J, Jalava J, Eerola E, et al.. Relatedness of Pseudallescheria, Scedosporium and Graphium pro parte based on SSU rDNA sequences. J Med Vet Mycol 1997; 35: 389-398. 8 Issakainen J, Jalava J, Hyvonen J, et al. Relationships of Scopulariopsis based on LSU rDNA sequences. Med Mycol 2003; 41: 31-42. 9 Guého E, De Hoog GS. Taxonomy of the medical species of Pseudallescheria and Scedosporium. J Mycol Méd 1991; 1: 3-9. 10 Gilgado F, Cano J, Gené J, et al. Characterization of Scedosporium frequentans: the most common species of the P. boydii complex. 16th ISHAM, Paris, June 2006. 11 Issakainen J, Jalava J, Saari J, et al. Relationship of Scedosporium prolificans with Petriella confirmed by partial LSU rDNA sequences. Mycol Res 1999; 103: 1179-1184. 12 De Rijk P, De Wachter R. DCSE v. 2.54, an interactive tool for sequence alignment and secondary structure research. Comput Appl Biosci 1993; 9: 735–740. 13 Swofford DL. PAUP* 4.0: phylogenetic analysis using parsimony. Sinauer Associates, Sunderland, MA, U.S.A., 2000. 14 Page RDM. TREEVIEW: An application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996; 12: 357-358.

41 Chapter 2

15 Williamson EC, Speers D, Arthur IH, et al. Molecular epidemiology of Scedosporium apiospermum infection determined by PCR amplification of ribosomal intergenic spacer sequences in patients with chronic lung disease. J Clin Microbiol 2001; 39: 47-50. 16 Gilgado F, Cano J, Gené J, et al. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J Clin Microbiol 2005; 43: 4930-4942. 17 Rainer J, de Hoog GS. Molecular taxonomy and ecology of Pseudallescheria, Petriella and Scedosporium prolificans (Microascaceae) containing opportunistic agents on humans. Mycol Res 2006; 110: 151-160. 18 Gilgado F, Serena C, Cano J, et al. Antifungal susceptibilities of the species of the Pseudallescheria boydii complex. Communication of the ECMM Working Group on Pseudallescheria and Scedosporium. Available from: 19 Radford SA, Johnson EM, Leeming JP, et al. Molecular epidemiological study of Aspergillus fumigatus in a bone marrow transplantation unit by PCR amplification of ribosomal intergenic spacer sequences. J Clin Microbiol 1998; 36: 1294-1299. 20 Sugita T, Nakajima M, Ikeda R, et al. Sequence analysis of the ribosomal DNA intergenetic spacer 1 region of Trichosporon species. J Clin Microbiol 2002; 40: 1826-1830. 21 Zouhair R, Defontaine A, Ollivier C, et al. Typing of Scedosporium apiospermum by multi-locus enzyme electrophoresis and random amplification of polymorphic DNA. J Med Microbiol 2001; 50: 925-932. 22 Zeng JS, Fukushima K, Zheng YC, et al. Characterization of Pseudallescheria boydii and Scedosporium apiosperium by Random Amplification of Polymorphic DNA Assay. Chin J Dermatol 2005; 38: 485-487. 23 De Hoog GS, Marvin-Sikkema FD, Lahpoor GA, et al. Ecology and physiology of the opportunistic fungi Pseudallescheria boydii and Scedosporium prolificans. Mycoses 1994; 37: 71-78. 24 Zeng J, Kamei K, Zheng Y, et al. Susceptibility of Pseudallescheria boydii and Scedosporium apiospermum to new antifungal agents. Nippon Ishinkin Gakkai Zasshi 2004; 45: 101-104.

42 Intraspecific diversity of species of P. boydii complex

25 Taylor JW, Jacobson DJ, Kroken S, et al. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 2000; 31: 21-32.

43 Chapter 2

44 Chapter 3

Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons

1,2, G. S. de Hoog , J. S. Zeng1,2,3, M. J. Harrak1,2 and D. A. Sutton4

1 Centraalbureau voor Schimmelcultures, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, P.O. Box 94062 1090 GB Amsterdam, The Netherlands; 3Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, 430022,Wuhan, Hubei, P. R. China; 4Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center, Mail Code 7750, 78229-3900 San Antonio, Texas, U.S.A;

Pubilshed in Antonie Van Leeuwenhoek 90: 257-268 (2006)

Key words: black yeast, Exophiala jeanselmei, taxonomy, ecology, cutaneous infection, hydrocarbon

45 Chapter 3

Abstract A new black yeast species, Exophiala xenobiotica, is described, a segregant of the E. jeanselmei complex. It is morphologically very similar to E. jeanselmei, though with less melanized conidiogenous cells, but deviates unambiguously on the basis of molecular phylogeny. The species is a relatively common agent of cutaneous infections in humans, whereas E. jeanselmei is associated with subcutaneous infections. Environmental strains of E. xenobiotica are frequently found in habitats rich in monoaromatic hydrocarbons and alkanes.

Introduction Among the black yeast species most frequently reported in the clinical laboratory is Exophiala jeanselmei (Langer.) McGinnis & Padhye. However, relatively soon after its recognition as a black yeast (McGinnis and Padhye 1977), it was realized that this taxon is actually quite heterogeneous. De Hoog (1977) introduced three varieties on the basis of morphological and cultural features: the var. heteromorpha (Nannf.) de Hoog and the var. lecanii-corni (Benedek & Specht) de Hoog were described in addition to the typical variety. Matsuda et al. (Matsuda et al. 1989) provided the first molecular confirmation of this diversity using molecular data by dot-blot nDNA reassociation. With recent data of all genes sequenced thusfar, such as the rDNA Small SubUnit (SSU) gene (Haase et al. 1999), the rDNA Internal Transcribed Spacer (ITS) region (Vitale and de Hoog 2002), the mitochondrial cytochrome B gene (Wang et al. 2001), and RFLP analysis of mitochondrial DNA (Kawasaki et al. 1999), all variants of E. jeanselmei were proven to represent separate species, now known as E. heteromorpha (Langer.) de Hoog & Haase (De Hoog et al. 2003), E. lecanii- corni (Benedek & Specht) Haase & de Hoog (Haase et al. 1999) and E. jeanselmei s. str. The latter entity, Exophiala jeanselmei itself, appears to be relatively rare (De Hoog et al. 2003). It is the only black yeast proven to be repeatedly involved in human mycetoma: two of the four strains identified with certainty using ITS sequencing (De Hoog et al. 2003) were agents of mycetoma (Langeron 1928; Murray et al. 1963). In the 23 strains of the closely related species E. oligosperma de Hoog & Tintelnot (De Hoog et al. 2003) only a single strain was reported to cause this disorder (Neumeister et al. 1995). It thus seems probable that the

46 Exophiala xenobiotica sp. nov. different opportunistic Exophiala species on humans and previously identified as E. jeanselmei differ in predilection, clinical behaviour and ecology. In general, Exophiala species also differ in their environmental autecology. Several authors (Middelhoven et al. 1989, Middelhoven 1993, Cox et al. 1997, Prenafeta-Boldú et al. 2006) noticed that black yeasts and their filamentous relatives of the ascomycete order are potent degraders of monoaromatic xenobiotics, and eventually tend to accumulate in industrial biofilters. A species regularly encountered in clinical samples as well as in phenolic environments was an as yet undescribed taxon recognized through ITS sequencing as ‘cluster 8’ by de Hoog et al. (De Hoog et al. 2003). Additional studies involving a large number of environmental and clinical Exophiala strains (Zeng et al. 2006) proved that this is a consistent entity, comprising clinical strains in addition to a striking number of isolates from sites polluted by toxic xenobiotics. The present article formally introduces this taxon as a new species of Exophiala.

Materials and methods Fungal strains, morphology and physiology A total of 55 strains studied is listed in Table 1. For morphological observation, slide cultures were made of strains grown on potato dextrose agar (PDA) and mounted in lactophenol cotton blue. Thermotolerance was tested by incubation of freshly inoculated culture plates at 30, 33, 36 and 40°C. The in vitro production of pseudothecia was observed with 11 strains (Table 1) following the method of Untereiner (1994). The strains tested were incubated on PDA in artificial light at room temperature for 1 week. Three 4-mm plugs taken from actively growing edges of each culture were transferred to a 25 ml Erlenmeyer flask containing 10 ml MP (maltpepton) broth and incubated on a rotary shaker at 100 r.p.m. for 3 days at room temperature. Segments of peduncle (Urtica dioica, 20 mm, sterile, moistened) were added to each Erlenmeyer flask and incubated for an additional 3-21 days on a rotary shaker. Colonized peduncle segments were transferred to plastic petri dishes with sterile filter paper moistened with sterile water. The dishes were sealed with Parafilm, illuminated with black blue light (20 Watt, 360-370 nm) at 21-25°C and checked weekly for the production of pseudothecia. One

47 Chapter 3 lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni

var. var.

var. var.

sp. var.

sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. Exophiala Exophiala castellanii E. Rhinocladiella Phialophora Rhinocladiella elatior castellanii E. jeanselmei E. jeanselmei E. E. jeanselmei E. jeanselmei E. jeanselmei Exophiala E. jeanselmei Exophiala Exophiala Exophiala jeanselmei E. Exophiala jeanselmei E. jeanselmei E. jeanselmei E. Exophiala Exophiala Exophiala Exophiala Exophiala E. jeanselmei Germany Germany Germany Switzerland USA UK USA UK USA USA USA Canada USA USA USA USA USA USA USA USA USA USA

Origin Geography Provisional name Provisional Origin Geography soil Oil-contaminated soil Gasoline-polluted façade urban Limestone, Venezuela browncoal Lignite Austria juice apple Spoilt floor bathroom Moist after water Hospital decontamination mill Paper pulp tie Railway timber joinery Decaying Peritoneal dialysis fluid fluid Dialysis Blood Netherlands USA Sputum Sputum Knee, cyst cyst Elbow, sclera Eye, infection Eye fluid vitreous Eye, fluid vitreous Eye, mass Nasal Hand lesion USA Brazil lesion Finger lesion Finger fluid Finger, wound Wrist, . Strainexamined Table 1 GenBank accession DQ182571, DQ182579, DQ182587 AJ301704 DQ182578, DQ182586, DQ182594 DQ182573, DQ182581, DQ182589 DQ182575, DQ182583, DQ182591 DQ182576, DQ182584, DQ182592 AK 9813 = T4, A. Kuhn [Prenafeta [Prenafeta A. Kuhn = T4, 9813AK 2001] Hölker U. 12868, dH H. Lüthi Szaniszlo P.J. 11749, dH 1998] [Phillips Phillips G. 11293, dH 1976] [Watson YB-4163 NRRL Morton L.H.G. 173394, IMI Sutton D.A. 94-1718, UTHSC Sutton D.A. 95-1261, UTHSC Sutton D.A. 92-1983, UTHSC Carmichael J.W. 570, UAMH Sutton D.A. 99-791, UTHSC Sutton D.A. 01-895, UTHSC Sutton D.A. 92-891, UTHSC Sutton D.A. 93-2633, UTHSC Sutton D.A. 96-2382, UTHSC Sutton D.A. R-3427, UTHSC Sutton D.A. 97-260, UTHSC Sutton D.A. 95-2059, UTHSC Sutton D.A. 99-1958, UTHSC Sutton D.A. 97-1139, UTHSC Sutton D.A. 00-2163, UTHSC 2001] [Sterflinger Sterflinger K. NH3-6, 117643 Adelmann D. 11807, dH 117235 Sutton D.A. 02-483, UTHSC CBS no.CBS Other number 118157 dH 13236 [Arias] [Arias] 13236 dH 118157 110555 115831 204.50 102606* 102177 580.76* 522.76 117653* 117658 117674 648.76A 117641 117669 117648 117671 117661* 117668 117676 117646 117660 117647 102455 102455 Resende 02, M.A. / LM HC-5

48 Exophiala xenobiotica sp. nov. lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni lecanii-corni var. var. . var. var. var. var. var. var. var. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. E. jeanselmei E. jeanselmei castellanii E. Exophiala Exophiala Exophiala Exophiala E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei E. jeanselmei Exophiala Exophiala E. jeanselmei E. jeanselmei Exophiala Exophiala Exophiala Exophiala E. jeanselmei E. jeanselmei E. jeanselmei Exophiala Exophiala USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA Netherlands USA USA USA USA USA USA USA USA Origin Geography Provisional name name Provisional Geography Origin lesion Forearm, lesion Forearm, abscess Arm, Arm, biopsy Toe Toe Foot, wound Leg, wound Foot, abscess Foot, ulcer Foot lesion Buttock lesion Knee, wound Knee, lesion Leg tissue Scalp lesion Canada Scalp lesion Skin, scales osteomyelitis Toe, Genital Skin tissue Netherlands Skin, wound Human Human Human Animal Animal source Unknown Germany GenBank accession DQ182577, DQ182585, DQ182593 DQ182574, DQ182582, DQ182590 DQ182572, DQ182580, DQ182588

production of pseudothecia were observed observed were pseudothecia of production in vitro UTHSC 90-311, D.A. Sutton Sutton 90-311, D.A. UTHSC Sutton 94-592, D.A. UTHSC Sutton 94-586, D.A. UTHSC 04-1239, D.A. Sutton UTHSC 98-2285, D.A. Sutton UTHSC 98-2286, D.A. Sutton UTHSC Sutton 97-242, D.A. UTHSC 00-1074, D.A. Sutton UTHSC 98-2412, D.A. Sutton UTHSC Sutton 93-16, D.A. UTHSC Sutton 87-282, D.A. UTHSC 94-2670, D.A. Sutton UTHSC 92-1962, D.A. Sutton UTHSC Sutton 96-938, D.A. UTHSC 02-1843, D.A. Sutton UTHSC Sutton 96-232, D.A. UTHSC R.W. Vreede Sutton 03-782, D.A. UTHSC Sutton 02-70, D.A. UTHSC Sutton 96-197, D.A. UTHSC D.A. Sutton R-904, UTHSC Sutton 00-955, D.A. UTHSC 93-2109, D.A. Sutton UTHSC Sutton 02-47, D.A. UTHSC Sutton 02-48, D.A. UTHSC . Strain examined (continued) CBS no. CBS number Other Table 1 117663 117651 117650* 117667 117670* 117675 117642 117753* 117644 117656 117655* 117654 117657 117662 117672 117673* 234.90 117666 117649 117652 117645 117659 * : strains whose whose : strains * 718.76 718.76 Carmichael 2034, J.W. UAMH 101271 Kuijper E.J. dH 11314, 117665 117664* Engelhardt M. 358.29

49 Chapter 3 set of peduncles was seeded with all pooled strains according to the same method. Antimycotic susceptibility test of 4 current antifungal agents (amphotericin B, itraconazole, and posaconazole) was performed with 37 strains according to NCCLS guidelines (M38-A)( National National Committee for Clinical Laboratory Standards 2002).

Isolation Selective isolation was performed using a sample (Hilversum b101b, kindly delivered by BioSoil BV, Hendrik Ido Ambacht, The Netherlands) of soil polluted by volatile aromatic compounds (naphtalene 4.8 mg/kg, xylene 2.2 mg/kg, ethylbenzene 0.15 mg/kg, toluene

<0.05 mg/kg, benzene <0.05 mg/kg) and mineral oil (C10-C12 9.8%, C12-C22 87.7%, C22-C30

2.3%, C30-C40 0.3%, total concentration of C10-C40 4600 mg/kg). Fungi were isolated using a mineral oil flotation method modified after Iwatsu et al. (1981). Enrichment was done in a closed system on Sabouraud`s dextrose agar plates under naphtalene and phenol atmospheres after incubation for 4-5 weeks at 30 ºC. Of the few fungi isolated (Fusarium, Scedosporium, Exophiala and Paecilomyces) the black yeast was identified by ITS sequencing.

DNA extraction About 1 cm2 of fungal material was transferred to a 2 ml Eppendorf tube containing a 2:1 (w/w) mixture of silica gel and Celite (silica gel H, Merck 7736/Kieselguhr Celite 545, Machery) and 300 μl TES buffer. The fungal material was ground with a micropestle for 1-2 min. Volume was adjusted by adding 200 μl TES buffer. After vigorous shaking and adding 10 μl 10 mg/ml Proteinase K to the tube, the mixture was incubated at 65°C for 10 min. The salt concentration was raised by adding 140 μl 5M NaCl solution. The mixture was mixed with 1/10 volume (~65 μl) cetyltrimethylammonium bromide (CTAB) buffer 10% followed by incubation for another 30 min at 65°C. One volume (~700 μl) chloroform-isoamylalcohol (v/v = 24/l) was added and mixed carefully by hand. After incubation 30 min at 0 ºC (on icewater) and centrifugation at 14,000 r.p.m. at 4°C for 10 min, the toplayer was transferred to a clean eppendorf tube. The sample mixed with 225 µl 5M NH4-acetate was incubated at 0 ºC for at least 30 min (on icewater) and spun again. The supernatant was transferred to a clean sterile Eppendorf tube and mixed with 0.55 volume (~510 µl) icecold isopropanol. After being spun 7 min, 14,000 r.p.m., 4 ºC (or room temperature), supernatant was decanted. The

50 Exophiala xenobiotica sp. nov. pellet was washed with icecold ethanol 70% 2 times and dried using a vacuum dryer. The powder was re-suspended in 48.5 µl TE-buffer with 1.5 µl RNAse, incubated at 37 ºC for 15- 30 min and stored at –20ºC until used.

DNA amplification and sequencing PCR was performed in 50 μl volumes of a reaction mixture containing 10 mM Tris HCL, pH

8.3, 50 mM KCl, 1.5 mM MgCl2·6H2O, 0.01% gelatin, 200 mM of each deoxynucleotide triphosphate, 25 pmol of each primer, 10-100 ng rDNA and 0.5 U Taq DNA polymerase (Sigma). Three primer sets ITS1 (5’-TCC GTA GGT GAA CCT GCG G-3’) and ITS4 (5’- TCC TCC GCT TAT TGA TAT GC-3’), EF1-728F (5’-CAT CGA GAA GTT CGA GAA GG-3’) and EF1-986R (5’-TAC TTG AAG GAA CCC TTA CC-3’), Bt-2a (5’-GGT AAC CAA ATC GGT GCT GCT TTC) and Bt-2b (5’-ACC CTC AGT GTA GTG ACC CTT GGC-3’) were used to amplify and sequence ITS region of rDNA, partial elongation factor 1- α (EF 1-α ) and β-tubulin (β-TUB) genes respectively. If no amplicon of ITS was obtained, the primers ITS1 and ITS4 were changed to V9G (5’-TTA CGT CCC TGC CCT TTG TA-3’) and LS266 (5’-GCAT TCC CAA ACA ACT CGA CTC-3’). Small subunit (SSU, 18S) amplicons were generated with primers Oli4 and NS24 and sequenced with primers Oli4, Oli5, BF83, Oli9, Oli1, Oli3, BF963, BF1419, BF951, BF1438, NS3, NS6 and NS24 (De Hoog et al. 2000). Amplification of ITS and SSU was performed as follows: 95°C for 4 min, followed by 35 cycles consisting of 94°C for 45 sec, 52°C for 30 sec and 72°C for 2 min. Annealing temperature was changed to 55 and 58°C, respectively when amplifying EF 1-α and β-TUB genes. Amplicons were cleaned with GFX columns (Amersham Pharmacia). Sequence-PCR was performed as follows: 95°C for 1 min, followed by 30 cycles consisting of 95°C for 10 sec, 50°C for 5 sec and 60°C for 2 min. DNA was purified with Sephadex G-50 Superfine and sequenced using an DYE-ET terminator.

Molecular identification Sequences obtained were adjusted using SeqMan Π of Lasergene software (DNASTAR, Inc.). ITS, EF 1-α and β-TUB sequences were aligned iteratively using Ward’s averaging in the BioNumerics package v. 4.0 (Applied Maths, Kortrijk, Belgium). Nearest neighbours were found by local Blast searches. The distance trees were based on a re-aligned file using the

51 Chapter 3

100 Capronia acutiseta CBS 618.96 T 100 Capronia pulcherrima CBS 609.96 Capronia moravica CBS 602.96 Capronia epimyces CBS 606.96 Capronia coronata CBS 617.96 T CBS 101.67 T 100 Exophiala dermatitidis CBS 292.49 100 Exophiala dermatitidis CBS 525.76 Exophiala dermatitidis KU A0052T 100 Exophiala dermatitidis CBS 207.35 T 1 Exophiala phaeomuriformis CBS 131.88 T Exophiala heteromorpha CBS 232.33 T Exophiala prototropha CBS 534.94 T Capronia munkii CBS 615.96 T 100 Capronia dactylotrichoides CBS 604.96 T Capronia fungicola CBS 614.96 T Cladophialophora arxii CBS 306.94 T Cladophialophora bantiana CBS 173.52 T 100 Fonsecaea monophora CBS 269.37 99 CBS 271.37 NT Fonsecaea pedrosoi CBS 272.37 100 Fonsecaea pedrosoi CBS 289.93 Cladophialophora emmonsii CBS 102594 Fonsecaea pedrosoi CBS 102237 2 98 Cladophialophora minourae CBS 556.83 T 78 Cladophialophora carrionii CBS 260.83 100 Cladophialophora carrionii CBS 260.83 100 100 Phialophora americana CBS 840.69 Phialophora americana CBS 273.37 Phialophora verrucosa CBS 286.47 Cladophialophora boppii CBS 126.86 T Exophiala brunnea CBS 587.66 AUT Veronaea botryosa CBS 102593 100 Exophiala pisciphila dH 13077 98 Exophiala psychrophila CBS 256.92 Exophiala pisciphila CBS 660.76 Exophiala salmonis CBS 157.67 T Exophiala salmonis CBS 110371 6 100 Phialophora europaea CBS 129.96 T Phialophora reptans CBS 113.85 Ramichloridium anceps CBS 181.65 NT Exophiala calicioides CBS 102080 100 Exophiala dopicola UTMB1229 T Capronia villosa CBS 616.96 Capronia parasitica CBS 123.88 100 Exophiala castellanii CBS 158.58 NT 100 Exophiala mesophila dH 13436 100 Exophiala lecanii-corni CBS 123.33 T Exophiala lecanii-corni CBS 232.39 100 Exophiala bergeri CBS 353.52 T 100 Exophiala bergeri CBS 526.76 Exophiala nigra CBS 535.94 T 4 Exophiala nigra CBS 546.82 100 Phaeoannellomyces elegans UTMB 1286 T Exophiala jeanselmei CBS 507.90 T 100 Exophiala spinifera CBS 101534 100 100 Exophiala spinifera CBS 899.68 T Phaeococcomyces exophialae CBS 668.76 T 100 Exophiala oligosperma CBS 725.88 T 100 Rhinocladiella similis dH14778 100 3 100 Exophiala nishimurae CBS 101538; IFM 41855 T Exophiala xenobiotica CBS 117642 Exophiala xenobiotica CBS 118157 Ramichloridium mackenziei CBS 650.93 T Cladophialophora modesta CBS 985.96 T Ceramothyrium linnaeae UPSC 2646 Phaeococcomyces catenatus CBS 650.76 T 5 5 changes

Figure 1. One of 500 most parsimonious trees obtained from a heuristic search with 100 random taxon additions of the 18S sequence alignment. The scale bar shows 5 changes; bootstrap support values (>90%) from 100 replicates are shown at the nodes. Thickened lines indicate the restrict consensus branches. The tree was rooted to Phaeococcomyces catenatus CBS 650.76 T. Clade descriptions are those of Haase et al. (9).

52 Exophiala xenobiotica sp. nov.

DCSE program (De Rijk and De Wachter 1993) and calculated with the Neighbor-joining method of the Treecon package (Van de Peer and De Wachter 1994) with Kimura-2 correction. Bootstrap values > 90 of 100 resampled dataset are shown. If the similarity between an ITS sequence and its nearest neighbor exeeds 99%, they are members of a single branch of the phylogenetic tree, and no reshuffling is observed when other genes are sequenced, the strains are regarded to belong to a single species. SSU sequences of 3 strains of E. xenobiotica were aligned using the ARB programme (Ludwig et al. 2004) and a parsimony tree was constructed with related species using PAUP v. 4.0b10 (Swofford 2000). A heuristic search was performed for each dataset with 100 random taxon additions and tree bisection and reconstruction (TBR) as the branch swapping algorithm. Branches of zero- length were collapsed and all multiple, equally parsimonious trees were saved. Measures calculated for parsimony included tree length, consistency index and retention index index (TL, CI and RI, respectively). The robustness of the resulting phylogenetic tree was evaluated by 100 bootsstrap replications and every replication used a maxium of 500 trees. The phylogenetic tree was printed with TreeView v. 1.6.6 (Page 1996)

Results Five hundred most parsimonious trees (TL = 565 steps; CI = 0.625; RI = 0.760) obtained from a heuristic search with 100 random taxon additions of the 18S sequence alignment of 67 strains of Chaetothyriales (black yeasts and relatives) . The total amount of characters was 1548, of which 1248 character were constent, 167 parsimony-uninformative and 133 parsimony-informative. One of the most parsimonious trees is shown in Figure 1. Six well delimited clades are observed [Figure 1; clade 1-5 descriptions are those of Haase et al. (Haase et al. 1999); clade 6 is recognized in this study]. Exophiala xenobiotica belongs to clade 3 and is paraphyletic to E. spinifera, E. jeanselmei and E. oligosperma. Using the 18S sequence of Saccharomyces cerevisiae as a reference, 4 introns were found in E. xenobiotica CBS 117655, at positions 563, 1168, 1431 and 1436, and with lengths of 359, 388, 294 and 85 bp, respectively. Only 1 intron of 387 bp was found in CBS 118157 at position 1168 with reference to S. cerevisiae. No intron was found in the SSU of CBS 117642. The interrelationships of fifty-five of the strains identified to be related to ‘cluster 8’

53 Chapter 3

0.02

CBS 102606 E. xenobiotica CBS 117644 E. xenobiotica CBS 117661 E. xenobiotica CBS 117652 E. xenobiotica CBS 117656 E. xenobiotica CBS 117657 E. xenobiotica CBS 117645 E. xenobiotica CBS 117659 E. xenobiotica CBS 117651 E. xenobiotica CBS 117665 E. xenobiotica CBS 117664 E. xenobiotica CBS 118157(T) E. xenobiotica CBS 117648 E. xenobiotica CBS 117646 E. xenobiotica CBS 117671 E. xenobiotica A, B, C CBS 117669 E. xenobiotica CBS 117662 E. xenobiotica CBS 117667 E. xenobiotica dH 13749 E. xenobiotica 91 CBS 117674 E. xenobiotica CBS 117753 E. xenobiotica CBS 117672 E. xenobiotica 97 CBS 117673 E. xenobiotica CBS 117647 E. xenobiotica CBS 117642 E. xenobiotica D 98 CBS 117643 E. xenobiotica CBS 117675 E. xenobiotica CBS 117653 E. xenobiotica CBS 117670 E. xenobiotica CBS 117641 E. xenobiotica 100 CBS 117650 E. xenobiotica CBS 117676 E. xenobiotica CBS 117655 E. xenobiotica D CBS 117649 E. xenobiotica CBS 353.52(T) E. bergeri 100 100 CBS 111662 E. bergeri CBS 119094 E. bergeri CBS 119101 E. bergeri CBS 119100 E. bergeri CBS 119099 E. bergeri CBS 101538(T) E. nishimurae CBS 119097 E. oligosperma 100 CBS 725.88(T) E. oligosperma CBS 119096 E. oligosperma CBS 715.76 E. oligosperma CBS 110628 E. spinifera 92 100 CBS 899.68(T) E. spinifera IFM 41856 E. spinifera CBS 119098 E. spinifera 100 CBS 194.61 E. spinifera 99 CBS 677.76 E. jeanselmei CBS 119095 E. jeanselmei CBS 116.86 E. jeanselmei CBS 528.76 E. jeanselmei CBS 507.90(T) E. jeanselmei

Fig. 2 Distance tree of ITS rDNA of 55 strains belonging to the E. spinifera clade, constructed with the Neighbor joining algorithm in the Treecon package with Kimura (2) correction and 100 bootstrap replications (values >90 are shown with the branches). E. jeanselmei, CBS 507.90 is selected as outgroup. Groups (A-C) and (D) are based on EF 1-α data.

54 Exophiala xenobiotica sp. nov. of de Hoog et al. (De Hoog et al. 2003) on the basis of rDNA ITS sequence data are shown in Figure 2. The cluster contains Exophiala jeanselmei, E. spinifera, E. oligosperma, E. nishimurae and E. bergeri. Informative variation in the clade was found in 21 of 205 positions (10.2%) in ITS1 and in 22 of 185 positions (11.9%) in ITS2; the 159 positions of the 5.8S gene were identical in all strains. Thirty-two of the strains were also sequenced for partial β-TUB gene and 33 strains for partial EF 1-α gene (data not shown). Highest sequence diversity was found in EF 1-α, where four groups (A-D) were detected at high bootstrap values. Using β-TUB sequencing, groups C and D were also recognized comprising the same strains, but groups A and B were not statistically supported. With ITS, group D was recognized, but A–C were not (Figure 2). Although group D showed the largest distance to the remainder groups with all genes sequenced, one of the strains, CBS 117642 was found in group A–C with ITS (Figure 2) but in D with EF 1-α and β-TUB. A possible error was excluded by re-sequencing of the same DNA for all genes. The groups A–D are therefore regarded to belong to a single species. The new species is described below. The black yeast selectively isolated from soil polluted by aromatic compounds and mineral oil in Hilversum, CBS 119307, was identified as Exophiala xenobiotica by ITS sequencing.

Exophiala xenobiotica de Hoog, Zeng, Harrak & D. A. Sutton, sp. nov. Mycobank 491509. – Figure 5. Coloniae (CBS 118157) in substrates PDA et MEA, 27°C post 14 dies, dictis restrictae, primum planae, olivaceo-atrae, mucidae, in medio velutinae et olivaceo-griseae, margine plana, deinde (post 15 dies) umbonatae, coactae, olivaceo-griseae, in medio velutinae et brunneo-griseae. Reversum olivaceo-atrum. Pigmentum diffundens absens. Cellulae gemmantes copiosae, dilute olivaceae, ellipsoideae, 5–6 × 2.5–3.0 µm, capsula egentes, saepe inflatae et in cellulas germinantes, 7–10 × 3–5 µm, transformatae quae saepe zonam irregulariter annellatam brevem formant. Hyphae pallide olivaceae vel brunneae, 1.3–2.0 µm latae, septis 7–28 µm distantibus irregulariter divisae. Anastomoses frequentes. Conidiophora 1–7-cellularia, angulis acutis vel rectis ex hyphis restantibus oriunda, hyphis concoloria, raro ramosa. Cellulae conidiogenae limoniformes vel fusiformes, zonam irregulariter annellatam

55 Chapter 3 extensam formantes. Conidia pauca cohaerentia, subhyalina, obovoidea, 3.3–5.4 × 1.6–2.0 µm. Chlamydosporae globosae, subhyalinae, ad 13 µm diam nonnumquam visae. Teleomorphosis ignota. Temperatura crescentiae optima 30°C, maxima 33–36°C. Typus: CBS H-18220 (holotypus), cultura ex-typus CBS 118157, vivus et exsiccatus in CBS, Utrecht, praeservatur.

The following description is of CBS 118157 incubated at 27°C for 14 d. Colonies on PDA and MEA restricted, circular, initially (on day 3) flat, olivaceous black, slimy with velvety, olivaceous grey center and flat margin, later (on day 14) becoming umbonate, felty, olivaceous grey, with velvety, brownish grey center. Reverse olivaceous black on PDA, olivaceous black with brownish black center on MEA. No diffusible pigment produced on any medium. Budding cells initially abundant, pale olivaceous, ellipsoidal, 5–6 × 2.5–3.0 µm, without capsule in India ink, often inflating and developing into broadly ellipsoidal, brown germinating cells of about 7–10 × 3–5 µm that often bear a short, irregular annellated zone. Hyphae pale olivaceous to brown, 1.3–2.0 µm wide, irregularly septate every 7–28 µm. Anastomoses abundant. Conidiophores 1–7-celled, arising at acute or right angles from creeping hyphae, with the same color as the hyphae, seldom branched. Conidiogenous cells lemon-shaped or fusiform with a flaring irregular annellated zones. Conidia adhering in small groups, subhyaline, obovoidal, 3.3–4.0 × 1.6–2.0 µm. Spherical, subhyaline chlamydospores up to 13 µm diameter may be present. Teleomorph not observed in any of the strains tested after 2 months incubation. Cardinal temperatures: optimum 30°C, maximum growth temperature 33–36°C. Type: deposited in Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands, as CBS H-18220 (holotype), ex-type culture CBS 118157, isolated from oil sludge, San Tome, Anzoategui State, Venezuela (Arias and Stotzky 1997). Living strain also deposited in the collection of the Institute for Hygiene and Microbiology, Brussels, Belgium, as IHEM 21721. The MIC50 and MIC90 are 0.25 mg/L and 0.5 mg/L for amphotericin B, 0.03 mg/L and 0.125 mg/L for itraconazole, 0.125 mg/L and 0.5 mg/L for voriconazole and ≤0.015 mg/L and 0.03 mg/L for posaconazole.

56 Exophiala xenobiotica sp. nov.

a c

e

d

b

Figure 3. E. xenobiotica CBS 118157. (a. conidia; b. conidiophores; c, d. conidiogenous cells; e. anastomoses. Bar = 10 µm.

57 Chapter 3

Discussion Like Exophiala jeanselmei and E. oligosperma, the new species has fusiform conidiogenous cells inserted laterally on hyphae, with a single, terminal annellated zone which often is somewhat irregularly flared. The species is indistinguishable from E. oligosperma and from immature colonies of E. jeanselmei in morphology and physiology. Mature E. jeanselmei conidiogenous cells arise at right angles from creeping hyphae and are somewhat darker than the remaining thallus (De Hoog et al. 2000). The phylogenetic position of the species within the order Chaetothyriales is shown in Figure 1. The main teleomorph genus in this order is Capronia, but nearly all species sequenced thus far are relatively distant at long branches. Haase et al. (Haase et al. 1999) supposed an ancestral position for Capronia, the human opportunistic anamorph species being derived. A number of clearly discernible clades is apparent. The Exophiala spinifera complex (clades 3 and 4) is paraphyletic to the majority of the black yeast-like fungi (clades 1, 2 and 6). The genus Cladophialophora is polyphyletic, the agents of systemic disease (C. arxii, C. bantiana, C. devriesii) being found with Fonsecaea, and the agents of cutanous disorders (C. carrionii, C. boppii) (clade 2). Exophiala dermatitidis and its allies is found in clade 1. A group of psychrophilic species clusters in clade 6. The E. spinifera complex consists of two sister groups, clades 3 and 4. E. xenobiotica is located in clade 3, with E. jeanselmei, E. nishimurae and E. oligosperma, in addition to Rhinocladiella similis which has an Exophiala synanamorph. CBS 204.50 was originally attributed to E. castellanii, but was re-identified as E. xenobiotica, which was comfirmed by rDNA ITS sequence data (Table 1). Iwatsu et al. (Iwatsu et al. 1984) selected this strain as neotype of E. castellanii Iwatsu et al., as a replacement name for E. mansonii Castell, but the present authors prefer to maintain CBS 158.58, deposited by A. Castellani in the CBS collection as representing E. mansonii, for this purpose. The position of E. xenobiotica close to a notorious pathogen as E. spinifera suggests an infectious potential on humans. Indeed E. xenobiotica was only exceptionally isolated from animals, all hosts being warm-blooded. However, clinical syndromes were predominantly mild cutaneous. The number of SSU introns is remarkably variable. The three strains sequenced have entirely different numbers of introns, varying between 0-4. One intron at position 1168 was shared by 2 strains. Haase et al. (Haase et al. 1999) noticed the occurrence of up to 3 introns

58 Exophiala xenobiotica sp. nov. in black yeasts, while Matos et al. (Matos et al. 2002) found that infraspecies variation (0-2) is observed in E. dermatitidis. The ITS, β-TUB and EF 1-α genes sequenced showed different degrees of resolution. The ITS sequences are sufficiently alignable over distant species to produce a robust tree of the entire E. spinifera SSU clade 3 including E. xenobiotica [ITS clade 8 in (De Hoog et al. 2003)]. The highest resolution with groups A–D was found with EF 1-α, while with ITS only a bipartition (A–C) versus (D) could be observed. Strains of group D seem to be clearly separate from the remaining strains of ‘cluster 8’ of de Hoog et al. (De Hoog et al. 2003) with three genes sequenced, but strain CBS 117642 which was found in group A–C with ITS but in D with partial EF 1-α and β-TUB genes. So strains in 4 groups were identified as same species. In general, the species is fairly common in mild cutaneous infections (Zeng et al. 2006): 41 of 55 strains examined and deposited in culture collections without identification bias originated from humans or animals. Unfortunately, detailed case reports are lacking for all of the strains, and we are not aware of any confirmed case report by a strain now known to be referable as E. xenobiotica. Consequently there is limited insight into the virulence of the species. This virulence is probably rather low. Most infections seem to have been of traumatic nature, judging from the frequent occurrence of eye, wound and (sub)cutaneous lesions and cysts. A single draining sinus of an ulcer was mentioned. The deeper infection of the positive blood culture (CBS 117674, Table 1) is likely to have been associated with immunodepression or major debilitating disease. Several of the environmental strains listed in Table 1 were derived from moist environments in a hospital setting, including dialysis fluid, and once from a bathroom floor. Phillips et al. (Phillips et al. 1998) isolated CBS 102177 from a biofilm in a water-pipe supplying automated endoscope washer disinfectors. The strain resisted UV-light and survived subsequent decontamination with peracetic acid and hydrogen peroxide disinfectans. E. xenobiotica survives acidic conditions, which is demonstrated by CBS 115831 isolated from browncoal at pH 1, together with Hortaea acidophila (Hölker et al. 2003). Watson et al. (Watson et al. 1976) analyzed a unique extracellular compound produced by CBS 580.76, 2- acetamido-2-deoxy-D-glucuronic acid, which is otherwise known from Staphylococcus aureus. This compound, when isolated as its potassium salt, dissolves readily in water and produces

59 Chapter 3 very viscous solutions, and may play a significant role in the protection of the fungus against oxygenic action. Two strains were derived from the lungs of patients with cystic fibrosis, where S. aureus is one of the prevalent colonizers (Elborn 1999). The prevalence of black yeasts with clinical potential in drinking water networks may be underestimated (Göttlich et al. 2002). Fungal load is generally low, but accumulation may take place in cells with decreased flow. Their resistance to disinfection gives the fungi a competitive advantage. For example, Porteous et al. (Porteous et al. 2003) noted biofilms dominated by Exophiala mesophila in chemical cleaners to reduce bacterial load in dental unit waterlines. Several reports of pseudoepidemics resulting from inoculation of fluids contaminated with black yeasts have been reported (Nucci et al. 2002; Woollons et al. 1996), eventually with fatal outcome (Engemann et al. 2002). In the remaining environmental strains we witness a striking association with toxic, aromatic xenobiotics (Table 1). Strain CBS 118157 was isolated from oil-contaminated soil, and CBS 110555 from soil polluted by gasoline. The timber strain CBS 522.76 was derived from wood treated with phenolic preservatives. Strain dH 11807 came from a creosote-treated railway tie. Also browncoal (CBS 115831) is rich in phenolic compounds. Sterflinger & Prillinger (Sterflinger and Prillinger 2001) encountered the species on the blackened surface of an urban building, where it was supposed to thrive at the expense of polycyclic aromatic hydrocarbons, degradation products of industrial activity and heavy traffic. Prenafeta-Boldú et al. (Prenafeta-Boldú et al. 2001, 2006) noted a distinct association with monoaromates in black yeasts and filamentous relatives of the order Chaetothyriales, confirming earlier reports (Cox et al. 1997, Middelhoven 1993). In conclusion, E. xenobiotica is remarkable in combining an obvious clinical potential – although at low virulence – with an environmental preference to grow in soils or waters containing xenobiotics. With this dual ecology the chaetothyrialean black yeasts and their relatives are unique in the fungal Kingdom (Prenafeta-Boldú et al. 2006). The frequent statement in the literature that human-infecting black yeasts are common degraders of dead plant material is obviously incorrect. In contrast, they inhabit quite specific environmental niches, many of which are rich in aromatic pollutants. How this predilection enhances their ability to infect humans is still a mystery.

60 Exophiala xenobiotica sp. nov.

Judging from the breakpoints of antifungal susceptibility (Sutton et al. 1998, 1999a), most strains tested were susceptible to the antifungal agents in vitro. Particularly, posaconazole is highly effective.

Acknowledgements K. Sterflinger (Vienna, Austria), U. Hölker (Bonn, Germany), L. Sigler (Edmonton, Canada), G. Haase (Aachen, Germany) and the curator of the IFM culture collection (Chiba, Japan) are acknowledged for sending strains. A. H. G. Gerrits van den Ende and K. F. Luijsterburg are thanked for technical assistance, and R.C. Summerbell for comments on the text.

References Arias M & Stotzky G (1997) Adsorption and binding of copper and lead by Exophiala sp. Abstr. Gen. Meet. ASM. 97: 497. Cox H H J, Moerman R E, Van Baalen S, Van Heyningen W J M, Doddema H J & Harder W (1997) Performance of a styrene-degrading biofilter containing the yeast Exophiala jeanselmei. Biotechnol. Bioengin. 53: 259-266. De Hoog G S, Guarro J, Gené J & Figueras M J (2000) Atlas of Clinical Fungi, 2nd ed. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili, Utrecht / Reus. De Hoog G S, Vicente V, Caligiorne R B, Kantargliocu S, Tintelnot K, Gerrits van den Ende A H G and Haase G (2003) Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J. Clin. Microbiol. 41: 4767–4778. De Hoog G S (1977) Rhinocladiella and allied genera. Stud. Mycol. 15: 141–144. De Rijk P & De Wachter R (1993) DCSE v. 2.54, an interactive tool for sequence alignment and secondary structure research. Comput. Appl. Biosci. 9: 735–740. Elborn J S (1999) Treatment of Staphylococcus aureus in cystic fibrosis. Thorax 54: 377–378. Engemann J, Kaye K, Cox G, Perfect J, Schell W, McGarry S A, Patterson K, Edupuganti S, Cook P, Rutala W A, Weber D J, Hoffmann K K, Engel J, Young S, Durant E, McKinnon K, Cobb N, Bell L, Gibson J, Jernigan D, Arduino M, Fridkin S, Archibald L, L Sehulster, Morgan J, Hajjeh R, Brandt M, Warnock D & Duffus W A (2002) Exophiala infection from contaminated injectable steroids prepared by a compounding pharmacy. Center for Disease Control (CDC) Morbid. Mortal. Wkly Rep. 51: 1109–1112.

61 Chapter 3

Göttlich E, Van der Lubbe W, Lange B, Fiedler S, Melchert I, Reifenrath M, Flemming H-C & De Hoog G S (2002) Fungal flora in groundwater-derived public drinking water. Int. J. Hyg. Environm. Health 205: 269–279. Haase G, Sonntag L, Melzer-Krick B & De Hoog G S (1999) Phylogenetic inference by SSU-gene analysis of members of the Herpotrichiellaceae with special reference to human pathogenic species. Stud. Mycol. 43: 80–97. Hölker U, Bend J, Pracht R, Müller T, Tetsch L & De Hoog G S (2003) Hortaea acidophila, a new acidophilic black yeast from lignite. Antonie van Leeuwenhoek 86: 287–294. Iwatsu T, Miyaji M & Okamoto S (1981) Isolation of Phialophora verrucosa and Fonsecaea pedrosoi from nature in Japan. Mycopathologia 75: 149-158. Iwatsu T, Nishimura K & Miyaji M (1984) Exophiala castellanii sp. nov. Mycotaxon 20: 307-314. Kawasaki M, Ishizaki H, Matsumoto T, Matsuda T, Nishimura K & Miyaji M (1999) Mitochondrial DNA analysis of Exophiala jeanselmei var. lecanii-corni and Exophiala castellanii. Mycopathologia 146: 75–77. Langeron M (1928) Mycétome à Torula jeanselmei Langeron, 1928. Nouveau type de mycétome à grains noirs. Ann. Parasitol. Hum. Comp. 6: 385–403. Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar, Buchner A, Lai T, Steppi S, Jobb G, Forster W, Brettske I, Gerber S, Ginhart AW, Gross O, Grumann S, Hermann S, Jost R, Konig A, Liss T, Lussmann R, May M, Nonhoff B, Reichel B, Strehlow R, Stamatakis A, Stuckmann N, Vilbig A, Lenke M, Ludwig T, Bode A & Schleifer KH (2004) ARB: a software environment for sequence data. Nucleic Acids Res. 32: 1363-71. Matos T, De Hoog G S, De Boer A G, De Crom I & Haase G (2002) High prevalence of the neurotrope Exophiala dermatitidis and related oligotrophic black yeasts in sauna facilities. Mycoses 45: 373-377. Matsuda M, Naka W, Tajima S, Harada T, Nishikawa T, Kaufman L & Standard P (1989) Deoxyribonucleic acid hybridization studies of Exophiala dermatitidis and Exophiala jeanselmei. Microbiol. Immunol. 33: 631–639. McGinnis M R and Padhye A A (1977) Exophiala jeanselmei, a new combination for Phialophora jeanselmei. Mycotaxon 5: 341-352. Middelhoven W J (1993) Catabolism of benzene compounds by ascomycetous and basidiomycetous yeasts and yeastlike fungi. Antonie van Leeuwenhoek 63: 125-144. Middelhoven W J, De Hoog G S & Notermans C (1989) Carbon assimilation and extracellular antigens of some yeast-like fungi. Antonie van Leeuwenhoek 55: 165-175.

62 Exophiala xenobiotica sp. nov.

Murray I G, Dunkerley G E & Hughes K E A (1963) A case of Madura foot caused by Phialophora jeanselmei. Sabouraudia 3: 175–177. National National Committee for Clinical Laboratory Standards (2002) Reference method for broth dilution antifungal susceptibility testing of forming filamentous fungi. Proposed standard M38-A. National Committee for Clinical Laboratory Standards, Wayne, Pa. Neumeister B, Zollner T M, Krieger D, Sterry W & Marre R (1995) Mycetoma due to Exophiala jeanselmei and Mycobacterium chelonae in a 73-year-old man with idiopathic CD4+ T lymphocytopenia. Mycoses 38: 271–276. Nucci M, Akiti T, Barreiros G, Silveira F, Revankar S G, Wickes B L, Sutton D A & Patterson T F (2002) Nosocomial outbreak of Exophiala jeanselmei associated with contamination of hospital water. Clin. Infect. Dis. 34: 1475–1480. Page R D M (1996) TREEVIEW: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12: 357-358. Phillips G, McEwan H, McKay I, Crowe G & McBeath J (1998) Black pigmented fungi in the water pipe-work supplying endoscope washer disinfectors. J. Hosp. Infect. 40: 250–251. Porteous N B, Redding S W, Thompson E H, Grooters A M, De Hoog G S & Sutton D A (2003) The isolation of an unusual fungus in treated dental unit waterlines. J. Am. Dent. Assoc. 134: 467-476. Prenafeta-Boldú F X, Kuhn A, Luykx D M A M, Anke H, Van Groenestijn J W & De Bont J (2001) Isolation and characterisation of fungi growing on volatile aromatic hydrocarbons as their sole carbon and energy source. Mycol. Res. 105: 477–484. Prenafeta-Boldú F X, Summerbell R & De Hoog G S (2006) Fungi growing on aromatic hydrocarbons: biotechnology’s unexpected encounter with biohazard. FEMS Microbiol. Rev. 30: 109-130. Sterflinger K & Prillinger H (2001) Molecular taxonomy and biodiversity of rock fungal communities in an urban environment (Vienna, Austria). Antonie van Leeuwenhoek 80: 275–286. Sutton D A, Fothergill A W & Rinaldi M G (1998) Guide to Clinically Significant Fungi. Williams & Wilkins, Baltimore. Sutton D A, Sanche S E, Revankar S G, Fothergill A W & Rinaldi M G (1999a) In vitro amphotericin B resistance in clinical isolates of Aspergillus terreus, with a head-to-head comparison to voriconazole. J. Clin. Microbiol. 37: 2343-2345. Swofford D L (2000) PAUP* 4.0: phylogenrtic analysis using parsimony. Sinauer Associates, Sunderland, MA, U.S.A. Untereiner W A (1994) A simple method for the in vitro production of pseudothecia in species of Capronia. Mycologia 86: 290–295.

63 Chapter 3

Van de Peer Y. and De Wachter R. 1994. Treecon for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10: 569–570. Vitale R G & De Hoog G S (2002) Molecular diversity, new species and antifungal susceptibilities in the Exophiala spinifera clade. Med. Mycol. 40: 545–556. Wang L, Yokoyama K, Miyaji M & Nishimura K (2001) Identification, classification and phylogeny of the pathogenic species Exophiala jeanselmei and related species by mitochondrial cytochrome b gene analysis. J. Clin. Microbiol. 39: 4462–4467. Watson P R, Sanford P A, Burton K A, Cadmus M C & Jeanes A (1976) An extracellular fungal polysaccharide composed of 2-acetamido-2-deoxy-d-glucuronic acid residues. Carbohydr. Res. 46: 259–265. Woollons A, Darley C R, Pandian S, Blackee J & Paul J (1996) Phaeohyphomycosis caused by Exophiala dermatitidis following intra-articular steroid injection. Br. J. Derm. 135: 475–477. J. S. Zeng, D. A. Sutton, A.W. Fothergill, M.G. Rinaldi, M. J. Harrak & G. S. de Hoog. Spectrum of clinically relevant Exophiala species in the U.S.A. J. Clin. Microbiol. (accepted)

64 Chapter 4

Spectrum of clinically relevant Exophiala species in the U.S.A.

J. S. Zeng1,2,3, D. A. Sutton4, A. W. Fothergill4, M. G. Rinaldi4,5, M. J. Harrak1,2 and G. S. de Hoog1,2

Centraalbureau voor Schimmelcultures, Utrecht,1 Institute for Biodiversity and Ecosystem Dynamics, Amsterdam,2 The Netherlands; Dept. of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, Wuhan, Hubei, China3; Fungus Testing Laboratory, University of Texas Health Science Center, San Antonio, TX, U.S.A.4, Audie L. Murphy Memorial Veterans’ Hospital, South Texas Veterans Health Care System, San Antonio, TX, U.S.A.5

Accepted by Journal of Clinical Microbiology in June, 2007

Key words: Exophiala, mycosis, ITS, identification, etiologic agent

65

Chapter 4

Abstract Numerous members of the genus Exophiala are potential agents of human and animal mycoses. The majority of these infections are cutaneous and superficial, but also fatal systemic infections are known. We re-identified 188 clinical isolates from the U. S. A., which had a preliminary morphological identification of Exophiala species, by sequencing internal transcribed spacer (ITS) region of the ribosomal DNA. Molecular identifications of the strains were, in order of frequency: 55 E. dermatitidis (29.3%), 37 E. xenobiotica (19.7%), 35 E. oligosperma (18.6%), 13 E. lecanii-corni (6.9%), 12 E. phaeomuriformis (6.4%), 7 E. jeanselmei (3.7%), 7 E. bergeri (3.7%), 6 E. mesophila (3.2%), 5 E. spinifera (2.7%), 3 Exophiala sp. 1 (1.6%), 3 E. attenuata (1.6%), 3 Phialophora europaea (1.3%), 1 E. heteromorpha (0.5%) and 1 Exophiala sp. 2 (0.5%). Exophiala strains were repeatedly isolated from deep infections (39.9%) involving lung, pleural fluid, sputum, digestive organs (stomach, intestines, bile), heart, brain, spleen, bone marrow, blood, dialysis fluid, lymph node, joint, breast, middle ear, throat and intraocular tissues. About 38.3% of Exophiala spp. strains were agents of cutaneous infections including skin, mucous membranes, nail and corneal epithelium lesions. The other strains caused superficial infections (0.5%, including hair) or subcutaneous infection (12.0%, including paranasal sinusitis, mycetoma and subcutaneous cyst). The systemic infections were preponderantly caused by E. dermatitidis, E. oligosperma, E. phaeomuriformis, E. xenobiotica and E. lecanii-corni. Strains of E. bergeri,

E. spinifera, E. jeanselmei, E. mesophila and E. attenuata mainly induced cutaneous and subcutaneous infections. Since relatively few unknown ITS motifs were encountered, we suppose that the list of opportunistic Exophiala species in temperate climates is nearing completion, but a number of species still have to be described.

Introduction Black yeasts of the genus Exophiala are notoriously difficult to classify and identify. In the past, diagnostic schemes were morphological, while soon physiological parameters were added (10, 11). Several species indeed have marked phenetic characteristics, such as the large conidiophores of E. spinifera, or the thermotolerance and absence of nitrite assimilation in E. dermatitidis. The majority of species, however, is morphologically variable, caused by

66 Spectrum of clinically relevant Exophiala species in the USA their passage through complicated life cycles where diagnostic features are variably expressed (14), and, conversely, very similar microscopic structures can be expressed in phylogenetically remote species. In recent years diagnostics has become supplemented by molecular tools, particularly sequence data of the rDNA Internal Transcribed Spacer (ITS) regions (13, 15, 37). A significant proportion of the known species is regularly encountered as causative agents of human mycoses (e.g., 4, 23, 28, 30, 32, 34, 37). In harbouring a wide array of clinically relevant species, the black yeasts and relatives are unique in the fungal kingdom. Because of the lack of tools for species distinction, Exophiala species have long been viewed as coincidental opportunists, having their prime occurrence as saprobes on plant material. However, when circumscribed according to modern criteria, some species have turned out to be consistent in their ecology and predilected sites of infection (15). This places the possibility of species-specific virulence and antifungal susceptibility in another light. In the present paper we analyzed retrospectively a large number of clinical strains preserved at the Fungus Testing Laboratory in the Department of Pathology at the University of Texas Health Science Center at San Antonio, Texas, U.S.A. (UTHSC) and determined their antifungal susceptibility profiles. Given the difficulty of morphological identification, final IDs were reached after sequencing. An overview of identification results showing discrepancies between morphological and molecular IDs can be sent upon request.

Materials and Methods Fungal strains. A total of 188 clinical strains, previously submitted to the Fungus Testing Laboratory for identification, antifungal susceptibility testing, or both, and accessioned into the UTHSC collection were analyzed (Table 1). All isolates were stored at – 80ºC prior to study, and had preliminary morphological identifications as Exophiala spp.. Sequences were compared with a database at Centraalbureau voor Schimmelcultures (CBS) containing thousands of comparable sequences of environmental and clinical Exophiala species and related black yeast-like fungi (orders Chaetothyriales and Dothideales). DNA extraction. About 1 cm2 of fungal material was transferred to a 2 ml Eppendorf tube containing a 2:1 (w/w) mixture of silica gel and Celite (silica gel H, Merck 7736/Kieselguhr Celite 545, Machery) and 300 μl TES buffer. The fungal material was

67

68

Spectrum of clinically relevant Exophiala species in the USA

69 Chapter 4 ground with a micropestle for 1-2 min. Volume was adjusted by adding 200 μl TES buffer. After vigorous shaking and adding 10 μl 10 mg/ml Proteinase K to the tube, the mixture was incubated at 65°C for 10 min. The salt concentration was raised by adding 140 μl 5M NaCl solution. The mixture was mixed with 1/10 volume (~65 μl) cetyltrimethylammonium bromide (CTAB) buffer 10%, followed by incubation for another 30 min at 65°C. One volume (~700 μl) chloroform-isoamylalchohol (v/v = 24/l) was added and mixed carefully by hand. After being incubated 30 min at 0 ºC (on ice water) and centrifugation at 14,000 r.p.m. at 4°C for 10 min, the toplayer was transferred to a clean Eppendorf tube. The sample mixed with 225 µl 5M NH4-acetate was incubated for at least 30 min (on ice water) and spun again. The supernatant was transferred to a clean sterile Eppendorf tube and mixed with 0.55 volume (~510 µl) icecold isopropanol. After being spun 7 min, 14,000 r.p.m., 4 ºC (or room temperature), the supernatant was decanted. The pellet was washed with icecold ethanol 70% 2 times and dried using a vacuum dryer. The powder was re-suspended in 48.5 µl TE-buffer with 1.5 µl 10 mg/ml RNAse, incubated at 37 ºC for 15-30 min and stored at –20ºC until used. DNA amplification and sequencing. PCR was performed in 50 μl volume of a reaction mixture containing 10 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2·6H2O, 0.01% gelatin, 200 mM of each deoxynucleotide triphosphate, 25 pmol of each primer, 10- 100 ng rDNA and 0.5 U Taq DNA polymerase (Sigma). ITS amplicons were generated for all strains using primers V9G (5’-TTA CGT CCC TGC CCT TTG TA-3’) and LS266 (5’-GCAT TCC CAA ACA ACT CGA CTC-3’) (20). Amplification was performed in GenAmp PCR System 9700 (Applied Biosystem, Foster City, U.S.A.) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 94°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, and a delay at 72°C for 7 min. Amplicons were cleaned with GFX columns (GE Healthcare UK Ltd., Buckinghamshire, England). For each of the two primers separately, sequencing PCR using 1 μl template DNA (1-10 ng), 3 μl dilution buffer, 1 μl BigDye v3.1 (Applied Biosystems, CA, U.S.A.), 1 μl of 4 pmol primer filled with 4 μl MilliQ water to a final volume of 10 μl, was performed as follows: 95°C for 1 min, followed by 30 cycles consisting of 95°C for 10 sec, 50°C for 5 sec and 60°C for 2 min. Reaction products were purified with Sephadex G-50 Fine (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) and analyzed using ABI PRISM 3730xl DNA Analyzer (Applied Biosystems, Foster City, U.S.A.).

70 Spectrum of clinically relevant Exophiala species in the USA

Molecular identification. The sequences were adjusted using the program SeqMan Π of Lasergene software (DNASTAR, Inc., Wisconsin, U.S.A.) and aligned iteratively using Ward’s averaging in the Bionumerics package v. 4.0 (Applied Maths, Kortrijk, Belgium). Nearest neighbours were found by local Blast searches. The distance trees were based on a re- aligned file using the DCSE program (17) and calculated with Neighbour-joining method of the Treecon package (38) with Kimura-2 correction; only unambiguously aligned positions were taken into account. 100 Bootstrap replicates were used for analysis. Bootstrap values > 90 of 100 resampled datasets are shown. If the similarity of sequences of ITS region is more than 99% between a studied strain and its nearest neighbor, and they distribute in same branch of phylogenetic tree, the strain is regarded as belonging to the same species as its nearest neighbor. Antifungal susceptibility. Antifungal susceptibility testing of four currently available antifungal agents (Amphotericin B, itraconazole, voriconazole and posaconazole) was performed with all strains according to Clinical and Laboratory Standards Institute guidelines (M38-A) (8)

Results A total of 185 strains from the U.S.A. were judged to belong to the genus Exophiala as circumscribed by annellidic conidium production and phylogenetic affinity to the order Chaetothyriales. Budding cells are mostly present in any stage of the life cycle, but are absent from some psychrophilic species. Three strains morphologically attributed to Exophiala appeared to be Phialophora europaea. Figure 1 shows a distance tree of partial ITS rDNA of a selection of the strains identified, supplemented with some reference strains. In this tree each Exophiala species is clearly individualized in an independent branch supported by a high bootstrap value. Molecular identifications of all strains are shown in Table 1; a total of 14 species was identified, which included 2 undescribed novel Exophiala species. The comparison between morphological and genetic identifications can be found in Table 2. Only E. dermatitidis had relatively high degree of congruent identifications with morphological and molecular approaches.

71 Chapter 4

0.1

UTHSC 97-2204 (EF025383) UTHSC 98-1828 (EF025384) 100 CBS 232.39 T E. lecanii-corni UTHSC 99-917 (EF025385) UTHSC 95-2350 (EF025386) CBS 402.95 T 100 CBS 836.95 92 UTHSC 91-270 (EF025387) E. mesophila 99 UTHSC 96-1493 (EF025388) UTHSC 04-1300 (EF025389) 92 100 CBS 110025 CBS 109915 E. castellanii 98 CBS 109812 100 UTHSC 01-354 (EF025391) UTHSC 03-3636 (EF025390) E. attenuata UTHSC 87-80 (EF025392) CBS 627.82 100 UTHSC 87-269 Exophiala sp. 2 UWFP 724 CBS117497 Exophiala sp. 3 96 100 CBS110371 E. salmonis 94 CBS 157.67 T UTHSC 97-1647 Exophiala sp. 1 92 UTHSC 04-526 UTHSC 89-386 100 DAOM 216387 DAOM 208453 Capronia pilosella UTHSC 89-467 (EF025397) UTHSC 01-1751 (EF025398) 100 UTHSC R-1002 (EF025399) E. dermatitidis CBS 207.35 T 98 CBS 102696 100 CBS 633.69 E. heteromorpha UTHSC 87-67 (EF025400) CBS 109813 100 CBS 109150 E. phaeomuriformis 100 UTHSC 88-471 (EF025401) UTHSC 96-1806 (EF025402) CBS 520.76 E. moniliae 100 CBS 688.76 CBS 685.76 Rhinocladiella atrovirens CBS 353.52 T 100 UTHSC 00-1119 (EF025403) UTHSC 94-540 (EF025404) E. bergeri UTHSC 99-1723 (EF025405) UTHSC 99-211 (EF025406) CBS 117641 CBS 118157 T 100 100 UTHSC 92-891 (EF025407) E. xenobiotica UTHSC R-3427 (EF025408) UTHSC 02-48 (EF025409) CBS 101538 T E. nishimurae 91 UTHSC 94-28 (EF025410) UTHSC R-3338 (EF025411) CBS 507.90 T E. jeanselmei UTHSC 93-2459 (EF025412) CBS 725.88 T 97 90 UTHSC 98-697 (EF025413) E. oligosperma 96 UTHSC 92-2007 (EF025414) UTHSC195-2041 (EF025415) 100 UTHSC 97-2073 (EF025416) 95 UTHSC 91-188 (EF025417) E. spinifera UTHSC R-2870 (EF025418) 98 UTHSC 88-15 (EF025419) CBS 668.76 T 99 UTMB 821 IFM 46126 Phaeococcomyces exophialae CBS 671.76 UTHSC 98-1110 (EF025421) UTHSC 98-1704 (EF025422) Phialophora europaea UTHSC 00-119 (EF025420)

FIG. 1. Consensus tree of ITS rDNA of 15 described clinical Exophiala and neighboring species, constructed with the Neighbor joining algorithm in the Treecon package with Kimura (2) correction and 100 bootstrap replications (values >90 are shown with the branches). Phialophora europaea is selected as outgroup. The numbers in brackets are GenBank accession numbers for ITS sequences deposited in the GenBank database.

72 Spectrum of clinically relevant Exophiala species in the USA

In order of frequency, the prevalent agents of Exophiala species were E. dermatitidis (29.7%), E. xenobiotica (20.0%) and E. oligosperma (18.9%), comprising more than two- thirds of isolates treated in this paper, being followed by E. lecanii-corni (7.0%), E. phaeomuriformis (6.5%), E. jeanselmei (3.8%), E. bergeri (3.8%), E. mesophila (3.2%) and E. spinifera (2.7%) (Fig. 2). The total frequency of the second series of species was more than 25%. E. attenuata, E. heteromorpha and 2 hitherto undescribed species were seldom isolated. Exophiala strains were repeatedly isolated from human systemic, single-organ infections (39.9%) particularly involving the lungs (Fig. 3, 4). More than fifty percent of the systemic strains were isolated from lung, pleural fluid or sputum (Fig. 4), while isolation from the digestive system and faeces was uncommon. Cerebral infections were very rare. Strains from human cutaneous infections, including skin, mucous membranes, nail and corneal epithelium, were equally common as agents from deep localizations (Fig. 3). Subcutaneous infections in humans were less common (12.0%, involving sinusitis, mycetoma and subcutaneous cysts), while strains were exceptional as commensals (0.5%, involving hair). Two strains were isolated from animals. Of a small number of strains no isolation data were available. The deep infections in human were preponderantly caused by E. dermatitidis (36/73, 49.3%), E. oligosperma (16/73, 21.9%), E. phaeomuriformis (9/73, 12.3%), E. xenobiotica (5/73, 6.8%) and E. lecanii-corni (4/73, 5.5%) (Tab. 1). The three mostly common Exophiala agents of cutaneous and subcutaneous infection were E. xenobiotica (25/95, 27.2%), E. dermatitidis (16/92, 17.4%) and E. oligosperma (16/92, 17.4%). E. jeanselmei, which in the literature has been regarded as a major agent of cutaneous and subcutaneous mycoses, was rarely observed (7/92, 7.6%). Though E. dermatitidis, E. oligosperma and E. phaeomuriformis caused different mycoses, they were more frequently isolated from deep infections than from cutaneous and subcutaneous lesions. Strains of the uncommon species E. jeanselmei, E. bergeri, E. spinifera and E. attenuata were rarely systemic. The result of antifungal susceptibility testing for 9 species strains is shown in Table 3. Although there are no defined breakpoints for any species in the genus, minimum inhibitory concentration (MIC) data correlated with safely achievable drug concentrations suggests clinical efficacy with each of the antifungal agents evaluated. Since the number of strains of

73 Chapter 4 sp. 1 sp. 2 1.6% 0.5% 0.5% 1.6% 2.7% E. spinifera Exophiala E. attenuata Exophiala E. heteromorpha species from the U.S.A. 3.2% 7.0% 3.8% Others E. mesophila E. bergeri 3.8% 6.5% E. jeanselmei E. Exophiala 29.7% E. phaeomuriformis E. dermatitidis E. 7.0% E. lecanii-corni FIG. 2. Spectrum FIG. of clinical 18.9% E. oligosperma E. 20.0% E. xenobiotica

74 Spectrum of clinically relevant Exophiala species in the USA 38.3% cutaneous mycoses species in the U.S.A. 12.0% Exophiala subcutaneous mycoses 0.5% superficial mycoses superficial infections caused by 9.3% unknown 39.9% FIG. 3. FIG. Localization of deep mycoses

75 Chapter 4 less-common species is low, susceptibility data are not shown. Of note, however, Exophiala attenuata (3 strains) was found to be resistant to amphotericin B.

Diccussion Though some Exophiala species can be identified morphologically and with the help of physiological parameters, most taxa can only be recognized with sufficient certainty using molecular methods. The sequence diversity of the ITS rDNA region has proven to be reliable for routine species distinction in the genus Exophiala (13, 37). For some of the main clinically relevant species (16) the conclusions in this paper have been confirmed by partial sequencing of the elongation factor 1-α and β-tubulin genes. Large distances were observed between nearly all species analyzed, even when these were highly similar morphologically and physiologically. Hence the use of umbrella names such as ‘Exophiala jeanselmei group’, which may be acceptable for daily routine, cannot be applied in the scientific literature. Publication of case reports should be accompanied by sequence data of at least ITS rDNA. Since relatively few ITS motifs were encountered in the present study that were unknown to us, we suppose that the list of human-associated Exophiala species in temperate climates is nearing completion, although still a few new species are on the list to be described. Species concepts in Exophiala have changed considerably after large-scale application of molecular methods over the last five years. In particular, the common clinical species Exophiala jeanselmei (9) appeared to comprise a number of cryptic species, such as E. heteromorpha (15), E. lecanii-corni (22), E. oligosperma (15) and E. xenobiotica (16), in addition to E. jeanselmei in a restricted sense (15). Most of these species have been reported from proven clinical cases, whereby slight, species-specific differences in preferred sites of infection were noted (15). Unfortunately, case reports continue to be published under obsolete concepts (33, 34) and thus create confusion. The present paper utilizes species circumscriptions published after the latest overview of clinically relevant Exophiala species, which dates back to the year 2000 (9). Thus far 17 out of 23 known Exophiala species have been proven or were suggested to cause infections in or colonization of humans and animals. The list includes the recently described taxa E. xenobiotica (16), E. oligosperma (1) and several mesophilic species [Harrak et al., unpublished data]. No reliable data are available on the incidence of diseases, as strains

76 Spectrum of clinically relevant Exophiala species in the USA 8.2% 6.8% bile, stool stool bile, stomach, intestine, intraocular 2.7% heart species in the U.S.A. 5.5% blood Exophiala 19.2% other 57.5% sputum, throat sputum, lung, pleural fluid, fluid, pleural lung, FIG. 4. Distribution of deepFIG. mycoses caused by

77 Chapter 4 studied were those that were sent to reference laboratories for identification and thus may be unrepresentative for their actual prevalence; the current data can only be taken as indicative for frequencies of main species. Unfortunately only limited clinical data were available for the present set of strains (not shown). Proof of clinical significance of a number of species thus has to be judged from future case reports. Epidemics caused by these species have not been observed, but repeated reports of pseudoepidemics due to contaminated fluids have been published (2, 33, 34). In the large set of strains analyzed for this study, 12 of the 17 known invasive species were encountered, with the exception of E. castellanii, E. moniliae, E. nishimurae, E. salmonis, and E. pisciphila. Exophiala dermatitidis, and two segregants of E. jeanselmei, viz. E. xenobiotica and E. oligosperma, are the three major agents of mycoses caused by Exophiala species. In the present overview, the frequency of deep mycoses in the studied set of isolates is almost two-fifths (39.9%), and thus significantly higher than that of the categories of subcutaneous and superficial mycoses, and also slightly higher than that of cutaneous mycoses. Predisposing diseases or metabolic factors listed by clinicians at submission of strains include solid organ or bone marrow transplant, hematologic or nonhematologic malignancy, diabetes mellitus, and exceptionally HIV infection. Microbial contamination at injury also occurs repeatedly in immunocompetent individuals. The most frequent deep infections are those of the respiratory system, caused by E. dermatitidis, E. oligosperma, E. phaeomuriformis and E. lecanii-corni. Pulmonary infections are mostly not invasive, but probably subclinical colonization is concerned, as observed in patients with cystic fibrosis (CF) (18, 24). In Europe, this is one of the preponderant clinical pictures by Exophiala species, particularly E. dermatitidis (18, 24). This fungus occurs with a frequency of 2-8% in susceptible patient population (21); similar screening has thus far not been done in the U.S.A. Cerebral infections caused by Exophiala species are very rare in the U.S.A. Until now only a single fatal case has been reported, caused by strain CDC B-6450. It concerned a contaminated steroid injection, the fungus being directly inoculated into the circulation (19). Strain R-1002 was listed as originating from human brain, but the clinical data and origin were not specified, neither whether it was a primary cerebral infection nor whether there were any predisposing conditions. In Asia, cerebral infection in healthy adolescents is a remarkable clinical syndrome. At least 11 fatal cases were reported (6, 23, 26). Primary cerebral infection

78 Spectrum of clinically relevant Exophiala species in the USA caused by E. dermatitidis appears to occur nearly only in Asian patients, the possibility of race-dependent virulence has been suggested (24). Strains of E. spinifera were mainly involved in cutaneous and subcutaneous mycoses. Outside the U.S.A. several cases of disseminated infection caused by this species have been reported (5, 31, 36, 40), in individuals without known immune disorder. The reason of the absence of systemic disease in the U.S.A. is unknown. In cutaneous sources, the recently described species E. xenobiotica appeared to be the most frequent black yeast. This species is a recent segregant of E. jeanselmei, differing at the molecular level and having a different predilected site of infection (16). Also E. dermatitidis and E. oligosperma occur in cutaneous infections. The underdiagnosis of E. xenobiotica and E. oligosperma is certainly due to recent developments in the taxonomy of black yeasts which led to the description of these taxa, after they had been deposited in reference collections, mostly either as ‘E. jeanselmei’ or ‘Exophiala sp.’ In conclusion, we suggest that black yeasts of the genus Exophiala are severely underdiagnosed in the U.S.A. In the case of occurrence of E. dermatitidis in cystic fibrosis and in stool, frequencies have been published in Europe (12, 21); data from the U.S.A. are unlikely to be different. Underdiagnosis of Exophiala in superficial and cutaneous disorders is a world wide problem, and the clinical significance of individual species is therefore hard to establish. Systemic and disseminated cases may be severe, particularly because they can take a fatal course in young and otherwise healthy individuals. The reason why the severe syndromes seem to be relatively rare in the U.S.A. is currently not understood. Most strains of Exophiala species tested appeared to be susceptible in vitro to the four widely used antifungal agents evaluated in this study except that Exophiala attenuata was resistant to amphotericin B; no significant differences were noted with different phylogenetic positions of the species concerned. Particularly low MICs were noted for posaconazole. Similar results were shown previously (3; 25, 27, 33, 39). Infections caused by Exophiala species may require a combination of surgical and medical treatment. Although amphotericin B and itraconazole, with or without additional flucytosine, are currently regarded to be efficaceous against cutaneous and subcutaneous lesions, the newer triazole agents, voriconazole and posaconazole, expand the therapeutic options for these mycoses. The clinical outcome in deep infection, however, is dismal (6, 7, 29, 23, 26; 33, 35). Improvement

79 Chapter 4 may be expected, as posaconazole has shown striking effects in a case of disseminated infection (31).

Acknowledgements A. H. G. Gerrits van den Ende and K. F. Luijsterburg are thanked for technical assistance, and R. C. Summerbell for comments on the text. E. H. Thompson and J. Ruiz are thanked for their morphological identification and antifungal susceptibility testing, respectively. This work was carried out with a grant provided by Pfizer Inc.

References 1. Al-Obaid, I., S. Ahmad, Z.U. Khan, B. Dinesh, and H. M. Hejab. 2006. Catheter- associated fungemia due to Exophiala oligosperma in a leukemic child and review of fungemia cases caused by Exophiala species. Eur. J. Clin. Microbiol. Infect. Dis. 25:729-32. 2. Anon. 2002. Exophiala infection from contaminated injectable steroids prepared by a compounding pharmacy – United States, July-November 2002. JAMA 289:291-3.

3. Blaschke-Hellmessen, R. 1996. and itraconazole susceptibility testing with clinical yeast isolates and algae of the genus Prototheca by means of the Etest. Mycoses 39 Suppl 2:39-43. 4. Bossler, A. D., S. S. Richter, A. J. Chavez, S. A. Vogelgesang, D. A. Sutton, A. M. Grooters, M. G. Rinaldi, G. S. de Hoog, and M. A. Pfaller. 2003. Exophiala

oligosperma causing olecranon bursitis. J. Clin. Microbiol. 41:4779-82. 5. Campos-Takaki, G. M., and M. L. Jardim. 1994. Report of chronic subcutaneous

abscesses caused by Exophiala spinifera. Mycopathologia 127:73-76. 6. Chang C. L, D. S. Kim, D. J. Park, H. J. Kim, C. H. Lee, and J. H. Shin. 2000. Acute cerebral phaeohyphomycosis due to Wangiella dermatitidis accompanied by cerebrospinal fluid eosinophilia. J. Clin. Microbiol. 38:1965-6.

80 Spectrum of clinically relevant Exophiala species in the USA

7. Clancy, C. J., J. R. Wingard, and M. Hong Nguyen. 2000. Subcutaneous phaeohyphomycosis in transplant recipients: review of the literature and demonstration of in vitro synergy between antifungal agents. Med. Mycol. 38:169-75. 8. Clinical and Laboratory Standards Institute. 2002. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi; approved standard M38- A. Clinical and Laboratory Standards Institute, Wayne, Pa. 9. de Hoog, G. S., J. Guarro, J. Gené, and M.J. Figueras. 2000. Atlas of Clinical Fungi, 2nd ed. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili, Utrecht / Reus, 1126 pp. 10. de Hoog, G. S., A. H. G. Gerrits van den Ende, J. M. J. Uijthof, and W. A. Untereiner. 1995. Nutritional physiology of type isolates of currently accepted species of Exophiala and Phaeococcomyces. Antonie van Leeuwenhoek 68:43-9. 11. de Hoog, G. S., and G. Haase. 1993. Nutritional physiology and selective isolation of Exophiala dermatitidis. Antonie van Leeuwenhoek 64:17-26. 12. de Hoog, G. S., T. Matos, M. Sudhadham, K. F. Luijsterburg, and G. Haase. 2005. Intestinal prevalence of the neurotropic black yeast Exophiala (Wangiella) dermatitidis in healthy and impaired individuals. Mycoses 48:142-5. 13. de Hoog, G. S., N. Poonwan, and A. H. G. Gerrits van den Ende. 1999. Taxonomy of Exophiala spinifera and its relationship to E. jeanselmei. Stud. Mycol. 43:133-42. 14. de Hoog, G. S., K. Takeo, S. Yoshida, E. Göttlich, K. Nishimura, and M. Miyaji. 1994. Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis. Antonie van Leeuwenhoek 65:143-53. 15. de Hoog, G. S., V. Vicente, R. B. Caligiorne, S. Kantarcioglu, K. Tintelnot, A. H. G. Gerrits van den Ende, and G. Haase. 2003. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J. Clin. Microbiol. 41:4767-78. 16. de Hoog, G. S., J. S. Zeng, M. J. Harrak and D. A. Sutton. 2006. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie van Leeuwenhoek. 90:257-68 17. de Rijk, P. and R. de Wachter. 1993. DCSE v. 2.54, an interactive tool for sequence alignment and secondary structure research. Comput. Appl. Biosci. 9:735–40.

81 Chapter 4

18. Diemert, D., D. Kunimoto, C. Sand, and R. Rennie. 2001. Sputum isolation of Wangiella dermatitidis in patients with cystic fibrosis. Scand. J. Infect. 33:777-9. 19. Engemann, J., K. Kaye, G. Cox, J. Perfect, W. Schell, S. A. McGarry, K. Patterson, S. Edupuganti, P. Cook, W. A. Rutala, D. J. Weber, K. K. Hoffmann, J. Engel, S. Young, E. Durant, K. McKinnon, N. Cobb, L. Bell, J. Gibson, D. Jernigan, M. Arduino, S. Fridkin, L. Archibald, L. Sehulster, J. Morgan, R. Hajjeh, M. Brandt, D. Warnock, and W. A. Duffus. 2002. Exophiala infection from contaminated injectable steroids prepared by a compounding pharmacy-United States,

July-November 2002. MMWR Morb Mortal Wkly Rep 51:1109-12. 20. Gerrits van den Ende, A. H. G., and G. S. de Hoog. 1999. Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana. Stud. Mycol.

43:151-62. 21. Haase, G., H. Skopnik, T. Groten, G. Kusenbach, and H. G. Posselt. 1991. Long- term fungal cultures from patients with cystic fibrosis. Mycoses 34:373-6. 22. Haase, G., L. Sonntag, B. Melzer-Krick, and G. S. de Hoog. 1999. Phylogenetic interference by SSU-gene analysis of members of the Herpotrichiellaceae with special reference to human pathogenic species. Stud. Mycol. 43:80-97. 23. Hiruma M, A. Kawada, H. Ohata, Y. Ohnishi, H. Takahashi, M. Yamazaki, A. Ishibashi, K. Hatsuse, M. Kakihara, and M. Yoshida. 1993. Systemic phaeohyphomycosis caused by Exophiala dermatitidis. Mycoses 36:1-7. 24. Horré, R., K. P. Schaal, R. Siekmeier, B. Sterzik, G. S. de Hoog, and N. Schnitzler. 2004. Isolation of fungi, especially Exophiala dermatitidis, in patients suffering from cystic fibrosis. A prospective study. Respiration 71:360-6. 25. Li, D., R. Li, D. Wang, and S. Ma. 1999. In vitro activities of five antifungal agents against pathogenic Exophiala species. Chin. Med. J. 112:484-8. 26. Matsumoto, T., T. Matsuda, M. R. McGinnis, and L. Ajello. 1993. Clinical and mycological spectra of Wangiella dermatitidis infections. Mycoses 36:145-55. 27. Meletiadis, J., J. F. Meis, G. S. de Hoog, and P. E. Verweij. 2000. In vitro susceptibilities of 11 clinical isolates of Exophiala species to six antifungal drugs. Mycoses 43:309-12.

82 Spectrum of clinically relevant Exophiala species in the USA

28. Murray, I. G., G. E. Dunkerley, and K. E. A. Hughes. 1964. A case of Madura foot caused by Phialophora jeanselmei. Sabouraudia 3:175-7. 29. Myoken, Y., T. Sugata, Y. Fujita, T. Kyo, M. Fujihara, M. Katsu, and Y. Mikami. 2003. Successful treatment of invasive stomatitis due to Exophiala dermatitidis in a

patient with acute myeloid leukemia. J. Oral. Pathol. Med. 32:51-4. 30. Naka, W., T. Harada, T. Nishikawa, and R. Fukushiro. 1986. A case of : with special reference to the mycology of the isolated Exophiala jeanselmei. Mykosen 29:445-52. 31. Negroni, R., S. H. Helou, N. Petri, A. M. Robles, A. Arechavala, and M. H. Bianchi. 2004. Case study: posaconazole treatment of disseminated phaeohyphomycosis due to Exophiala spinifera. Clin. Infect. Dis. 38:15-20. 32. Neumeister, B., T. M. Zollner, D. Krieger, W. Sterry, and R. Marre. 1995. Mycetoma due to Exophiala jeanselmei and Mycobacterium chelonae in a 73-year-old man with idiopathic CD4+ T lymphocytopenia. Mycoses 38:271-6. 33. Nucci, M., T. Akiti, G. Barreiros, F. Silveira, S. G. Revankar, D. A. Sutton, and T. F. Patterson. 2001. Nosocomial fungemia due to Exophiala jeanselmei var. jeanselmei and a Rhinocladiella species: newly described causes of bloodstream infection. J. Clin. Microbiol. 39:514-8. 34. Nucci, M., T. Akiti, G. Barreiros, F. Silveira, S. G. Revankar, B. L. Wickes, D. A. Sutton, and T. F. Patterson. 2002. Nosocomial outbreak of Exophiala jeanselmei fungemia associated with contamination of hospital water. Clin. Infect. Dis. 34:1475- 80. 35. Padhye, A. A., A. A. Hampton, M. T. Hampton, N. W. Hutton, E. Prevost-Smith, and M. S. Davis. 1996. Chromoblastomycosis caused by Exophiala spinifera. Clin. Infect. Dis. 22:331-5. 36. Rajendran, C., B. K. Khaitan, R. Mittal, M. Ramam, M. Bhardwaj, and K. K. Datta. 2003. Phaeohyphomycosis caused by Exophiala spinifera in India. Med. Mycol. 41:437-41. 37. Tintelnot, K., G. S. de Hoog, E. Thomas, W.-I. Steudel, K. Huebner, and H. P. R. Seeliger. 1991. Cerebral phaeohyphomycosis caused by an Exophiala species. Mycoses 34:239-44.

83 Chapter 4

38. Van de Peer, Y. and R. De Wachter. 1994. Treecon for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput. Appl. Biosci. 10:569–570. 39. Vitale, R. G., and G. S. de Hoog. 2002. Molecular diversity, new species and antifungal susceptibilities in the Exophiala spinifera clade. Med. Mycol. 40:545-56. 40. Wang, D., R. Li, X. Wang, and W. Dai. 1987. Studies on three strains of Exophiala spinifera. Acta Mycol. Sin. 6:229-32.

84 Chapter 5

Phylogeny of the Exophiala spinifera clade using multilocus sequence data and exploring phylogenetic species concept

J.S. Zeng1, 2, 3, M.J. Harrak1, 2, A.H.G. Gerrits van den Ende1 and G.S. de Hoog1, 2

1Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P.O. Box 85167, NL- 3508 AD Utrecht, The Netherlands 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands 3Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, Jiefang Dadao 1277, Wuhan, Hubei, P.R. China

Submitted to Studies in Mycology in April, 2007

Key words: black yeasts, Exophiala, phylogeny, sexuality, clonality

85 Chapter 5

Abstract Taxonomy of black yeast-like fungi until recently was mainly based on sequence diversity of the Internal Transcribed Spacer (ITS) region of ribosomal DNA (rDNA) gene. To confirm species delimitations in the Exophiala spinifera clade, four independent genes were analysed and phylogenetic trees were reconstructed using different algorithms. Reproductive isolation within the clade and reproductive modes of species involved were also determined in order to explore specific borderlines with Genealogical Concordance Phylogenetic Species Recognition (GCPSR) criterion. Sequences of the ITS region, partial Elongation Factor 1-α (EF 1-α), β-Tubulin (β-TUB) and Actin (ACT) genes were analysed for a set of 156 strains belonging to the E. spinifera clade. Phylogenetic reconstruction was performed using Neighbour-Joining (NJ), Maximum Parsimony (MP) and Bayesian Analysis (BA) to evaluate the concordance of topologies obtained under different optimization criteria. The incongruence among lineages was detected by Partition Homogeneity Test (PHT). Reproductive isolation and modes were tested by measuring index of differentiation (theta, ө) and Index of Association (IA). Though the tree topologies were not completely identical when different algorithms were used, 4 gene lineages were nearly congruent and the trees of the combined multilocus data set did not provide more phylogenetic information than those of separate data sets. The phylogenetic relationship of species in the clade was also nearly identical to that based on the sequences of 18S of rDNA gene in previous studies. E. xenobiotica de Hoog. segregated from the other species at a large distance. The remaining species clustered in a single large clade, but phylogenetic relationships within the clade varied among loci and had poor statistical supports. Most Exophiala species analysed in this study were clonal. No novel species was discovered. In conclusion, ITS sequence data are basically reliable for phylogenetic reconstruction and identification of species in this clade. It is a candidate for genetic barcoding of Exophiala species.

Introduction Black yeasts belonging to the genus Exophiala J.W. Carmich are notoriously difficult to classify and identify. In the past, diagnostic schemes were morphological, while later some physiological parameters proved to be useful (de Hoog & Haase 1993, de Hoog et al. 1995).

86 Phylogeny of Exophiala spinifera clade

The majority of species, however, is morphologically diverse, caused by their passage through complicated life cycles where diagnostic features are variably expressed , and, conversely, very similar microscopic structures can be expressed in phylogenetically remote species. In recent years diagnostics has been supplemented by molecular tools, particularly sequence data of the Internal Transcribed Spacer (ITS) region of ribosomal DNA (rDNA) gene (Tintelnot et al. 1991, de Hoog et al. 1999, de Hoog et al. 2003). The Exophiala spinifera clade as determined by 18S rDNA sequences (Haase et al. 1999) contains some common species, comprising more than 40% of clinical agents of Exophiala species known to date (Zeng et al. 2007), e.g. E. xenobiotica de Hoog, E. oligosperma Calendron ex de Hoog & Tintelnot, E. jeanselmei (Langeron) McGinnis & A.A. Padhye and E. spinifera (H.S. Nielsen & Conant) McGinnis. In the pre-molecular era E. xenobiotica and E. oligosperma were identified under the name E. jeanselmei. The predilections and clinical pictures of newly defined species on average are different from each other (Zeng et al. 2007), and thus the entities are clinically significant, but morphological characters for identification are scant. Today, an essential parameter for species delimitation in addition to sequences of 18S and the ITS region of rDNA gene (de Hoog et al. 1999, Vitale & de Hoog 2002, de Hoog et al. 2003) is the occurrence of recombination, as suggested from comparisons of multiple gene genealogies (Genealogical Concordance Phylogenetic Species Recognition, GCPSR). This criterion has been proved helpful for fungal species recognition elsewhere (Koufopanou et al. 1997, Geiser et al. 1998, Kasuga et al. 1999). Supplementing data on molecular biodiversity in a limited part of the E. spinifera clade with multilocus sequencing (de Hoog et al. 2006), we aim to demonstrate whether ITS sequence is a sufficient parameter and species thus distinguished fulfil the criterion of GCPSR .

Materials and Methods Fungal strains A total of 156 strains belonging to E. spinifera clade were analysed (Table 1). They were deposited in the culture collection of the Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre (CBS) and the Fungus Testing Laboratory in the Department of

87 Chapter 5

Table 1. Source of strains tested GenBank accession nr. species name strain number region source ITS ACT Bt EF E. jeanselmei CBS 677.76 UK mycetoma AY163553 EF551470 EF551503 EF551532 CBS 119095 USA foot skin UTHSC R-2968 USA skin scraping UTHSC 88-402 USA skin UTHSC 94-28 USA knee EF025410 EF551471 EF551504 EF551528 UTHSC 01-2688 USA finger UTHSC R-3338 USA foot EF025411 EF551472 EF551505 EF551529 CBS 117.86 Japan mycetoma (isolated from CBS 116.86) CBS 116.86 Japan mycetoma CBS 507.90 (T) Uruguay mycetoma AY156963 EF551468 EF551501 EF551530 CBS 528.76 USA skin AY857530 EF551469 EF551502 EF551531 UTHSC R-2666 Australia ankle UTHSC R-1922 USA foot lesion biopsy CBS 109635 USA arm lesion E. nishimurae CBS 101538 (T) Venezuela bark (isolated from IFM 41855) AY163560 EF551463 EF551506 EF551523 E. oligosperma CBS 725.88 (T) Germany / Philippines sphenoid AY163551 EF551474 EF551508 EF551534 dH 12971 Finland insulation material dH 13019 Spain toluene dH 13308 Austria steambath dH 12236 Ukraine forest litter UTHSC 97-2226 Brazil human UTHSC 96-2015 USA duodenal aspirate UTHSC 93-271 USA maxillary sinus UTHSC 93-2599 USA spleen UTHSC 92-2007 USA lung autopsy EF025414 EF551476 EF551510 EF551535 UTHSC R-768 USA skin UTHSC 94-1531 USA knee tissue UTHSC 97-474 USA throat UTHSC 98-697 USA valve (heart?) EF025413 UTHSC 92-85 USA maxillary sinus UTHSC 02-2072 USA lung UTHSC R-680 USA subcutaneous lesion UTHSC 01-593 USA lung UTHSC 04-46 USA sputum UTHSC 01-2053 USA tissue UTHSC 93-2598 USA lung tissue UTHSC 93-2310 USA lymph node UTHSC 94-1756 USA pleural fluid UTHSC 94-2548 USA lung UTHSC 89-254 USA human UTHSC 01-1205 USA pleural fluid UTHSC 00-1921 USA foot dH 13321 Austria sauna floor CBS 115966 Netherlands process water dH 13304 Austria sauna dH 13314 Austria steambath dH 13320 Austria steambath UTHSC 91-870 USA hand EF551458 EF551475 EF551509 EF551537 UTHSC 02-45 USA animal UTHSC 01-597 USA nail dH 13579 Austria steambath floor UTHSC 95-2350 USA middle finger EF025386 EF551478 EF551512 EF551538 CBS 109807 Brazil fungemia UTHSC R-2997 Brazil human UTHSC R-3000 Brazil human UTHSC R-2999 Brazil human UTHSC R-2998 Brazil human UTHSC R-2977 Brazil human UTHSC R-2976 Brazil human UTHSC R-2993 Brazil human UTHSC R-2989 Brazil human UTHSC R-2991 Brazil human UTHSC R-2987 Brazil human UTHSC R-2979 Brazil human UTHSC R-2981 Brazil human UTHSC R-2984 Brazil human UTHSC R-2980 Brazil human UTHSC 88-209 USA lymph node UTHSC R-2975 Brazil human UTHSC R-2988 Brazil human UTHSC R-2995 Brazil human CBS 265.49 France honey AY163555 EF551473 EF551507 EF551536 UTHSC R-2996 Brazil human UTHSC 95-416 USA foot lesion UTHSC 95-2041 USA foot lesion EF025415 EF551477 EF551511 EF551533 UTHSC 96-968 USA leg CBS 537.76 Italy human CBS 538.76 unknown branchus CBS 634.69 Baltic Sea wood, ship resting at sea bottom (to be continued)

88 Phylogeny of Exophiala spinifera clade

Table 1. Source of strains tested (continued) GenBank accession nr. species name strain number region source ITS ACT Bt EF E. spinifera CDC B-5383 USA elbow lesion UTHSC R-1443 UK phaeohyphomycotic cyst CBS 194.61 India systemic mycosis CBS 101537 Venezuela cactus CBS 236.93 Germany apple juice CBS 269.28 Germany skin CBS 356.83 Egypt skin AJ244246 EF551480 EF551514 EF551540 CBS 425.92 Germany apple juice EF551459 EF551481 EF551515 EF551539 CBS 101644 USA maize kernel EF551460 EF551479 EF551513 EF551543 CBS 899.68 (T) USA nasal granuloma AY156976 EF551482 EF551516 EF551541 CBS 110628 Venezuela bark UTHSC R-2959 China human UTHSC R-773 USA human UTHSC R-2955 USA human UTHSC 88-15 USA human EF025419 EF551483 EF551517 EF551542 UTHSC R-2870 USA subcutaneous cyst EF025418 UTHSC 91-188 USA upper thigh EF025417 EF551484 EF551518 EF551544 UTHSC 97-2073 USA skin EF025416 CBS 667.76 Uruguay fallen palm CBS 670.76 Uruguay nest of Anumbis anumbi CBS 102179 Senegal skin E. xenobiotica CBS 117650 USA arm abscess CBS 117641 USA knee cyst DQ182591 EF551485 DQ182575 DQ182583 CBS 117655 USA buttock CBS 117676 USA finger DQ182592 EF551492 DQ182576 DQ182584 CBS 117649 USA wound CBS 117654 USA total knee CBS 204.50 Switzerland apple juice CBS 117671 USA eye vitreous tab CBS 117662 USA leg tissue CBS 117648 USA sclera EF025407 EF551487 EF551519 EF551545 CBS 117646 USA finger CBS 118157 (T) Venezuela oil-spilled soil DQ182587 EF551493 DQ182571 DQ182579 CBS 117669 USA cyst in elbow CBS 117667 USA arm biopsy CBS 642.82 Australia treated Eucalyptus pole CBS 102455 Brazil eye CBS 119306 USA animal CBS 117674 USA blood DQ182589 EF551491 DQ182573 DQ182581 CBS 117647 USA wrist wound CBS 101271 Netherlands skin CBS 522.76 UK timber CBS 117754 Germany benzene-contaminated ground water CBS 117672 USA scalp CBS 117673 USA scalp DQ182590 EF551490 DQ182574 DQ182582 CBS 117753 USA leg wound CBS 648.76A Canada sputum CBS 718.76 Canada foot CBS 117661 USA eye vitreous fluid CBS 117652 USA human CBS 117657 USA knee tissue CBS 117665 USA tissue DQ182588 EF551489 DQ182572 DQ182580 CBS 117645 USA human CBS 117651 USA forearm CBS 117659 USA human CBS 117644 USA foot abscess CBS 117658 USA dialysis fluid CBS 117663 USA forearm CBS 102606 USA bathroom CBS 527.76 Sweden culture contaminant of Hyphodontia breviseta , on Picea abies CBS 117235 USA sputum CBS 117656 USA foot sinus CBS 117642 USA foot wound DQ182593 EF551486 DQ182577 DQ182585 CBS 117675 USA great toe CBS 117643 USA hand CBS 117653 USA peritoneal dialysis fluid DQ182594 EF551488 DQ182578 DQ182586 E. exophialae CBS 101542 Colombia soil AY156967 EF551465 EF551498 EF551527 CBS 671.76 Uruguay nest AY156975 EF551467 EF551500 EF551525 CBS 668.76 (T) Uruguay Dasypus septemcinctus , straw in burrow, armadillo AY156973 EF551466 EF551499 EF551526 Ramichloridium basitonum CBS 101460 (T) Japan skin AY163561 EF551494 EF551520 EF551546 Rhinocladiella similis dH 14724 Austria industrial indoor air dH 13054 Slovenia CSF AY857529 EF551496 EF551522 EF551547 UTHSC R-2978 USA human UTHSC R-3002 USA human UTHSC R-3003 USA human CBS 116299 France aspirate of bronchus CBS 111763 (T) Brazil foot lesion EF551461 EF551495 EF551521 EF551548 Exophiala bergeri CBS 353.52 (T) Canada skin EF551462 EF551464 EF551497 EF551524 CBS: CBS Fungal Biodiversity Centre, Utrecht, the Netherlands; UTHSC: University of Texas Health Science Center, San Antonio, TX, USA; CDC: Centers for Disease Control and Prevention, Atlanta, USA; dH: working number of strains in Department of Ecology of Clinical Fungi in Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, the Netherlands T: type culture of a species

89 Chapter 5

Pathology at the University of Texas Health Science Center at San Antonio, Texas, U.S.A. (UTHSC). Strains were identified morphologically and genetically on the basis of sequences of the ITS region of rDNA gene. The ex-type strain of E. bergeri Haase & de Hoog CBS 353.52 was used as outgroup strain for phylogenetic analysis.

DNA extraction About 1 cm2 of fungal material was transferred to a 2 mL Eppendorf tube containing a 2:1 (w/w) mixture of silica gel and Celite (silica gel H, Merck 7736/Kieselguhr Celite 545, Machery) and 300 μL TES buffer. The fungal material was ground with a micropestle for 1-2 min. Volume was adjusted by adding 200 μL TES buffer. After vigorous shaking and adding 10 μL 10 mg/mL Proteinase K to the tube, the mixture was incubated at 65 °C for 10 min. The salt concentration was raised by adding 140 μL 5 M NaCl solution. One-tenth volume (~65 μL) cetyltrimethylammonium bromide (CTAB) buffer 10% was put to the mixture, followed by incubation for another 30 min at 65 °C. One volume (~700 μL) chloroform- isoamylalchohol (v/v = 24/l) was added and mixed carefully by hand. After being incubated 30 min at 0 ºC (on ice water) and centrifugated at 14,000 r.p.m. at 4 °C for 10 min, the toplayer was transferred to a clean Eppendorf tube. The sample mixed with 225 µl 5M NH4- acetate was incubated for at least 30 min on ice water and spun again. The supernatant was transferred to a clean sterile Eppendorf tube and mixed with 0.55 volume (~510 µl) ice-cold isopropanol. After being spun 7 min at 14,000 r.p.m. at 4 ºC (or room temperature), the supernatant was decanted. The pellet was washed with ice-cold ethanol 70% twice and dried using a vacuum dryer for 10 min. The powder was re-suspended in 48.5 µl TE-buffer with 1.5 µl 10 mg/mL RNase, incubated at 37 ºC for 15-30 min and stored at –20 ºC until used.

DNA amplification and sequencing PCR was performed in 50 μL volume of a reaction mixture containing 10 mM Tris HCl, pH

8.3, 50 mM KCl, 1.5 mM MgCl2·6H2O, 0.01% gelatin, 200 mM of each deoxynucleotide triphosphate, 25 pmol of each primer (50 pmol for each degenerated primer), 10-100 ng rDNA and 0.5 U Taq DNA polymerase (Sigma). Genes amplified and primer sets used are listed in Table 2. If no amplicon of a gene was obtained with a certain primer set, the other

90 Table 2 Primer sequences for PCR amplication and sequencing Gene region Primer name Primer sequence (5'->3') reference ITS ITS1 TCC GTA GGT GAA CCT GCG G White et al. 1990 ITS4 TCC TCC GCT TAT TGA TAT GC White et al. 1990 V9G TTA CGT CCC TGC CCT TTG TA de Hoog et al. 1998 LS266 GCAT TCC CAA ACA ACT CGA CTC Masclaux et al. 1995 EF 1-α EF1-728F CAT CGA GAA GTT CGA GAA GG Carbone et al. 1999 EF1-986R TAC TTG AAG GAA CCC TTA CC Carbone et al. 1999 β-TUB Bt-2a GGT AAC CAA ATC GGT GCT GCT TTC O'Donnell et al. 2000 Bt-2b ACC CTC AGT GTA GTG ACC CTT GGC O'Donnell et al. 2000 T2 TAG TGA CCC TTG GCC CAG TTG O'Donnell et al. 2000 ACT ACTfw TCT TCG AGA CCT TCA ACG CC Okeke et al. 2001 ExenoACTfw TTC TCT CYC TGT ACG CTT C this study EspACTfw CAC GTT GTC CCC ATC TAC this study ACTbw AAG CCA CCG ATC CAG ACG this study ITS: internal transcribed spacer region of ribosomal DNA; EF 1-α : partial elongation factor 1-α gene; β-TUB: partial β-tubulin gene; ACT: partial actin gene. combinations of primers were tried. Amplification was performed in GenAmp PCR System 9700 (Applied Biosystems, Foster City, U.S.A.) thermocycler as follows: 95 °C for 4 min, followed by 35 cycles consisting of 94 °C for 45 sec, 52 °C for 30 sec and 72 °C for 2 min, and a delay at 72 °C for 7 min. Annealing temperature was changed to 55 and 58 °C, respectively when amplifying partial Elongation Factor 1-α (EF 1-α ) and β-Tubulin (β-TUB) genes. Amplicons were cleaned with GFX columns (GE Healthcare UK Ltd., Buckinghamshire, England). For each of the two primers separately, sequencing PCR using 1 μL template DNA (1-10 ng), 3 μL dilution buffer, 1 μL BigDye v3.1, 1 μL of 4 pmol primer (8 pmol for degenerated primer) filled with 4 μL MilliQ water to a final volume of 10 μL, was performed as follows: 95 °C for 1 min, followed by 30 cycles consisting of 95 °C for 10 sec, 50 °C for 5 sec and 60 °C for 2 min. Reaction products were purified with Sephadex G-50 Fine (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) and analysed using ABI PRISM 3730xl DNA Analyzer (Applied Biosystems, Foster City, U.S.A.).

Alignment and phylogenetic reconstruction The sequences were adjusted using the program SeqMan Π of Lasergene software (DNASTAR, Inc., Wisconsin, U.S.A.) and aligned iteratively using Ward’s averaging in the BioNumerics package v. 4.0 (Applied Maths, Kortrijk, Belgium). Nearest neighbours were found by local Blast searches. We performed phylogenetic reconstructions for each locus separately using Neighbour-Joining (NJ) and Maximum Parsimony (MP) implemented in PAUP v. 4.0b10 (Swofford 2000), and Bayesian analysis (BA) with MrBayes v. 3.1.1

91 Chapter 5

(Ronquist & Huelsenbeck 2003) to evaluate the concordance of topologies obtained under different optimization criteria. Kimura-2 correction and 100 Bootstrap replicates were used for NJ analysis. Bootstrap values > 50 of 100 resampled data sets were shown on phylogenetic trees. MP heuristic search was performed for each data set with 100 random taxon additions and Tree Bisection and Reconstruction (TBR) as the branch swapping algorithm. Branches of zero- length were collapsed and all multiple, equally parsimony trees were saved. The robustness of the resulting phylogenetic tree was evaluated by 100 bootstrap replications and every replication used a maximum of 500 trees. The congruence of gene genealogies was assessed using the Partition Homogeneity Test (PHT) in PAUP v. 4.0b10 (Swofford 2000) based on sequences of 4 loci using only parsimony-informative sites with 1000 replicates with random additions. Modeltest v 3.7 (Posada & Crandall 1998) was used to choose evolutionary models of DNA substitution for BA analyses using a hierarchical hypothesis-testing. According to Akaike Information Criterion (AIC) (Akaike 1974, Posada & Buckley 2004), Modeltest determined that the SYM model (Zharkikh 1994) was the best fit for the ITS data set, K80 (Kimura 1980) for EF 1-α, HKY (Hasegawa et al. 1985) for β-TUB and TrN (Tamura & Nei 1993) for partial Actin (ACT) gene including invariable sites (+I) and rate variation among sites (+G) in each model. By default, MrBayes performed two simultaneous, completely different runs, starting from different random trees. In each of 2 runs, 4 incrementally heated simultaneous Monte Carlo Markov chains (MCMC) were run over 2,000,000 generations using models of DNA substitution suggested, also assuming a portion of invariable sites with gamma-distributed substitution rates of the remaining sites (+I+G), random starting trees, and default starting parameters of the DNA substitution model. Trees were sampled every 100 generations, resulting in an overall sampling of 20,000 trees. MrBayes discarded the first 25% trees sampled in each of two MCMC runs and a consensus topology was created with all the remaining trees. The BA analysis of the combined data set was run with individual DNA substitution model for each of the 4 genes as selected by Modeltest, each of which was the same model used for subset BA analysis. The BA analyses of different data sets were repeated 2 times separately to test the reproducibility of the results.

92 Phylogeny of Exophiala spinifera clade

67/54

E. oligosperma

UTHSC 91-870 UTHSC 95-2350 93/ dH13579 UTHSC 01-597 UTHSC 02-45

UTHSC 95-416 99/94 UTHSC 96-968 UTHSC 95-2041

68/68 91/70

61/61 E. spinifera 92/93 96/79 CBS 670.76 63/81 CBS 667.76 CBS 102179

93/58 /71 88/90 90/86 CBS 668.76 E. exophialae 99/99 Rh. similis

96/99 67/ 93/82 E. jeanselmei 94/97 70/75 93/77 100/100 R. basitonum CBS 101538 E. nishimurae

56/67

51/70 /59

97/97 E. xenobiotica

91/95 CBS 101271

63/58

59/ 99/91 99/100 CBS 353.52 E. bergeri

Fig. 1. A 50% majority rule consensus tree from Bayesian analysis (BA) of 157 taxa of E. spinifera clade (Haase et al. 1999) and E. bergeri based on ITS region sequences of rDNA. Terminal clades are collapsed, taxon numbers are omitted except those mentioned in the text, and clades of same species are indicated in identical colour. The supporting values for concordant clades on trees from 3 algorithms are exhibited. Thickened lines indicate branches with more than 80% of a posterior probability from BA. Numbers on branches are bootstrap values greater than 50% shown as first number from Neighbour-joining (NJ) and second from maximum parsimony (MP) analyses. The values greater than 80 are in blot. E. bergeri CBS 353.52 is treated as outgroup taxon.

93 Chapter 5

/68

/60 E. oligosperma

UTHSC 01-597

UTHSC 91-870 /57 UTHSC 95-2350 dH13579 UTHSC 02-45 UTHSC 95-416 UTHSC 96-968 UTHSC 95-2041 E. nishimurae CBS 101538 CBS 667.76 0.97/91 CBS 670.76 E. spinifera

1.00/100

1.00/96 CBS 668.76 E. exophialae CBS 102179 1.00/94

0.99/98 0.79/68 E. jeanselmei /53 1.00/96 0.67/

1.00/100 Rh. similis 1.00/91 R. basitonum

0.95/62

0.86/65 E. xenobiotica 1.00/91

/100 0.98/87 1.00/100

1.00/98

0.63/52 1.00/100 0.99/93 0.51/

0.78/ 1.00/69 CBS 101271

CBS 353.52 E. bergeri

Fig. 2. A 50% majority rule consensus tree from Neighbour-joining (NJ) of 157 taxa of E. spinifera clade (Haase et al. 1999) and E. bergeri based on partial Elongation Factor 1-α (EF 1-α ) gene sequences. Kimura-2 correction and100 Bootstrap replicates were used for NJ analysis. Terminal clades are collapsed, taxon numbers are omitted except those mentioned in the text, and clades of same species are indicated in identical colour. The supporting values for concordant clades on trees from 3 algorithms are exhibited. Thickened lines indicate branches with a bootstrap value more than 80% from NL. Numbers on branches before slashes are posterior probabilities > 50% (shown as desimals) from Bayesian analysis (BA), and those after slashes are bootstrap values >50% from maximum parsimony (MP) analysis. The values greater than 80% are in blot. E. bergeri CBS 353.52 is treated as outgroup taxon.

94 Phylogeny of Exophiala spinifera clade

The phylogenetic trees were printed with TreeView v. 1.6.6 (Page 1996) and edited with FigTree v. 1.0 (http://evolve.zoo.ox.ac.uk/software/figtree).

Analysis of reproductive isolation and mode

Using MULTILOCUS v. 1.2.2 (http://www.bio.ic.ac.uk/evolve/software/multilocus) software, population differentiation (index: ө) was detected among strongly supported clades of E. oligosperma, E. xenobiotica, E. jeanselmei, Rhinocladiella similis de Hoog & Caligiorne and Ramichloridium basitonum de Hoog and on an E. spinifera subclade (= E. spinifera, E. nishimurae Vitale & de Hoog and E. exophialae (de Hoog) de Hoog) using combined genotype data sets. Population differentiation was also tested within the E. spinifera subclade. The null hypothesis for this analysis is no differentiation. If ө is significantly different from that of a random data set (p < 0.05), population differentiation is considered. To test for reproductive modes in above clades or species, the Index of Association (IA, a measure of multi-locus linkage disequilibrium) was calculated with the same software. The null hypothesis for this analysis is complete panmixia. The values of IA were compared between observed and randomized data sets. The hypothesis would be rejected when p < 0.05.

Results A total of 4 locus sequences of 157 isolates were included in the comparison. Of the 1710 nucleotides involved, 626 characters (36.6%) were parsimony informative. The lowest number was 91 (17.1%) in the ITS region, and the highest was 203 (50.6%) in the ACT region.

Topologies resulting from different algorithms Three ITS region phylogenetic trees had similar resolutions and topologies with all algorithms used. Strains of every species formed a monophyletic clade in each tree except E. oligosperma in the MP tree, where eight isolates (UTHSC 95-416, UTHSC 96-968, UTHSC 95-2041, UTHSC 91-870, UTHSC 95-2350, dH 13579, UTHSC 01-597 and UTHSC 02-45) were located at a position distant from the remaining strains. Values of clade support are summarized in the BA tree (Fig. 1). Resolution of trees of the partial EF 1-α gene became lower with NJ, MP and BA, in this order. The monophyletic groups of E. xenobiotica, E.

95 Chapter 5 oligosperma, E. jeanselmei and E. spinifera were not strongly supported in the trees (Fig. 2). E. nishimurae was not distinguishable from E. spinifera. The BA tree of the partial β-TUB gene (Fig. 3) showed similar topology as the NJ and MP trees, but with higher resolution. E. xenobiotica and E. oligosperma clades in all trees and E. jeanselmei clade in the BA tree proved to be polyphyletic. E. nishimurae, CBS 101538 was embedded within E. spinifera. E. spinifera CBS 670.76, CBS 667.76 and E. exophialae CBS 668.76 formed a highly supported clade even far from the E. xenobiotica clade in all trees (Fig. 3). Among trees of the partial ACT gene, the BA tree yielded most phylogenetic information. Only E. xenobiotica and E. jeanselmei clades were paraphyletic in all trees (Fig. 4). E. nishimurae was located within E. spinifera. Monophyletic clades of the other species were strongly supported except E. oligosperma in the NJ and MP trees. Topology of the BA tree of combined data set (Fig. 5) was similar to that of the MP tree (not shown), but the MP tree was less resolved than the BA tree.

Topologies of different genes Strains of different species formed independent clades in ITS trees, with high value support except E. xenobiotica comprising two well-supported branches (Fig. 1). With the exception of strain CBS 101271, E. xenobiotica strains composed a monophyletic clade in every gene tree. Though E. oligosperma strains formed a monophyletic clade in the ITS, EF and ACT trees, only in the ITS tree the clade was strongly supported. Conversely, isolates of E. spinifera and E. nishimurae mixed to form a separate clade in all gene trees except the ITS tree. E. spinifera CBS 102179 in the EF tree, and CBS 670.76 and CBS 667.76 in the β-TUB tree were distant from the clade. E. exophialae clade is nearest neighbour of E. spinifera and monophyletic in all trees except in the β-TUB tree. Rhinocladiella similis always showed as an independent clade with robust support in all gene trees. E. jeanselmei consisted of 2 clades with strong support. In the ITS and β-TUB trees, they formed monophyletic clades with weak support. Ramichloridium basitonum was close to E. jeanselmei. The E. xenobiotica clade always separated clearly from the remaining species. Though the remaining species coalesced to a large clade, their phylogenetic relationships and evolutionary rates were variable among 4 loci (Figs 1-4).

96 Phylogeny of Exophiala spinifera clade

84/81 E. oligosperma UTHSC 01-597

100/99

71/63

UTHSC 91-870 UTHSC 95-2350 dH13579 CBS 101538 E. nishimurae 95/93 UTHSC 02-45 94/97

90/97 /88 E. spinifera

100/98 100/98 CBS 102179 100/100 /66 E. exophialae 100/100 Rh. similis

94/93

100/100 99/97 E. jeanselmei

100/100 100/100 R. basitonum 98/98 UTHSC 95-416 UTHSC 96-968 UTHSC 95-2041 97/99

E. xenobiotica /95

100/99 /74

100/100 CBS 670.76 100/100 CBS 667.76 CBS 101271 CBS 668.76 CBS 353.52 E. bergeri

Fig. 3. A 50% majority rule consensus tree from Bayesian analysis (BA) of 157 taxa of E. spinifera clade (Haase et al. 1999) and E. bergeri based on β-tubulin (β-TUB) gene sequences. Terminal clades are collapsed, taxon numbers are omitted except those mentioned in the text, and clades of same species are indicated in identical colour. The supporting values for concordant clades on trees from 3 algorithms are exhibited. Thickened lines indicate branches with more than 80% of a posterior probability from BA. Numbers on branches are bootstrap values greater than 50% shown as first number from Neighbour-joining (NJ) and second from maximum parsimony (MP) analyses. The values greater than 80 are in blot. E. bergeri CBS 353.52 is treated as outgroup taxon.

97 Chapter 5

UTHSC 91-870 UTHSC 95-2350 dH13579 UTHSC 02-45

UTHSC 95-2041

100/100 E. oligosperma

UTHSC 01-597

75/55

100/100 UTHSC 95-416 UTHSC 96-968 100/100 Rh. similis

82/55 86/66 CBS 102179 E. spinifera CBS 670.76 CBS 667.76 95/97

100/99 CBS 101538 E. nishimurae

100/100 97/95 CBS 668.76 E. exophialae 97/95

98/98 89/97 E. jeanselmei

92/83 79/61 R. basitonum CBS 101271

90/88

100/100

99/55 E. xenobiotica 99/98 88/82

55/ 90/79 97/88 100/100 91/87 82/63 /70 80/78 CBS 353.52 E. bergeri

Fig. 4. A 50% majority rule consensus tree from Bayesian analysis (BA) of 157 taxa of E. spinifera clade (Haase et al. 1999) and E. bergeri based on actin (ACT) gene sequences. Terminal clades are collapsed, taxon numbers are omitted except those mentioned in the text, and clades of same species are indicated in identical colour. The supporting values for concordant clades on trees from 3 algorithms are exhibited. Thickened lines indicate branches with more than 80% of a posterior probability from BA. Numbers on branches are bootstrap values greater than 50% shown as first number from Neighbour-joining (NJ) and second from maximum parsimony (MP) analyses. The values greater than 80 are in blot. E. bergeri CBS 353.52 is treated as outgroup taxon.

98 Phylogeny of Exophiala spinifera clade

Comparing phylogenetic tree topologies between individual data sets and combined data set Though the result of PHT showed that four gene lineages were not congruent (p = 0.001), the BA (Fig. 5) and MP (not shown) trees of the combined multi-locus data set revealed topologies similar to those of individual genes. Compared to the ITS tree, E. xenobiotica, E. spinifera and E. exophialae did not form monophyletic clades in the BA tree. E. spinifera CBS 670.76, CBS 667.76 and E. exophialae CBS 668.76 composed a clade with high value support located in the E. spinifera subclade, which merged with E. nishimurae.

Reproductive isolation and mode There was population differentiation among species (ө = 0.39, p < 0.001 of the E. spinifera subclade and the remaining species clades; ө = 0.34, p < 0.001 within the E. spinifera subclade). Except for E. exophialae and Rh. similis (IA not shown; p = 1.00 for each of the 2 species), the reproductive modes of remaining species were clonal (IA not shown; p < 0.01 for each species).

Ecology All E. jeanselmei and Ramichloridium basitonum strains came from human cutaneous and subcutaneous mycoses, while E. exophialae originated from outdoor environments. Isolations of the other species were clinical as well as environmental. The environmental sources involved indoor floor and air, plant, soil, sugary substrates, materials treated or contaminated by toxic chemicals (Tab. 1). The strains isolated from the later source are E. oligosperma and E. xenobiotica. The sources of species with a number of isolates showed worldwide distribution, mainly in the temperate zones. For most species, the strains of same species from different sources and different continents tended to cluster in subgroups within the phylogenetic trees.

Discussion Phylogenetic relationships Phylogenetic analyses of three separate partial protein-encoding genes in the E. spinifera clade revealed phylogenetic relationships similar to those based on the earlier ITS and 18S

99 Chapter 5

55 E. oligosperma

77 UTHSC 01-597

100 UTHSC 91-870 93 91 UTHSC 95-2350 80 dH13579 UTHSC 02-45 90 100 UTHSC 95-416 100 UTHSC 96-968 UTHSC 95-2041 CBS 670.76 100100 CBS 667.76 56 CBS 668.76 E. nishimurae 73 CBS 101538

E. spinifera 97 99 100 CBS 102179 90 E. exophialae 100 Rh. similis 96 96 100 100 100 69 E. jeanselmei 51 100 100

100 R. basitonum

97

90

E. xenobiotica 100

100 100 88 81 99 94 100 100 93 100

100

CBS 101271CBS 353.52 E. bergeri

Fig. 5. A 50% majority rule consensus tree from Bayesian analysis (BA) of 157 taxa of E. spinifera clade (Haase et al. 1999) and E. bergeri based on 4 gene sequences. Terminal clades are collapsed, taxon numbers are omitted except those mentioned in the text, and clades of same species are indicated in identical colour. The supporting values for concordant clades on trees from 2 algorithms are exhibited. Thickened lines indicate branches with more than 80% of a posterior probability from BA. Numbers on branches are bootstrap values greater than 50% from maximum parsimony (MP) analysis. The values greater than 80 are in blot. E. bergeri CBS 353.52 is treated as outgroup taxon.

100 Phylogeny of Exophiala spinifera clade

rDNA sequence data (de Hoog et al. 1999, Haase et al. 1999, Vitale & de Hoog 2002, de Hoog et al. 2003, 2006) and combined data sets (de Hoog et al. 2006). The tree topologies were not completely identical with different algorithms, and the four gene lineages were incongruent as indicated by PTH. Nevertheless the multilocus data set provided similar phylogenetic information to individual data sets. The individualization of E. xenobiotica within the E. spinifera clade remained robust in all trees. With phylogenetic relationships between taxa varying with loci and algorithms applied, the species other than E. xenobiotica aggregated into a large clade. The bootstrap support was mostly low. This suggests that the members of the clade had a recent common ancestor and evolved radially. The positions of E. nishimurae and E. exophialae remain unclear. When the species E. nishimurae was described, ITS sequence was the only available molecular datum (Vitale & de Hoog 2002). The ITS sequence of the single known strain of E. nishimurae CBS 101538 was clearly separate from those of E. spinifera strains, but with coding genes this isolate was found as a member of the E. spinifera subclade at high confidence. The ITS sequence of CBS 101538 thus is likely to be a paralogue. E. exophialae, described for an entity of three strains very close to but consistently separated from E. spinifera in the ITS region, was supported by the partial EF1-α and ACT gene sequences, and partially corresponded in the β-TUB gene. One of the E. exophialae strains, CBS 668.76, combined with two E. spinifera isolates (CBS 670.76 and CBS 667.76) to form a cluster, which was distant from the remaining strains of E. spinifera subclade in the β-TUB trees. Possibly this may be ascribed to β-TUB paralogues, similar to the situation in the ITS region of E. nishimurae.

Reproductive modes The reproductive modes of most Exophiala species were detected to be clonal in this study. Though the anamorphs of major Capronia teleomorphs can be predicted to belong to Exophiala (Schol-Schwarz 1968, Samuels & Müller 1978, Müller et al. 1987, Untereiner 1995, Untereiner et al. 1995, Untereiner 1997), the number of described species of Exophiala with a proven Capronia teleomorph, conspecific to or even close in morphological and physiological parameters (Haase et al. 1995, 1999, Masclaux et al. 1995, Untereiner et al. 1999) is very small. In the SSU distance tree of a selected number of members of Herpotrichiellaceae Munk (Haase et al. 1999), four out of five recognizable clades nearly

101 Chapter 5 exclusively contained anamorphs. In a split decomposition, Capronia species tended to be located at the centre of the tree individually or near the base of clades (Haase et al. 1999). It was inferred that heterothallic Capronia teleomorphs were somewhat older, while further evolutionary development might have taken place by clonal reproduction. Our findings support this hypothesis. A similar evolution of species was recently surmised for anthropophilic (Graeser et al. 2006).

Species circumscriptions The application of GCPSR confirmed nearly all species previously circumscribed on the basis of ITS sequence data; no novel or cryptic species was discovered. Multilocus data were concordant with present taxonomy. In general, GCPSR is helpful for fungal species recognition when conflict occurs among gene lineages caused by recombination among individuals within species (Planet 2006). However, when no recombination occurs among strains within taxa, i.e., when there is a preponderance of clonality, it is very difficult to determine the limit of species objectively. Since confident recombination was not revealed in our data, GCPSR failed to work for species recognition in the E. spinifera clade. Congruence of multilocus data suggested that ITS sequencing is a reliable tool for phylogenetic reconstruction and identification of species in the E. spinifera clade. Identical phylogenetic informations were repeatedly released in ITS trees in different studies (de Hoog et al. 1999, Vitale & de Hoog 2002, de Hoog et al. 2003, de Hoog et al. 2006) and similar topologies were obtained from other genes, even using different analyses. The same entities were recognized when the partial EF 1-α, β-TUB, ACT gene sequences were used, either separately or in combined data sets. Given the preponderantly clonal character of Exophiala species in the clade analysed, the ITS region is a useful candidate for diagnostics and barcoding for species of the E. spinifera clade. This suggestion may be extended to barcoding for the entire genus Exophiala. When PHT was performed with the four genes, incongruence was found, indicating evolutionary historical heterogeneity among the lineages. Normally evolutionary historical heterogeneity includes differences in evolutionary processes, such as different rates of evolution, or alternative evolutionary processes. The latter mostly concerns non-vertical inheritance, e.g. gene duplication, loss, horizontal gene transfer, hybridization or

102 Phylogeny of Exophiala spinifera clade recombination (Planet 2006). Though tests for locating incongruence among loci are available, most of them are not thoroughly tested and insufficiently understood (Planet 2006). Detailed localization is time consuming. Of the above mentioned historical events, recombination is most closely related to species recognition with GCPSR. Different evolutionary rates of loci were uncovered on the base of the phylograms (Figs 1-3), though the degree may be partly dependent on the choice of outgroup. Analyses of reproductive isolation and reproductive mode indicated that all tested species were clonal with the exception of E. exophialae and Rhinocladiella similis. Only three and seven isolates of these species were available for study, respectively, and thus the results might be an artifact. Recombination detected in small numbers of strains is doubtful and needs to be proven with larger data sets. Since other evolutionary historical events were not detected in this research, we can not ignore the contribution of the variation of evolutionary rate and, conversely, the limited recombination to the incongruence among the lineages. Hipp et al. (2004) indicated that PHT should not be used as an indicator of increased accuracy when combining partitions. Combining multilocus sequences did not yield more phylogenetic information than using single gene data in our study. The trees of the combined data set revealed topologies similar to those of individual gene data sets, even thought PHT suggested that lineages were incongruent.

Ecology A large portion of the strains analysed in the present study were derived from clinical sources, but nearly all species also comprised environmental isolates. Strains from different sources or from different continents frequently shared the same genotypes. This implies that the environmental isolates are likely to have similar opportunistic potentials as the clinical strains. E. xenobiotica and E. oligosperma are among the most frequent opportunists on humans in the genus Exophiala, causing cutaneous and systemic infections (Zeng et al. 2007). Another recurrent source of isolation for these 2 species was material rich in aromatic hydrocarbons. Besides the species in the E. spinifera clade, some Exophiala species are agents of human mycoses. Among them, E. dermatitidis is one of the agents that are able to cause systemic infections (Zeng et al. 2007); surprisingly this species was also isolated from toxic creosotes in the tropics (M. Sudhadham, pers. comm.). For Exophiala and its relatives, the relationship

103 Chapter 5 of opportunistic potential and ability of assimilating alkylbenzenes as a sole source of nutrient indicates that a thus far unknown type of virulence factors may be concerned (Prenafeta- Boldú et al. 2001, Prenafeta-Boldú et al. 2006).

Acknowledgements K.F. Luijsterburg is thanked for technical assistance. D.A. Sutton (Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center, San Antonio, Texas, U.S.A.) is acknowledged for providing a large number of clinical isolates, for which E.H. Thompson and J. Ruiz performed morphological identification.

References Akaike H (1974). A new look at the statistical model identification. IEEE Transactions on Automatic Control 19: 716-723. Geiser DM, Pitt JI, Taylor JW (1998). Cryptic speciation and recombination in the aflatoxin- producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences of the United States of America 95: 388-393. Graeser Y, de Hoog GS, Summerbell RC (2006). Dermatophytes: recognizing species of clonal fungi. Medical Mycology 44: 199-209. Haase G, Sonntag L, Melzer-Krick B, de Hoog GS (1999). Phylogenetic interference by SSU- gene analysis of members of the Herpotrichiellaceae with spcial reference to human pathogenic species. Studies in Mycology 43: 80-97. Haase G, Sonntag L, van de PY, Uijthof JM, Podbielski A, Melzer-Krick B (1995). Phylogenetic analysis of ten black yeast species using nuclear small subunit rRNA gene sequences. Antonie van Leeuwenhoek 68: 19-33. Hasegawa M, Kishino H, Yano T (1985). Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174. Hipp AL, Hall JC, Sytsma KJ (2004). Congruence versus phylogenetic accuracy: revisiting the incongruence length difference test. Systematic Biology 53: 81-89.

104 Phylogeny of Exophiala spinifera clade

Hoog GS, Gerrits van den Ende AHG, Uijthof JM, Untereiner WA (1995). Nutritional physiology of type isolates of currently accepted species of Exophiala and Phaeococcomyces. Antonie van Leeuwenhoek 68: 43-49. Hoog GS de, Haase G (1993). Nutritional physiology and selective isolation of Exophiala dermatitidis. Antonie van Leeuwenhoek 64: 17-26. Hoog GS de, Poonwan N, Gerrits van den Ende AHG (1999). Taxonomy of Exophiala spinifera and its relationship to E. jeanselmei. Studies in Mycology 43: 133-142. Hoog GS de, Takeo K, Yoshida S, Gottlich E, Nishimura K, Miyaji M (1994). Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis. Antonie van Leeuwenhoek 65: 143-153. Hoog GS de, Vicente V, Caligiorne RB, Kantarcioglu S, Tintelnot K, Gerrits van den Ende AH, Haase G (2003). Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. Journal of Clinical Microbiology 41: 4767-4778. Hoog GS de, Zeng JS, Harrak MJ, Sutton DA (2006). Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie van Leeuwenhoek 90: 257-268. Kasuga T, Taylor JW, White TJ (1999). Phylogenetic relationships of varieties and geographical groups of the human pathogenic fungus Histoplasma capsulatum Darling. Journal of Clinical Microbiology 37: 653-663. Kimura M (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120. Koufopanou V, Burt A, Taylor JW (1997). Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus . Proceedings of the National Academy of Sciences of the United States of America 94: 5478-5482. Masclaux F, Gueho E, de Hoog GS, Christen R (1995). Phylogenetic relationships of human- pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. Journal of Medical and Veterinary Mycology 33: 327-338.

105 Chapter 5

Müller E, Pitrini O, Fisher PJ, Samuels GJ, Rossman AY (1987). Taxonomy and anamorphs of the Herpotrichiellaceae with notes on genetic synonymy. Transactions British Mycological Society 88: 63-74. Page RD (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12: 357-358. Planet PJ (2006). Tree disagreement: measuring and testing incongruence in phylogenies. Journal of Biomedical Informatics 39: 86-102. Posada D, Buckley TR (2004). Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793-808. Posada D, Crandall KA (1998). MODELTEST: testing the model of DNA substitution. Bioinformatics (Oxford, England) 14: 817-818. Prenafeta-Boldú FX, Kuhn A, Luykx DMAM, Anke H, van Groenestijn JW, de Bont J (2001). Isolation and characterisation of fungi growing on volatile aromatic hydrocarbons as their sole carbon and energy source. Mycological Research 105: 477-484. Prenafeta-Boldú FX, Summerbell RC, de Hoog GS (2006). Fungi growing on aromatic hydrocarbons: biotechnology's unexpected encounter with biohazard? FEMS Microbiology Reviews 30: 109-130 Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics (Oxford, England) 19: 1572-1574. Samuels GJ, Müller E (1978). Life-history studies of Brazilian ascomycetes. 3. Melonomma radicans sp. nov. and its Aipiosphaeria anamorph, Trematosphaeria perrumpens sp. nov. and Berlesiella fungicola sp. nov. and its Ramichloridium anamorph. Sydowia 31: 142-156. Schol-Schwarz MB (1968). Rhinocladiella, its synonym Fonsecaea and its relation to Phialophora. Antonie van Leeuwenhoek 34: 119-152. Swofford DL (2000). PAUP* 4.0: phylogenetic analysis using parsimony. Tamura K, Nei M (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512-526. Tintelnot K, de Hoog GS, Thomas E, Steudel WI, Huebner K, Seeliger HP (1991). Cerebral phaeohyphomycosis caused by an Exophiala species. Mycoses 34: 239-244.

106 Phylogeny of Exophiala spinifera clade

Untereiner WA (1995). Fruiting studies in species of Capronia (Herpotrichiellaceae). Antonie van Leeuwenhoek 68: 3-17. Untereiner WA (1997). Taxonomy of selected members of the ascomycete genus Capronia with notes on anamorph-teleomorph connections. Mycologia 89: 120-131. Untereiner WA, Gerrits van den Ende AHG, de Hoog GS (1999). Nutritional physiology of species of Capronia. Studies in Mycology 43: 98-106. Untereiner WA, Straus NA, Malloch D (1995). A molecular-morphotaxonomic approach to the systemics of the Herpotrichiellaceae and allied black yeasts. Mycological Research 99: 897-913. Vitale RG, de Hoog GS (2002). Molecular diversity, new species and antifungal susceptibilities in the Exophiala spinifera clade. Medical Mycology 40: 545-556. Zeng JS, Sutton AD, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS (2007). Spectrum of clinically relevant Exophiala species in the U.S.A. Journal of Clinical Microbiology (accepted) Zharkikh A (1994). Estimation of evolutionary distances between nucleotide sequences. Journal of Molecular Evolution 39: 315-329.

107 Chapter 5

108 Chapter 6

Exophiala spinifera and its allies: diagnostics from morphology to DNA barcoding

J.S. Zeng1, 2, 3 and G.S. de Hoog1, 2

1Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands 3Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, Wuhan, Hubei, P.R. China

Submitted to Medical Mycology in June, 2007

Key words: black yeasts, Exophiala, diagnostics, morphology, physiology, immunology, genetics, barcoding

109 Chapter 6

Abstract Diagnostic features of morphology, physiology, immunology and genetics of species belonging to the Exophiala spinifera clade, comprising a large number of human associated Exophiala species, are summarized. Several species have closely similar morphological characters and physiological profiles. Taxonomy is therefore primarily mainly based on sequence diversity of the Internal Transcribed Spacer (ITS) region of ribosomal DNA (rDNA). Multilocus sequencing has shown that the ITS region is reliable for identification of the species in this clade, and is a good candidate for barcoding species of Exophiala.

Introduction The black yeast genus Exophiala comprises some major agents of human systemic disease. A hallmark of species of the genus is their morphological plasticity, as they tend to pass through complicated life cycles where diagnostic features are variably expressed [1]. Conversely, very similar microscopic structures can be expressed in phylogenetically remote species. Therefore species are notoriously difficult to classify and identify. In the past, diagnostic schemes were morphological, while soon physiological and serological parameters were added [2-6]. In recent years diagnostics has been supplemented by molecular tools, particularly sequence data of the Internal Transcribed Spacer (ITS) region of ribosomal DNA (rDNA) [7-9], while currently coding genes such as translation elongation factor 1-α and β-tubulin are added. A large-scale DNA sequencing project has been advocated known as DNA barcoding, which aims to promote rapid and automatic species identification and to provide insight into the evolutionary history of life. It attracted much attention as well as controversy [10-13], but increasingly techniques are being developed which proved to be powerful in various aspects of molecular identification of unknown samples [14-21]. The ‘E. spinifera clade’ is a cluster of taxa that was recognized among members of the Herpotrichiellaceae (black yeasts and relatives) based on SSU rDNA data [22]. At its first recognition it comprised the three previously described species E. spinifera, E. jeanselmei and Phaeococcomyces exophialae (= E. exophialae), plus one strain, CBS 725.88 that was later described as Exophiala oligosperma. E. jeanselmei had long been recognized to be heterogeneous, even on morphological grounds [23] as it showed two dissimilar phenotypes

110 Diagnostics of Exophiala spinifera and its allies with annellidic vs. sympodial conidiogenesis. Since these different types of conidium production may occur in a single species, in a single strain and even on a single , some preponderantly sympodial taxa such as Rhinocladiella similis and Ramichloridium basitonum were included in the study [9;24]. Species of the E. spinifera clade were defined and identified by phylogeny rather than by morphology. Subsequently some Exophiala species (E. oligosperma, E. nishimurae and E. xenobiotica) have been segregated from known species based on sequences of the ITS region [9;25;26], while E. nigra and E. bergeri were uncovered to be close to E. jeanselmei on the basis of their genetic features [9]. A summary of currently recognized taxa in the form of a distance tree is presented in Fig. 1. In a previews study [27] we found that more than 40% of the Exophiala species derived from symptomatic humans in the U.S.A. concern species that belong to the E. spinifera clade. The predilections of E. xenobiotica, E. oligosperma, E. spinifera and E. jeanselmei seem to be slightly different from each other [27]. Despite the paucity of proven case reports, the distinguished entities are likely to be clinically significant. Routine characters for identification are mostly inappropriate, hampering the development of insight into species-specific pathologies. In this paper we will review the optimal method for identification of these species.

Morphological Identification On potato dextrose agar (PDA) or Sabouraud’s agar (SGA), colonies of Exophiala species generally grow restrictedly, are slimy or at least mucous at the centre, olivaceous grey to brownish black, with olivaceous black reverse. Initial propagation is usually with yeast-like cells, which soon transform into germinating cells and to torulose hyphae, prior to forming evenly wide filaments. The presence of torulose mycelium is characteristic for Exophiala, may be insignificant in prevalently sympodial species of the clade. Exophiala has annellidic conidiogenous cells. Coexisting of annellides, sympodial and/or phialidic conidiogeneous cells is known in several species, e.g. in E. jeanselmei (annellidic / sympodial) and E. spinifera (annellidic / phialidic). Significant halos presenting around yeast cells are helpful to distinguish E. spinifera from other species; E. dermatitidis, outside the E. spinifera clade, is the only other capsule-forming black yeast [28]. Mackinnon et al. [29] reported the production of capsule by yeast-like cells of E. jeanselmei, but the identities of the strains were

111 Chapter 6

Global (Gapcost:0%) Disc. unkn. (Kimura2P) ITS 28 24 20 16 10 22 18 14 12 6 2 0 8 4 26

Exophiala oligosperma 0.6 89

1.6 74

2.2 84

0 100

0.4 100 Rhinocladiella similis

3.8

0.9 Exophiala spinifera

1.3

4.3 1.8 88 96 0.2 100 Exophiala exophialae

6.4 96 0.4 100 2.5 Exophiala jeanselmei 89 0 100 CBS 101460 (T) Ramichloridium basitonum

9.7 88 0.9 Exophiala xenobiotica

1.1 98

3.9 89 13 0.2 97

0.2 5.8 100 99 1.1 97

CBS 101538 (T) Exophiala nishimurae 16.7 100

0.2 100 Exophiala bergeri 4.6 29.1 100

CBS 546.82 Exophiala nigra CBS 110172 Phaeoannellomyces elegans CBS 129.96 Phialophora europaea

Figure 1. The dendrogram based on sequences of ITS region of rDNA gene of species in E. spinifera clade was constructed using Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method with correction of Kimura 2 parameter (K2P) in the Bionumerics package. The clades comprising taxa with minimum sequence divergence of < 1.0% are collapsed. The number of simulation to run was 100. The percentages of sequence divergence are indicated over branches in bold, and the bootstrap values of > 70% are located on the right side of nodes. The scale shows percentage of global alignment divergence. Phialophora europaea CBS 129.96 was used for comparison. Abbreviations used in the tree, CBS: CBS Fungal Biodiversity Centre, Utrecht, the Netherlands

112 Diagnostics of Exophiala spinifera and its allies not confirmed. E. spinifera is also characteristic in its conidiophores and annellated zones, the latter being long-cylindrical with numerous annellations as is clearly observed with scanning electron microscopy [30]. E. attenuata has similar conidiophores, but reduced annellated zones [25]. In conclusion, only a limited number of taxa can be recognized by morphological features. Diagrams for the identification of human-associated Exophiala species and related black yeast-like fungi are given in Fig. 2 (1-2). E. nigra is not included, as this species has never been observed from a human or an animal source. When species-specific microscopic structures are absent or there are no distinguishable differences in morphology, physiology or immunology, molecular data should offer tools for accurate identification.

Physiological Identification Physiological characteristics frequently applied in diagnostics are summarized in Table 1; but comparable data are unavailable for E. xenobiotica, Rhinocladiella similis and Ramichloridium basitonum. A major problem with physiological profiles of black yeasts is that as yet reproducibility is low, data sometimes being unclear or even contradictory within species. For many species, profiles have to be re-established on the basis of strains verified by molecular biology. Salient differences are mainly found in assimilation of the carbon compounds D-ribose, methyl-α-D-glucoside, salicin, melibiose, raffinose, soluble starch, meso-erythritol, xylitol, D-glucuronate, DL-lactate, succinate and ethanol. Tolerance of MgCl2, NaCl and cycloheximide at different concentrations and thermotolerance showed different profiles between species. Unambiguous differences are lacking to distinguish E. jeanselmei, E. oligosperma and E. spinifera, as well as E. spinifera and E. exophialae. Absence of proteolytic activity in E. jeanselmei and E. spinifera was uncovered by Espinel-Ingroff, et al. using 26 different formulations of gelatin, milk, casein, and Loeffler media [31;31]. Other physiological properties including hydrolysis of tyrosine and xanthine were examined in the same study. Kane et al. found a consistent difference in sodium chloride tolerance, viz. 7% for E. spinifera and 9% for E. jeanselmei [32], but this was not reproduced in sequent studies [6;8]. The ability to assimilating melezitose of the species of the E. spinifera clade listed in Table 1 was valuable to differentiate them from E. dermatitidis [6;8;25;33].

113 Chapter 6 Exophiala Fonsecaea F. monophora Conidia chains in of 1-3 Sequencing Phialides absent or insignificant Rhinocladiella similis Ramichloridium mackenziei Other F. pedrosoi Frequent human-associated species Conidia ellipsoidal, brown Conidia cylindrical, hyaline Conidia single Ramichloridium / Rhinocladiella yeast cells absentnearly or absent) yeast cells ( Sympodial conidiogenesis P. europaea Filamentous Collarettes very small Collarettes sessile on creeping hyphae Other Ramichloridium basitonum P. reptans is included not due lack to latest of data P. richardsiae P. Collarettes flaring E. nigra Otherwise Filamentous relatives, salmonisE. pisciphila / E. nishimurae E. / P. verrucosa Collarettes vase-shaped P. americana Collarettes funnel- shaped Monomorphic for phialides Collarettes on flask- shaped phialides Phialophora P. verrucosa / P. reptans speciesand related black fungi. yeast-like Yeast cells present, at least at the colony centre Colony characteristics Exophiala Black yeasts See Fig. 2 (2) E. pisciphila Conidia 0 (0-1) septate; assimilation of lactose, D- lactose, of assimilation septate; (0-1) Conidia 0 glucuronate and D-galacturonate Clamydospore-like cells absent Annellides present Very rapid spots, pink growth, hyphae partly wide, hyaline E. salmonispisciphila E. / Aureobasidium pullulans E. salmonispisciphila / E. nishimurae E. / E. nishimurae E. salmonis Fig. 2 (1) Graph foridentificationFig. Graph 2 (1) of humanassociated Clamydospore-like cells present Conidia 1 (0-3) septate; no assimilation of of assimilation no Conidiaseptate; 1 (0-3) D-lactose, glucuronate D-galacturonate and

114 Diagnostics of Exophiala spinifera and its allies E. heteromorpha Budding cells often cells formBudding a to 1um long butt prominent Otherwise E. moniliae Rh. similis E. bergeri Only sympodial conidiogenesis present, discernible annellation rare of absent No assimilation of salicin assimilation No and xylitol; amture conidiogenous cells have long annellated zones Rhinocladiella similisheteromorpha E. / Conidiogenousvery cells with short annellated zones, arising as part of long cells of ellipsoidal chains branched E. lecanii-corni E. exophialae E. isnot included due to lackof latest data. Phialides and absent growth at 37C E. nigra Assimilation oflactose; no Assimilation of L-arabinitol assimilation Phialidic, annellidicPhialidic, or sympodial hyphomycetous synanamorphs present No assimilation DL-lactate;No assimilation of conidiogenous or undifferentiated ellipsoidal cells Phialides no or present at 37C growth Phaeoannellomyces elegans If conidiogenous are cells in chains Phaeoannellomyces elegans E. / exophialaeheteromorpha / E. If conidiogenous arein cells longer have they chains, annellations castellanii E. No assimilation of salicin of assimilation No amture and xylitol; annellides have always short annellated zones No assimilation ofNo assimilation lactose; assimilation of L-arabinitol E. phaeomuriformis Black yeasts species (continued).and related black yeast-like fungi complex Hyphae absent; yeast-like cells, or later converting into thick- walled muriform bodies E. mesophila Exophiala Assimilationof DL-lactate; conidiogenous cels rocket-shaped or fusiform Large conidiophores absent E. jeanselmei E. Bottle-shaped annellides are not in chains Almost only annellidie present / hyphae present Narrow hyphae; annellated zones narrower wtdththe than supporting the of conidia cell; half mostly aseptate No growthNo 40C at E. jeanselmei, E. oligosperma, E. xenobiotica oligosperma, E. E. jeanselmei, distinguished by sequencing Exophiala Annellated reduced; zones yeast cells without capsule Exophiala Large conidiophores present E. attenuata E. spinifera E. attenuata / E. spinifera Growth at 40C Fig. 2 (2) Graph forFig.Graph identification2 (2) of humanassociated Hortaea werneckii Exophiala dermatitidis Wide hyphaeWide with short cells; annellated nearly zones wide as as the supporting conidia cell; with dark median septum Cylindrical annellated zones; yeastcells with in visible ink India capsule

115 Chapter 6

Biodegradation of low-molecular-weight urethane compounds and cyclohexanone by E. jeanselmei CBS 528.76 was reported [34;35]. E. oligosperma strains were repeatedly isolated from air biofilters fed with toluene [36] or styrene [37;38], raw sewage with high concentrated ethane, propane and butane [39]. In a survey of fungal assimilation of a wide variety of oxidized aromatic compounds, E. oligosperma CBS 658.73 was shown to exhibit a comparatively broad substrate specificity [40]. Environmental strains of E. xenobiotica are mostly associated with habitats rich in monoaromatic hydrocarbons, e.g., soil polluted by gasoline, wood treated with phenolic preservatives, creosote-treated railway ties or browncoal rich in phenolic compounds [26]. The remarkable ability to grow at the expense of alkylbenzene hydrocarbons seems to be widespread in species of the E. spinifera clade, but thus far this feature has not been used for diagnostic purposes. In conclusion, presently available physiological data are insufficient to separate all species of the E. spinifera clade, particularly E. jeanselmei, E. oligosperma and E. xenobiotica which share similar morphologies.

Immunological Identification In animal experiments, antigenic preparations were made from culture filtrates of E. jeanselmei by Iwatsu et al. [3], and positive delayed-skin reactions were elicited in all tested rats. However, antigens displayed cross-reactivity in 2 of 3 rats tested. This result suggested that a delayed-type skin type using these antigens may be useful not only for the diagnosis of chromoblastomycosis but also for the identification of species of the causative agents [3]. An exoantigen test performed by Espinel-Ingroff et al. permitted the differentiation of E. jeanselmei and E. dermatitidis from one another as well as from Hortaea werneckii and other dematiaceous fungi (Fonsecaea, Phialophora, Cladosporium and Rhinocladiella species) and , but it failed to distinguish E. jeanselmei from E. spinifera [4]. This problem was solved by another exoantigen test developed by Standard et al. [2]. It was able to differentiate E. spinifera not only from E. jeanselmei, but also from Exophiala alcalophila, E. moniliae, E. pisciphila, E. salmonis, E. dermatitidis and Hortaea werneckii. In conclusion, exoantigen tests are promising diagnostic tools, but as yet they have not been developed sufficiently to be used routinely.

116 Diagnostics of Exophiala spinifera and its allies

Table 1. Physiological comparison of a part of the species of the E. spinifera clade species name* E. jeanselmei a-d, f-gE. oligosperma f-g E. spinifera a-d, f E. nishimurae e E. bergeri b, d E. exophialae d, f E. nigra d P. elegans assimilation D-glucose + + + + + + + + D- +, v + +, v + + + + + L-sorbose++++++++ D-glucosamine + + +, w + + +, w w + D-ribose +, w++++, w+w- D-xylose+, -+++++++ L-arabinose++++++++ D-arabinose+, w++++, w+++ L-rhamnose++++++++ sucrose++++++w+ maltose++++++++ α,α-trehalose++++++++ methyl-α-D-glucoside +, - w +, w + -, w + - w cellobiose + + + + + + w + salicin +, w+++-, w+- + arbutin ? +, - -, w + ? -, w ? ? melibiose --+, -w++-w lactose +, - - +, -, w w - -, w - w raffinose -, v +, - +, -, v w + + - w melezitose++++++++ inulin - - -, w w - -, w - w soluble starch ---, ww--, w-+ glycerol++++++++ meso-erythritol +++--+-+ ribitol+, w++w++ww xylitol +, w, v++-++++ L-arabinitol++++++w+ D-glucitol++++++++ D-mannitol++++++++ galactitol w+ w, v+- +, -, w-w myo-inositol +, w +, w +, w w + +, w + + inositol +, - - - ? ? ? ? ? sorbitol v ? - ? ? ? ? ? glucono-δ-lactone w +, w + ? + + + w D-gluconate + + + + +, w + w w 2-keto-D-gluconate v ? + ? ? ? ? ? D-glucuronate +++- ++++ D-galacturonate + + + + +, w + w + DL-lactate ++++-, v+- + succinate + +, w+, w+- +, w- w citrate +, -, v +, -, w +, v - -, w +, -, w - - methanol - - -, w - - - - - ethanol ++++- +, ww- nitrate++++w+++ nitrite++++++++ ethylamine + + +, w + + + + + L-lysine+++, ww++++ cadaverine++++++++ creatine+++w++++ creatinine +, - +, w + w + + + + tolerance tests 5% MgCl2 ++++?+- + 10% MgCl2 w+ +, w+? + - + 5% NaCl w+ +, w-? + - + 10% NaCl - w -, w - ? w - w 0.01% cycloheximide -?+?-++- 0.1% cycloheximide +, -+++-, w++- 30ºC++++++++ 37ºC +, - + +, -, w + + + - - 40ºC---, w----- fermentation ---?---- urease acivity +++++++w extracellular DNAse - -, ? - ? ? - ? ? note: The tests which show different profiles among the species and useful for diagnosis are marked in bold. * Species name of strains were reassigned on the basis of latest data before cited. +: growth; w: weak growth; -: no growth; v: variable; ?: ambiguous or unknow a-f: references from which data were summarized. a: Espinel-Ingroff, et al.,1988; b:de Hoog, et al., 2000 (Atlas of Clinical Fungi); c: Espinel-Ingroff, et al.,1989; d: de Hoog, et al., 1995; e: Vitale, et al., 2002; f: de Hoog, et al., 1999; g:Tintelnot, 1991

117 Chapter 6

Histopathological Identification Mycoses caused by dematiaceous fungi include chromoblastomycosis, mycetoma and different types of phaeohyphomycosis. Infections may be superficial, cutaneous, subcutaneous, systemic or disseminated. Depending on published case reports, the dominant infections due to the species of the E. spinifera clade are phaeohyphomycosis [7;41-55], and a few of the infections are chromoblastomycosis [56-61], while mycetoma is uncommon [62- 64]. Most frequently reported phaeohyphomycoses are subcutaneous. The main histopathological characters of subcutaneous phaeohyphomycosis with hematoxylin-eosin (HE) or PAS staining are granulomatous inflammation (or accumulation of macrophages, , histocytes etc. without granuloma formation) with or without abscess. Melanized fungal elements were found inside or outside granulomata in dermis and subcutaneous layers [42-44;47;50;51;53-55]. The fungal elements included brownish, yeast-like cells, pseudohyphae and septate, branched or unbranched hyphae. Elements were seen in tissue either in one form or in a combination of these forms. In systemic infections, lymph node biopsy specimens showed giant cells with brown bodies [48;51]. Fungal vasculitis with hyphal elements and fungal nodes with radial orientation of hyphae were found on the sections of brain autopsy from a case infected by E. oligosperma [7]. A part of fungal cells appeared lightly pigmented or hyaline, lacking melanization. In such cases the application of Fontana-Masson staining was useful to distinguish the infection from those by e.g. Aspergillus [43]. The fungal cells were easily observed with Gomori methenamine silver (GMS) or periodic acid-Schiff stain [50;51]. The manifestation of fungal elements in lesions of skin, lymph nodes or brain was similar, all being filamentous or exhibiting a mixture of hyphal elements and yeast-like cells, occasionally intermingled with torulose hyphae. The histological pictures of subcutaneous phaeohyphomycosis caused by E. jeanselmei [43;45;47;53-55], E. spinifera [42;49-51] or Phaeoannellomyces elegans [44] resembled each other closely. Sclerotic bodies in the lesions of chromoblastomycosis due to different etiologic agents were not distinguishable for diagnosis [56;58;65]. No specific histopathological features are available to differentiate species of the E. spinifera clade from other black yeasts and relatives.

118 Diagnostics of Exophiala spinifera and its allies

Genetic Identification For classification, phylogeny and identification of the species in the E. spinifera clade and epidemiological research of the infections due to these species, a large diversity of molecular biological methods have been applied. Initial methods concerned DNA-DNA hybridization, and banding methods such as restriction Fragment Length Polymorphism (RFLP) and Random Amplified Polymorphic DNA (RAPD) analyses. More recently, DNA sequencing was applied to mitochondrial DNA (mtDNA), partial mitochondrial cytochrome b gene, the ITS region and small subunit (SSU) of rDNA, partial Elongation Factor 1-α (EF 1-α), β- Tubulin (β-TUB), Chitin Synthase (CHS) and Actin (ACT) genes. The E. spinifera clade was first uncovered by Haase et al. [22] based on an analysis of SSU rDNA of the Herpotrichiellaceae. The group was phylogenetically clearly delimited and distinct from the remaining species of Exophiala. The three morphological varieties of E. jeanselmei were confirmed by DNA-DNA hybridization, RFLP analysis of mtDNA, and sequencing of partial mitochondrial cytochrome b gene and the ITS region of rDNA, leading to the distinction of 6-18 genetically different entities [66-68]. The varieties of E. jeanselmei were attributed the status of individual species, and the typical variety was found to contain cryptic but distantly related species, defined by sequences of SSU and ITS region of rDNA and partial mitochondrial cytochrome b genes, and RFLP of mtDNA and the ITS region [22;66;68]. The biodiversity of E. spinifera was exhibited in mtDNA using RFLP analysis and sequences of the ITS region of rDNA [69]. Strains morphologically classified as E. jeanselmei proved to be highly diverse upon sequencing the ITS region, leading to species being newly introduced or redefined [9;25;26]. Multilocus studies [87] showed that species are preponderantly clonal, and consequently that additional genes do not provide more phylogenetic informations than those acquired on the basis of separate data sets. For this reason ITS rDNA has remained a very useful parameter of the distinction of entities [70]. In the absence of sexuality, and given slight ecological differences between the entities, we refer to these taxa as species. Modern taxonomy of species in the E. spinifera clade is therefore based on sequence diversity of ITS rDNA, after confirmation by additional genes (EF 1-α, β- TUB and ACT) [70]. With the aid of RFLP profiles of mtDNA and SSU and ITS sequencing, it is possible to separate species within the E. spinifera clade from those outside the clade [69;71-73].

119 Chapter 6

Table 2. Source of strains tested species name strain number region source GenBank accession nr. E. jeanselmei CBS 677.76 UK mycetoma AY163553 CBS 119095 USA foot skin UTHSC R-2968 USA skin scraping UTHSC 88-402 USA skin UTHSC 94-28 USA knee EF025410 UTHSC 01-2688 USA finger UTHSC R-3338 USA foot EF025411 CBS 117.86 Japan mycetoma (isolated from CBS 116.86) CBS 116.86 Japan mycetoma CBS 507.90 (T) Uruguay mycetoma AY156963 CBS 528.76 USA skin AY857530 UTHSC R-2666 Australia ankle UTHSC R-1922 USA foot lesion biopsy CBS 109635 USA arm lesion E. nishimurae CBS 101538 (T) Venezuela bark (isolated from IFM 41855) AY163560 E. oligosperma CBS 725.88 (T) Germany / Philippines sphenoid AY163551 dH 12971 Finland insulation material dH 13019 Spain toluene dH 13308 Austria steambath dH 12236 Ukraine forest litter UTHSC 97-2226 Brazil human UTHSC 96-2015 USA duodenal aspirate UTHSC 93-271 USA maxillary sinus UTHSC 93-2599 USA spleen UTHSC 92-2007 USA lung autopsy EF025414 UTHSC R-768 USA skin UTHSC 94-1531 USA knee tissue UTHSC 97-474 USA throat UTHSC 98-697 USA valve (heart?) EF025413 UTHSC 92-85 USA maxillary sinus UTHSC 02-2072 USA lung UTHSC R-680 USA subcutaneous lesion UTHSC 01-593 USA lung UTHSC 04-46 USA sputum UTHSC 01-2053 USA tissue UTHSC 93-2598 USA lung tissue UTHSC 93-2310 USA lymph node UTHSC 94-1756 USA pleural fluid UTHSC 94-2548 USA lung UTHSC 89-254 USA human UTHSC 01-1205 USA pleural fluid UTHSC 00-1921 USA foot dH 13321 Austria Sauna floor CBS 115966 Netherlands process water dH 13304 Austria Sauna dH 13314 Austria steambath dH 13320 Austria steambath UTHSC 91-870 USA hand UTHSC 02-45 USA animal UTHSC 01-597 USA nail dH 13579 Austria steambath floor UTHSC 95-2350 USA middle finger EF025386 CBS 109807 Brazil fungemia UTHSC R-2997 Brazil human UTHSC R-3000 Brazil human UTHSC R-2999 Brazil human UTHSC R-2998 Brazil human UTHSC R-2977 Brazil human UTHSC R-2976 Brazil human UTHSC R-2993 Brazil human UTHSC R-2989 Brazil human UTHSC R-2991 Brazil human UTHSC R-2987 Brazil human UTHSC R-2979 Brazil human UTHSC R-2981 Brazil human UTHSC R-2984 Brazil human UTHSC R-2980 Brazil human UTHSC 88-209 USA lymph node UTHSC R-2975 Brazil human UTHSC R-2988 Brazil human UTHSC R-2995 Brazil human CBS 265.49 France honey AY163555 UTHSC R-2996 Brazil human UTHSC 95-416 USA foot lesion UTHSC 95-2041 USA foot lesion EF025415 UTHSC 96-968 USA leg CBS 537.76 Italy human CBS 538.76 unknown branchus CBS 634.69 Baltic Sea wood, ship resting at sea bottom E. spinifera CDC B-5383 USA elbow lesion UTHSC R-1443 UK phaeohyphomycotic cyst CBS 194.61 India systemic mycosis CBS 101537 Venezuela cactus CBS 236.93 Germany apple juice CBS 269.28 Germany skin (to be continued)

120 Diagnostics of Exophiala spinifera and its allies

Table 2. Source of strains tested (continued) species name strain number region source GenBank accession nr. E. spinifera CBS 356.83 Egypt skin AJ244246 CBS 425.92 Germany apple juice CBS 101644 USA maize kernel CBS 899.68 (T) USA nasal granuloma AY156976 CBS 110628 Venezuela bark UTHSC R-2959 China human UTHSC R-773 USA human UTHSC R-2955 USA human UTHSC 88-15 USA human EF025419 UTHSC R-2870 USA subcutaneous cyst EF025418 UTHSC 91-188 USA upper thigh EF025417 UTHSC 97-2073 USA skin EF025416 CBS 667.76 Uruguay fallen palm CBS 670.76 Uruguay nest of Anumbis anumbi CBS 102179 Senegal skin E. xenobiotica CBS 117650 USA arm abscess CBS 117641 USA knee cyst DQ182591 CBS 117655 USA buttock CBS 117676 USA finger DQ182592 CBS 117649 USA wound CBS 117654 USA total knee CBS 204.50 Switzerland apple juice CBS 117671 USA eye vitreous tab CBS 117662 USA leg tissue CBS 117648 USA sclera EF025407 CBS 117646 USA finger CBS 118157 (T) Venezuela oil-spilled soil DQ182587 CBS 117669 USA cyst in elbow CBS 117667 USA arm biopsy CBS 642.82 Australia treated Eucalyptus pole CBS 102455 Brazil eye CBS 119306 USA animal CBS 117674 USA blood DQ182589 CBS 117647 USA wrist wound CBS 101271 Netherlands skin CBS 522.76 UK timber CBS 117754 Germany benzene-contaminated ground water CBS 117672 USA scalp CBS 117673 USA scalp DQ182590 CBS 117753 USA leg wound CBS 648.76A Canada sputum CBS 718.76 Canada foot CBS 117661 USA eye vitreous fluid CBS 117652 USA human CBS 117657 USA knee tissue CBS 117665 USA tissue DQ182588 CBS 117645 USA human CBS 117651 USA forearm CBS 117659 USA human CBS 117644 USA foot abscess CBS 117658 USA dialysis fluid CBS 117663 USA forearm CBS 102606 USA bathroom CBS 527.76 Sweden culture contaminant of Hyphodontia breviseta , on Picea abies CBS 117235 USA sputum CBS 117656 USA foot sinus CBS 117642 USA foot wound DQ182593 CBS 117675 USA great toe CBS 117643 USA hand CBS 117653 USA peritoneal dialysis fluid DQ182594 E. exophialae CBS 101542 Colombia soil AY156967 CBS 671.76 Uruguay nest AY156975 CBS 668.76 (T) Uruguay Dasypus septemcinctus , straw in burrow, armadillo AY156973 Ramichloridium basitonum CBS 101460 (T) Japan skin AY163561 Rhinocladiella similis dH 14724 Austria industrial indoor air dH 13054 Slovenia CSF AY857529 UTHSC R-2978 USA human UTHSC R-3002 USA human UTHSC R-3003 USA human CBS 116299 France aspirate of bronchus CBS 111763 (T) Brazil foot lesion Phaeoannellomyces elegans CBS 110172 Netherlands railway tie EF551549 Exophiala nigra CBS 546.82 USSR unknown EF551550 Exophiala bergeri CBS 353.52 (T) Canada skin UTHSC R-2664 USA leg wound UTHSC 93-1707 USA hand UTHSC 00-1119 USA lesion in forearm EF025403 UTHSC 99-211 USA knee EF025406 UTHSC 94-540 USA index finger EF025404 UTHSC 99-1723 USA penis EF025405 Phialophora europaea CBS 129.96 Germany chromoblastomycosis of toe EF551553 CBS: Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, the Netherlands; UTHSC: University of Texas Health Science Center, San Antonio, TX, USA; CDC: Centers for Disease Control and Prevention, Atlanta, USA; dH: working number of strains in Department of Ecology of Clinical Fungi in CBS Fungal Biodiversity Centre, Utrecht, the Netherlands

121 Chapter 6

RFLP analysis failed to distinguish some closely interrelated species, e.g. E. bergeri and Phaeoannellomyces elegans [72]. Sequencing of less variable genes is optimal for recognition of species belonging to main clades in the black yeasts [9;22;24;74]. Among these genes, sequence data of mtDNA and CHS gene are not available for all species. Partial SSU sequences have been applied for species distinction, but they are insufficiently variable for this purpose. Abliz et al. reported that intra-species sequence diversity of the D1/D2 domains of large subunit (26S) rDNA was very small in E. dermatitidis, E. jeanselmei, E. spinifera and E. moniliae, while inter-species differences were consistently larger [75]. These data suggested that the D1/D2 domain may prove to be a useful tool for identification of these species, but studied data set outside the E. spinifera clade is limited. Therefore, optimal molecular diagnostics of the species in the E. spinifera clade remains sequencing of the rDNA ITS regions [8;9;25;26]. Fig. 1 shows a dendrogram based on sequences of the ITS region of the rDNA gene of all species in the E. spinifera clade, constructed using Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method with correction of Kimura 2 parameter (K2P) in the Bionumerics package v. 4.0 (Applied Maths, Kortrijk, Belgium). The tree generated on the basis of the sequence data obtained with the method described in [27] in our previous [26;27;70] and present studies, and the sequences downloaded from GenBank. The sources of strains in the tree are shown in Table 2. Strains of each species formed a reciprocal monophyletic clade with a high bootstrap value. The sequence divergences within a species varied from 0.2% (E. bergeri and E. exophialae) to 3.9% (E. xenobiotica), and distances between two closest species in the tree varied from 1.8% (E. spinifera and E. exophialae) to 5.8% (E. xenobiotica and E. nishimurae) (Fig. 1). Though there is overlap between intra- and interspecific divergences, most of the intraspecies diversities are lower than 2% except those of E. xenobiotica (3.9%) and E. jeanselmei (2.5%), while most of the interspecies diversities are larger than 2% except that between E. spinifera and E. exophialae (1.8%). DNA barcoding is a standardized approach to identify species by a short gene sequence from a uniform region in the genome [http://www.barcoding.si.edu]. The technique allows rapid and unambiguous definition and recognition, and has phylogenetical implications as it is directly based upon the evolutionary history of life. Barcoding has been applied to resolve species boundaries in populations of apparently similar organisms and discover

122 Diagnostics of Exophiala spinifera and its allies possible new species [17;76-79]. There is no universal barcoding gene, as no single gene that is conserved in all domains of life and exhibits enough sequence divergence for species discrimination. Cytochrome c oxidase subunit I (COI) region of mitochondrial DNA was proposed as the barcode gene in the animal kingdom [80]. A chloroplast gene such as maturase K or a nuclear gene such as ITS may be an effective target for barcoding in plants [13]. The utility of COI was tested in fungi with strains from 58 species of Penicillium subgenus Penicillium and 12 allied species [19]. The COI sequence divergences within species were less than those of the ITS and beta-tubulin sequences, while the divergences between species were comparable to those of the ITS region. This is a good prospect for fungus identification using COI DNA barcodes. The development of a barcoding system for fungi that shares a common gene target with other kingdoms would be a significant advantage. As we know, the mitochondrial genes of fungi contain many introns. Though this limitation can be circumvented by employing reverse transcription in conjunction with PCR [13], reference sequences from taxonomically confirmed specimens of fungi are limited. Sequencing the ITS region of rDNA has widely been used for studies of fungal diversity and phylogeny. In many groups traditional taxonomy is basically congruent with the main traits of phylogeny reconstructed with ITS sequences. In black yeasts, however, molecular diversity appears to be very much larger than that observed on the basis of phenetics; novel species are continually being described. The ITS region is a tandem repeat with a length about 500-600 bp in most fungi. Though it comprises introns, it can easily be amplified from many taxa using a limited set of primers designed from adjacent exons. Based on the fact that differences among species are consistently larger than those within species, ITS sequences have been frequently utilized for fungal identification [25;81-88]. The ITS region currently is a logical candidate for DNA barcoding of fungi, and certainly for black yeasts, as long as no other gene has been sequenced at a comparatively wide scale. ‘Accuracy of barcoding for identification depends on the ratio between intraspecific variation and interspecific divergence. The more overlap there is between these categories, the less effective barcoding becomes’ [11]. We observed distinct overlap between intraspecific and interspecific divergence values of the ITS sequences of species in the E. spinifera clade, which seems to imply difficulties in definition of threshold values to identify candidate species. Using a 2% threshold for species diagnosis in our data set, 7 out of 11

123 Chapter 6 described species would be accurately identified. Fortunately, the overlap occurred in the tree where each species was reciprocally monophyletic to all others. Intraspecific variation locally exceeded interspecific divergence in other parts of the tree. Such overlap will not affect identification of unknown specimens in a thoroughly sampled tree [11]. To test accuracy of the ITS region sequences for identification, the sequences used in this study were blasted against our local database which contains almost 6000 entities of human associated black yeasts, and against GenBank. If taxonomic names would have been updated in GenBank, the tested samples almost always showed highest sequence similarities to the entities which were same species or nearest neighbours in the E. spinifera clade in both databases. Therefore, the ITS rDNA works well as a barcode for species of the E. spinifera clade.

Table 3. Sequences of species-specific fragments for species in the E. spinifera clade. GenBank Position in the ITS Numbers of Species name Strain number accession nr. Sequence of species-specific fragment region of rDNAd used isolates Exophiala bergeri CBS 353.52 (T) EF551462 ACAAAATTCTGAATAAATCATGCCT 140-164 in ITS1 11 Exophiala exophialae CBS 668.76 (T) AY156973c CAGGCCTGGTCTCGACCTGCCGGAG 69-93 in ITS1 3 Exophiala jeanselmei CBSa 507.90 (T) AY156963 AAGACAATGACGGCGGGCTGTTCGA 71-95 in ITS2 16 Exophiala nigra CBS 546.82 EF551550 TTAAAAAATTCTGAATAATCATGCC 139-163 in ITS1 1 Exophiala nishimurae CBS 101538 (T) b AAACTACAAACTCATGAACTAAACG 137-161 in ITS1 1 Exophiala oligosperma CBS 725.88 (T) AY163551 CTCCAAAATTCTTTAACCAAACGTG 147-171 in ITS1 93 Exophiala spinifera CBS 899.68 (T) AY156976 GGCCCCAACTTCAAAATTCTTAACT 129-153 in ITS1 26 Exophiala xenobiotica CBS 118157 (T) DQ182587 CTGGCTCGTCCTACCGGAGGACCGT 74-98 in ITS1 65 Phaeoannellomyces elegans CBS 110172 EF551549 TTTAAAAACTCTTGAATAATCATGC 143-167 in ITS1 1 Ramichloridium basitonum CBS 101460 (T) AY163561 ATAAAATTCTTAACTAAACGTGTCT 140-164 in ITS1 1 Rhinocladiella similis CBS 111763 (T) EF551461 ACCTCAAAATCTTTAACCAAACGTG 136-160 in ITS1 15 aCBS: Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands bThe sequenc deposited as AY163560 in GenBank is incorrect. cThe species name was E. spinifera when the sequence was deposited in GenBank. dBased on sequences of the strains listed in the table.

Detecting species-specific oligo-nucleotide fragments is also useful for diagnosis by hybridization. The species-specific fragments were searched in the ITS region of species in the E. spinifera clade and listed in Table 3. Sequences of the fragments are identical within a species, and divergent between species (at least 8% except for that between E. spinifera and E. exophialae). Specificity of the fragments was also proved by blasting the sequences in GenBank and our local database. In conclusion, the specific sequences in the ITS region can be used for designing probes for identifying species in the E. spinifera clade.

Acknowledgements

124 Diagnostics of Exophiala spinifera and its allies

Dr. Grit Walther and M.J. Harrak are acknowledged for giving suggestions associated to DNA Barcoding and searching species-specific oligo-nucleotide fragments for studied species.

Reference

1. de Hoog GS, Takeo K, Yoshida S, et al. Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis. Antonie Leeuwenhoek 1994; 65: 143-153.

2. Standard PG, Padhye AA, Kaufman L. Exoantigen test for the rapid identification of Exophiala spinifera. J Med Vet Mycol 1991; 29: 273-277.

3. Iwatsu T, Miyaji M, Taguchi H, et al. Evaluation of skin test for chromoblastomycosis using antigens prepared from culture filtrates of Fonsecaea pedrosoi, Phialophora verrucosa, Wangiella dermatitidis and Exophiala jeanselmei. Mycopathologia 1982; 77: 59-64.

4. Espinel-Ingroff A, Shadomy S, Kerkering TM, et al. Exoantigen test for differentiation of Exophiala jeanselmei and Wangiella dermatitidis isolates from other dematiaceous fungi. J Clin Microbiol 1984; 20: 23-27.

5. de Hoog GS, Haase G. Nutritional physiology and selective isolation of Exophiala dermatitidis. Antonie Leeuwenhoek 1993; 64: 17-26.

6. de Hoog GS, Gerrits van den Ende AHG, Uijthof JM, et al. Nutritional physiology of type isolates of currently accepted species of Exophiala and Phaeococcomyces. Antonie Leeuwenhoek 1995; 68: 43-49.

7. Tintelnot K, de Hoog GS, Thomas E, et al. Cerebral phaeohyphomycosis caused by an Exophiala species. Mycoses 1991; 34: 239-244.

8. de Hoog GS, Poonwan N, Gerrits van den Ende AHG. Taxonomy of Exophiala spinifera and its relationship to E. jeanselmei. Stud Mycol 1999; 43: 133-142.

9. de Hoog GS, Vicente V, Caligiorne RB, et al. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J Clin Microbiol 2003; 41: 4767-4778.

10. Ebach MC, Holdrege C. DNA barcoding is no substitute for taxonomy. Nature 2005; 434: 697.

11. Meyer CP, Paulay G. DNA barcoding: error rates based on comprehensive sampling. PLoS Biol 2005; 3: 2229-2238.

12. Schindel DE, Miller SE. DNA barcoding a useful tool for taxonomists. Nature 2005; 435: 17.

125 Chapter 6

13. Stoeckle M. Taxonomy, DNA, and the Bar Code of Life. BioScience 2003; 53: 796- 797.

14. Hajibabaei M, Janzen DH, Burns JM, et al. DNA barcodes distinguish species of tropical Lepidoptera. Proc Natl Acad Sci USA 2006; 103: 968-971.

15. Hebert PD, Gregory TR. The promise of DNA barcoding for taxonomy. Syst Biol 2005; 54: 852-859.

16. Janzen DH, Hajibabaei M, Burns JM, et al. Wedding biodiversity inventory of a large and complex Lepidoptera fauna with DNA barcoding. Philos Trans R Soc Lond B Biol Sci 2005; 360: 1835-1845.

17. Kress WJ, Wurdack KJ, Zimmer EA, et al. Use of DNA barcodes to identify flowering plants. Proc Natl Acad Sci USA 2005; 102: 8369-8374.

18. Kumar NP, Rajavel AR, Natarajan R, et al. DNA barcodes can distinguish species of Indian mosquitoes (Diptera: Culicidae). J Med Entomol 2007; 44: 1-7.

19. Seifert KA, Samson RA, Dewaard JR, et al. From the Cover: Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case. Proc Natl Acad Sci USA 2007; 104: 3901-3906.

20. Vences M, Thomas M, Bonett RM, et al. Deciphering amphibian diversity through DNA barcoding: chances and challenges. Philos Trans R Soc Lond B Biol Sci 2005; 360: 1859-1868.

21. Waugh J. DNA barcoding in animal species: progress, potential and pitfalls. Bioessays 2007; 29: 188-197.

22. Haase G, Sonntag L, Melzer-Krick B, et al. Phylogenetic interference by SSU-gene analysis of members of the Herpotrichiellaceae with spcial reference to human pathogenic species. Stud Mycol 1999; 43: 80-97.

23. de Hoog GS. Rhinocladiella and allied genera. Stud Mycol 1977; 15: 1-140.

24. Haase G, Sonntag L, van de Peer Y, et al. Phylogenetic analysis of ten black yeast species using nuclear small subunit rRNA gene sequences. Antonie Leeuwenhoek 1995; 68: 19-33.

25. Vitale RG, de Hoog GS. Molecular diversity, new species and antifungal susceptibilities in the Exophiala spinifera clade. Med Mycol 2002; 40: 545-556.

26. de Hoog GS, Zeng JS, Harrak MJ, et al. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie Leeuwenhoek 2006; 90: 257-268.

126 Diagnostics of Exophiala spinifera and its allies

27. Zeng JS, Sutton AD, Fothergill AW, et al. Spectrum of clinically relevant Exophiala species in the U.S.A. J Clin Microbiol 2007; in press.

28. Yurlova NA, de Hoog GS. Exopolysaccharides and capsules in human pathogenic Exophiala species. Mycoses 2002; 45: 443-448.

29. Mackinnon JE, Gezuele E, Conti-Diaz IA, et al. Production of capsule and conidia by yeast-like cells of Phialophora spinifera and Phialophora jeanselmei. Sabouraudia 1973; 11: 33-38.

30. Nishimura K, Miyaji M. Further studies on the phylogenesis of the genus Exophiala and Hortaea. Mycopathologia 1985; 92: 101-109.

31. Espinel-Ingroff A, Goldson PR, McGinnis MR, et al. Evaluation of proteolytic activity to differentiate some dematiaceous fungi. J Clin Microbiol 1988; 26: 301-307.

32. Kane J, Summerbell RC. Sodium chloride as aid in identification of Phaeoannellomyces werneckii and other medically important dematiaceous fungi. J Clin Microbiol 1987; 25: 944-946.

33. Espinel-Ingroff A, McGinnis MR, Pincus DH, et al. Evaluation of the API 20C yeast identification system for the differentiation of some dematiaceous fungi. J Clin Microbiol 1989; 27: 2565-2569.

34. Owen S, Otani T, Masaoka S, et al. The biodegradation of low-molecular-weight urethane compounds by a strain of Exophiala jeanselmei. Biosci Biotechnol Biochem 1996; 60: 244-248.

35. Hasegawa Y, Yoshioka N, Obata H, et al. Degradation of cyclohexanone by Exophiala jeanselmei. Nippon Nogei Kagaku Kaishi 1990; 64: 157-162.

36. Estevez E, Veiga MC, Kennes C. Biodegradation of toluene by the new fungal isolates Paecilomyces variotii and Exophiala oligosperma. J Ind Microbiol Biotechnol 2005; 32: 33-37.

37. Cox HHJ, Houtman JHM, Dddema HJ, et al. Enrichment of fungi and degradation of styrene in biofilters. Biotechnol Lett 1993; 15: 737-742.

38. Cox HHJ, Magielsen FJ, Doddema HJ, et al. Influence of the water content and water activity on styrene degradation by Exophiala jeanselmei in biofilters. Appl Biochem Biotechnol 1996; 45: 851-856.

39. Davies JS, Wellman AM, Zajic JE. Hypomycetes utilizing natural gas. Can J Microbiol 1973; 19: 81-85.

40. Middelhoven WJ. Catabolism of benzene compounds by ascomycetous and basidiomycetous yeasts and yeastlike fungi. A literature review and an experimental approach. Antonie Leeuwenhoek 1993; 63: 125-144.

127 Chapter 6

41. Bossler AD, Richter SS, Chavez AJ, et al. Exophiala oligosperma causing olecranon bursitis. J Clin Microbiol 2003; 41: 4779-4782.

42. Campos-Takaki GM, Jardim ML. Report of chronic subcutaneous abscesses caused by Exophiala spinifera. Mycopathologia 1994; 127: 73-76.

43. Clancy CJ, Wingard JR, Hong NM. Subcutaneous phaeohyphomycosis in transplant recipients: review of the literature and demonstration of in vitro synergy between antifungal agents. Med Mycol 2000; 38: 169-175.

44. Engleberg NC, Johnson J, Bluestein J, et al. Phaeohyphomycotic cyst caused by a recently described species, Phaeoannellomyces elegans. J Clin Microbiol 1987; 25: 605-608.

45. Hironaga M, Mochizuki T, Watanabe S. Cutaneous phaeohyphomycosis of the sole caused by Exophiala jeanselmei and its susceptibility to amphotericin B, 5-FC and . Mycopathologia 1982; 79: 101-104.

46. Kettlewell P, McGinnis MR, Wilkinson GT. Phaeohyphomycosis caused by Exophiala spinifera in two cats. J Med Vet Mycol 1989; 27: 257-264.

47. Murayama N, Takimoto R, Kawai M, et al. A case of subcutaneous phaeohyphomycotic cyst due to Exophiala jeanselmei complicated with systemic lupus erythematosus. Mycoses 2003; 46: 145-148.

48. Negroni R, Helou SH, Petri N, et al. Case study: posaconazole treatment of disseminated phaeohyphomycosis due to Exophiala spinifera. Clin Infect Dis 2004; 38: e15-e20.

49. Oba M, Suzuki Y, Kawasaki M. A case of cutaneous Exophiala spinifera infection. Nippon Ishinkin Gakkai Zasshi 2000; 41: 17-21.

50. Padhye AA, Kaplan W, Neuman MA, et al. Subcutaneous phaeohyphomycosis caused by Exophiala spinifera. Sabouraudia 1984; 22: 493-500.

51. Rajendran C, Khaitan BK, Mittal R, et al. Phaeohyphomycosis caused by Exophiala spinifera in India. Med Mycol 2003; 41: 437-441.

52. Rallis E, Frangoulis E. Successful treatment of subcutaneous phaeohyphomycosis owing to Exophiala jeanselmei with oral . Int J Dermatol 2006; 45: 1369- 1370.

53. Schwinn A, Strohm S, Helgenberger M, et al. Phaeohyphomycosis caused by Exophiala jeanselmei treated with itraconazole. Mycoses 1993; 36: 445-448.

54. Silva MR, Fernandes OF, Costa CR, et al. Subcutaneoous phaeohyphomycosis by Exophiala jeanselmei in a cardiac transplant recipient. Rev Inst Med Trop Sao Paulo 2005; 47: 55-57.

128 Diagnostics of Exophiala spinifera and its allies

55. Suh MK. Phaeohyphomycosis in Korea. Nippon Ishinkin Gakkai Zasshi 2005; 46: 67- 70.

56. Tomson N, Abdullah A, Maheshwari MB. Chromomycosis caused by Exophiala spinifera. Clin Exp Dermatol 2006; 31: 239-241.

57. Padhye AA, Ajello L. A case of chromoblastomycosis with special reference to the mycology of the isolated Exophiala jeanselmei. Mykosen 1987; 30: 134.

58. Padhye AA, Hampton AA, Hampton MT, et al. Chromoblastomycosis caused by Exophiala spinifera. Clin Infect Dis 1996; 22: 331-335.

59. Naka W, Harada T, Nishikawa T, et al. A case of chromoblastomycosis: with special reference to the mycology of the isolated Exophiala jeanselmei. Mykosen 1986; 29: 445-452.

60. Kinkead S, Jancic V, Stasko T, et al. Chromoblastomycosis in a patient with a cardiac transplant. Cutis 1996; 58: 367-370.

61. Barba-Gomez JF, Mayorga J, McGinnis MR, et al. Chromoblastomycosis caused by Exophiala spinifera. J Am Acad Dermatol 1992; 26: 367-370.

62. Thammayya A, Sanyal M. Exophiala jeanselmei causing mycetoma pedis in India. Sabouraudia 1980; 18: 91-95.

63. Neumeister B, Zollner TM, Krieger D, et al. Mycetoma due to Exophiala jeanselmei and Mycobacterium chelonae in a 73-year-old man with idiopathic CD4+ T lymphocytopenia. Mycoses 1995; 38: 271-276.

64. Hemashettar BM, Patil CS, Nagalotimath SJ, et al. Mycetoma due to Exophiala jeanselmei (a case report with description of the fungus). Indian J Pathol Microbiol 1986; 29: 75-78.

65. Pena-Penabad C, Duran MT, Yebra MT, et al. Chromomycosis due to Exophiala jeanselmei in a renal transplant recipient. Eur J Dermatol 2003; 13: 305-307.

66. Wang L, Yokoyama K, Miyaji M, et al. Identification, classification, and phylogeny of the pathogenic species Exophiala jeanselmei and related species by mitochondrial cytochrome b gene analysis. J Clin Microbiol 2001; 39: 4462-4467.

67. Masuda M, Naka W, Tajima S, et al. Deoxyribonucleic acid hybridization studies of Exophiala dermatitidis and Exophiala jeanselmei. Microbiol Immunol 1989; 33: 631- 639.

68. Kawasaki M, Anzawa K, Tanabe H, et al. Intra-species variation of genotypes of Exophiala jeanselmei isolated from patients in Japan. Nippon Ishinkin Gakkai Zasshi 2005; 46: 261-265.

129 Chapter 6

69. Ishizaki H, Kawasaki M, Nishimura K, et al. Mitochondrial DNA analysis of Exophiala spinifera. Mycopathologia 1995; 131: 67-70.

70. Zeng JS, Harrak MJ, Gerritis van den Ende AHG, et al. Phylogeny of the Exophiala spinifera clade using multilocus sequences and exploring phylogenetic species. Stud Mycol 2008.

71. Yamagishi Y, Kawasaki K, Ishizaki H. Mitochondrial DNA analysis of Phialophora verrucosa. Mycoses 1997; 40: 329-334.

72. Uijthof JM, de Hoog GS. PCR-ribotyping of type isolates of currently accepted Exophiala and Phaeococcomyces species. Antonie Leeuwenhoek 1995; 68: 35-42.

73. Kawasaki M, Ishizaki H, Matsumoto T, et al. Mitochondrial DNA analysis of Exophiala jeanselmei var. lecanii-corni and Exophiala castellanii. Mycopathologia 1999; 146: 75-77.

74. Spatafora JW, Mitchell TG, Vilgalys R. Analysis of genes coding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. J Clin Microbiol 1995; 33: 1322-1326.

75. Abliz P, Fukushima K, Takizawa K, et al. Identification of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol Med Microbiol 2004; 40: 41-49.

76. Cywinska A, Hunter FF, Hebert PD. Identifying Canadian mosquito species through DNA barcodes. Med Vet Entomol 2006; 20: 413-424.

77. Hebert PD, Stoeckle MY, Zemlak TS, et al. Identification of Birds through DNA Barcodes. PLoS Biol 2004; 2: 1657-1663.

78. Hebert PD, Penton EH, Burns JM, et al. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci USA 2004; 101: 14812-14817.

79. Smith MA, Woodley NE, Janzen DH, et al. DNA barcodes reveal cryptic host- specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proc Natl Acad Sci USA 2006; 103: 3657-3662.

80. Hebert PD, Cywinska A, Ball SL, et al. Biological identifications through DNA barcodes. Proc Biol Sci 2003; 270: 313-321.

81. De Hoog GS, Attili-Angelis D, Vicente VA, et al. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42: 405-416.

82. Kauserud H, Lie M, Stensrud O, et al. Molecular characterization of airborne fungal spores in boreal forests of contrasting human disturbance. Mycologia 2005; 97: 1215- 1224.

130 Diagnostics of Exophiala spinifera and its allies

83. Sugita T, Takeo K, Hama K, et al. DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals. Med Mycol 2005; 43: 21-26.

84. Roose-Amsaleg C, Brygoo Y, Harry M. Ascomycete diversity in soil-feeding termite nests and soils from a tropical rainforest. Environ Microbiol 2004; 6: 462-469.

85. Katsu M, Kidd S, Ando A, et al. The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the species complex. FEMS Yeast Res 2004; 4: 377-388.

86. Tamura M, Watanabe K, Mikami Y, et al. Molecular characterization of new clinical isolates of and C. dubliniensis in Japan: analysis reveals a new genotype of C. albicans with group I intron. J Clin Microbiol 2001; 39: 4309-4315.

87. Sugita T, Takashima M, Ikeda R, et al. Intraspecies diversity of Cryptococcus albidus isolated from humans as revealed by sequences of the internal transcribed spacer regions. Microbiol Immunol 2001; 45: 291-297.

88. Kuninaga S, Natsuaki T, Takeuchi T, et al. Sequence variation of the rDNA ITS regions within and between anastomosis groups in Rhizoctonia solani. Curr Genet 1997; 32: 237-243.

131 Chapter 6

132 Chapter 7

Susceptibility of Pseudallescheria boydii and Scedosporium apiospermum to new antifungal agents

Jingsi Zeng1,2, Katsuhiko Kamei1, Yuecheng Zheng2, Kazuko Nishimura1

1 Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan; 2 Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, Wuhan, Hubei, P. R. China

Published in Japanese Journal of Medical Mycology 45: 101-104 (2004)

Key words: voriconazole, micafungin, Psedallescheria boydii, Scedosporium apiospermum, antifungal susceptibility

133 Chapter 7

134 Antifungal susceptibility of P. boydii

135 Chapter 7

136 Antifungal susceptibility of P. boydii

137 Chapter 7

138 Chapter 8

General discussion

139 Chapter 8

Diversity in Pseudallescheria Intraspecific polymorphisms of P. boydii were noted at different levels of diversity in previous studies: in nDNA homology data [1], in the SSU[2], partial D1/D2 region (about 300 bp) of LSU [3] and the ITS region of rDNA gene [4;5], in the partial β-tubulin and calmodulin genes [5], in multilocus enzyme electrophoresis (MLEE) [6] and random amplification of polymorphic DNA (RAPD) data [6;7]. In present study, diversity in P. boydii was also revealed in sequences of the complete D1/D2 region (nearly 600 bp) of rDNA gene and the partial EF 1-α gene and RFLP of the IGS region of rDNA gene. The isolates were divided into 3 clusters based on the sequences of the D1/D2 regions. This clustering is in main traits congruent with that based on nDNA homology data [1], the combined data of partial sequences of β-tubulin and calmodulin genes and the ITS region of rDNA [5]. But some of the independent polymorphisms are not concordant, for example, having similar ITS sequences, strains of DNA-DNA reassociation groups were not unambiguously supported [6]. The distributions of strains in clusters are not completely identical among independent polymorphism data sets in this study. PHT performed with the sequence datasets of D1/D2, ITS and EF 1-α indicated that the genealogies of these 3 loci were not congruent within Pseudallescheria. Recombination was revealed among 2 of 3 clusters by linkage disequilibrium analysis as well. These evidences suggest that the incongruence among the independent polymorphisms would be related with gene flow having occurred in Pseudallescheria evolutionary history. Clonality was supposed in clade 5A. This is remarkable, as this clade contains the type strain of Pseudallescheria boydii, originally described to produce a teleomorph. We therefore assume that Pseudallescheria populations may show a high degree of inbreeding. The genetics of Pseudallescheria ascocarps are insufficiently understood to allow an interpretation of these data. RFLP of the IGS region may prove to be useful for monitoring intraspecific dispersal and evolution, and could be applied in population genetic studies [8;9]. In the present research, IGS-typing detected a level of high diversity between that of EF 1-α groups and individual strains. Though the variability of P. boydii with IGS-RFLP analysis is lower than that with RAPD or MLEE [6;7], the reliability of the data generated by IGS-RFLP analysis may be higher than that of RAPD, because banding patterns are likely to be stable.

140 General discussion

With the present set of strains we did not observe a clear pattern from the point of view of geography or ecology, suggesting a world wide distribution of P. boydii. However, there may be differences in predilection among strains of one IGS-type. Reassociation groups 1 and 2 were reported to comprise mainly invasive strains or involved in colonization of cavities, with environmental strains being rare, while the infrequent group 3 was preponderantly environmental [1;10]. In the present research, two invasive strains were found in clade 5A, while preponderantly colonizers of cavities (pulmonary and maxillary) were found in clade 4, and isolation of clade 5B was mainly environmental. The suggestion that there are differences in virulence to humans between members of groups of P. boydii complex [5] thus is approximately confirmed. Most of strains of reassociation groups 1 and 3 initially displayed cleistothecia, while most strains of group 2 (corresponding to clades 3-4) did not [1]. This criterion is hard to reproduce, because isolates maintained as P. boydii failed to produce cleistothecia upon inspection from collection strains regardless of growth conditions [11]. In this research, cleistothecia were observed in 3 P. boydii isolates on potato dextrose agar (PDA). These 3 strains were isolated from Chinese or Japanese patients. Thus, based on present data, no obvious predilection of the ability to develop cleistothecia was revealved among the individuals in clades 5A and 5B. The frequency of the Graphium anamorph in reassociation group 2 appeared higher than in group 1 (data not shown). This tendency was also observed in the data of Gilgado et al. [1] and in the present research. Though the strains belonging to clade 4 (part of reassociation group 2) will be described as a new species [12], Gilgado et al. reported that the difference of susceptibilities against 10 antifungal agents between clade 5 and 4 was disclosed only in AMB [13]. Our susceptibility data shown in Chapter 7 were analysed in strains identified according to morphological criteria, and published before molecular diversity analysis. In retrospect, no significant difference in the susceptibilities between P. boydii and S. apiospermum isolates against 7 antifungal agents including AMB were observed. The tested strains proved to belong to clades 5 and 4 in later research (Chapter 1). We can conclude that isolates in clades 5 and 4 are not significantly different in antifungal susceptibility.

Phylogeny and sexuality of Exophiala

141 Chapter 8

The anamorphs of major Capronia teleomorphs can be predicted to belong to Exophiala [14-19], while the number of described species of Exophiala with a proven Capronia teleomorph, conspecific to or even close in morphological and physiological parameters [20-23], is very small. Nevertheless, phylogenetic analysis offered evidences supporting the sexual relation between Capronia and Exophiala. On a phylogenetic tree of 18S rDNA of black yeast and relatives, Capronia species distributed to different Exophiala clades (PhD thesis, M. J. Harrak, 2008). This close relationship between some Exophiala and Capronia species shown on the 18S tree was rarely found at lower levels of diversity, such as ITS sequences (e.g. E. angulospora and C. coronata). In the SSU distance tree of a selected number of members of Herpotrichiellaceae, Capronia species tended to be located at the centre of the tree individually or near the base of clades [22], usually in isolated position; and nearly all are environmental (e. g. hyperparasites), while clonal Exophiala species tend to be medical. It was inferred that heterothallic Capronia teleomorphs were phylogenetically older, while further evolutionary development might have taken place by clonal reproduction during a relatively period of evolutionary time, as shown in the splittree made by Haase et al [22]. This hypothesis was supported by that the reproductive modes of most Exophiala species were detected to be clonal in this study. The clonal mode was promoted by a shift in ecology, with a marked tendency of specialization on hitherto unknown substrate that enable invasion in human tissue. A similar evolution of species was recently surmised for anthropophilic dermatophytes [24].

Species recognition and circumscription Though the genera involved in this thesis (Pseudallescheria and Exophiala) belong to different order of Euascomycetes, both of them are problematic in species recognition with criteria of Morphological Species Recognition (MSR) and Biological Species Recognition (BSR). The morphological circumscription of teleomorph species P. bodii, P. angusta, P. ellipsoidea and P. fusoidea is narrow; anamophs are identical. Most isolates maintained as P. boydii fail to produce cleistothecia regardless of growth conditions. Since Pseudallescheria teleomorphs are homothallic, mating tests can not be used for identification according to the criterion of BSR. For Exophiala species, morphology is rather unreliable for species identification due to variable appearance. The genus Capronia, comprising teleomorphs of

142 General discussion

Exophiala, are heterothallic, but the number of Exophiala with a proven Capronia teleomorph in morphological, physiological and genetic parameters is limited [20-23]. Main species in the E. spinifera clade were also clonal and polymorphic. It is possible that when new environments are explored, additional, undescribed taxa will be discovered, and these species will be subdivided to different species. Phenotypic and ecological characters are very important to determine limits of species. When GCPSR was applied to the P. boydii complex, it seemed to work well for recombining clusters (clades 4 and 5B), to which novel species could be assigned. But for the clonal cluster (clade 5A), which is polymorphic and contains two morphological species (P. boydii and P. ellipsoidea), GCPSR failed to defined species. Thus, circumscription of species can not be delimited even with GCPSR when clusters are clonal. This situation also applies to anthropophilic dermatophytes [24].

Pathogenicity and ecology of Exophiala Fifteen out of 26 described species of the genus Exophiala are potential agents of human and animal diseases. Eleven of them, including two novel species that will be described soon [PhD thesis, J. M. Harrak, 2008], were encountered during a survey of clinically relevant Exophiala species in the USA. (Chapter 4). The three most frequent etiologic agents were E. dermatitidis, E. xenobiotica and E. oligosperma. They covered more than 65% of isolates in the study. E. jeanselmei, to which most cases in older literature were ascribed, appeared to be relatively rare. This is due to the fact that a number of cryptic species included in E. jeanselmei previously, such as E. heteromorpha [25], E. lecanii-corni [22], E. oligosperma [25] and E. xenobiotica [26] were established on molecular grounds only recently. The frequency of deep mycoses caused by the studied set of isolates is almost two- fifths (39.9%), and thus significantly higher than that of the categories of subcutaneous and superficial mycoses, and also slightly higher than that of cutaneous mycoses. The result from this study firstly demonstrated that the deep mycoses due to Exophiala species are not scarce and probably most frequent among the spectrum of mycoses. The prevalent type of deep infections is that of the respiratory system. Pulmonary infections are mostly not invasive, but probably subclinical colonization is concerned, as observed in patients with cystic fibrosis

143 Chapter 8

(CF) [27;28]. Cerebral infections caused by Exophiala species are very rare in the USA. In Asia, cerebral infection in healthy adolescents is a remarkable clinical syndrome. At least 11 fatal cases were reported [29-31]. Primary cerebral infection caused by E. dermatitidis appears to occur nearly only in Asian patients, the possibility of race-dependent virulence has been suggested [32]. Cases of disseminated infection caused by E. spinifera are absent from the USA. But severe deep infection cases have been reported in individuals without known immune disorder outside the USA. [33-35]. The only pseudoepidemic deep infections caused by Exophiala in USA concerned contaminated steroid injections, the fungi being directly inoculated into the circulation [36]. The reason of absence of severe deep infection cases due to E. spinifera in USA is unknown. E. dermatitidis is the most common etiologic agent of systemic infections due to Exophiala. E. xenobiotica, a recent segregant of E. jeanselmei, takes over E. jeanselmei to become the most frequent opportunist causing cutaneous and subcutenous mycoses of humans in the genus Exophiala. E. dermatitidis, E. xenobiotica and E. oligosperma were repeatedly isolated not only from human patients but also from material rich in aromatic hydrocarbons in the environment [26;37] (M. Sudhadham, pers. comm.). Recently, a few black yeasts species were enriched from oak, creosote-treated railway tie in the Netherlands, which formed a new clade close to E. bergeri in the phylogenetic tree of ITS rDNA gene (J. Zhao, pers. comm.). Prenafeta-Boldú et al. [38;39] noted a distinct association with monoaromates in black yeasts and filamentous relatives of the order Chaetothyriales, confirming earlier reports [40;41]. For Exophiala and its relatives, the relationship of opportunistic potential and ability of assimilating alkylbenzenes as a sole source of nutrient indicates that a thus far unknown type of virulence factors may be concerned [38;39].

Diagnostics of human associated Exophiala species As representatives of the genus Exophiala, diagnostics of the E. spinifera clade was reviewed in Chapter 6. Only a limited number of taxa can be recognized by morphological features. Available physiological data are insufficient to separate all species in the E. spinifera clade, particularly E. jeanselmei, E. oligosperma and E. xenobiotica which share similar morphologies. Exoantigen tests are promising diagnostic tools, but as yet they have not been developed sufficiently to be used routinely. No specific histopathological features are

144 General discussion available to differentiate species of the E. spinifera clade from other black yeasts and relatives. When species-specific microscopic structures are absent or there are no distinguishable differences in morphology, physiology or immunology, molecular data offer tools for accurate identification. A large diversity of molecular biological methods has been applied in classification, phylogeny and identification of the species in the E. spinifera clade and epidemiological research of the infections due to these species with rDNA, mtDNA or protein coding genes [22;25;26;42-47]. These studies uncovered the genetic variation of related species at different diversity levels and gave clues for the species diagnosis. Performing DNA-DNA hybridization requires specific probes for each species. Banding methods used for distinguishing species, such as RFLP and RAPD, sometimes need several endoenzymes to digest DNA fragments and, in case of RAPD, may lack stability. Most of the tested genes showed interspecific divergences slightly below the species level, but they are not commonly studied and an insufficiently large number of Exophiala species has been analysed. Sequencing the ITS region of the rDNA gene has been most frequently applied in phylogenetic studies of the genus Exophiala. In Chapter 5, the phylogenetic trees of the E. spinifera clade applying the ITS sequences revealed similar topologies to those resulting from other coding genes. Therefore, the optimal method for identification of species in the E. spinifera clade remains to be sequencing ITS region of rDNA. DNA barcoding as a standardized approach to identify species by a short gene sequence from a uniform region in the genome [http://www.barcoding.si.edu] has been advocated for a few years. Cytochrome c oxidase subunit I (COI) region of mitochondrial DNA was proposed as the barcode gene in the animal kingdom [48]. This region also showed potentiality in identifying fungal species in a test set using Penicillium subgenus Penicillium and 12 allied taxa [49]. The development of a barcoding system for fungi that shares a common gene target with other kingdoms would be a significant advantage. However, for Exophiala species, comparable data are absent. Based on the present genetic data from species in the E. spinifera clade, the ITS region could be the optimal candidate for barcodes of species in the clade. Given the preponderantly clonal mature of clinical Exophiala species, we extrapolate that sequencing the ITS region maybe also suitable for barcoding for the identification of black yeasts in the clinical laboratory.

145 Chapter 8

Reference

1. Guého E, de Hoog GS. Taxonomy of the medical species of Pseudallecheria and Secedosporium. J Mycol Méd 1991; 1: 3-9.

2. Issakainen J, Jalava J, Eerola E, et al. Relatedness of Pseudallescheria, Scedosporium and Graphium pro parte based on SSU rDNA sequences. J Med Vet Mycol 1997; 35: 389-398.

3. Issakainen J, Jalava J, Hyvonen J, et al. Relationships of Scopulariopsis based on LSU rDNA sequences. Med Mycol 2003; 41: 31-42.

4. Rainer J, de Hoog GS, Wedde M, et al. Molecular variability of Pseudallescheria boydii, a neurotropic opportunist. J Clin Microbiol 2000; 38: 3267-3273.

5. Gilgado F, Cano J, Gené J, et al. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J Clin Microbiol 2005; 43: 4930-4942.

6. Zouhair R, Defontaine A, Ollivier C, et al. Typing of Scedosporium apiospermum by multilocus enzyme electrophoresis and random amplification of polymorphic DNA. J Med Microbiol 2001; 50: 925-932.

7. Zeng JS, Fukushima K, Zheng YC, et al. Characterization of Pseudallescheria boydii and Scedosporium apiosperium by Random Amplification of Polymorphic DNA Assay. Chin J Dermatol 2005; 38: 485-487.

8. Sugita T, Nakajima M, Ikeda R, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J Clin Microbiol 2002; 40: 1826- 1830.

9. Radford SA, Johnson EM, Leeming JP, et al. Molecular epidemiological study of Aspergillus fumigatus in a bone marrow transplantation unit by PCR amplification of ribosomal intergenic spacer sequences. J Clin Microbiol 1998; 36: 1294-1299.

10. de Hoog GS, Marvin-Sikkema FD, Lahpoor GA, et al. Ecology and physiology of the emerging opportunistic fungi Pseudallescheria boydii and Scedosporium prolificans. Mycoses 1994; 37: 71-78.

11. Rainer J, de Hoog GS. Molecular taxonomy and ecology of Pseudallescheria, Petriella and Scedosporium prolificans (Microascaceae) containing opportunistic agents on humans. Mycol Res 2006; 110: 151-160.

12. Gilgado, F., Cano, J., Gene, J., and Guarro, J. Characterization of Scedosporium frequentans: the most common species of the P. boydii complex. 2006. Paris, France, the 16th Congress of the International Society for Human and Animal Mycology. 25-6- 2006. Ref Type: Conference Proceeding

146 General discussion

13. Gilgado F, Serena C, Cano J, et al. Antifungal susceptibilities of the species of the Pseudallescheria boydii complex. Antimicrob Agents Chemother 2006; 50: 4211-4213.

14. Schol-Schwarz MB. Rhinocladiella, its synonym Fonsecaea and its relation to Phialophora. Antonie Leeuwenhoek 1968; 34: 119-152.

15. Samuels GJ, Müller E. Life-history studies of Brazilian ascomycetes. 3. Melonomma radicans sp. nov. and its Aipiosphaeria anamorph, Trematosphaeria perrumpens sp. nov. and Berlesiella fungicola sp. nov. and its Ramichloridium anamorph. Sydowia 1978; 31: 142-156.

16. Müller E, Pitrini O, Fisher PJ, et al. Taxonomy and anamorphs of the Herpotrichiellaceae with notes on genetic synonymy. Trans Brit Mycol Soc 1987; 88: 63-74.

17. Untereiner WA, Straus NA, Malloch D. A molecular-morphotaxonomic approach to the systemics of the Herpotrichiellaceae and allied black yeasts. Mycol Res 1995; 99: 897- 913.

18. Untereiner WA. Fruiting studies in species of Capronia (Herpotrichiellaceae). Antonie Leeuwenhoek 1995; 68: 3-17.

19. Untereiner WA. Taxonomy of selected members of the ascomycete genus Capronia with notes on anamorph-teleomorph connections. Mycologia 1997; 89: 120-131.

20. Haase G, Sonntag L, van de Peer Y, et al. Phylogenetic analysis of ten black yeast species using nuclear small subunit rRNA gene sequences. Antonie Leeuwenhoek 1995; 68: 19-33.

21. Masclaux F, Guého E, de Hoog GS, et al. Phylogenetic relationships of human- pathogenic Cladosporium (Xylohypha) species inferred from partial LSU rRNA sequences. J Med Vet Mycol 1995; 33: 327-338.

22. Haase G, Sonntag L, Melzer-Krick B, et al. Phylogenetic interference by SSU-gene analysis of members of the Herpotrichiellaceae with spcial reference to human pathogenic species. Stud Mycol 1999; 43: 80-97.

23. Untereiner WA, Gerrits van den Ende AHG, de Hoog GS. Nutritional physiology of species of Capronia. Stud Mycol 1999; 43: 98-106.

24. Graeser Y, de Hoog GS, Summerbell RC. Dermatophytes: recognizing species of clonal fungi. Med Mycol 2006; 44: 199-209.

25. de Hoog GS, Vicente V, Caligiorne RB, et al. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J Clin Microbiol 2003; 41: 4767-4778.

147 Chapter 8

26. de Hoog GS, Zeng JS, Harrak MJ, et al. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie Leeuwenhoek 2006; 90: 257-268.

27. Horre R, Schaal KP, Siekmeier R, et al. Isolation of fungi, especially Exophiala dermatitidis, in patients suffering from cystic fibrosis. A prospective study. Respiration 2004; 71: 360-366.

28. Diemert D, Kunimoto D, Sand C, et al. Sputum isolation of Wangiella dermatitidis in patients with cystic fibrosis. Scand J Infect Dis 2001; 33: 777-779.

29. Matsumoto T, Matsuda T, McGinnis MR, et al. Clinical and mycological spectra of Wangiella dermatitidis infections. Mycoses 1993; 36: 145-155.

30. Hiruma M, Kawada A, Ohata H, et al. Systemic phaeohyphomycosis caused by Exophiala dermatitidis. Mycoses 1993; 36: 1-7.

31. Chang CL, Kim DS, Park DJ, et al. Acute cerebral phaeohyphomycosis due to Wangiella dermatitidis accompanied by cerebrospinal fluid eosinophilia. J Clin Microbiol 2000; 38: 1965-1966.

32. Horre R, Schaal KP, Siekmeier R, et al. Isolation of fungi, especially Exophiala dermatitidis, in patients suffering from cystic fibrosis. A prospective study. Respiration 2004; 71: 360-366.

33. Negroni R, Helou SH, Petri N, et al. Case study: posaconazole treatment of disseminated phaeohyphomycosis due to Exophiala spinifera. Clin Infect Dis 2004; 38: e15-e20.

34. Rajendran C, Khaitan BK, Mittal R, et al. Phaeohyphomycosis caused by Exophiala spinifera in India. Med Mycol 2003; 41: 437-441.

35. Wang D, Li R, Wang X, et al. Studies on three strains of Exophiala spinifera. Acta Mycol Sin 2007; 6: 229-232.

36. Engemann J, Kaye K, Cox G, et al. Exophiala infection from contaminated injectable steroids prepared by a compounding pharmacy-United States. MMWR Morb Mortal Wkly Rep 2002; 51: 1109-1112.

37. Estevez E, Veiga MC, Kennes C. Biofiltration of waste gases with the fungi Exophiala oligosperma and Paecilomyces variotii. Appl Microbiol Biotechnol 2005; 67: 563-568.

38. Prenafeta-Boldu FX, Sumerbell RC, de Hoog GS. Fungi growing on aromatic hydrocarbons: biotechnology's unexpected encounter with biohazard? FEMS Microbiol Rev 2006; 30: 109-130.

148 General discussion

39. Prenafeta-Boldú FX, Kuhn A, Luykx DMAM, et al. Isolation and characterisation of fungi growing on volatile aromatic hydrocarbons as their sole carbon and energy source. Mycol Res 2001; 105: 477-484.

40. Cox HHJ, Moerman RE, Van Baalen S, et al. Performance of a styrene-degrading biofilter containing the yeast Exophiala jeanselmei. Biotechnol Bioengin 1997; 53: 259- 266.

41. Middelhoven WJ. Catabolism of benzene compounds by ascomycetous and basidiomycetous yeasts and yeastlike fungi. A literature review and an experimental approach. Antonie Leeuwenhoek 1993; 63: 125-144.

42. Ishizaki H, Kawasaki M, Nishimura K, et al. Mitochondrial DNA analysis of Exophiala spinifera. Mycopathologia 1995; 131: 67-70.

43. Kawasaki M, Ishizaki H, Matsumoto T, et al. Mitochondrial DNA analysis of Exophiala jeanselmei var. lecanii-corni and Exophiala castellanii. Mycopathologia 1999; 146: 75- 77.

44. Kawasaki M, Anzawa K, Tanabe H, et al. Intra-species variation of genotypes of Exophiala jeanselmei isolated from patients in Japan. Nippon Ishinkin Gakkai Zasshi 2005; 46: 261-265.

45. Masuda M, Naka W, Tajima S, et al. Deoxyribonucleic acid hybridization studies of Exophiala dermatitidis and Exophiala jeanselmei. Microbiol Immunol 1989; 33: 631- 639.

46. Vitale RG, de Hoog GS. Molecular diversity, new species and antifungal susceptibilities in the Exophiala spinifera clade. Med Mycol 2002; 40: 545-556.

47. Wang L, Yokoyama K, Miyaji M, et al. Identification, classification, and phylogeny of the pathogenic species Exophiala jeanselmei and related species by mitochondrial cytochrome b gene analysis. J Clin Microbiol 2001; 39: 4462-4467.

48. Hebert PD, Cywinska A, Ball SL, et al. Biological identifications through DNA barcodes. Proc Biol Sci 2003; 270: 313-321.

49. Seifert KA, Samson RA, Dewaard JR, et al. From the Cover: Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case. Proc Natl Acad Sci USA 2007; 104: 3901-3906.

149 Chapter 8

150 Appendix

Summary List of publications and abstracts Acknowledgements

Curriculum vitae

151 Appendix

Summary The genera Pseudallescheria and Exophiala contain opportunists on humans. They belong to the order Microascales and Chaetothyriales of Ascomycetes, respectively. Both of them are problematic in species recognition with criteria of Morphological Species Recognition (MSR) and Biological Species Recognition (BSR). In order to guide diagnosis of the human associated species in these 2 genera, the inter- and intraspecific diversities were detected and the recognitions of species were furthered with genetic methods in the present study. Polymorphisms within P. boydii complex were revealed in the sequences of 3 loci, which are the D1/D2 region of large subunit (LSU) and the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) gene, and the partial Elongation Factor 1-α (EF 1-α) gene. The polymorphism was also detected with Restriction Fragment Length Polymorphism (RFLP) analysis of the intergenic spacer (IGS) region of rDNA gene. Clustering based on the sequences of the D1/D2 region in present research are congruent basically with those on nDNA homology data, the combined data of sequences of partial β-tubulin (BTU) and calmodulin genes and the ITS region of rDNA in previous studies. Based on multilocus sequence data set (the D1/D2 region and ITS region of rDNA gene and partial EF 1-α gene), the isolates in P. boydii complex were divided into 3 clusters, namely clades 4, 5A and 5B. Partition Homogeneity Test (PHT) performed with the multilocus sequence data set of D1/D2, ITS and EF 1-α indicated that the genealogies of these 3 loci were not congruent within P. boydii complex. Recombination was revealed in clades 4 and 5B by linkage disequilibrium analysis. With the criterion of Genealogical Concordance Phylogenetic Species Recognition (GCPSR), the isolates in clades 4 and 5B could be assigned to 2 novel species. Recently strains belonging to clade 4 have been defined as new species Scedosporium frequentans. Clade 5B comprised morphological species P. boydii, P. angusta and P. fusoidea. Whether this clade should be described as single species or just keep primary species recognition is not decided. Clonality was implied in clade 5A which was polymorphic. This clade contained the type strains of P. boydii and P. ellipsoidea, originally described to produce teleomorphs. We therefore assume that populations of P. boydii and P. ellipsoidea may show a high degree of inbreeding. RFLP analysisof the IGS region detected a level of high diversity between those of the EF 1-α group and the individual strains. With the present set of strains we did not observe a

152 Summary clear pattern from the point of view of geography or ecology, suggesting a world wide distribution of P. boydii. However, 2 invasive strains were found in clade 5A, while preponderantly colonizers of cavities (pulmonary and maxillary) were found in clade 4, and isolation of clade 5B is mainly environmental. This situation corresponds to the result of DNA/DNA reassociation analysis. The suggestion that there are differences in virulence to humans between members of groups of P. boydii complex thus is approximately confirmed. In this research, cleistothecia were observed in 3 P. boydii isolates. No obvious predilection of the ability to develop cleistothecia was uncovered among the individuals in clades 5A and 5B. The frequency of the Graphium anamorph in clade 4 appeared higher than those in the other groups. This tendency was also observed in other studies. Morphologically identified strains of P. boydii and S. apiospermum belonged to clade 5 and 4 shared similar antifungal susceptibilities.

So far 15 of 26 described species of the genus Exophiala are potential agents of human and animal mycoses. In the investigation of clinically relevant Exophiala species in the USA, the 3 most common etiological species are E. dermatitidis, E. xenobiotica and E. oligosperma. They covered more than 65% of isolates in the study. The previously common clinical species E. jeanselmei appeared to be relatively rare. The frequency of deep mycoses is almost two-fifths (39.9%), and thus significantly higher than those of the categories of subcutaneous and superficial mycoses, and also slightly higher than that of cutaneous mycoses. The most frequent deep infections are those of the respiratory system. Pulmonary infections are mostly not invasive. Cerebral infections caused by Exophiala species are very rare, and disseminated infection caused by E. spinifera are absent in the study. E. dermatitidis is the most common etiologic agent of systemic infections due to Exophiala. E. xenobiotica replaces E. jeanselmei to become the most frequent agent causing cutaneous and subcutenous mycoses on human in the genus of Exophiala. E. dermatitidis, E. xenobiotica and E. oligosperma were repeatedly isolated from material rich in aromatic hydrocarbons in the environment. The relationship of opportunistic potential and ability of assimilating alkylbenzenes as a sole source of nutrient indicates that a thus far unknown type of virulence factors may be concerned.

155 Appendix

Reconstructed with different algorithms, the phylogeny of E. spinifera clade depending on the ITS region sequences is confirmed to be basically congruent with those on sequences of the partial EF 1-α, BTU and Actin (ACT) genes. The reproductive modes of most clusters on the phylogenetic trees attributed to different morphological Exophiala species were detected to be clonal and polymorphic based on multilocus genetic data set (the ITS region of rDNA gene, the partial EF 1-α, BTU and ACT genes). GCPSR is not effective on locating borderlines of species, and phenotypic features determine limits of species in this situation. Diagnostical and stable morphological, physiological, immunological and histological characters are insufficient for identification of species in the E. spinifera clade. Sequencing the ITS region of rDNA is a promising diagnostic method for this clade. DNA barcoding is proposed as a standardized approach to identify species by a short gene sequence from a uniform region in the genome. Based on the data from species in the E. spinifera clade, the ITS region could be the optimal candidate for barcodes of these species. Sequencing the ITS region maybe is also suitable for barcoding the whole Exophiala genus.

154 Publications

List of Publications 1. J. S. Zeng and G. S. de Hoog. Exophiala spinifera clade and allies: diagnostics from morphology to DNA barcoding. Medical Mycology. (submitted in June, 2007) 2. J. S. Zeng, M. J. Harrak, A. H. G. Gerrits van den Ende and G. S. de Hoog. Phylogeny of Exophiala spinifera clade using multilocus sequences and exploring phylogenetic species. Studies in Mycology. (submitted in April, 2007) 3. J. S. Zeng, D. A. Sutton, A.W. Fothergill, M.G. Rinaldi, M. J. Harrak and G. S. de Hoog. Spectrum of clinically relevant Exophiala species in the U.S.A. Journal of Clinical Microbiology (accepted in June, 2007) 4. J. S. Zeng, K. Fukushima, K. Takizawa , Y. C. Zheng , K. Nishimura, Y. Gräser & G. S. De Hoog. Intraspecific diversity of species of Pseudallescheria boydii complex. Medical Mycology (accepted in May, 2007) 5. J. S. Zeng, C. M. de Souza Motta, K. Fukushima, K. Takizawa, O. M. Correia Magalhes, R. Pereira Neves, K. Nishimura. Identification of Trichosporon spp. strains by sequencing D1/D2 region and sub-typing by sequencing ribosomal intergenic spacer region. Brazilian Journal of Microbiology (submitted in December, 2006) 6. J. S. Zeng, K. Fukushima, Y. Zheng, K, Takizawa, K. Nishmura. 2007. Comparison among inoculum forms of Pseudallescheria boydii isolates on antifungal susceptibility to three azole agents in vitro. Chinese Journal of Leprosy and Skin Disease 23: 12. 7. G. S. de Hoog, J. S. Zeng, M. J. Harrak, & D. A. Sutton. 2006. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie van Leeuwenhoek 90: 257. 8. S. Surash, A. Tyagi, G. S. de Hoog, J. S. Zeng, R. C. Barton, R. P. Hobson. 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Medical Mycology 43: 465. 9. J. S. Zeng, K. Fukushima, Y. C. Zheng, K, Takizawa, K. Nishimura. 2005. Characterization of Pseudallescheria boydii and Scedosporium apiospermum by Random Amplification of Polymorphic DNA Assay. Chinese Journal of Dermatology 38: 485.

155 Appendix

10. J. Zeng, K. Kamei, Y. Zheng, K. Nishimura. 2004. Susceptibility of Pseudallescheria boydii and Scedosporium apiospermum to new antifungal agents. Nippon Ishinkin Gakkai Zasshi 45: 101 11. J. S. Zeng, Y. C. Zheng, Y. Q. Wu, Z. J. Tan, L. Lian. 2004. Effect of inoculum form on in vitro antifungal susceptibilities of some filamentous fungi to terbinafine. Chinese Journal of Dermatology 37: 452 12. Y. C. Zheng, Z. J. Tan, Z. R. Zhu, J. S. Zeng, Y. Q. Wu. 1995. Clinical Significance of Fungi-bearing Status of Inpatients. Journal of Chinese Medicine 75: 552 13. Y. C. Zheng, Z. J.Tan, Y. Q. Wu, J. S. Zeng, Z. R. Zhu. 1995. Preliminary Studies on Clinical Fungi-bearing Status of Patients. Acta Universitatis Medicines Tongji 24(Suppl.): 73

List of Abstracts 1. J. S. Zeng, D. A. Sutton and G. S. de Hoog. 2005. Identification and pathogenicity of clinical isolates of genus Exophiala from the U.S.A. Wetenschappelijke Voorjaarsvergadering, de Netherlandse Vereniging voor Medische Microbiologie en de Netherlandse Vereniging voor Microbiologie. Arnhem, the Netherlands.

2. J. S. Zeng, G. S. de Hoog. 2006. Diagnosis of the genus Exophiala: agents of human mycoses. the 16th Congress, International Society for Human and Animal Mycology. Paris, France.

3. J. S. Zeng, Fukushima, K. Takizawa, Y. C. Zheng, K. Nishimura, G. S. de Hoog.

2006. Molecular identification and subspecific typing of Pseudallescheria boydii. the 16th Congress, International Society for Human and Animal Mycology. Paris, France. 4. J. S. Zeng, K. Fukushima, K. Takizawa, Y. C. Zheng, K. Nishimura, Y. Graeser, G. S. de Hoog. 2006. Species recognition of Pseudallescheria boydii complex. Joint meeting Netherlands Society for Medical Mycology and Sektion Antimykotische Chemotherapie der Paul-Ehrlich-Gesellschaft für Chemotherapie (Germany). Nijmegen, the Netherlands. 5. J. S. Zeng, J. J. Zhao, M.J. Harrak, A. H. G. Gerrits van den Ende, G.S. de Hoog. Phylogeny of the Exophiala spinifera clade in search of new virulence factors. 2007.

156 Publications

Wetenschappelijke Voorjaarsvergadering, de Netherlandse Vereniging voor Medische Microbiologie en de Netherlandse Vereniging voor Microbiologie. Arnhem, the Netherlands. 6. J. S. Zeng, J. J. Zhao, M.J. Harrak, A. H. G. Gerrits van den Ende, G.S. de Hoog. Phylogeny of the Exophiala spinifera clade in search of new virulence factors. 2007. International Workshop: "Black Yeasts between Extremotolerance and Human Pathology". Utrecht, the Netherlands. 7. J. J. Zhao, J. S. Zeng, G. S. de Hoog. 2007. Alkylbenzene assimilation, a new virulence factor? International Workshop: "Black Yeasts between Extremotolerance and Human Pathology". Utrecht, the Netherlands. 8. J. S. Zeng, K. Fukushima, K. Takizawa, Y. C. Zheng, K. Nishimura, Y. Graeser, G. S.

de Hoog. 2007. Molecular intraspecific diversity of Pseudallescheria boydii with recombination: multi-locus analysis, 2nd Meeting of the ECMM-ISHAM working group on Pseudallescheria/Scedosporium infections. Angers, France.

157 Appendix

Acknowledgements

Since my childhood, I have had a dream to study oversea and gain highest university degree in a scientific field. This is also one of my parents’ wishes for me. Three years ago, when I failed to find a chance to get PhD degree in Japan, one of my best friends, Dr. Paride Abliz (Department of Dermatology, First Hospital, Xinjiang Medical University, P. R. China) recommended me to Prof. G. S. de Hoog to join a China-Netherlands bilateral project. After I expressed my dream to Prof. G. S. de Hoog, he told me that you could make your dream true in CBS. I feel that I am one of most lucky persons in the world. First, thank you, Sybren, my PhD promotor, from my heart for opening the door of kingdom of fungi for me and leading me to achieve to my goal. It has been a privilege to work with such a visionary and practical mycologist as yourself. I greatly appreciated your enthusiasm for medical mycology having an always young and active heart in life. Thank you for your patience with my poor ‘Chinglish’ (Chinese English) and understanding my Chinese mentality. Your hospitality and thoughtfulness gave me deep impression. I enjoyed the parties held in your home and the exciting cycling trip along the canal to Amsterdam organized by you. A part of my PhD research was done in Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Japan under the supervision of Prof. K. Nishimura, Prof. K. Fukushima and Prof. K. Kamei. You are my first supervisors and friends outside China. Prof. K. Fukushima and Dr. K. Takizawa are my first teachers teaching me molecular biological technique. Thank all of you and the other friends in the center for many helps and kindness to me. The knowledge and techniques I learnt from you are foundation stones for my later study in CBS and also for my future work. As my PhD co-promoter, Dr. Y. Gräser (Humboldt University, Germany), you gave me suggestions of analyzing population structure and productive mode of my data, and taught me personally to operate programs for the analysis. With your help, the difficultly interpretable results became acceptable. Your comments to my thesis are much helpful for me to improve

158 Acknowledgements it. Though we did not contact frequently, you really play an important role in my PhD study. My thanks go to you for your outstanding promoting work for me.

A lot of thanks give to present and previous members, PhD students, guests and stagiairs I met in ‘BYP’ group (Department of Ecology of Clinical fungi) of CBS. Though your name, Bert Gerrits van den Ende, is not in the list of my PhD promoters, you are a real co-promoter in my heart. Your thorough knowledge of molecular techniques and phylogeny strongly supported my practical work and datum analysis. Thank you for letting me share your rich experiences in the work. Your warmhearted help was very much appreciated. Kasper Luijsterburg, my daily supervisor, I prefer to calling you as ‘a computer expert’ of our group. You solved the problems happened to my PC and told me a lot of tips for running computer software. With your management of cultures in ‘BYP’ collection, I could efficiently work with my strains. Thank you not only for helping me to finish my research smoothly, but also for teaching me computer’s knowledge, which will also bring benefits in my future life. I would like to acknowledge Dr. Richard Summerbell for giving comments to my thesis. His knowledge greatly widened my view in medical mycology. My heart is filled with gratitude to a fellow PhD student, Mohamed Jamal Harrak and Dr. Grit Walther. We came from different countries and have totally different culture backgrounds, but we learnt from each other and helped each other in the work, and enjoyed different views over life. I am grateful for both of you for giving strength to me to persist in studying in the Netherlands for 3 years and for your helpfulness in organizing the defense of this thesis as my paranymphs. I also would like to express my thanks to fellow PhD students Montarop Sudhadham, Hamid Badali and Mohammad Javad Najafzadeh as well as my Chinese colleagues Dr. Shuwen Deng and Dr. Jingjun Zhao. We met and studied in CBS for the same aim. Sharing happiness or difficulties with you made my life colorful and significant. Mark Wuite, my first lab mate, your kindness and helpfulness in first several months I stayed in CBS are much appreciated. There are many people from the staff of CBS to whom I would like to extend my acknowledgements and a few people in specific. Thank Janny, Yda and Rina for finding or reviving cultures from the CBS collection for me immediately every time; Trix, for helping

159 Appendix

me to deposit my strains in the collection; Arien, for teaching me how to prepare herbarium specimens and making a sample for me in person; Lizel and Mahdi, for assisting me in taking beautiful microscopic photos of fungi; Marizeth and Ewald, for concerning my thesis preparation and giving helps when I moved; Tineke and Manon, for arranging accommodation for me and my friends when we just came to the Netherlands; Manon, also for giving nice suggestions for designing my thesis’s cover; every member in Events Commission of CBS, for organizing exciting parties and trips every year, which I enjoyed greatly. My appreciation also goes to Susann in Human Resource Management for helping me to apply documents and certifications needed for my staying in the Netherlands. I can not forget all people who friendly offered the isolates used in my study, specially, Prof. D. Sutton (Fungus Testing Laboratory, University of Texas Health Science Center, U.S.A.), Prof. K. Nishimura (Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Japan) and Prof. L. Xi (Second Affiliated Hospital, Sun Yat-Sen University, P. R. China). Sincerely thank for your supports. Here I would like to thank Prof. R. Li (First Hospital and Research Centre for Medical Mycology of Peking University, China) for cooperating with Prof. G. S. de Hoog to gain the joint project which supported my research in CBS, and also thank Dr. Paride Abliz for offering an opportunity to me to approach my dream. The encouragements from my tutors for Master’s degree, Prof. Z. Zhu and Prof. Y. Zheng (Department of Dermatology and Venereology, Union Hospital, Tongji Medical College, Huazhong Science and Technology University, P. R. China) are appreciated as well. Thank all of you for concerning with my study all the time. Lastly I want to thank my parents for having encouraged me to studying continuously and looked after my daughter frequently during more than 10 years. My deepest gratitude is due to you, my husband, for your patience, understanding, and support. My dear daughter, I am happy with every progress you made. We will have a normal life soon as every happy family.

160 Curriculum vitae

Curriculum vitae

Jinsi Zeng was born on the 15th of July, 1967 in Wuhan, Hubei, P. R. China. She studied at the Faculty of Medicine, Tongji Medical College, Huazhong Science and Technology University, P. R. China, where she gained the degree of Bachelor of Medicine in 1990. She continued with her 3-year postgraduate study and obtained Master’s degree in Medicine at the same university. Since September, 1993 she worked at Department of Dermatology and Venereology, Union Hospital, which is affiliated to the university where she graduated as associated lecturer and resident physician. In 1996, she was promoted to lecturer and physician in charge. Supported by scholarship from Chinese government, from 2002 to 2003 as a visiting scholar she worked with the fungal opportunists on human, Pseudallescheria spp. in the Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan. One year later, she was invited by Prof. G. S. de Hoog to join the joint research project ‘Comparative genomics in search of origins of human pathogenicity in the fungal Tree of Life focusing on species with high morbidity and mortality in Chinese patients’, which belonged to Scientific cooperation between China and the Netherlands Academy of Arts and Sciences, China Exchange Programme. In October, 2004, she started her PhD at CBS Fungal Biodiversity Centre, Utrecht, the Netherlands, supported by the joint project. During the 3 years of PhD student, her research focused on species recognition and diagnostics of Pseudallescheria spp. and Exophiala spp.. After finishing her PhD study, she went back to China and continued serving at the previous hospital.

161

Layout and design: the author, Kasper Luijsterburg and Manon van den Hoeven Verweij

Front and back cover: microscopy photos of Exophiala xenobiotica CBS118157 (background)

Front cover insets: microscopy photos of (form top to bottom) Pseudallescheria boydii CBS 101.21, P.

ellipsoidea CBS 418.73, P. a fr ic a na CBS 311.72 and P. fusoidea CBS 106.54

Printed at Ponsen & Looijen B.V., Wageningen, Netherlands

162