Role of Autophagy in Normal and Malignant Hematopoiesis

Role of autophagy in normal and malignant

hematopoiesis

A dissertation submitted to the Division of Research and Advanced Studies of the

University of Cincinnati

in partial fulfillment of the requirement for the degree of

Doctor of Philosophy (Ph.D.)

in the Department and Cancer and Cell Biology

of the College of Medicine

2016

Xiaoyi Chen

M.D. Sichuan University

Committee Members:

Maria Czyzyk-Krzeska, MD, PhD

Marie-Dominique Filippi, PhD

Gang Huang, PhD

Daniel Starczynowski, PhD

Yi Zheng, PhD (Chair)

1 Abstract

In this thesis work, we investigate the role of autophagy in normal and malignant hematopoiesis.

In normal hematopoiesis, we study the mechanism of autophagy regulation by mTOR in hematopoietic stem and progenitor cells (HSPCs) using genetic mTOR knockout and knock-in mouse models. We find that HSPCs have varied basal autophagy activity in different subpopulations, higher in more primitive hematopoietic stem cells (HSC) and lower in more differentiated progenitor cells, suggesting varied dependence on autophagy in these cells. We also observe that the autophagy activity responds differently to mTOR deletion in HSPCs subpopulations. HSC and GMP subpopulations show mTOR independent autophagy regulation, while CMP has increased autophagy activity upon mTOR deletion. We speculate that a compensatory kinase pathway in HSC and GMP exists to negatively regulate autophagy activity upon mTOR loss in HSC population based on our kinase inhibitor data. We also find that the autophagy response in mTOR knock-in cells is similar to mTOR knockout, suggesting that mTOR regulates autophagy through its kinase function, not a protein scaffolding effect. The autophagy response in Raptor knockout cells mimics that of the mTOR knockout, indicating that mTORC1 regulates autophagy in HSPCs. This project is progressing and more studies are needed to validate our current observations and conclusions.

In malignant hematopoiesis, we investigate the therapeutic potential of inhibiting autophagy for

AML treatment. We show that Kmt2a/Mll-Mllt3/Af9 AML (MA9-AML) cells have high autophagy flux compared to normal bone marrow cells, but autophagy-specific targeting, either through

Rb1cc1-disruption to abolish autophagy initiation, or via Atg5-disruption to prevent autophagosome membrane elongation, does not affect the growth or survival of MA9-AML cells, either in vitro or in vivo. Mechanistically, neither Atg5 nor Rb1cc1 disruption impairs the endolysosome formation or survival signaling pathways. The autophagy inhibitor, chloroquine,

i shows autophagy-independent anti-leukemic effects in vitro but has no efficacy in vivo likely due to limited achievable drug efficacy in blood. Further, vesicular exocytosis appears to mediate chloroquine resistance in AML cells and exocytotic inhibition significantly enhances the anti- leukemic effect of chloroquine. Thus, the autophagy inhibitor chloroquine can induce leukemia cell death in vitro in an autophagy-independent manner but with inadequate efficacy in vivo, and vesicular exocytosis is a possible mechanism of chloroquine resistance in MA9-AML. This study also reveals that autophagy-specific targeting is unlikely to benefit MA9-AML therapy.

iii

Acknowledgement

I would like to thank my advisor, Dr. Yi Zheng, who led me into the scientific world. His talent and enthusiasm for science had inspired me throughout my Ph.D. education. He is a great mentor. The freedom that he gives to his students greatly helps us forming the ability of independent thinking, which is the most important thing I learned and valued during my graduate life. He also offered timely guidance when I got puzzled in my research. He is always patient, humorous and considerate. It has been such a great pleasure to be his student and work under his mentoring.

I also want to thank other members of my thesis committee, Dr. Marie-Dominique Filippi, Dr.

Maria Czyzyk-krzeska, Dr. Gang Huang, and Dr. Daniel Starczynowski for their support and thoughtful suggestions.

I want to thank both the current and the previous lab members of Dr. Zheng’s laboratory. They offered me good suggestions, timely technical support and a very pleasant work environment in the past few years.

I also want to thank Dr. Theodosia Kalfa for her support and encouragement.

I want to thank our collaborators: Dr. Jun-Lin Guan and his lab member Song Chen, Dr. Ashish

Kumar and his lab member Jason Clark, Dr. James C. Mulloy and his lab member Mark

Wunderlich.

I also want to thank the Cancer and Cell Biology Graduate program. This is a very nice program and offers students great opportunities on the way of scientific exploration. I also meet great classmates in this program and I want thank them to accompany me in these years.

Lastly, my most grateful thanks go to my husband Chi for his understanding and continuous support, my daughter Jingyi for the happiness she has brought and will bring to us, and my parents for their endless love and encouragement.

Table of Contents

Abstract...... i

Acknowledgement ...... iv

Abbreviations ...... ix

Chapter 1 Introduction ...... 1

1.1. Autophagy process and regulation ...... 2

1.1.1 Canonical autophagy process ...... 2

1.1.2 Alternative autophagy process ...... 4

1.1.3 Selective autophagy ...... 6

1.1.4 Autophagy regulation ...... 7

1.1.4.1 mTOR pathway ...... 7

1.1.4.2 mTOR- independent autophagy regulation pathways ...... 10

1.1.5 Interpretation of autophagy markers ...... 11

1.2. Autophagy is essential for normal hematopoiesis ...... 12

1.2.1 Normal hematopoiesis...... 12

1.2.2 Role of autophagy in normal hematopoiesis ...... 14

1.3. Autophagy is involved in hematopoietic malignancies...... 15

1.3.1. Hematopoietic malignancies...... 15

1.3.2. MLL rearranged acute myeloid leukemia ...... 17

1.3.3 Role of autophagy in leukemia ...... 17

1.4 Therapeutic autophagy targeting ...... 19

1.4.1 Inducing autophagy for disease treatment ...... 19

1.4.2. Inhibiting autophagy for disease treatment ...... 20

1.5 Autophagy independent cancers ...... 22

1.6 Significance of this thesis studies ...... 23

1.7 Reference ...... 25

Chapter 2 mTOR on autophagy regulation in normal hematopoietic stem/progenitor cells

(HSPCs)...... 40

2.1 Abstract ...... 41

2.2 Introduction ...... 43

2.3 Results ...... 46

Basal autophagy activity varies in HSPCs subpopulations ...... 46

mTOR deletion leads to the expansion of HSPCs pool ...... 46

Response of autophagy activity to mTOR deletion varies in different HSPCs subpopulations

...... 47

In HSPC subpopulations, mTOR regulates autophagy through its kinase function and

through mTORC1 ...... 47

2.4 Discussion ...... 49

2.6 Figures ...... 53

2.7 Reference ...... 62

Chapter 3 Autophagy is dispensable for Kmt2a/Mll-Mllt3/Af9 AML maintenance and anti- leukemic effect of chloroquine ...... 64

3.1 Abstract ...... 65

3.2 Introduction ...... 66

3.3 Results ...... 69

MA9-AML cells have high autophagy activity ...... 69

Atg5 is dispensable for MA9-AML maintenance both in vitro and in vivo ...... 69

Rb1cc1 is not essential for MA9-AML cell maintenance ...... 71

Endolysosome formation remains intact in Atg5- or Rb1cc1-deleted MA9-AML cells ...... 71

Neither Atg5 nor Rb1cc1 disruption increases the susceptibility of MA9-AML cells to

standard chemotherapies ...... 72

vii

Chloroquine shows an autophagy-independent anti-leukemic effect that can be enhanced

by exocytosis inhibition ...... 73

3.4 Discussion ...... 76

3.5 Materials and methods ...... 80

3.6 Acknowledgement ...... 85

3.7 Authorship ...... 85

3.8 Tables ...... 86

3.9 Figures ...... 89

3.10 Reference ...... 109

Chapter 4 Summary and Perspectives ...... 116

4.1 Summaries ...... 117

4.2 Discussion and Perspectives ...... 119

4.2.1 Why do HSPCs subpopulations bear different levels of autophagy activity? ...... 119

4.2.2 What is the role of mTOR in autophagy regulation in normal hematopoiesis? ...... 119

4.2.3 What are the potential benefits and challenges of autophagy targeting in AML

treatment? ...... 120

4.2.4 What are the potential benefits and challenges of lysosome targeting in AML

treatment? ...... 121

4.3 Reference ...... 124

viii

Abbreviations

7-AAD 7-Amino-Actinomycin D

AMPK 5’AMP-activated protein kinase

ATG autophagy related

BECN1 beclin1

CMP common myeloid progenitor

CLP common lymphoid progenitor

CQ chloroquine

DA doxorubicin

DAPI 4’,6-diamidino-2-phenylindole

DMA 5-(N,N-Dimethyl) amiloride.HCl

DMSO dimethysulfoxide

FACS fluorescence activated cell sorting

RB1CC1/FIP200 RB1-inducible coiled-coil 1

GABARAP gamma-aminobutyrate receptor associated protein

GFP green fluorescent protein

GMP granulocyte-monocyte progenitor

HSC hematopoietic stem cell

HSPCs hematopoietic stem and progenitor cell

KMT2A/MLL lysine (K) – specific methyltransferase 2A

KO knockout

LAMP1 lysosomal-associated membrane protein 1

LDBM low density bone marrow cells

LK lin-Sca-1-c-kit+

LSK lin-Sca-1+c-kit+

LT-HSC long-term hematopoietic stem cell

MA9 KMT2A/MLL-MLLT3/AF9

MAP1-LC3/LC3 microtubule-associated protein 1 light chain

MEP megakaryocyte-erythroid progenitor

MLLT3/AF9 myeloid/lymphoid or mixed-lineage leukemia; translocated, 3

MPP multi-potent progenitor mTOR mammalian target of rapamycin mTORC1 mTOR complex 1 mTORC2 mTOR complex 2

PBS phosphate buffered saline

PE phosphatidylethanolamine

PI3K phosphoinositide-3-kinase

PIK3C3/Vps34 phosphatidylinositol 3-kinase catalytic subunit type 3

PLC phospholipase C polyI:C polyinosinic-polycytidylic acid double-stranded RNA

ROS reactive oxygen species

RUNX1/AML1 runt related transcription factor 1

RUNX1T1/ETO Runt-related transcription factor 1; translocated to, 1 (cyclin D-related) shRNA short hairpin RNA

ST-HSC short-term hematopoietic stem cell

SQSTM1/p62 sequestosome 1

TEM transmission electron microscopy

Tuni tunicamycin

Ub ubiquitin

ULK UNC-51-like kinase

WT wildtype

Figure and table contents

Figure 1.1-1 Autophagy process…………………………………………………..…………………..5

Figure 1.1-2 mTOR signaling pathways………………………...…………..……………………..…8

Figure 1.1-3 mTORC1 regulation of autophagy initiation complex…………………..………...... 9

Figure 1.1.5-1 Mouse hematopoietic hierarchy………………………………………………..…….13

Figure 2-1. mTOR deletion leads to HSPCs pool expansion in adult mouse bone marrow…….53

Figure 2-2. mTOR inhibitor induces autophagy in WT, but not in KO Lineage negative cells….54

Figure 2-3. Basal autophagy activity varies in wildtype HSPCs subpopulations…………….…..55

Figure 2-4. mTOR knockout induces different autophagy responses in HSPCs subpopulations…………………………………………………………………………………………..56

Figure 2-5. mTOR inhibitor and genetic knockout induces different autophagy response in

HSC……………………………………………………………………………………………………….57

Figure 2-6. mTOR knockin mimics mTOR knockout in autophagy response…………………... 58

Figure 2-7. mTORC1 regulates autophagy in Lineage negative bone marrow cells……………59

Figure 2-8. mTOR knockin mouse making and breeding strategy………………………………...60

Figure 2-9. Bone marrow HSPCs subpopulation sorting strategy…………………………………61

Figure 3-1. MA9-induced leukemia cells exhibit a high autophagy flux…………………………..89

Figure 3-2. MA9 knock-in leukemia cells exhibit a high autophagy flux…………………………91

Figure 3-3. Atg5 is dispensable for MA9-AML cell growth and survival in vitro……………….92

Figure 3-4. Atg5 is dispensable for MA9-AML cell growth and survival in vitro………………..93

Figure 3-5. Atg5 disruption does not benefit MA9-AML mice survival………………….……..…94

Figure 3-6. Atg5 disruption does not benefit MA9-AML mice survival…………………………95

Figure 3-7. Atg5 is dispensable for AE leukemia cell survival…………………………………….96

Figure 3-8. Rb1cc1 deficiency does not affect the maintenance of MA9-AML cells……………97

Figure 3-9. Rb1cc1 deficiency does not affect the maintenance of MA9-AML cells..………98

Figure 3-10. Atg5 or Rb1cc1 deficiency does not affect the lysosomal degradation pathway..99

Figure 3-11. Atg5 or Rb1cc1 deficiency does not affect the lysosomal degradation pathway..100

Figure 3-12. Loss of Atg5 or Rb1cc1 does not sensitize MA9-AML cells to chemotherapy…..101

Figure 3-13. Loss of Atg5 or Rb1cc1 does not sensitize MA9-AML cells to chemotherapy. Two day cell growth curves supplementary to Figure 6……………………………………………...... 102

Figure 3-14. Chloroquine shows an autophagy-independent anti-leukemic effect in vitro,…...103

Figure 3-15. Chloroquine (CQ) shows an anti-leukemic effect in vitro, but is not potent in vivo………………………………………………………………………………………………………105

Figure 3-16. The anti-leukemic activity of chloroquine is enhanced by exocytosis inhibition…107

Table 1.2.1-1 WHO classification of myeloid and lymphoid malignancies………………………..16

Table 1.4.2-1 Example clinical trials using chloroquine/hydroxychloroquine in cancer treatment………………………………………………………………………………………………21

Table 3-1. Quantification of endolysosomes under TEM…………………………………………...86

Table 3-2. Quantification of exocytosis under TEM…………………………………………………87

Table 3-3. Genotyping primers……………………………………………………………………….. 88

xii

Chapter 1 Introduction

1.1. Autophagy process and regulation

1.1.1 Canonical autophagy process

Autophagy is a self-digestive process through which cells degrade and recycle damaged organelles, protein aggregates, and other unnecessary components to maintain cellular homeostasis.1 There are three types of autophagy: macroautophagy, microautophagy, and chaperone-mediated autophagy (CMA), and they have different function and mechanisms.2

Macroautophagy, thereafter referred as autophagy, the topic of this dissertation, is characterized by the sequestration of cargos into a double membrane autophagosome, which fuses with lysosomes for cargo degradation by lysosomal enzymes.3 Microautophagy refers to the recognition of cytosolic contents by a lysosomal membrane which then directly ingests target molecules through invagination.4 Chaperone-mediated autophagy is the direct recognition of soluble proteins biochemically related to a KFERP motif by the 70 kD heat shock protein

(Hsp70). The Hsp70 complex recognizes lysosomal membrane protein LAMP-2A and is subsequently translocated to the interior of the lysosome digestion.5

To date, there are more than 30 identified AuTophaGy related genes (ATG) that are involved in the autophagy process. This process can be subdivided into 3 major steps: initiation, elongation and maturation, and fusion with the lysosomes (Figure 1.1-1). Each step is controlled by unique protein complexes.6

During initiation, the first complex to form is the ULK1/2-Rb1cc1/FIP200-Atg13-Atg101 complex, which is the interaction of Atg13 with ULK and Rb1cc1, along with the phosphorylation of

Rb1cc1 by ULK, a serine/threonine protein kinase.7, 8 This complex transmits cellular nutrient signals and recruits downstream Atg proteins to the sites where the autophagosome will be formed.9 The second complex is the Vps34-Beclin1-Atg14 protein complex (also referred as

VPS34 complex I) containing Vps34, a class III phosphatidylinositol 3-kinase.10, 11 The VPS34 product, phosphatidylinositol-3-phosphate (PI-3-P), is an essential signal for the recruitment of autophagy factors required for the isolation membrane.12, 13 Binding of Vps34 with Beclin 1 promotes autophagosome formation while the unbound state suppresses this activity.14

The second step of the autophagy process, elongation and maturation of phagophores, involves two ubiquitin-like reactions. In the first reaction, the ubiquitin-like protein Atg12 is first tagged to

Atg5 and then the Atg12-Atg5 molecule forms a conjugate with Atg16L1. Atg12-Atg5-Atg16L1 complex is necessary for elongation of the autophagosomal membrane and dissociates upon mature autophagosome formation.15, 16 The second ubiquitin-like reaction is the conjugation of microtubule-associated protein 1 light chain 3 (MAP1LC3/LC3/Atg8) with phosphatidylethanolamine (PE) to form LC3-II by Atg4, Atg3, and Atg7. 17 LC3-II mediates membrane tethering and fusion which is necessary for autophagosome maturation and also serves as a marker for autophagy.18 The proteins GABARAP and GABARAPL, related to the

LC3 family, may play a similar role to LC3 in autophagy elongation process.19 There is crosstalk between the two conjugation systems: the Atg12-Atg5-Atg16L1 complex accelerates the transfer of LC3 from Atg3 to PE20 and is also necessary for the correct localization of LC3 in the autophagosomes.21

The third step of the autophagy process is the fusing of autophagosomes with lysosomes to form autophagolysosomes, which is regulated by proteins largely shared with endocytic pathway. This involves the interaction between trafficking proteins, including UVRAG, Rab7, and Vps34 complex II, and the lysosomal transmembrane protein LAMP1/2, to enable the delivery of cellular debris into the degradative compartment.6, 22, 23 The degradation of these contents requires the proper function of lysosomal enzymes such as cathepsin.24 Changes in

3 the internal lysosomal environment, such as acidity by chloroquine, can hinder the proper functioning of lysosomal enzymes.25

1.1.2 Alternative autophagy process

In addition to the canonical autophagy process previously discussed, an alternative autophagy pathway has also been identified.26 The initiation and fusion steps are very similar to the canonical pathway, with differences during the elongation process. Rab9, not the two ubiquitin- like processes, mediates the elongation and maturation of the autophagosome membranes

(Figure 1.1-1).

Although the ULK1/2-Atg13-Rb1cc1 protein complex is considered indispensable for both canonical and alternative autophagy processes,26, 27 there are exceptions. Research has found that ULK1/2 are required in response to amino acid deprivation but not for autophagy induced by glucose starvation, suggesting that ULK1/2 is not as essential for autophagy initiation as previously considered.28 In previous publications,29, 30 as well as our own research, autophagy markers LC3-II and LC3 puncta still exist after clean Rb1cc1 deletion, although at a much lower level than in wild type cells. This may indicate the existence of low level Rb1cc1 independent autophagy.

Figure 1.1-1 Autophagy process

Canonical and alternative autophagy pathways start from the same ULK-FIP200-Atg13 complex.

The elongation of the canonical autophagy pathway depends on Atg5-Atg12-Atg16L and LC3-

PE (LC3-II) complexes, while the elongation of the alternative autophagy pathway depends on

Rab9 as the adaptive protein. Both pathways end with fusion of autophagosome to lysosomes for cargo degradation. Chloroquine and Bafilomycin A1 act as suppressors to lysosomal activity.

1.1.3 Selective autophagy

To date, several types of selective autophagy have been described, such as mitochondria degradation by mitophagy, ribosome degradation by ribophagy, and endoplasmic reticulum degradation by ER-phagy respectively.31-33 The selectivity is largely based on autophagy adaptors, which recognize cargos tagged with degradation signals. The turnover of damaged organelles, removal of protein aggregates, and the elimination of intracellular pathogens are all highly selective processes and require proper cargo recognition by adaptor proteins. Autophagy adaptors, such as Sequestosome 1 (SQSTM1) and NBR1, have LC3-interacting regions (LIR) to interact with LC3/GABARAP family proteins on the autophagosomal membrane.34, 35 This interaction then leads to the selection of proper targets for degradation.

In mammals, the ubiquitin (Ub) signal is the most prevalent modification signal on the cargo for autophagy selectivity.36 For example, in mitophagy, depolarization of mitochondria leads to the activation of PINK1 and recruitment of E3 ligase Parkin. Proteins on the mitochondria membrane that get ubiquintinated by Parkin are recognized by autophagy adaptor SQSTM1 and translocated to an autophagosome membrane for degradation.37 Besides mitophagy, ubiquitin-

SQSTM1/NBR1 also mediates aggrephagy (degradation of aggregated protein), pexophagy

(degradation of peroxisome), and exnophagy (degradation of pathogens).38

Although the selectivity of autophagy is well recognized, we are just beginning to understand this complicated process. Many questions still remain, such as the mechanistic details, the membrane source, the regulatory signaling, and roles in different diseases. Further investigation is underway and will greatly help us understand and utilize this pathway for potential disease therapies.

1.1.4 Autophagy regulation

1.1.4.1 mTOR pathway

Mammalian target of rapamycin (mTOR) is a serine/threonine kinase that belongs to the phosphoinositide-3-kinase (PI3K) related kinase family. mTOR kinase functions in two distinct protein complexes: mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2), differentiated by Raptor and Rictor among other components, respectively.39 mTORC1 and mTORC2 interrelate with each other through Akt, with mTORC1 as a downstream target of Akt, while mTORC2 as an upstream activator.40 Functionally, mTORC2 regulates cell survival and cytoskeletal organization through Akt and PKCa activation, respectively, while mTORC1 integrates multiple extra- and intra-cellular cues, including growth factors, amino acids, and oxygen to control multiple major intracellular processes, such as protein and lipid synthesis, energy metabolism, and autophagy.39 (Figure 1.1-2)

mTORC1, a negative regulator of autophagy, inhibits autophagy by suppressing the initiation complex through phosphorylating ULK1/2 and Atg13, which are the central components in the initiation complex ULK-Atg13-Rb1cc1.7, 41 Under nutrient-rich conditions, activated mTORC1 phosphorylates ULK, a serine/threonine kinase, on site S637/757, causing the suppression of

ULK kinase function and thereby autophagy inhibition.42 During starvation, inactive mTORC1 dissociates from ULK, activating it, resulting in the phosphorylation of Atg13 and ULK at different sites along with FIP200 to initiate the autophagy process.42 Other conditions such as using mTOR pharmacological inhibitors rapamycin, torin1, or AZD8055, can also contribute to the induction of autophagy.43 (Figure 1.1-3)

Figure 1.1-2 mTOR signaling pathways

The mTOR kinase exists in two protein complexes: mTORC1 and mTORC2. The mTORC1 signaling pathway regulates processes such as protein synthesis and autophagy, while mTORC2 signaling pathway regulates cytoskeletal organization and cells proliferation through Akt. The two pathways interact with each other through Akt, with mTORC1 regulated by Akt and mTORC2 regulating Akt.

Figure 1.1-3 mTORC1 regulation of autophagy initiation complex.

In nutrient rich conditions, mTORC1 suppresses autophagy by phosphorylating ULK and Atg13. Upon starvation or mTOR inhibitor treatment, dephosphorylated ULK auto-phosphorylates and phosphorylates

Atg13 at different amino acid to initiate the autophagy process.

There are additional ways in which mTORC1 suppresses autophagy, including inhibiting the

ULK1 stabilizing protein autophagy/beclin1 regulator 1 (AMBRA1) by phosphorylation. Un- phosphorylated AMBRA1 interacts with TRAF6, which is an E3-ligase that ubiquitinates and stabilizes ULK1.44 Furthermore, mTORC1 phosphorylates Atg14L in the VPS34 complex, inhibiting the activity of VPS34, leading to autophagy inhibition.45 mTORC1 can also regulate autophagy at the transcriptional level by modulating the cytosol-nuclear location of transcription factor EB (TFEB), which drives the expression of autophagy and lysosomal genes. mTORC1 phosphorylates TFEB at Ser211 and this phosphorylation sequestrates TFEB in the cytosol.

The dephosphorylated TFEB remains in the nucleus where it increases the transcription of multiple autophagy and lysosomal genes.46 In general, mTORC1 plays a major role as negative regulator acting on multiple levels to maintain the proper level of autophagy in cells.

1.1.4.2 mTOR- independent autophagy regulation pathways

Apart from the mTOR pathway, there are other commonly known pathways that also regulate autophagy. The inositol signaling pathway begins with a G-protein-coupled receptor mediated activation of phospholipase C (PLC), which hydrolyzes PIP2 to form IP3 and DAG. An elevation of intracellular inositol or IP3, which do not respond to rapamycin treatment, inhibits autophagosome formation.47, 48 The Ca2+/Calpain pathway regulates autophagy at the level of both autophagosome formation and autophagosome-lysosome fusion. Increasing intracellular

Ca2+ levels could inhibit autophagy flux directly or through the activation of calpains, which are

Ca2+ dependent cysteine proteases. Pharmacological inhibitor or genetic knockdown of calpains increases autophagy flux without perturbing mTORC1 signaling.49-51 The cAMP/Epac/IP3 pathway converges with the inositol/IP3 and Ca2+/Calpain pathways, bringing in a second messenger, cAMP, which negatively regulates autophagy. Epac is a downstream target of cAMP that mediates the autophagy suppression effect.50 The JNK1/Beclin1/PI3KC3 pathway involves the activation of JNK1 by phosphorylating Bcl-2, which dissociates from the Beclin1-

Bcl-2 complex.52 This chain of events promotes the formation of the Beclin1-Vps34 complex and stimulates autophagy.53, 54

In addition to the aforementioned mTOR-independent pathways, there are also small molecules that regulate autophagy. For example, trehalose, a disaccharide, is a potent autophagy activator found in various non-mammalian species.55 Others such as fluspirilene and trifluoperazine

(dopamine antagonist) can also induce autophagy by blocking Ca2+ in an mTOR-independent manner. 49 Identifying and characterizing mTOR-independent autophagy regulation pathways and small molecules is important, as this may provide therapeutic applications in certain diseases.

1.1.5 Interpretation of autophagy markers

The journal Autophagy publishes “Guidelines for the Use and Interpretation of Assays for

Monitoring Autophagy” every four years, starting from the year 2008. 56 According to the guideline, now in its third edition, transmission electron microscopy for autophagosome detection, LC3II or LC3 puncta detection and/or quantification, and LC3 related binding protein turn over assays are commonly used in experimental settings. Other markers, such as Beclin1 and ATG proteins or transcriptional assays, are also used in determining autophagy activity.

Transmitted electron microscopy is the only technique that can view the autophagosomes directly, but it is labor intensive and hard to acquire accurate quantifiable data.57 Increased

LC3II protein levels or LC3 puncta are usually interpreted as autophagy induction though a similar LC3 response will be observed if autophagy is blocked at the lysosomal level. To demonstrate autophagy flux through lysosomal inhibition, Bafilomycin A, chloroquine, or hydroxychloroquine are commonly used.56 Generally, there is no one single gold standard to examine autophagy activity; usually a combination of assays and markers is needed for a clear interpretation.

1.2. Autophagy is essential for normal hematopoiesis

1.2.1 Normal hematopoiesis

Hematopoiesis, the generation of erythroid, lymphoid, and myeloid blood cell lineages, is a highly regulated process involving a hierarchy of cells at various proliferative and differentiation stages (Figure 1.1.5-1). The most primitive population in this hierarchy is long-term hematopoietic stem cells (LT-HSC), which give rise to short-term HSC (ST-HSC). ST-HSC are a group of transient proliferating cells that differentiate into multipotent progenitors (MPP), which retain the ability to differentiate into any of the three lineages mentioned above, but lose the self-renewal ability seen in LT and ST-HSC. MPP gives rise to common lymphoid progenitors

(CLP) which differentiate to lymphocytes and common myeloid progenitors (CMP). CMP gives rise to the committed progenitors of myeloid, erythroid, and megakaryocytes.58 Based on cell surface antigens, subpopulations of hematopoietic stem/progenitor cells (HSPC) can be distinctly isolated by FACS methods for mechanistic analysis.59

Figure 1.1.5-1 Mouse hematopoietic hierarchy

Hematopoiesis starts from a small population of cells called LT-HSC, which give rise to transient amplifying ST-HSC. MPP arise from ST-HSC and differentiate into committed progenitors including CLP and CMP. CLP differentiate into B/T lymphocytes, natural killer cells, and dendritic cells. CMP give rise to cells belonging to the myeloid and erythroid lineages.

1.2.2 Role of autophagy in normal hematopoiesis

Autophagy, which is indispensable for the blood system, is involved in multiple differentiation stages of normal hematopoiesis. In the primitive hematopoietic stem cells, loss of autophagy essential genes results in functionally defective HSC, observed as a reduced HSC number and failure of the blood system to reconstitute after bone marrow transplantation, both in mouse and human systems.60-63 Mice with conditional loss of autophagy essential genes develop a myeloproliferative phenotype in the bone marrow and die a few weeks after birth.62 Notably,

FOXO3A is found to be critical to maintain the autophagy gene expression panel, preparing the

HSC to a rapid autophagy response, which mitigates an energy crisis and allows cells to survive.63 During the process of monocyte to macrophage differentiation, induction of autophagy is pivotal for the survival and differentiation of monocytes, while inhibition of autophagy with chloroquine hampers the differentiation process and causes the monocytes to undergo apoptosis.64 In the lymphoid lineage, autophagy essential gene Atg5 deletion leads to a significant reduction in thymocytes and peripheral T and B lymphocytes. Both CD4+ and CD8+ lymphocytes fail to undergo efficient proliferation after T-cell receptor (TCR) stimulation.65, 66 In the erythroid lineage, autophagy suppression leads to a very serious defect in mitochondria and

ROS clearance, causing lethal anemia in mice.67, 68 In the megakaryocyte-platelets lineage, autophagy defects lead to a robust bleeding diathesis and a prolonged occlusion time in mouse models.69 Conclusively, autophagy is necessary for normal HSC maintenance and differentiation to various blood lineages.

Interestingly, key hematopoietic regulatory genes also regulate autophagy genes. For example,

GATA-1 directly regulates LC3B transcription and genes involved in the biogenesis/function of lysosomes.70 The mixed lineage leukemia (MLL) gene regulates autophagy related genes including Atg9b and Atg2b.71 It appears that there is a tightly intertwined relationship between autophagy and hematopoiesis, and autophagy is involved in normal hematopoiesis.

1.3. Autophagy is involved in hematopoietic malignancies

1.3.1. Hematopoietic malignancies

Hematopoietic malignancies are a heterogeneous group of tumors in the blood system. Table

1.2.1-1 shows a simplified version of blood malignancies based on the World Health

Organization classification.72, 73 According to this classification, there are two categories of blood malignancies: leukemia and lymphoma. Under the leukemia classification, there are myeloid and lymphoid leukemia, while lymphoma only applies to lymphoid system. In myeloid leukemia, there are myeloproliferative neoplasms and myelodysplastic syndromes, as well as acute and chronic myeloid leukemia. Acute myeloid leukemia (AML) is further divided in to subtypes according to genetic mutations, which occasionally correlates with prognosis. Currently, about

60,000 new adult and pediatric cases of leukemia are diagnosed in United States per year,

20,000 of whom would die. It remains a high disease risk and poor prognosis of this category of cancer, highlighting a need for improved and more effective therapies.74

Table 1.2.1-1 WHO classification of myeloid and lymphoid malignancies

Myeloproliferative neoplasms (MPN)

Myeloid/lymphoid neoplasms with eosinophilia and rearrangement of PDGFRA,

PDGFRB, or FGFR1, or with PCM1-JAK2

Myelodysplastic/myeloproliferative neoplasms (MDS/MPN)

Myelodysplastic syndromes (MDS)

Acute myeloid leukemia and related neoplasms

Blastic plasmacytoid dendritic cell neoplasm

Acute leukemia of ambiguous lineages

B-lymphoblastic leukemia/lymphoma Myeloid leukemia and acute leukemia acute and leukemia Myeloid T-lymphoblastic leukemia/lymphoma

Mature B-cell neoplasms

Mature T and NK neoplasms

Hodgkin lymphoma

Post-transplant lymphoproliferative disorders

Histiocytic and dendritic cell neoplasms

lymphoid lymphoid , histiocytic,

Mature neoplasms dendritic and

1.3.2. MLL rearranged acute myeloid leukemia

Mixed lineage leukemia (MLL) gene, on chromosome 11q23, can translocate and rearrange to give rise to leukemia of both acute lymphoblastic leukemia (ALL) and AML. In pediatric AML,

MLL rearrangements are the most commonly recurrent cytogenetic aberration.75 The MLL gene, also known as Kmt2a, encodes a DNA-binding protein and is part of a large chromatin- modifying complex, which has histone methyltransferase and histone acetyltransferase activity.76 In MLL rearrangement, a new chimeric protein is transcribed from the relocated genes and leads to a gain of function of MLL complex, causing an upregulation of key hematopoietic development genes, such as HOX and MEIS1, which could inhibit maturation and trigger leukemogenesis.77 So far, MLL is found to rearrange with more than 60 different genes. Among them, AF9, ENL, AF4, AF10, and AF6 are the most commonly seen translocation sites, leading to acute myeloid leukemia.78 In general, MLL-rearranged leukemia bears an average to poor prognosis. Under intensive chemotherapy regimen, the 5-year probability of overall survival for

MLL-rearranged leukemia ranges from 40% to 60%.78 To date, targeted therapies include strategies blocking Menin-MLL interaction,79, 80 inhibiting the AF10 interacting partner DOT1L,81 and inhibiting BRD4 82. However, none has been proven effective clinically.

1.3.3 Role of autophagy in leukemia

Autophagy has been found to be involved in multiple aspects of leukemia, including development, progression, and chemotherapy response.83-86 In murine models, defects in autophagy machinery could either inhibit or promote leukemogenesis. For instance, in BCR-ABL mediated leukemogenesis, autophagy essential gene Atg3 deletion leads to cell cycle arrest and apoptosis of leukemic cells, as well as inhibition of leukemia formation.83 However, in an autophagy essential gene Atg7 knockout model, a myeloidproliferative pre-leukemic phenotype develops in the blood system.62 In the leukemia maintenance and progression stage, heterogeneous loss of the autophagy gene Atg5 leads to increased MLL-ENL leukemia cell

17 proliferation in vitro and more aggressive leukemia in vivo, while homogenous loss of Atg5 is lethal to these cells.84 Others find that Atg5-dependent autophagy may contribute to the development of MLL-AF9 driven leukemia, but is dispensable for its propagation and chemosensitivity.87 Additionally, in myelodysplastic syndrome (MDS) patients, autophagy activity is relatively higher and is associated with increased reactive oxygen species (ROS) and defective mitochondria clearance, which may serve as a cell protective method to lower the risk of MDS evolution to AML.88, 89

The effect of autophagy on the response of leukemia cells to chemotherapy varies; induced autophagy can be either cytoprotective or cytotoxic.90 For example, the classical chemotherapy drug L-asparaginase induces cytoprotective autophagy, which has a strong pro-survival role for

AML cells, 91 while other drugs, such as arsenic trioxide and all-transretinoc acid, stimulate a cytotoxic autophagy to proteolyze PML-ARAα in acute promyelocytic leukemia.92 A third type of drug, such cytarabine or mTOR inhibitor AZD8055, could induce either cytoprotective or cytotoxic autophagy in the same type of leukemia cells under different circumstances.93, 94

Thus, the relationship between autophagy and blood malignancies is complicated. Progresses in this field raise new questions. The opposing effect of autophagy can be seen in different stages of leukemia development and in response to different drugs. The factors and circumstances that determine the cytoprotective or cytotoxic effect of autophagy remain unclear.

More research is needed to define the role of autophagy in different types of leukemia.

1.4 Therapeutic autophagy targeting

1.4.1 Inducing autophagy for disease treatment

The rationale of inducing autophagy as a form of treatment lies in the observation that autophagy may prevent the occurrence, progression, and therapeutic responses under certain conditions, such as during cancer progression as well as neurodegenerative and connective tissue diseases.2 Evidences supporting this approach are: first, genetic mutations in autophagy genes are known to lead to a wide spectrum of diseases, including neural degeneration, cancer, inflammation and bacterial infection;62, 95-100 second, it is found that mutation or polymorphism in autophagy genes are related to diseases, such as cancer malignancies, and neurological disorders;101-104 third, autophagy gene therapy improves patients’ condition in certain diseases;105, 106 finally, drugs inducing autophagy have also been found to be beneficial for disease treatment.92, 107

Autophagy activation can be induced through either non-pharmacologic or pharmacologic interventions. Calorie restriction and exercise are two non-pharmacologic ways to induce autophagy.108, 109 Pharmacologically, there are many FDA approved drugs that could induce autophagy. The best know autophagy inducers are the mTOR inhibitor, rapamycin, and its analogs. They induce autophagy by suppressing mTORC1 activity, which, as previously discussed, is the major negative regulator of autophagy.110, 111 Other drugs induce autophagy through a variety of mechanisms: metformin induces autophagy by upregulation of AMPK activity;110, 112 lithium, carbamazepine and valproate induce autophagy by lowering PIP3 level;47,

113 clonidine induces autophagy by reducing cAMP levels.50 Despite the variety of FDA approved options, none of them are specific enough to be effective and all have side effects.

Fluorescent based methods to screen for more specific autophagy inducers with less toxic side- effects are ongoing in research.49, 114, 115

1.4.2. Inhibiting autophagy for disease treatment

While inducing autophagy can be an effective therapy for a range of diseases, inhibiting autophagy is mainly employed in cancer therapy. Cancer cells utilize autophagy to overcome harsh environments, such as hypoxia, chemotherapy, and radiation treatments. Autophagy inhibition can improve the response to treatments.116-119 Currently, lysosomal trophic agents chloroquine and its derivative hydroxychloroquine are widely used to inhibit autophagy.120-122

Clinical phase I/II trials using chloroquine/hydroxychloroquine in solid and hematological malignancies are constantly expanding (Table 1.4.2-1). Some of these studies indicate that chloroquine/hydroxychloroquine may enhance the efficacy of conventional chemotherapies.123

However, larger clinical trials are needed to provide definitive answers as to the benefits of these therapies. Meanwhile, there are groups trying to improve drug efficacy by structurally optimizing chloroquine to improve its relatively low and inconsistent blood concentration.124, 125

The newly designed and synthesized dimeric analog of chloroquine shows a better potency and enhanced anti-tumor effect.124

Although chloroquine is considered to produce anti-tumor effects through autophagy blockage, more and current research shows that chloroquine has autophagy-independent anti-tumor effects.126, 127 For example, chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy inhibition by an Atg12 or a Beclin1 gene knockdown.126 In a solid tumor xenograft model, chloroquine reduces tumor growth by normalizing tumor vessels.127 In our work, we found that the anti-leukemic effect of chloroquine is independent of autophagy, since knocking out the autophagy essential genes Rb1cc1 or Atg5 did not mimic the chloroquine response. Based on these observations, caution needs to be taken when interpreting the results of research using chloroquine or hydroxychloroquine as an autophagy inhibitor.

Table 1.4.2-1 Example clinical trials using chloroquine/hydroxychloroquine in cancer treatment.

Tumor type Clinical trial Therapeutic combination

phase

Metastatic melanoma I HCQ + temsirolimus122

Lung cancer I HCQ + erlotinib128

Breast cancer II CQ + paclitaxel, docetaxel, inxabepilione

Multiple myeloma I HCQ + bortezomib129

CLL II HCQ only (NCT00771056)

CML II CQ + imatinib (NCT01227135)

Prostate cancer II HCQ + docetaxel (NCT01828476)

Colorectal cancer II HCQ + bevacizumab + capecitabine + oxaliplatin

(NCT01006369)

Gliobastoma multiforme I/II HCQ + temozolomide + radiation130

Pancreatic cancer I/II HCQ + Gemcitabine/Abraxane (NCT01506973)

Abbreviations: CQ, chloroquine; HCQ, hydrochloroqine; CLL, chronic lymphocytic leukemia; CML, chronic myelogenous leukemia. Trials with NCT number are ongoing.

1.5 Autophagy independent cancers

As a conserved process in eukaryotes, autophagy is considered essential for cellular homeostasis and its significance has been well documented for decades. However, exceptions exist and there are cancer cells that can function independent of autophagy, or autophagy essential genes. In a lung cancer cell line, loss of Atg7 protein expression due to a biallelic deletion within Atg7 gene locus does not affect the cell survival, proliferation, mitochondrial metabolism, and response to nutrient starvation.131 In DU145 cells, a prostate cancer cell line, a lack of Atg5 protein via distinct splicing profiles does not affect normal activity.132 In several

KRAS driven tumors, Atg7 deletion with CRISPR/Cas9 technology completely blocks autophagy but does not inhibit cell proliferation in vitro or tumorigenesis in vivo. The Atg7 knockout does not sensitize cells to several chemotherapy drugs or radiotherapy in the KRas models.133 In our own experiments, we also found that neither Atg5 or Rb1cc1 knockout show any anti- proliferative or survival effects on MA9-AML in vitro, and autophagy deficient MA9-AML cells can still induce leukemia in mice. As more and more autophagy-independent tumors are found, further research is needed to validate the role autophagy plays in each type of tumor before autophagy is considered as a therapeutic strategy in cancer.

1.6 Significance of this thesis studies

Autophagy, as a cellular degrading and recycling system, has fundamental importance in many physiological processes. In 2016, the Nobel Prize was awarded to Professor Yoshinori Ohsumi for his contribution to this field, confirming the important role of autophagy in cell physiology. In the hematopoietic system, the autophagy function and regulation are still unclear and needs extensive investigation. In normal hematopoiesis, although autophagy is essential for stem cell maintenance and differentiation, the regulation of the autophagy process and its impacts on blood cell development is still unclear. In hematopoietic malignancies, the evidence of autophagy in acute myeloid leukemia development and therapy are limited and sometimes controversial.84, 85 Accurate and reliable genetic models are necessary to address the questions mentioned above.

In this dissertation, we investigated the regulation of autophagy by mTOR signaling and its role in normal hematopoiesis using conditional genetic mTOR knockout and genetic knockin mouse models. We found that basal autophagy levels in different cell populations are different, with higher levels in more primitive HSC populations and lower levels in differentiated GMP populations, suggesting that HSPCs subpopulations have variable dependence on autophagy activity. Although mTOR is a known autophagy suppressor, its deletion is considered to be an autophagy inducer. HSPCs are able to compensate after mTOR deletion in terms of autophagy function, indicating that HSPCs need to maintain a certain level of autophagy in order to survive.

We also found that the mTOR protein complex has no scaffold role in autophagy regulation, as mTOR knockout and knockin HSPCs showed a similar autophagy phenotype. This suggests that mTOR regulates autophagy through its kinase function. Our findings will help us understand better autophagy regulation and its function in HSPCs.

We also investigated the potential benefits of targeting autophagy in MA9-AML through genetic knockout of autophagy essential genes. Through knocking out of Atg5 and FIP200, we found that both canonical and alternative autophagy pathways were dispensable for MA9-AML survival. This means autophagy specific targeting will unlikely be beneficial for certain types of

AML treatment. Although current clinical trials using chloroquine/hydroxychloroquine as autophagy inhibitor exist, we showed that the anti-leukemic effect of chloroquine was indeed independent of autophagy, as Atg5 or FIP200 null MA9 cells showed similar responses to chloroquine treatment. We also demonstrated that MA9 cells were able to resist chloroquine by exocytosis activity and this exocytosis inhibition enhanced the anti-leukemia efficacy of chloroquine. These findings enrich our knowledge in autophagy function and therapeutic potential by offering clear evidence. We also provide data on AML response and resistance to chloroquine treatment, offering a new therapeutic and drug combinatory strategy in AML treatment.

1.7 Reference

1. Mizushima N. Autophagy: process and function. Genes Dev 2007 Nov 15; 21(22): 2861-

2873.

2. Mizushima N, Levine B, Cuervo AM, Klionsky DJ. Autophagy fights disease through

cellular self-digestion. Nature 2008 Feb 28; 451(7182): 1069-1075.

3. Yang Z, Klionsky DJ. Mammalian autophagy: core molecular machinery and signaling

regulation. Curr Opin Cell Biol 2010 Apr; 22(2): 124-131.

4. Sahu R, Kaushik S, Clement CC, Cannizzo ES, Scharf B, Follenzi A, et al.

Microautophagy of cytosolic proteins by late endosomes. Dev Cell 2011 Jan 18; 20(1):

131-139.

5. Bejarano E, Cuervo AM. Chaperone-mediated autophagy. Proc Am Thorac Soc 2010

Feb; 7(1): 29-39.

6. Antonioli M, Di Rienzo M, Piacentini M, Fimia GM. Emerging Mechanisms in Initiating

and Terminating Autophagy. Trends Biochem Sci 2016 Oct 17.

7. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, et al. ULK-Atg13-FIP200 complexes

mediate mTOR signaling to the autophagy machinery. Mol Biol Cell 2009 Apr; 20(7):

1992-2003.

8. Chang YY, Neufeld TP. An Atg1/Atg13 complex with multiple roles in TOR-mediated

autophagy regulation. Mol Biol Cell 2009 Apr; 20(7): 2004-2014.

9. Mizushima N. The role of the Atg1/ULK1 complex in autophagy regulation. Curr Opin

Cell Biol 2010 Apr; 22(2): 132-139.

10. Itakura E, Kishi C, Inoue K, Mizushima N. Beclin 1 forms two distinct phosphatidylinositol

3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell 2008 Dec; 19(12):

5360-5372.

11. Kihara A, Kabeya Y, Ohsumi Y, Yoshimori T. Beclin-phosphatidylinositol 3-kinase

complex functions at the trans-Golgi network. EMBO Rep 2001 Apr; 2(4): 330-335.

12. Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, Habermann A, et al.

Autophagosome formation from membrane compartments enriched in

phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic

reticulum. J Cell Biol 2008 Aug 25; 182(4): 685-701.

13. Lamb CA, Yoshimori T, Tooze SA. The autophagosome: origins unknown, biogenesis

complex. Nat Rev Mol Cell Biol 2013 Dec; 14(12): 759-774.

14. Furuya N, Yu J, Byfield M, Pattingre S, Levine B. The evolutionarily conserved domain of

Beclin 1 is required for Vps34 binding, autophagy and tumor suppressor function.

Autophagy 2005 Apr; 1(1): 46-52.

15. Mizushima N, Kuma A, Kobayashi Y, Yamamoto A, Matsubae M, Takao T, et al. Mouse

Apg16L, a novel WD-repeat protein, targets to the autophagic isolation membrane with

the Apg12-Apg5 conjugate. J Cell Sci 2003 May 1; 116(Pt 9): 1679-1688.

16. Mizushima N, Sugita H, Yoshimori T, Ohsumi Y. A new protein conjugation system in

human. The counterpart of the yeast Apg12p conjugation system essential for

autophagy. J Biol Chem 1998 Dec 18; 273(51): 33889-33892.

17. Tanida I, Sou YS, Ezaki J, Minematsu-Ikeguchi N, Ueno T, Kominami E.

HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8

homologues and delipidates microtubule-associated protein light chain 3- and GABAA

receptor-associated protein-phospholipid conjugates. J Biol Chem 2004 Aug 27; 279(35):

36268-36276.

18. Nakatogawa H, Ichimura Y, Ohsumi Y. Atg8, a ubiquitin-like protein required for

autophagosome formation, mediates membrane tethering and hemifusion. Cell 2007 Jul

13; 130(1): 165-178.

19. Le Grand JN, Chakrama FZ, Seguin-Py S, Fraichard A, Delage-Mourroux R, Jouvenot M,

et al. GABARAPL1 (GEC1): original or copycat? Autophagy 2011 Oct; 7(10): 1098-1107.

20. Hanada T, Noda NN, Satomi Y, Ichimura Y, Fujioka Y, Takao T, et al. The Atg12-Atg5

conjugate has a novel E3-like activity for protein lipidation in autophagy. J Biol Chem

2007 Dec 28; 282(52): 37298-37302.

21. Suzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y. The pre-

autophagosomal structure organized by concerted functions of APG genes is essential

for autophagosome formation. EMBO J 2001 Nov 1; 20(21): 5971-5981.

22. Liang C, Lee JS, Inn KS, Gack MU, Li Q, Roberts EA, et al. Beclin1-binding UVRAG

targets the class C Vps complex to coordinate autophagosome maturation and endocytic

trafficking. Nat Cell Biol 2008 Jul; 10(7): 776-787.

23. Saftig P, Beertsen W, Eskelinen EL. LAMP-2: a control step for phagosome and

autophagosome maturation. Autophagy 2008 May; 4(4): 510-512.

24. Koike M, Shibata M, Waguri S, Yoshimura K, Tanida I, Kominami E, et al. Participation

of autophagy in storage of lysosomes in neurons from mouse models of neuronal ceroid-

lipofuscinoses (Batten disease). Am J Pathol 2005 Dec; 167(6): 1713-1728.

25. Misinzo G, Delputte PL, Nauwynck HJ. Inhibition of endosome-lysosome system

acidification enhances porcine circovirus 2 infection of porcine epithelial cells. J Virol

2008 Feb; 82(3): 1128-1135.

26. Nishida Y, Arakawa S, Fujitani K, Yamaguchi H, Mizuta T, Kanaseki T, et al. Discovery

of Atg5/Atg7-independent alternative macroautophagy. Nature 2009 Oct 1; 461(7264):

654-658.

27. Kishi-Itakura C, Koyama-Honda I, Itakura E, Mizushima N. Ultrastructural analysis of

autophagosome organization using mammalian autophagy-deficient cells. J Cell Sci

2014 Sep 15; 127(Pt 18): 4089-4102.

28. Cheong H, Lindsten T, Wu J, Lu C, Thompson CB. Ammonia-induced autophagy is

independent of ULK1/ULK2 kinases. Proc Natl Acad Sci U S A 2011 Jul 5; 108(27):

11121-11126.

29. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, et al. FIP200, a ULK-

interacting protein, is required for autophagosome formation in mammalian cells. J Cell

Biol 2008 May 5; 181(3): 497-510.

30. Wei H, Wei S, Gan B, Peng X, Zou W, Guan JL. Suppression of autophagy by FIP200

deletion inhibits mammary tumorigenesis. Genes Dev 2011 Jul 15; 25(14): 1510-1527.

31. Bernales S, Schuck S, Walter P. ER-phagy: selective autophagy of the endoplasmic

reticulum. Autophagy 2007 May-Jun; 3(3): 285-287.

32. Tolkovsky AM. Mitophagy. Biochim Biophys Acta 2009 Sep; 1793(9): 1508-1515.

33. Kraft C, Deplazes A, Sohrmann M, Peter M. Mature ribosomes are selectively degraded

upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease.

Nat Cell Biol 2008 May; 10(5): 602-610.

34. Ichimura Y, Kumanomidou T, Sou YS, Mizushima T, Ezaki J, Ueno T, et al. Structural

basis for sorting mechanism of p62 in selective autophagy. J Biol Chem 2008 Aug 15;

283(33): 22847-22857.

35. Noda NN, Kumeta H, Nakatogawa H, Satoo K, Adachi W, Ishii J, et al. Structural basis

of target recognition by Atg8/LC3 during selective autophagy. Genes Cells 2008 Dec;

13(12): 1211-1218.

36. Kirkin V, McEwan DG, Novak I, Dikic I. A role for ubiquitin in selective autophagy. Mol

Cell 2009 May 15; 34(3): 259-269.

37. Gegg ME, Cooper JM, Chau KY, Rojo M, Schapira AH, Taanman JW. Mitofusin 1 and

mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent manner upon induction of

mitophagy. Hum Mol Genet 2010 Dec 15; 19(24): 4861-4870.

38. Stolz A, Ernst A, Dikic I. Cargo recognition and trafficking in selective autophagy. Nat

Cell Biol 2014 Jun; 16(6): 495-501.

39. Laplante M, Sabatini DM. mTOR signaling in growth control and disease. Cell 2012 Apr

13; 149(2): 274-293.

40. Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell 2007 Jun 29;

129(7): 1261-1274.

41. Ganley IG, Lam du H, Wang J, Ding X, Chen S, Jiang X. ULK1.ATG13.FIP200 complex

mediates mTOR signaling and is essential for autophagy. J Biol Chem 2009 May 1;

284(18): 12297-12305.

42. Wong PM, Puente C, Ganley IG, Jiang X. The ULK1 complex: sensing nutrient signals

for autophagy activation. Autophagy 2013 Feb 01; 9(2): 124-137.

43. Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, Green-Thompson ZW,

et al. Regulation of mammalian autophagy in physiology and pathophysiology. Physiol

Rev 2010 Oct; 90(4): 1383-1435.

44. Nazio F, Strappazzon F, Antonioli M, Bielli P, Cianfanelli V, Bordi M, et al. mTOR inhibits

autophagy by controlling ULK1 ubiquitylation, self-association and function through

AMBRA1 and TRAF6. Nat Cell Biol 2013 Apr; 15(4): 406-416.

45. Yuan HX, Russell RC, Guan KL. Regulation of PIK3C3/VPS34 complexes by MTOR in

nutrient stress-induced autophagy. Autophagy 2013 Dec; 9(12): 1983-1995.

46. Martina JA, Chen Y, Gucek M, Puertollano R. MTORC1 functions as a transcriptional

regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 2012 Jun;

8(6): 903-914.

47. Sarkar S, Floto RA, Berger Z, Imarisio S, Cordenier A, Pasco M, et al. Lithium induces

autophagy by inhibiting inositol monophosphatase. J Cell Biol 2005 Sep 26; 170(7):

1101-1111.

48. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature 1993 Jan 28;

361(6410): 315-325.

49. Zhang L, Yu J, Pan H, Hu P, Hao Y, Cai W, et al. Small molecule regulators of

autophagy identified by an image-based high-throughput screen. Proc Natl Acad Sci U S

A 2007 Nov 27; 104(48): 19023-19028.

50. Williams A, Sarkar S, Cuddon P, Ttofi EK, Saiki S, Siddiqi FH, et al. Novel targets for

Huntington's disease in an mTOR-independent autophagy pathway. Nat Chem Biol 2008

May; 4(5): 295-305.

51. Goll DE, Thompson VF, Li H, Wei W, Cong J. The calpain system. Physiol Rev 2003 Jul;

83(3): 731-801.

52. Pattingre S, Espert L, Biard-Piechaczyk M, Codogno P. Regulation of macroautophagy

by mTOR and Beclin 1 complexes. Biochimie 2008 Feb; 90(2): 313-323.

53. Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N, et al. Bcl-2 antiapoptotic

proteins inhibit Beclin 1-dependent autophagy. Cell 2005 Sep 23; 122(6): 927-939.

54. Wei Y, Pattingre S, Sinha S, Bassik M, Levine B. JNK1-mediated phosphorylation of Bcl-

2 regulates starvation-induced autophagy. Mol Cell 2008 Jun 20; 30(6): 678-688.

55. Sarkar S, Davies JE, Huang Z, Tunnacliffe A, Rubinsztein DC. Trehalose, a novel

mTOR-independent autophagy enhancer, accelerates the clearance of mutant huntingtin

and alpha-synuclein. J Biol Chem 2007 Feb 23; 282(8): 5641-5652.

56. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, et

al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd

edition). Autophagy 2016; 12(1): 1-222.

57. Lucocq JM, Hacker C. Cutting a fine figure: On the use of thin sections in electron

microscopy to quantify autophagy. Autophagy 2013 Sep; 9(9): 1443-1448.

58. Ogawa M. Differentiation and proliferation of hematopoietic stem cells. Blood 1993 Jun 1;

81(11): 2844-2853.

59. Heiser D, Tan YS, Kaplan I, Godsey B, Morisot S, Cheng WC, et al. Correlated miR-

mRNA expression signatures of mouse hematopoietic stem and progenitor cell subsets

predict "Stemness" and "Myeloid" interaction networks. PLoS One 2014; 9(4): e94852.

60. Liu F, Lee JY, Wei H, Tanabe O, Engel JD, Morrison SJ, et al. FIP200 is required for the

cell-autonomous maintenance of fetal hematopoietic stem cells. Blood 2010 Dec 2;

116(23): 4806-4814.

61. Gomez-Puerto MC, Folkerts H, Wierenga AT, Schepers K, Schuringa JJ, Coffer PJ, et al.

Autophagy Proteins ATG5 and ATG7 Are Essential for the Maintenance of Human

CD34(+) Hematopoietic Stem-Progenitor Cells. Stem Cells 2016 Jun; 34(6): 1651-1663.

62. Mortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E, et al. The

autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med

2011 Mar 14; 208(3): 455-467.

63. Warr MR, Binnewies M, Flach J, Reynaud D, Garg T, Malhotra R, et al. FOXO3A directs

a protective autophagy program in haematopoietic stem cells. Nature 2013 Feb 21;

494(7437): 323-327.

64. Zhang Y, Morgan MJ, Chen K, Choksi S, Liu ZG. Induction of autophagy is essential for

monocyte-macrophage differentiation. Blood 2012 Mar 22; 119(12): 2895-2905.

65. Pua HH, Dzhagalov I, Chuck M, Mizushima N, He YW. A critical role for the autophagy

gene Atg5 in T cell survival and proliferation. J Exp Med 2007 Jan 22; 204(1): 25-31.

66. Stephenson LM, Miller BC, Ng A, Eisenberg J, Zhao Z, Cadwell K, et al. Identification of

Atg5-dependent transcriptional changes and increases in mitochondrial mass in Atg5-

deficient T lymphocytes. Autophagy 2009 Jul; 5(5): 625-635.

67. Kundu M, Lindsten T, Yang CY, Wu J, Zhao F, Zhang J, et al. Ulk1 plays a critical role in

the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation.

Blood 2008 Aug 15; 112(4): 1493-1502.

68. Mortensen M, Ferguson DJ, Edelmann M, Kessler B, Morten KJ, Komatsu M, et al. Loss

of autophagy in erythroid cells leads to defective removal of mitochondria and severe

anemia in vivo. Proc Natl Acad Sci U S A 2010 Jan 12; 107(2): 832-837.

69. Ouseph MM, Huang Y, Banerjee M, Joshi S, MacDonald L, Zhong Y, et al. Autophagy is

induced upon platelet activation and is essential for hemostasis and thrombosis. Blood

2015 Sep 3; 126(10): 1224-1233.

70. Kang YA, Sanalkumar R, O'Geen H, Linnemann AK, Chang CJ, Bouhassira EE, et al.

Autophagy driven by a master regulator of hematopoiesis. Mol Cell Biol 2012 Jan; 32(1):

226-239.

71. Artinger EL, Mishra BP, Zaffuto KM, Li BE, Chung EK, Moore AW, et al. An MLL-

dependent network sustains hematopoiesis. Proc Natl Acad Sci U S A 2013 Jul 16;

110(29): 12000-12005.

72. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, et al. The 2016

revision to the World Health Organization classification of myeloid neoplasms and acute

leukemia. Blood 2016 May 19; 127(20): 2391-2405.

73. Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, et al. The 2016

revision of the World Health Organization classification of lymphoid neoplasms. Blood

2016 May 19; 127(20): 2375-2390.

74. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin 2016 Jan-Feb;

66(1): 7-30.

75. Schoch C, Schnittger S, Klaus M, Kern W, Hiddemann W, Haferlach T. AML with

11q23/MLL abnormalities as defined by the WHO classification: incidence, partner

chromosomes, FAB subtype, age distribution, and prognostic impact in an unselected

series of 1897 cytogenetically analyzed AML cases. Blood 2003 Oct 1; 102(7): 2395-

2402.

76. Nakamura T, Mori T, Tada S, Krajewski W, Rozovskaia T, Wassell R, et al. ALL-1 is a

histone methyltransferase that assembles a supercomplex of proteins involved in

transcriptional regulation. Mol Cell 2002 Nov; 10(5): 1119-1128.

77. Ross ME, Mahfouz R, Onciu M, Liu HC, Zhou X, Song G, et al. Gene expression

profiling of pediatric acute myelogenous leukemia. Blood 2004 Dec 1; 104(12): 3679-

3687.

78. Balgobind BV, Zwaan CM, Pieters R, Van den Heuvel-Eibrink MM. The heterogeneity of

pediatric MLL-rearranged acute myeloid leukemia. Leukemia 2011 Aug; 25(8): 1239-

1248.

79. Borkin D, He S, Miao H, Kempinska K, Pollock J, Chase J, et al. Pharmacologic

inhibition of the Menin-MLL interaction blocks progression of MLL leukemia in vivo.

Cancer Cell 2015 Apr 13; 27(4): 589-602.

80. Grembecka J, He S, Shi A, Purohit T, Muntean AG, Sorenson RJ, et al. Menin-MLL

inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia. Nat Chem Biol

2012 Jan 29; 8(3): 277-284.

81. Daigle SR, Olhava EJ, Therkelsen CA, Basavapathruni A, Jin L, Boriack-Sjodin PA, et al.

Potent inhibition of DOT1L as treatment of MLL-fusion leukemia. Blood 2013 Aug 8;

122(6): 1017-1025.

82. Zuber J, Shi JW, Wang E, Rappaport AR, Herrmann H, Sison EA, et al. RNAi screen

identifies Brd4 as a therapeutic target in acute myeloid leukaemia. Nature 2011 Oct 27;

478(7370): 524-U124.

83. Altman BJ, Jacobs SR, Mason EF, Michalek RD, MacIntyre AN, Coloff JL, et al.

Autophagy is essential to suppress cell stress and to allow BCR-Abl-mediated

leukemogenesis. Oncogene 2011 Apr 21; 30(16): 1855-1867.

84. Watson AS, Riffelmacher T, Stranks A, Williams O, De Boer J, Cain K, et al. Autophagy

limits proliferation and glycolytic metabolism in acute myeloid leukemia. Cell Death

Discov 2015 Aug 17; 1.

85. Piya S, Kornblau SM, Ruvolo VR, Mu H, Ruvolo PP, McQueen T, et al. Atg7

suppression enhances chemotherapeutic agent sensitivity and overcomes stroma-

mediated chemoresistance in acute myeloid leukemia. Blood 2016 Sep 1; 128(9): 1260-

1269.

86. Altman JK, Szilard A, Goussetis DJ, Sassano A, Colamonici M, Gounaris E, et al.

Autophagy is a survival mechanism of acute myelogenous leukemia precursors during

dual mTORC2/mTORC1 targeting. Clin Cancer Res 2014 May 1; 20(9): 2400-2409.

87. Liu Q, Chen L, Atkinson JM, Claxton DF, Wang HG. Atg5-dependent autophagy

contributes to the development of acute myeloid leukemia in an MLL-AF9-driven mouse

model. Cell Death Dis 2016; 7(9): e2361.

88. Houwerzijl EJ, Pol HW, Blom NR, van der Want JJ, de Wolf JT, Vellenga E. Erythroid

precursors from patients with low-risk myelodysplasia demonstrate ultrastructural

features of enhanced autophagy of mitochondria. Leukemia 2009 May; 23(5): 886-891.

89. Watson AS, Mortensen M, Simon AK. Autophagy in the pathogenesis of myelodysplastic

syndrome and acute myeloid leukemia. Cell Cycle 2011 Jun 1; 10(11): 1719-1725.

90. Evangelisti C, Evangelisti C, Chiarini F, Lonetti A, Buontempo F, Neri LM, et al.

Autophagy in acute leukemias: a double-edged sword with important therapeutic

implications. Biochim Biophys Acta 2015 Jan; 1853(1): 14-26.

91. Willems L, Jacque N, Jacquel A, Neveux N, Maciel TT, Lambert M, et al. Inhibiting

glutamine uptake represents an attractive new strategy for treating acute myeloid

leukemia. Blood 2013 Nov 14; 122(20): 3521-3532.

92. Isakson P, Bjoras M, Boe SO, Simonsen A. Autophagy contributes to therapy-induced

degradation of the PML/RARA oncoprotein. Blood 2010 Sep 30; 116(13): 2324-2331.

93. Palmeira dos Santos C, Pereira GJ, Barbosa CM, Jurkiewicz A, Smaili SS, Bincoletto C.

Comparative study of autophagy inhibition by 3MA and CQ on Cytarabineinduced death

of leukaemia cells. J Cancer Res Clin Oncol 2014 Jun; 140(6): 909-920.

94. Willems L, Chapuis N, Puissant A, Maciel TT, Green AS, Jacque N, et al. The dual

mTORC1 and mTORC2 inhibitor AZD8055 has anti-tumor activity in acute myeloid

leukemia. Leukemia 2012 Jun; 26(6): 1195-1202.

95. Liang CC, Wang C, Peng X, Gan B, Guan JL. Neural-specific deletion of FIP200 leads to

cerebellar degeneration caused by increased neuronal death and axon degeneration. J

Biol Chem 2010 Jan 29; 285(5): 3499-3509.

96. Komatsu M, Waguri S, Chiba T, Murata S, Iwata J, Tanida I, et al. Loss of autophagy in

the central nervous system causes neurodegeneration in mice. Nature 2006 Jun 15;

441(7095): 880-884.

97. Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y, et al. Bif-1 interacts

with Beclin 1 through UVRAG and regulates autophagy and tumorigenesis. Nat Cell Biol

2007 Oct; 9(10): 1142-1151.

98. Nedjic J, Aichinger M, Emmerich J, Mizushima N, Klein L. Autophagy in thymic

epithelium shapes the T-cell repertoire and is essential for tolerance. Nature 2008 Sep

18; 455(7211): 396-400.

99. Conway KL, Kuballa P, Song JH, Patel KK, Castoreno AB, Yilmaz OH, et al. Atg16l1 is

required for autophagy in intestinal epithelial cells and protection of mice from

Salmonella infection. Gastroenterology 2013 Dec; 145(6): 1347-1357.

100. Levine B, Packer M, Codogno P. Development of autophagy inducers in clinical

medicine. J Clin Invest 2015 Jan; 125(1): 14-24.

101. Kang MR, Kim MS, Oh JE, Kim YR, Song SY, Kim SS, et al. Frameshift mutations of

autophagy-related genes ATG2B, ATG5, ATG9B and ATG12 in gastric and colorectal

cancers with microsatellite instability. J Pathol 2009 Apr; 217(5): 702-706.

102. Liang C, Feng P, Ku B, Dotan I, Canaani D, Oh BH, et al. Autophagic and tumour

suppressor activity of a novel Beclin1-binding protein UVRAG. Nat Cell Biol 2006 Jul;

8(7): 688-699.

103. Vantaggiato C, Crimella C, Airoldi G, Polishchuk R, Bonato S, Brighina E, et al.

Defective autophagy in spastizin mutated patients with hereditary spastic paraparesis

type 15. Brain 2013 Oct; 136(Pt 10): 3119-3139.

104. Oz-Levi D, Ben-Zeev B, Ruzzo EK, Hitomi Y, Gelman A, Pelak K, et al. Mutation in

TECPR2 reveals a role for autophagy in hereditary spastic paraparesis. Am J Hum

Genet 2012 Dec 7; 91(6): 1065-1072.

105. Pyo JO, Yoo SM, Ahn HH, Nah J, Hong SH, Kam TI, et al. Overexpression of Atg5 in

mice activates autophagy and extends lifespan. Nat Commun 2013; 4: 2300.

106. Yang L, Li P, Fu S, Calay ES, Hotamisligil GS. Defective hepatic autophagy in obesity

promotes ER stress and causes insulin resistance. Cell Metab 2010 Jun 9; 11(6): 467-

478.

107. Khandelwal PJ, Herman AM, Hoe HS, Rebeck GW, Moussa CE. Parkin mediates beclin-

dependent autophagic clearance of defective mitochondria and ubiquitinated Abeta in

AD models. Hum Mol Genet 2011 Jun 1; 20(11): 2091-2102.

108. He C, Bassik MC, Moresi V, Sun K, Wei Y, Zou Z, et al. Exercise-induced BCL2-

regulated autophagy is required for muscle glucose homeostasis. Nature 2012 Jan 26;

481(7382): 511-515.

109. Jia K, Levine B. Autophagy is required for dietary restriction-mediated life span

extension in C. elegans. Autophagy 2007 Nov-Dec; 3(6): 597-599.

110. Kim J, Kundu M, Viollet B, Guan KL. AMPK and mTOR regulate autophagy through

direct phosphorylation of Ulk1. Nat Cell Biol 2011 Feb; 13(2): 132-141.

111. Kim YC, Guan KL. mTOR: a pharmacologic target for autophagy regulation. J Clin Invest

2015 Jan; 125(1): 25-32.

112. Egan DF, Shackelford DB, Mihaylova MM, Gelino S, Kohnz RA, Mair W, et al.

Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy

sensing to mitophagy. Science 2011 Jan 28; 331(6016): 456-461.

113. Hidvegi T, Ewing M, Hale P, Dippold C, Beckett C, Kemp C, et al. An autophagy-

enhancing drug promotes degradation of mutant alpha1-antitrypsin Z and reduces

hepatic fibrosis. Science 2010 Jul 9; 329(5988): 229-232.

114. Sarkar S, Perlstein EO, Imarisio S, Pineau S, Cordenier A, Maglathlin RL, et al. Small

molecules enhance autophagy and reduce toxicity in Huntington's disease models. Nat

Chem Biol 2007 Jun; 3(6): 331-338.

115. Hundeshagen P, Hamacher-Brady A, Eils R, Brady NR. Concurrent detection of

autolysosome formation and lysosomal degradation by flow cytometry in a high-content

screen for inducers of autophagy. BMC Biol 2011 Jun 02; 9: 38.

116. Rouschop KM, Ramaekers CH, Schaaf MB, Keulers TG, Savelkouls KG, Lambin P, et al.

Autophagy is required during cycling hypoxia to lower production of reactive oxygen

species. Radiother Oncol 2009 Sep; 92(3): 411-416.

117. Qadir MA, Kwok B, Dragowska WH, To KH, Le D, Bally MB, et al. Macroautophagy

inhibition sensitizes tamoxifen-resistant breast cancer cells and enhances mitochondrial

depolarization. Breast Cancer Res Treat 2008 Dec; 112(3): 389-403.

118. Carew JS, Nawrocki ST, Kahue CN, Zhang H, Yang C, Chung L, et al. Targeting

autophagy augments the anticancer activity of the histone deacetylase inhibitor SAHA to

overcome Bcr-Abl-mediated drug resistance. Blood 2007 Jul 1; 110(1): 313-322.

119. Apel A, Herr I, Schwarz H, Rodemann HP, Mayer A. Blocked autophagy sensitizes

resistant carcinoma cells to radiation therapy. Cancer Res 2008 Mar 1; 68(5): 1485-1494.

120. Harhaji-Trajkovic L, Arsikin K, Kravic-Stevovic T, Petricevic S, Tovilovic G, Pantovic A, et

al. Chloroquine-mediated lysosomal dysfunction enhances the anticancer effect of

nutrient deprivation. Pharm Res 2012 Aug; 29(8): 2249-2263.

121. Ramser B, Kokot A, Metze D, Weiss N, Luger TA, Bohm M. Hydroxychloroquine

modulates metabolic activity and proliferation and induces autophagic cell death of

human dermal fibroblasts. J Invest Dermatol 2009 Oct; 129(10): 2419-2426.

122. Rangwala R, Chang YC, Hu J, Algazy KM, Evans TL, Fecher LA, et al. Combined

MTOR and autophagy inhibition: phase I trial of hydroxychloroquine and temsirolimus in

patients with advanced solid tumors and melanoma. Autophagy 2014 Aug; 10(8): 1391-

1402.

123. Rojas-Puentes LL, Gonzalez-Pinedo M, Crismatt A, Ortega-Gomez A, Gamboa-Vignolle

C, Nunez-Gomez R, et al. Phase II randomized, double-blind, placebo-controlled study

of whole-brain irradiation with concomitant chloroquine for brain metastases. Radiat

Oncol 2013 Sep 08; 8: 209.

124. McAfee Q, Zhang Z, Samanta A, Levi SM, Ma XH, Piao S, et al. Autophagy inhibitor

Lys05 has single-agent antitumor activity and reproduces the phenotype of a genetic

autophagy deficiency. Proc Natl Acad Sci U S A 2012 May 22; 109(21): 8253-8258.

125. Rosenfeld MR, Grossman SA, Brem S, Mikkelsen T, Wang D, Piao S, et al.

Pharmacokinetic analysis and pharmacodynamic evidence of autophagy inhibition in

patients with newly diagnosed glioblastoma treated on a phase I trial of

hydroxychloroquine in combination with adjuvant temozolomide and radiation (ABTC

0603). J Clin Oncol (Meeting Abstracts) 2010 May 20, 2010; 28(15_suppl): 3086-.

126. Maycotte P, Aryal S, Cummings CT, Thorburn J, Morgan MJ, Thorburn A. Chloroquine

sensitizes breast cancer cells to chemotherapy independent of autophagy. Autophagy

2012 Feb 1; 8(2): 200-212.

127. Maes H, Kuchnio A, Peric A, Moens S, Nys K, De Bock K, et al. Tumor vessel

normalization by chloroquine independent of autophagy. Cancer Cell 2014 Aug 11; 26(2):

190-206.

128. Goldberg SB, Supko JG, Neal JW, Muzikansky A, Digumarthy S, Fidias P, et al. A phase

I study of erlotinib and hydroxychloroquine in advanced non-small-cell lung cancer. J

Thorac Oncol 2012 Oct; 7(10): 1602-1608.

129. Vogl DT, Stadtmauer EA, Tan KS, Heitjan DF, Davis LE, Pontiggia L, et al. Combined

autophagy and proteasome inhibition: a phase 1 trial of hydroxychloroquine and

bortezomib in patients with relapsed/refractory myeloma. Autophagy 2014 Aug; 10(8):

1380-1390.

130. Rosenfeld MR, Ye X, Supko JG, Desideri S, Grossman SA, Brem S, et al. A phase I/II

trial of hydroxychloroquine in conjunction with radiation therapy and concurrent and

adjuvant temozolomide in patients with newly diagnosed glioblastoma multiforme.

Autophagy 2014 Aug; 10(8): 1359-1368.

131. Mandelbaum J, Rollins N, Shah P, Bowman D, Lee JY, Tayber O, et al. Identification of

a lung cancer cell line deficient in atg7-dependent autophagy. Autophagy 2015 Jun 19: 0.

132. Ouyang DY, Xu LH, He XH, Zhang YT, Zeng LH, Cai JY, et al. Autophagy is differentially

induced in prostate cancer LNCaP, DU145 and PC-3 cells via distinct splicing profiles of

ATG5. Autophagy 2013 Jan; 9(1): 20-32.

133. Eng CH, Wang Z, Tkach D, Toral-Barza L, Ugwonali S, Liu S, et al. Macroautophagy is

dispensable for growth of KRAS mutant tumors and chloroquine efficacy. Proc Natl Acad

Sci U S A 2016 Jan 5; 113(1): 182-187.

Chapter 2 mTOR on autophagy regulation in normal

hematopoietic stem/progenitor cells (HSPCs)

2.1 Abstract

Macroautophagy, or autophagy, is a self- degrading and recycling process that maintains cellular homeostasis. In the blood system, autophagy is essential for life-long support and maintenance of hematopoietic stem cells (HSC). Defects in the autophagy process lead to HSC aging, transplant failure, and abnormal development in the various lineages. Currently, mTOR signaling is the known major inhibitory regulator of autophagy process. mTOR deletion in the blood system leads to the failure of normal hematopoiesis, shown as an expanded HSC pool but massive apoptosis in more mature cells. Since phenotypical responses to mTOR deletion vary in different subpopulations, we hypothesized that the dependence on mTOR to regulate autophagy also differs among different HSPCs subpopulations.

To address our hypothesis, we crossed an autophagy reporter GFP-LC3 to an mTORflox/floxMxCre+/- or an mTORflox/knockinMxCre+/- genetic background. mTORflox/knockinMxCre+ mice have a point mutation in the kinase domain of the knockin allele, producing a protein that is kinase dead. In the wildtype hematopoietic system, HSC and CMP subpopulations have higher

LC3 levels and basal autophagy activity than more differentiated GMP populations. In HSC and

GMP subpopulations, the basal autophagy status does not change upon mTOR deletion, suggesting that the autophagy regulation is independent of mTOR in these two groups. In the

CMP subpopulation, the basal autophagy activity increases significantly upon mTOR knockout compared to wild type. Pharmacological mTOR inhibition induces autophagy in wildtype lineage negative cells and the HSC subpopulation, while genetic knockout of mTOR does not. A nonspecific kinase inhibitor compound C induces autophagy in both mTOR wildtype and knockout HSC, suggesting the existence of a kinase dependent compensatory pathway that suppresses autophagy upon mTOR loss. We also found that mTOR knockin, resulting in a kinase dead protein, mimics mTOR knockout, indicating that the suppression of autophagy is through the kinase function, not the protein scaffold effect. Also, our preliminary data indicates that mTOR regulation of autophagy is likely through mTORC1. Conclusively, HSPCs

41 subpopulations show different dependence on autophagy activity and mTOR has various roles in autophagy regulation.

2.2 Introduction

In the hematopoietic system, the effect autophagy has on normal maintenance and functionality of hematopoietic stem cells (HSC) is well documented. Generally, autophagy defects affect normal HSC maintenance and stem cell function, causing stem cell exhaustion and loss of stemness. Warr et al. reports that mouse HSC robustly induce autophagy upon cytokine withdrawal ex vivo or upon starvation in vivo, a response maintained by Foxo3a. Hsc with an autophagy defect, through the Atg12 knockout mouse model, lose the protection against starvation-induced apoptosis.1 Mortensen et al. found that the autophagy essential gene Atg7 deletion causes HSC depletion and an expansion of the progenitor cell pool, mimicking a myeloproliferative phenotype in mouse bone marrow.2 Although the importance of autophagy for

HSC is well established, little is known about autophagy regulation and balancing in normal hematopoiesis.

The mammalian target of rapamycin (mTOR) signaling pathway senses environmental cues, such as nutrient status, stress, and growth factor levels to regulate cell growth and homeostasis3 through two protein complexes, mTOR complex 1 (mTOC1) and mTOR complex

2 (mTORC2).3 Autophagy, as a cellular process responding to nutrient and energy status, is one of the downstream effectors of the mTORC1 signaling pathway through the autophagy initiation

ULK complex (ULK1/2-FIP200-Atg13-Atg101). 4 mTOR phosphorylates ULK1/2 and Atg13 and inhibits the kinase activity of ULK1/2 under nutrient rich conditions. Upon starvation, mTORC1 phosphorylation of ULK complex is suppressed, releasing ULK from mTORC1 inhibition, which subsequently induces ULK to phosphorylate Atg13, FIP200 and itself, inducing the autophagy process.5, 6 mTORC1 can also destabilize ULK through inhibiting the ULK1 stabilizing protein autophagy/beclin1 regulator 1 (AMBRA1) by phosphorylation. While dephosphorylated

AMBRA1 interacts with TRAF6, which is an E3-ligase that ubiquitylates and stabilizes ULK1.7

Furthermore, mTORC1 phosphorylates Atg14L in the VPS34 complex, inhibiting the activity of

VPS34, leading to autophagy inhibition.8 In addition to influencing phosphorylation, mTORC1 can also regulate autophagy at the transcriptional level by modulating the cytosol-nuclear location of transcription factor EB (TFEB), which drives the expression of autophagy and lysosomal genes.9 Generally, the mechanism of mTOR inhibiting autophagy is complicated and not fully understood.

Due to the importance of mTOR in cell growth regulation, mice with homozygous loss of mTOR, affecting both complexes, die at a very early embryonic stage.10 mTORC1 regulates a wide variety of cellular processes including protein synthesis, lipid synthesis, lysosome biogenesis, and energy metabolism, while mTORC2 regulates cytoskeletal organization, cell survival and metabolism.3 In the hematopoietic system, mice with mTORC1 inhibition through deletion of the regulatory-associated protein of mTOR (Raptor), show a nonlethal phenotype characterized by pancytopenia, splenomegaly, and the accumulation of monocytoid cells. Although Raptor loss is not required for HSC maintenance under homeostatic conditions, there are significant changes in a cell’s cycle, metabolic rates, differentiation, and gene expression; HSC with Raptor loss are unable to engraft and reconstruct the blood system after transplantation.11 Phenotypical similarities exist between Raptor and mTOR knockouts, such as pancytopenia and failure of

HSC engraftment, while discrepancies could be possibly explained by the existence of undiscovered mTOR complexes in blood system. For example, a recent publication reported the discovery of a new mTOR complex in neural system.12 Or the mTOR protein, other than the kinase function plays a role to compensate.

With rapamycin-insensitive companion of mTOR (Rictor) deletion in mTORC2, only the lower level of peripheral blood cells are observed, while HSC number, immunophenotype, engraftment, and blood system reconstitution abilities are all unchanged.11 The double knockout of Raptor and Rictor mostly mimic the phenotype of Raptor knockout.11 Pancytopenia in the

44 peripheral blood, but an expanded HSPC pool, shown as increase LK and LSK populations, in the bone marrow are observed.13

The true cause of these blood phenotypes remains unknown. Deregulated autophagy after mTOR suppression could be a cause or if the mTOR kinase and protein have different roles in hematopoiesis. In this thesis, we investigate the mechanism of mTOR regulation on autophagy in HSPCs using the conditional mTOR knockout and knockin mouse models. Our work will greatly help us understand the mechanism of the mTOR kinase and the protein itself in normal hematopoiesis as well as the mechanism of mTOR regulation on autophagy in HSPCs.

2.3 Results

Basal autophagy activity varies in HSPCs subpopulations

We initially isolated lineage negative progenitor cells for autophagy analysis. We observed that mTOR deletion did not induce the basal autophagy activity in lineage negative cells (Fig. 2-2, upper panels). Upon treatment with mTOR pharmacological inhibitor rapamycin, autophagy activity was induced in mTOR wildtype, but not in mTOR knockout lineage negative cells (Fig. 2-

2 lower panels).

Due to the heterogeneity of lineage negative cells, we went on to investigate more defined

HSPCs subpopulations. By utilizing FACS analysis, we observed that in wildtype mouse HSPCs, the expression level of GFP-LC3 varied among different subpopulations, with higher expression in more primitive HSC and CMP and lower expression in more differentiated MEP and GMP populations (Fig. 2-3A). Using the late stage autophagy blocker Bafilomycin A1 (BA) treatment, we observed higher LC3 puncta accumulation in HSC and CMP, while it was lower in GMP

(Figure 2-3B). These data suggest that more primitive HSPCs need higher autophagy activity. mTOR deletion leads to the expansion of HSPCs pool

Induction of mTOR deletion in the blood system causes changes to the downstream signaling.

In lineage negative hematopoietic progenitor cells, we observed decreased phosphorylation of

S6 and 4EBP1, which are downstream effectors of mTORC1; decreased phosphorylation of

AKT473, which are downstream effectors of mTORC2; while increased pAKT308 possibly due to the regulation of negative feedback loop in PI3K pathway (Fig. 2-1A). We also observed the expansion of HSPCs pool, shown as increased LK and LSK population after mTOR deletion in mouse bone marrow (Fig. 2-1B). More detailed characterization of bone morrow HSPCs subpopulations upon mTOR deletion was reported in our previous publication.13

Response of autophagy activity to mTOR deletion varies in different HSPCs subpopulations

Upon mTOR deletion through genetic knockout, we observed that the autophagy response varied in HSPC subpopulations. In HSC, there was no change of basal autophagy activity, shown as similar percentage of LC3 puncta positive cells with or without BA blockage between mTOR wildtype and knockout (Fig. 2-4A). In CMP population, a higher autophagy flux is observed in mTOR knockouts compared to wildtype (Fig. 2-4B). In the GMP population, a similar autophagy flux is observed between mTOR wild type and knockout (Fig. 2-4C). Together, these preliminary data suggests that HSPCs subpopulations have varying dependence on mTOR in regulating autophagy activity.

To investigate further, we treated HSC with mTOR pharmacological inhibitor AZD 8055. Unlike mTOR genetic knockout, AZD8055 induced autophagy activity in mTOR wildtype HSC. No response is seen in mTOR knockout HSC (Fig. 2-5). When we treated HSC with a non-specific kinase inhibitor compound C, we found that both wildtype and knockout cells have increased

LC3 puncta formation, indicating induced autophagy activity (Fig. 2-5). These data suggest that mTOR genetic knockout and pharmacological inhibitors behave differently in inducing autophagy. The existence of a compensatory kinase suppressor is highly likely.

In HSPC subpopulations, mTOR regulates autophagy through its kinase function and through mTORC1

To determine if the mTOR protein has a scaffold role in autophagy regulation, we made mTOR knockin mice using CRISPR-Cas9 technology (Fig. 2-8). After the induced deletion of the floxed allele, mice with the knockin allele expressed mTOR protein without the kinase function. We subsequently found that the change of downstream signaling was similar to mTOR knockout mice (Fig. 2-6A). In mTOR knockin mice bone marrow, we also observed expanded HSPCs

47 pool (Fig. 2-6B), similar to what we found in mTOR knockout (Fig. 2-1B). By using flow cytometry analysis, we found that GFP-LC3 level in each HSPCs subpopulation shifted similarly between mTOR knockout and knockin (Fig. 2-6C). These data indicate that mTOR regulates autophagy through its kinase function instead of a scaffold role.

To determine if the regulation of autophagy is through mTORC1, we deleted Raptor, an essential component of mTORC1, in mouse blood system. We observed that the Raptor knockout did not affect the protein level, but did affect the kinase function of mTOR (Fig. 2-7A).

In the Raptor knockout lineage negative cells, we did not observe increased basal autophagy activity or responses to mTOR pharmacological inhibitor treatment, similar to what we found in mTOR knockout lineage negative cells (Fig. 2-7B). These data suggest that mTOR regulates autophagy through mTORC1 in hematopoietic progenitor cells.

2.4 Discussion

In this section, we investigated the mechanism of how mTOR regulates autophagy in HSPCs.

We found that HSPCs subpopulations have varied basal autophagy activity, with higher autophagy activity in more primitive stem cells and lower levels in more differentiated progenitor cells. This indicates HSPCs at different stages have varied dependence on basal autophagy activity. In stem cells, the inner environment needs low levels of ROS and mitochondria; both are degraded and recycled by the autophagy process. Also, high LC3 expression level and autophagy activity guarantee a quick response to eliminate damages. As a long-lasting small sized population, primitive stem cells need high autophagy activity to keep them in a healthy state.

Although mTOR is considered to be the major suppressor of the autophagy process, our data suggests that it is not the only negative regulator. In HSC and GMP populations, mTOR deletion does not affect the basal autophagy activity, suggesting the existence of other negative regulatory pathways. To investigate this mechanism, we made the mTOR knockin mice to rule out the protein scaffold effect of the mTOR complex in autophagy regulation. The similar autophagy phenotype between mTOR knockout and knockin highly suggests that mTOR inhibits autophagy through the kinase function, although a small chance does exist that a point mutation in mTOR could affect the assembly of the mTOR complexes. In this case, an immunoprecipitation assay could be utilized to rule out this possibility. In the CMP subpopulation, we observed increased basal autophagy activity upon mTOR deletion, suggesting that in CMP, mTOR is the only major negative regulator, or the compensatory system is this subpopulation may need longer time to be effective.

To further explore the compensatory mechanism, we introduced an mTOR pharmacological inhibitor treatment to the HSPCs. Upon inhibitor treatment, wildtype HSPCs show increased

LC3 puncta formation, which was different from what we observed in mTOR knockout. This discrepancy could be caused by the delayed response of the compensatory pathway. In the mTOR genetic knockout model, mice were treated with polyI:C before autophagy analysis, while treatment with pharmacological inhibitors was only a few hours, which maybe too short to see any compensatory effects. When we treated mTOR wildtype and knockout with a nonspecific kinase inhibitor compound C, both wildtype and knockout show increased LC3 puncta formation.

This suggests that other kinases are inhibiting autophagy upon mTOR loss. We considered Akt as a possible candidate because Akt has been reported to suppress autophagy by phosphorylating Beclin1, an essential components in Vps34-Beclin1 complex that functions at the beginning stage of autophagy process.14 Indeed, after the loss of the mTOR kinase function, we found increased Akt phosphorylation at site 308. However, further research with Akt inhitor treatment is needed before we draw any conclusion.

We also found that autophagy response in the Rptor knockout lineage negative population mimics what is seen in mTOR knockout lineage negative cells, suggesting that mTOR regulates autophagy through mTORC1. Papers exist showing that mTORC2 also regulates autophagy in certain type of cells, 15 but this is not well investigated in hematopoietic system. There is also the possibility that more autophagy regulating mTOR complexes exist but are yet to characterized.

Much of this data is currently very preliminary resulting in only tentative conclusions. To fully address the mechanism of how mTOR regulates autophagy, more extensive and detailed research is planned and will be carried out in the future.

2.5 Material and methods

Mouse models mTORflox/floxMxcre mice have been described previously.8 The mTOR knockin mouse was made by CRISPR-Cas9 technology (Fig.2-8). All mice used were 6 to 12 weeks of age unless otherwise indicated. Animal research was approved by the Institutional Animal Care and Use

Committee at the Cincinnati Children’s Hospital Research Foundation.

Fluorescent Microscopy

For immunofluorescence microscopy, cells were seeded on retronectin coated slides for at least

2 hrs. Fixation was performed in cold methanol (Fisher Scientific, A412-4) for 15 minutes at -

20oC. Fixed cells were permeablilized with 0.2% Triton-100 (Bio-Rad, 1610407) for 20 minutes and blocked in 5% goat serum (Thermo Fisher Scientific, 16210064) for 1 hour. After blocking, slides were stained with primary antibodies overnight followed by 1 hour incubation with secondary antibodies. Images were taken on a Nikon C2 confocal microscope.

Western blot assays

Cell lysis buffer for western blot contained 63 mM Tris, pH 6.8 (Research Products

International,T60050), 2% SDS (Bio-Rad, 161-0302), 10% glycerol (Research Products

International, G22020), 0.01% bromophenol blue (Bio-Rad, 161-0404), 10mM NaF (Sigma-

Aldrich, s6521), 4mM dithiothreitol (DTT; ThermoFisher Scientific, 15508013), 0.2 mM sodium orthovanadate (Santa Cruz Biotechnology, sc-24948A), 10 mM β-glycerophosphate

(Calbiochem,35675), 1 mM PMSF (Santa Cruz Biotechnology, sc-24948A), 5% β- mercaptoethanol (Thermo Fisher, 60-24-2) and proteinase inhibitor cocktail (Santa Cruz

Biotechnology; sc-24948A). Whole cell lysate was resolved on a 4-15% precast gel (Bio-Rad,

456-1086) and transferred to PVDF (EMD Millipore, IPFL00010) using the Bio-Rad Transblot

Turbo® system. Blots were developed using the Odyssey infrared imager (LI-COR Biosciences).

Flow cytometry and cell sorting

Cells were stained following the manufacturer’s standard staining protocol. Flow cytometry analyses were performed on a FACS Canto II analyzer (BD Biosciences). Data were analyzed using BD FACSDiva software v8.0.1. Cell sorting strategy is illustrated in Fig. 2-9.

Cell culture

Cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; HyClone Laboratories,

SH30228.01) containing 10% FBS (Atlanta biologicals, S12450), 1% Penicillin/Streptomycin

(HyClone Laboratories, SV30010) and supplemented with 50 ng/mL SCF (Peprotech, 250-03) and TPO (Peprotech, 315-14).

Drugs and reagents

Bafilomycin A1 (Sigma-Aldrich, 88899-55-2), Chloroquine (Sigma-Aldrich, C6628), LC3A/B (Cell

Signaling Technology, 4108), Secondary antibodies for immunofluorescent staining including

Alexa Flour 488 goat anti-rabbit IgG (Life Technologies, A11008), Alexa Flour 568 goat anti- rabbit IgG (Life Technologies, A11011), and Alexa Flour 568 goat anti-rat IgG (Life

Technologies, A11077). Secondary antibodies for western blot include goat anti-rabbit 680 (LI-

COR Biosciences, 926-68071), goat anti-Rabbit 800 (LI-COR Biosciences, 926-32211), goat anti-mouse 680 (LI-COR Biosciences, 929-68070), goat anti-mouse 800 (LI-COR Biosciences,

926-32210).

2.6 Figures

Figure 2-1. mTOR deletion leads to HSPCs pool expansion in adult mouse bone marrow. (A)

Lineage negative cells were selected followed by western blot analysis for mTOR downstream signaling. (B) Bone marrow cells from both mTOR wildtype and knockout were analyzed by

FACS. Number represents the percentage of LK and LSK in total bone marrow cells. Data represent 2 independent repeats.

Figure 2-2. mTOR inhibitor induces autophagy in WT, but not in KO lineage negative cells.

Lineage negative cells were selected by beads and followed by respective treatment for 24 hours before immunofluorescent staining of LC3 puncta. CQ: chloroquine, 25 μM, Rapa: rapamycin, 1 μM. Scale bar: 5 μm.

Figure 2-3. Basal autophagy activity varies in wildtype HSPCs subpopulations. (A) FACS analysis of GFP-LC3 expression level ex vivo. Data represent 2 independent repeats. (B)

Sorted HSPC subpopulations were treated with BA for 4 hours at 10 nM followed by immunofluorescent staining of LC3 puncta. Data represent two independent repeats. Scale bar:

10 μM. Cells with more than one puncta are considered as positive. BA: Bafilomycin A1.

Figure 2-4. mTOR knockout induces different autophagy responses in HSPC subpopulations.

(A) HSC were sorted by FACS and treated with BA for 4 hours at 10 nM before immunostaining for LC3 puncta. (B, C) CMP and GMP were sorted followed by same treatment described in A.

Data represent two independent repeats. HSC: hematopoietic stem cells. CMP: common myeloid progenitors. GMP: granulo-macrophage progenitors.

Figure 2-5. mTOR inhibitor and genetic knockout induces different autophagy response in HSC.

FACS sorted HSC were treated with AZD 8055 (100 nM) or CC (5 μΜ) for 4 hours followed by immunofluorescent staining for LC3 puncta. CC: compound C. Data represents two independent repeats.

Figure 2-6. mTOR knockin mimics mTOR knockout in autophagy response. (A) Bone marrow cells harvested from mTOR WT, KO, and KI mice were analyzed by western blot. KI: mTOR knockin. (B) FACS analysis of mTOR WT and KI HSPCs. Number represents the percentage of

LK and LSK cells in total bone marrow cells. (C) FACS analysis of GFP-LC3 intensity in HSPCs subpopulations. Data represent two independent repeats.

Figure 2-7. mTORC1 regulates autophagy in lineage negative bone marrow cells. (A) Lineage negative cells from Rptor wildtype and knockout mice were selected and followed by western blot analysis. (B) Lineage negative bone marrow cells were treated with Rapa (1 μΜ) or Torin1

(200 nM) for 24 hours before immunostaining for LC3 puncta. Scale Bar: 5 μΜ.

Figure 2-8. mTOR knockin mouse creation and breeding strategy. Point mutation at amino acid

2338 (labeled in red) by CRISPR-cas9 technology led to a loss of function of mTOR kinase. By breeding a mouse with a KI allele to mTORflox/floxMxCre mice, we were able to breed mTORflox/KIMxcre mice.

Figure 2-9. Bone marrow HSPC subpopulation sorting strategy.

2.7 Reference

1. Warr MR, Binnewies M, Flach J, Reynaud D, Garg T, Malhotra R, Debnath J, Passegue

E. FOXO3A directs a protective autophagy program in haematopoietic stem cells. Nature 2013;

494:323-7.

2. Mortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E, Stranks

AJ, Glanville J, Knight S, Jacobsen SE, et al. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med 2011; 208:455-67.

3. Laplante M, Sabatini DM. mTOR signaling in growth control and disease. Cell 2012;

149:274-93.

4. Jung CH, Ro SH, Cao J, Otto NM, Kim DH. mTOR regulation of autophagy. FEBS Lett

2010; 584:1287-95.

5. Ganley IG, Lam du H, Wang J, Ding X, Chen S, Jiang X. ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. J Biol Chem 2009; 284:12297-305.

6. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH. ULK-Atg13-

FIP200 complexes mediate mTOR signaling to the autophagy machinery. Mol Biol Cell 2009;

20:1992-2003.

7. Nazio F, Strappazzon F, Antonioli M, Bielli P, Cianfanelli V, Bordi M, Gretzmeier C,

Dengjel J, Piacentini M, Fimia GM, et al. mTOR inhibits autophagy by controlling ULK1 ubiquitylation, self-association and function through AMBRA1 and TRAF6. Nat Cell Biol 2013;

15:406-16.

8. Yuan HX, Russell RC, Guan KL. Regulation of PIK3C3/VPS34 complexes by MTOR in nutrient stress-induced autophagy. Autophagy 2013; 9:1983-95.

9. Martina JA, Chen Y, Gucek M, Puertollano R. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 2012; 8:903-14.

10. Gangloff YG, Mueller M, Dann SG, Svoboda P, Sticker M, Spetz JF, Um SH, Brown EJ,

Cereghini S, Thomas G, et al. Disruption of the mouse mTOR gene leads to early

62 postimplantation lethality and prohibits embryonic stem cell development. Mol Cell Biol 2004;

24:9508-16.

11. Kalaitzidis D, Sykes SM, Wang Z, Punt N, Tang Y, Ragu C, Sinha AU, Lane SW, Souza

AL, Clish CB, et al. mTOR complex 1 plays critical roles in hematopoiesis and Pten-loss-evoked leukemogenesis. Cell Stem Cell 2012; 11:429-39.

12. Smithson LJ, Gutmann DH. Proteomic analysis reveals GIT1 as a novel mTOR complex component critical for mediating astrocyte survival. Genes Dev 2016; 30:1383-8.

13. Guo F, Zhang S, Grogg M, Cancelas JA, Varney ME, Starczynowski DT, Du W, Yang

JQ, Liu W, Thomas G, et al. Mouse gene targeting reveals an essential role of mTOR in hematopoietic stem cell engraftment and hematopoiesis. Haematologica 2013; 98:1353-8.

14. Wang RC, Wei Y, An Z, Zou Z, Xiao G, Bhagat G, White M, Reichelt J, Levine B. Akt- mediated regulation of autophagy and tumorigenesis through Beclin 1 phosphorylation. Science

2012; 338:956-9.

15. Gurusamy N, Lekli I, Mukherjee S, Ray D, Ahsan MK, Gherghiceanu M, Popescu LM,

Das DK. Cardioprotection by resveratrol: a novel mechanism via autophagy involving the mTORC2 pathway. Cardiovasc Res 2010; 86:103-12.

Chapter 3 Autophagy is dispensable for Kmt2a/Mll-Mllt3/Af9

AML maintenance and anti-leukemic effect of chloroquine

Xiaoyi Chen,1, 2 Jason Clark,1 Mark Wunderlich,1 Cuiqing Fan,1,3 Ashley Davis,1 Song Chen,2 Jun-Lin Guan,2 James C. Mulloy,1,2 Ashish Kumar,1 and Yi Zheng1, 2

1Division of Experimental Hematology and Cancer Biology, Cincinnati Children’s Research Foundation, Cincinnati, OH 45229, USA; 2Department of Cancer Biology, University of Cincinnati, Cincinnati, OH 45269, USA; 3Institute of Pediatrics, Children's Hospital, Fudan University, 399 Wanyuan Road, Shanghai 201102, China

Correspondence to: Yi Zheng, Ph.D., Division of Experimental Hematology and Cancer Biology, Cincinnati Children’s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH, 45229; Phone: 513-636-0595; Fax: 513-636-3768; E-mail: [email protected]

Key words: Acute myeloid leukemia, ATG5, Autophagy, Chloroquine, RB1CC1/FIP200

Abbreviations: 4-OHT 4-hydroxytamoxifen ACTB actin beta AE RUNX1/AML1-RUNX1T1/ETO AML acute myeloid leukemia AraC cytarabine ATG autophagy related BA bafilomycin A1 BECN1 beclin 1 CQ chloroquine DA doxorubicin DMA 5-(N,N-dimethyl) amiloride HCl RB1CC1/FIP200 RB1-inducible coiled-coil 1 GFP green fluorescent protein GABARAP GABA type A receptor-associated protein IMDM Iscove’s modified Dulbecco’s medium KMT2A/MLL lysine (K)-specific methyltransferase 2A LAMP1 lysosomal-associated membrane protein 1 LDBM low-density bone marrow cells MAP1LC3/LC3 microtubule associated protein 1 light chain 3 MA9 KMT2A/MLL-MLLT3/AF9 MLLT3/AF9 myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 PIK3C3/Vps34 phosphatidylinositol 3-kinase catalytic subunit type 3 ROS reactive oxygen species RUNX1/AML1 runt related transcription factor 1 RUNX1T1/ETO Runt-related transcription factor 1; translocated to, 1 (cyclin D-related) shRNA short hairpin RNA SQSTM1/p62 sequestosome 1 TEM transmission electron microscopy Tuni tunicamycin ULK1/2 unc-51 like autophagy activating kinase 1/2

3.1 Abstract

Recently, macroautophagy/autophagy has emerged as a promising target in various types of solid tumor treatment. However, the impact of autophagy on acute myeloid leukemia (AML) maintenance and the validity of autophagy as a viable target in AML therapy remain unclear.

Here we show that Kmt2a/Mll-Mllt3/Af9 AML (MA9-AML) cells have high autophagy flux compared to normal bone marrow cells, but autophagy-specific targeting, either through

Rb1cc1-disruption to abolish autophagy initiation, or via Atg5-disruption to prevent phagophore

(the autophagosome precursor) membrane elongation, does not affect the growth or survival of

MA9-AML cells, either in vitro or in vivo. Mechanistically, neither Atg5 nor Rb1cc1 disruption impairs endolysosome formation or survival signaling pathways. The autophagy inhibitor chloroquine shows autophagy-independent anti-leukemic effects in vitro but has no efficacy in vivo likely due to limited achievable drug efficacy in blood. Further, vesicular exocytosis appears to mediate chloroquine resistance in AML cells, and exocytotic inhibition significantly enhances the anti-leukemic effect of chloroquine. Thus, chloroquine can induce leukemia cell death in vitro in an autophagy-independent manner but with inadequate efficacy in vivo, and vesicular exocytosis is a possible mechanism of chloroquine resistance in MA9-AML. This study also reveals that autophagy-specific targeting is unlikely to benefit MA9-AML therapy.

3.2 Introduction

Macroautophagy/autophagy, is a self-recycling process that maintains cellular homeostasis by degrading and recycling damaged intracellular organelles and protein aggregates. The canonical autophagy process is well characterized and is orchestrated by a series of highly conserved protein complexes. Autophagy begins with the protein complex RB1CC1-ULK1/2-

ATG13-ATG101 relocating to the phagophore assembly site (PAS).1-3 This is followed by elongation of the phagophore membrane, which requires 2 ubiquitin-like conjugation processes to form the ATG12–ATG5-ATG16L1 protein complex and LC3-II, the mammalian homolog of yeast Atg8.4,5 A recently identified alternative autophagy process begins with the same

RB1CC1-ULK1/2-ATG13-ATG101 and BECN1-PIK3C3 protein complexes.6 However, the elongation phase of the alternative pathway requires RAB9 instead of the 2 ubiquitin-like processes needed in the canonical pathway.6 Both the canonical and the alternative pathways terminate with the autophagosome merging with a lysosome to degrade the contents with lysosomal enzymes. Accordingly, ATG5 is necessary only for the canonical autophagy pathway, while RB1CC1 is required for both the canonical and alternative autophagy pathways.

Cancer cells exhibit high autophagy flux to support their rapid proliferation and turnover rates.

Recent studies suggest that the autophagy pathway is a promising therapeutic target for the treatment of a number of solid tumors such as breast cancer, melanoma and ovarian cancer. In experimental studies, combining an autophagy inhibitor with chemotherapy augments therapeutic benefits and helps overcomes drug resistance.7-9 Clinical trials using the late stage autophagy inhibitor chloroquine or its derivative hydroxychloroquine are underway. Published results show patients have safely gone through the combinatory treatment of chloroquine- hydroxychloroquine with standard chemotherapies and exhibit prolonged survival in certain types of cancer.10-14

Although autophagy-inhibition appears beneficial in the treatment of solid tumors,15 evidence supporting a role for autophagy-manipulation for acute myeloid leukemia (AML) treatment is preliminary and controversial, as the reported evidence is mostly based on in vitro effects of nonspecific autophagy inducers or inhibitors and cell lines.16-18 One recent report showed decreased autophagy genes expression may contribute to AML proliferation,19 while another found higher autophagy flux is associated with shorter disease remission in AML patients and a possible involvement in chemoresistance.20 In the blood system, autophagy is necessary for normal hematopoiesis,21-25 which is a process of continuous self-renewal and active proliferation.

We hypothesize that AML cells might also be dependent on autophagy, given their higher proliferation and turnover rates.

In this study, we have analyzed the role of autophagy genetically in Kmt2a/Mll-Mllt3/Af9 AML

(MA9-AML), an aggressive and chemotherapy-resistant subtype of AML induced by Kmt2a fusion genes.26 Additionally, we have sought to determine the potential value of autophagy inhibition as a therapeutic strategy in MA9-AML treatment. We observed highly elevated levels of autophagy in MA9-AML cells compared to non-leukemic mouse bone marrow cells. However, autophagy inhibition, through specific gene disruptions in both the canonical and alternative autophagy pathways, did not affect the propagation of MA9-AML cells, either in vitro or in vivo.

Further, the autophagy inhibitor chloroquine showed autophagy-independent anti-leukemic effects in both wild-type and autophagy gene disrupted MA9-AML cells. However, chloroquine therapy showed no significant therapeutic benefit in vivo likely due to the inability to reach effective drug concentrations. We also found that leukemia cells treated with chloroquine underwent prominent exocytosis to expel undigested endolysosome cargos extracellularly. With the inhibition of exocytotic processes, the anti-leukemic effect of chloroquine was significantly increased. Our study reveals that autophagy is dispensable for MA9-AML cell growth and survival, both in vitro and in vivo. Additionally, the autophagy inhibitor chloroquine works in an

67 autophagy-independent manner, and exocytosis may be a mechanism for chloroquine resistance in AML cells. These findings will have a significant impact on autophagy- and chloroquine-related leukemia therapy and drug discovery.

3.3 Results

MA9-AML cells have high autophagy activity

To determine whether autophagy is a potential targetable pathway in MA9-AML, we examined autophagy levels in both the retroviral and knock-in MA9 AML models. Compared with wild-type low-density bone marrow cells (LDBM) with enriched hematopoietic progenitors, retroviral- transduced leukemia cells had a significantly higher autophagy activity as shown by increased

LC3-II accumulation (Fig. 3-1A) and increased LC3 puncta formation upon chloroquine treatment (Fig. 3-1B). A higher autophagy flux was also seen after addition of bafilomycin A1, another late stage autophagy inhibitor (Fig. 3-1C). Similarly, a higher autophagy flux was also observed in MA9 knock-in leukemia cells compared to their littermate controls (Fig. 3-2). These data show that MA9-AML cells have a higher basal autophagy activity than wild-type cells.

Atg5 is dispensable for MA9-AML maintenance both in vitro and in vivo

Since Atg5 is essential for proper autophagosome formation and/or maturation,27 we investigated the effect of autophagy inhibition in MA9-AML cells through an Atg5 gene-targeting strategy. We first retrovirally transduced MA9 into Atg5flox/flox lineage negative (Lin-) bone marrow cells. We then introduced a puromycin-resistant retrovirus expressing tamoxifen-inducible

CreER (Puro-CreER) into MA9-AML cells. Treatment with 4-hydroxytamoxifen (4-OHT) and colony selection led to clean Atg5 gene deletion as demonstrated by the absence of ATG5 protein expression in MA9-AML cells (Fig. 3-3A). In agreement with previous reports,28 cells without Atg5 lacked LC3-II and GABARAP-II (another Atg8 family member) generation, and also exhibited increased SQSTM1/p62 accumulation, which is a receptor and substrate protein in autophagy, upon treatment with chloroquine (Fig. 3-3A). LC3 puncta were also absent in Atg5- deleted cells (Fig. S2A). Surprisingly, we did not observe any growth inhibition (Fig. 3-3B) or pro-apoptotic effects (Fig. S2B) after Atg5 deletion in MA9-AML cells. A colony forming assay showed a similar number of colonies in Atg5 wild-type and Atg5-deleted conditions, with a larger

69 average colony size in the Atg5-deleted group (Fig. 3-3C). Although autophagy inhibition can cause elevated reactive oxygen species (ROS) levels and mitochondria accumulation, 29 we did not observe any significant changes; nor did the expression of the mitochondria protein

COX4/COX IV change after Atg5 deletion (Fig. S2C-E). In addition, Atg5 wild-type and knockout cells showed a similar response to starvation (Fig. S2F), further indicating that autophagy is not required for leukemia cell survival.

Next, we examined whether Atg5 deletion had any growth and/or survival impact on MA9-AML in vivo. We transformed Atg5flox/floxMxCre+ Lin- cells with a retrovirus expressing MA9-GFP, using

Atg5flox/flox littermates as controls. After 2 rounds of colony selection, GFP+ MA9-AML cells together with supporting cells, were transplanted into lethally irradiated BoyJ recipient mice (Fig.

3-5A). Two weeks post-transplantation, recipient mice were treated with polyinosinic:polycytidylic acid (polyI:C) to induce Atg5 deletion (Fig. 3-6A). Upon Atg5 deletion, the peripheral white blood cell count dropped significantly (Fig. 3-6B). However, there were no changes in either hemoglobin or platelet levels (Fig. 3-6C,D). Leukemia burden in the bone marrow was unchanged (Fig. 3-6E) and Atg5 deletion did not prolong the survival of MA9-AML mice in either primary or secondary transplantation assays (Fig. 3-5B,C). These data strongly suggest that the Atg5-dependent autophagy pathway is dispensable for the pathogenesis of

MA9-AML cells both in vitro and in vivo.

To investigate whether the lack of a dependence on Atg5 is specific to MA9 leukemia, we examined the effect of Atg5 deletion on cells expressing Runx1/Aml1-Runx1t1/Eto (AE), another oncogene commonly found in AML.30 Using a similar retroviral transduction strategy, we introduced a retrovirus expressing AE labeled with THY1/Thy1.1 followed by Puro-CreER into

Atg5flox/flox Lin- cells to generate AE-Atg5flox/flox CreER cells (Fig. 3-7A). We observed no change in colony-forming ability compared to wild-type AE-AML cells (Fig. 3-7B), after induction of Atg5

70 deletion (Fig. 3-7C). These data indicate that the Atg5-dependent autophagy pathway is also likely dispensable for AE-AML.

Rb1cc1 is not essential for MA9-AML cell maintenance

To determine whether the resistance of MA9-AML cells to Atg5 deletion is due to compensatory effects from an alternative autophagy pathway, we performed a similar set of experiments in a

Rb1cc1-deleted background. We introduced MA9-GFP and Puro-CreER retroviruses into

Rb1cc1flox/flox Lin- bone marrow cells followed by 4-OHT treatment to induce deletion in vitro.

Through colony selection, clean deletion of Rb1cc1 was confirmed by western blot analysis (Fig.

3-8A). Unlike Atg5 deletion, we still observed LC3-II accumulation by western blot and LC3 puncta formation in Rb1cc1-deleted cells, albeit at a much lower level when compared to wild- type MA9-AML cells (Fig. 3-8A, Fig. 3-9A). There was also a high level of SQSTM1 accumulation (Fig. 3-8A), indicating suppression of autophagy activity after Rb1cc1 deletion.

However, when we examined the growth and survival impact of Rb1cc1 deletion in MA9-AML cells, we did not observe any changes in cell proliferation (Fig. 3-8B), apoptosis (Fig. 3-9B), colony-forming ability (Fig. 3-9C), or survival under starvation conditions (Fig. 3-9D). In addition,

Rb1cc1-deleted MA9-AML cells did not show changes in ROS or mitochondria levels, nor in the mitochondria protein COX4 expression (Fig. 3-8C, D). Collectively, these data show that although Rb1cc1 deletion causes signaling changes in the autophagy pathway, the normal growth and survival of MA9-AML cells is not impaired, indicating that both the canonical and alternative autophagy pathways are dispensable for MA9-AML maintenance.

Endolysosome formation remains intact in Atg5- or Rb1cc1-deleted MA9-AML cells

To investigate why early stage autophagy inhibition does not impair MA9-AML maintenance, we tracked the change of late stage autophagy in either Atg5- or Rb1cc1-deleted MA9 cells with or

71 without chloroquine treatment using transmission electron microscopy (TEM). At basal state, neither Atg5- nor Rb1cc1-deleted cells showed any ultrastructural abnormalities compared to wild-type MA9-AML cells. (Fig. 3-10Ai-iii). Upon chloroquine treatment, we observed a large number of morphologically typical endolysosomes in both Atg5- and Rb1cc1-deleted cells similar to wild-type (Fig. 3-10A iv-vi, Table 3-1). When staining the cells with the lysosomal marker LAMP1, we observed large LAMP1-positive puncta formation, matching the size of vesicles observed under TEM, upon chloroquine treatment in Atg5- or Rb1cc1-deleted leukemia cells, similar to the observation in wild type (Fig. 3-11).

Since autophagy blockade can induce TRP53 phosphorylation and apoptotic response in cancer cells,31 we examined signaling changes in TRP53 and apoptotic pathways in both Atg5- and Rb1cc1-deleted MA9-AML cells. We did not observe any change in phospho-TRP53, its downstream effector CDKN1A/p21, or the DNA damage-related protein -H2AFX by western blot (Fig. 3-10B). Neither did we observe any changes in the apoptosis related proteins BCL2L1,

BCL2, or cleaved CASP3 (Fig. 3-10B). These data show that although autophagy inhibition is achieved by specific gene targeting at the early stages of autophagy, MA9-AML cells can still form intact endolysosomes, suggesting a normally functioning lysosomal degradation system that maintains cellular homeostasis.

Neither Atg5 nor Rb1cc1 disruption increases the susceptibility of MA9-AML cells to standard chemotherapies

Since autophagy blockade showed a combinatory activity with chemotherapy in solid tumor treatment, we investigated whether an autophagy-specific gene disruption would increase the susceptibility of MA9-AML cells to standard chemotherapy. Interestingly, ATG5-deficient MA9-

AML cells showed a slight resistance to chemotherapy drugs, including cytarabine (AraC) and

72 doxorubicin (DA) (Fig. 3-12A,B, Fig. 3-13A,B). Such resistance was not seen in the RB1CC1- deficient cells, which had a similar response to wild-type after treatment with either AraC or DA

(Fig. 3-12A,B, Fig. 3-13A,B). We also tested the effect of ER stressing (upstream of the autophagy pathway) with the ER stressor tunicamycin, on Atg5- or Rb1cc1-deleted cells and found that leukemia cells with an Atg5 deletion were more resistant to tunicamycin treatment, while loss of Rb1cc1 had no effect relative to wild-type cells (Fig. 3-12C, Fig. 3-13C).

Collectively, these data suggest that autophagy inhibition through either Atg5 or Rb1cc1 gene disruption does not increase the sensitivity of MA9-AML cells to chemotherapy.

Chloroquine shows an autophagy-independent anti-leukemic effect that can be enhanced by exocytosis inhibition

Currently, the antimalarial drug chloroquine is being widely tested in both research and clinical settings for cancer treatment with the antitumor mechanism thought to work through autophagy inhibition. However, recent reports have shown that chloroquine also has autophagy- independent roles that suppress tumor growth and invasion.32,33 To investigate the effect and potential mechanism of chloroquine in leukemia, we tested the sensitivity of MA9-AML cells to chloroquine treatment in comparison with wild-type Lin- bone marrow cells. We found that both

MA9 knock-in and retroviral-transduced leukemia cells were more sensitive to chloroquine treatment as demonstrated by suppressed growth rates (Fig. 3-14A). Colony-forming assays showed that chloroquine at a high (25 μM) concentration can sufficiently suppress the colony- forming ability of MA9 leukemia cells, but not at a low (10 μM) concentration (Fig. 3-15A). Loss of either Atg5 or Rb1cc1 did not improve the sensitivity of MA9-AML cells to chloroquine treatment (Fig. 3-14B and Fig. 3-15B). These data collectively suggest that chloroquine has an anti-leukemic effect that is independent of Atg5- or Rb1cc1-regulated autophagy.

To validate the therapeutic benefit of chloroquine in vivo, we treated MA9-AML transplanted mice with chloroquine intraperitoneally at 50 mg/kg twice a day for 5 days. We observed a significant improvement in hemoglobin levels in treated versus nontreated groups (Fig. 3-15C).

However, no changes were seen in peripheral white blood cell counts (Fig. 3-15D), leukemia burden in the bone marrow (Fig. 3-15E), or improvement in overall survival (Fig. 3-15E) following chloroquine treatment. In an attempt to enhance the efficacy, we combined chloroquine treatment with chemotherapy drugs and found that whereas chloroquine showed prominent combinatory activities with chemotherapy in suppressing leukemia cell growth (Fig. 3-

15G,H) and inducing apoptosis (Fig. 3-15I,J) in vitro, this combinatory benefit was not enough to prolong mouse survival (Fig. 3-14C). We also tested the anti-leukemia effect of chloroquine on human patient KMT2A-SEPT6-rearranged leukemia cells and found similar results to mouse

MA9-AML, including suppressed leukemia cell growth in vitro, but no change in mouse survival in vivo (Fig. 3-15K,L). The lack of detectable effects of chloroquine treatment in vivo may be due to its suboptimal pharmacokinetics resulting in an inability to maintain this drug at a blood concentration of approximately 10 μM.34 Consistently, we could not observe an accumulation of

LC3-II in chloroquine-injected mouse bone marrow cells, which can be readily detected at 10

μM in vitro (Fig. 3-14D). These data suggest that adding chloroquine to AML chemotherapy can improve certain clinical features such as anemia, but the current drug formulation is not effective enough to treat AML in vivo possibly due to its limitations in pharmacokinetics and nontoxic delivery dosage.34-36

To investigate the possible chloroquine response mechanism in MA9-AML, we followed the response of leukemia cells to chloroquine treatment at different dosages and time points under

TEM. We began to observe endolysosome accumulation at 5 μM concentration within a short time period (2 h) upon chloroquine treatment. Meanwhile, cells started to expel under-degraded endolysosomes through exocytosis (Fig. 8A iii,iv). Such responses happened in a time- and

74 dosage-dependent manner with a more prominent exocytotic activity seen at a higher chloroquine concentration (25 μM) and a longer treatment period (6 h) (Fig. 8A v,vi, Table 3-2).

To validate exocytosis as a mediator of chloroquine resistance, we treated leukemia cells with chloroquine and the exocytosis inhibitor 5-(N,N-dimethyl) amiloride HCl (DMA).37 We found that

DMA treatment greatly enhanced the anti-leukemic effect of chloroquine in inducing cell death

(Fig. 8B). To further address the mechanism, we performed shRNA interference of the Rab27a gene, a well-validated gene involved in cellular exocytotic activity.37, 38 We found that Rab27a knockdown did not significantly affect the survival of MA9 leukemia cells. However, when combined with chloroquine treatment, Rab27a knockdown significantly improved the anti- leukemic effect of chloroquine (Fig. 8C, D), similar to DMA. These data suggest that when the lysosomal degradation pathway is blocked by chloroquine, MA9-AML cells may utilize exocytosis to export damaged organelles and debris to maintain cellular homeostasis.

3.4 Discussion

To date, mounting evidence from both research and clinical trials has shown the success of targeting autophagy in various types of cancer. The potential benefits of this strategy are also being investigated in leukemia.39,40 In chronic myeloid leukemia (CML), autophagy is critical for

BCR-ABL1-induced leukemogenesis, and autophagy-deficient CML cells undergo rapid cell cycle arrest and apoptosis.31 In this study, we found that MA9-AML cells bear a high basal autophagy flux. However, inhibiting the canonical autophagy pathway through Atg5 deletion or suppressing both canonical and alternative pathways through Rb1cc1 deletion does not affect the growth and survival of MA9-AML cells. One recent study suggested that Atg5 homozygous deletion is lethal to Kmt2a-Mllt1/Enl leukemia,19 which was opposite to what we observed in

MA9-AML. The discrepancy could be because of the different subtypes of AML or the procedure of retroviral transduction in different genetic backgrounds. Another preliminary study found that

Atg5 homozygous loss did not prolong the survival of Kmt2a-Mllt1 leukemia mice,41 consistent with our observation in MA9-AML. In addition, we found that autophagy gene depletion does not improve the anti-leukemic effect of standard chemotherapy. A recent paper showed ATG7 suppression by shRNA in ATG7-high human AML cell lines could enhance chemotherapy sensitivity.20 The different genetic backgrounds in AML subtypes, mouse versus human leukemia difference, off-target effects of shRNA methodology, and possible autophagy- independent function of ATG7 may contribute to the discrepancy with our results. Our findings suggest that targeting autophagy alone, or in combination with chemotherapy, will unlikely produce therapeutic benefits in MA9-AML. We also found that Atg5 deficiency did not affect normal survival and colony-forming ability of AE leukemic cells, suggesting the existence of autophagy-resistant AML subtypes other than MA9-AML. Therefore, individual subtypes of leukemia need to be carefully evaluated regarding the importance of autophagy and the potential targeting benefit. Recently, there have been several characterized cell lines including lung, prostate and KRAS-driven cancer lines that survive normally with either Atg5 or Atg7

76 deficiency in vitro.42-44 Here we report that autophagy is dispensable for AML cells not only in vitro, but also in vivo, further broadening our view on the role of autophagy in a specific type of blood cancer cell maintenance.

When investigating autophagy resistance mechanisms in AML, we found that leukemia cells with autophagy gene disruption were still competent in forming endolysosomes similar to wild- type leukemia cells. This observation suggests a functionally intact lysosomal degradation system to maintain homeostasis in AML cells and explains why leukemia cells are able to survive both in vitro and in vivo regardless of autophagy status. This interesting discovery indicates the existence of compensatory vesicular transport systems that carry debris to lysosomes for degradation and recycling. Further investigation into this compensatory machinery is worth pursuing, as it could provide new therapeutic targets in autophagy-resistant tumors.

Although autophagy gene disruption does not affect AML survival, the pharmacological autophagy inhibitor chloroquine shows an autophagy-independent anti-leukemic effect because it induces cell death in both wild-type and Atg5- or Rb1cc1-deleted MA9-AML cells. Recent reports have shown that adding chloroquine to chemotherapy regimens displays a promising antitumor effect in certain types of cancer.13,14,45 However, the mechanism whereby chloroquine induces tumor cell death is unclear. Existing hypotheses include 1) neutralizing the pH in the solid tumor environment,46 2) changing the pH in endosomes and reducing the sequestration of chemo-drugs in this organelle,47 3) intercalating into DNA to cause DNA damage,48 4) destabilizing lysosomal membrane and leading to mitochondria-related intrinsic apoptosis,49 or 5) blocking the autophagy process.50 Although the exact mechanism is still under investigation, the possibility exists that the antitumor mechanism could vary among different tumor types. Our

77 data offer solid evidence that the killing of leukemia cells by chloroquine is autophagy- independent.

There are innate limitations of using chloroquine and its derivative hydroxychloroquine in cancer treatment, such as poor anticancer activity and inability to achieve effective drug concentration in vivo.35, 36 We also encountered these limitations in both the mouse and human xenograft experiments. With our injection regimen of 50 mg/kg twice a day, the potentially achievable peak blood concentration is only between 10 and 15 μM.34 Our colony assay results in Fig. 3-

15A show that this concentration is not sufficient to suppress the colony-forming ability of MA9-

AML cells in vitro. In addition, chloroquine injection did not lead to a detectable LC3-II accumulation, an observation we made in vitro at 10 μM (Fig. 3-14D), providing supporting evidence that a standard chloroquine injection protocol may not reach a beneficial concentration in vivo. We think this is a possible explanation as to why we did not observe significant therapeutic benefits in vivo. One possible solution is to synthesize more potent chloroquine derivatives with less toxic effects. There is recent literature describing new derivatives under development, which are much more potent than chloroquine for tumor treatment in preclinical tests.36

We find that active exocytosis upon chloroquine treatment also contributes to drug resistance in

MA9-AML cells. Induction of exocytosis through inhibition of lysosomal degradation by chloroquine has previously been observed in other tissues.51 Our results show that this phenomenon may also occur in leukemia cells. Chloroquine-induced vesicular exocytosis in

AML cells occurs rapidly at a low drug dosage and increases in a dosage- and time-dependent manner. Addition of an exocytosis inhibitor or the knockdown of the exocytotic gene Rab27a greatly enhances the effect of chloroquine in inducing leukemia cell death. Collectively, these data suggest that exocytosis is one potential mechanism of chloroquine resistance in MA9-AML.

This finding enriches our understanding of limited chloroquine efficacy in tumor treatment and offers a new drug combinatory strategy.

3.5 Materials and methods

Mice and transplantation

Atg5flox/flox, Rb1cc1flox/flox and MA9 knock-in mice have been described previously.28,52,53

Atg5flox/floxMxCre+ mice were generated by crossing Atg5flox/flox with MxCre+ mice. In vivo disruption of the Atg5 gene was induced by intraperitoneal injection of polyI:C (GE Healthcare

Life Sciences, 27-4732-01). Primers used for genotyping are listed in Table 3-3. All mice used were 6 to 12 weeks of age unless otherwise indicated. Animal research was approved by the

Institutional Animal Care and Use Committee at the Cincinnati Children’s Hospital Research

Foundation. BoyJ mice 5 to 8 weeks of age obtained from the Comprehensive Mouse and

Cancer Core at Cincinnati Children’s Hospital Medical Center were used as mouse leukemia cell transplantation recipients. Recipient mice were lethally irradiated (7 Gy followed by 4.75 Gy) before intravenous injection of 1 million leukemia cells and 0.25 million supporting cells per mouse. Leukemia cells collected from the bone marrow of primary transplantation recipients were used for secondary transplantation. For primary human KMT2A-SEPT6 leukemia cell transplantation,54 NRGS mice were preconditioned with a single dose of busulfan at 30 mg/kg intravenously, followed by intravenous injection of 1.25 million leukemia cells per mouse.

Cell culture

MA9 knock-in and retroviral-transduced leukemia cells were both cultured in Iscove’s modified

Dulbecco’s medium (IMDM; HyClone Laboratories, SH30228.01) containing 10% fetal bovine serum (FBS; Atlanta biologicals, S12450), 1% penicillin-streptomycin (HyClone Laboratories,

SV30010) and supplemented with 10 ng/mL murine IL-3 (Peprotech, 213-13), IL-6 (Peprotech,

213-16), GM-CSF (Peprotech, 315-03) and SCF (Peprotech, 250-03). The same medium was also used for wild-type mouse bone marrow cell culture. Primary human AML cells were cultured in IMDM containing 20% FBS, 1% penicillin-streptomycin, and supplemented with 10 ng/mL human SCF (Peprotech, 300-07), TPO (Perprotech, 300-18), FLT3L (Perprotech, 300-

19), IL3/IL-3 (Peprotech, 200-03) and IL6/IL-6 (PeproTech, 200-06).

Low-density bone marrow cells

Whole bone marrow cells were flushed from the hind legs of mice. Red blood cells were lysed in

BD Pharm Lyse Buffer (BD Bioscience, 555899) and washed twice with phosphate-buffered saline (PBS; HyClone Laboratories, SH30028.02). The remaining bone marrow cells were resuspended in 4 mL PBS and layered onto 4 mL of Histopaque-1083 (Sigma-Aldrich, 1083-1).

Centrifugation was performed at 673 g for 30 min at room temperature. The low-density bone marrow cells were collected at the interface and were washed twice with PBS before culturing.

Retrovirus transduction

AE oncogene in a pMSCV-IRES-THY1/Thy1.1 backbone,55 MA9 oncogene in a MSCV-eGFP backbone56 and MSCV-CreERT2-puro (Addgene, 22776; deposited by Tyler Jacks lab) were used for retroviral transduction. Retrovirus production and infection were performed as described previousy.57 Lineage negative (Lin-) bone marrow cells used for transduction were selected using the Lineage Cell Depletion Kit (Miltenyi Biotec, 130-090-858) following the manufacturer’s protocol. Diagnosis of AML was confirmed by both morphological and flow cytometry analysis.

Lentiviral short-hairpin RNA interference assay

Lentiviral constructs were purchased from Sigma-Aldrich. Mouse Rab27a1: TRCN 0000100577,

Rab27a2: TRCN 0000100578. Viral supernatant was harvested from transfected HEK293T cells.

Transduction of MA9 leukemia cells with viral supernatant was performed by spinoculation on retronectin (Takara Bio Inc. T100B)-coated plates. After puromycin (Gold Biotechnology, P-

600-100) selection, cells were used for drug treatment. The remaining cells were used for western blot analysis to determine knockdown efficiency. We also tested Rab27b and found by both western blot and quantitative RT-PCR assays that its expression was at a very low level in

MA9 leukemia cells.

Colony formation assays

Leukemia cells were cultured in 1 mL cytokine-supplemented MethoCult GF M3434 medium

(STEMCELL Technologies, 03434) for 5 days before counting, unless indicated otherwise.

Starvation assays

Before starvation, MA9 leukemia cells were harvest and washed in PBS for 5 min X 3 times.

Then cells were plated in the starvation media (IMDM supplemented with 1% FBS, 1% penicillin-streptomycin) at 1 million/mL for different time points followed by analyses.

Western blot assays

Cell lysis buffer for western blot contained 63 mM Tris, pH 6.8 (Research Products

International,T60050), 2% SDS (Bio-Rad, 161-0302), 10% glycerol (Research Products

International, G22020), 0.01% bromophenol blue (Bio-Rad, 161-0404), 10mM NaF (Sigma-

Aldrich, s6521), 4mM dithiothreitol (DTT; ThermoFisher Scientific, 15508013), 0.2 mM sodium orthovanadate (Santa Cruz Biotechnology, sc-24948A),10 mM β-glycerophosphate

(Calbiochem,35675), 1 mM PMSF (Santa Cruz Biotechnology, sc-24948A), 5% β- mercaptoethanol (Thermo Fisher, 60-24-2) and proteinase inhibitor cocktail (Santa Cruz

Biotechnology; sc-24948A). Whole cell lysate was resolved on a 4-15% precast gel (Bio-Rad,

456-1086) and transferred to PVDF (EMD Millipore, IPFL00010) using the Bio-Rad Transblot

Turbo® system. Blots were developed using the Odyssey infrared imager (LI-COR Biosciences).

Fluorescence and electron microscopy

For immunofluorescence microscopy, cells were seeded on retronectin-coated slides for at least

2 h. Fixation was performed in cold methanol (Fisher Scientific, A412-4) for 15 min at -20oC.

Fixed cells were permeablilized with 0.2% Triton X-100 (Bio-Rad, 1610407) for 20 min and blocked in 5% goat serum (Thermo Fisher Scientific, 16210064) for 1 h. After blocking, slides were stained with primary antibodies overnight followed by a 1-h incubation with secondary antibodies. Images were taken on a Nikon C2 confocal microscope. For transmission electron microscopy (TEM), cells were fixed in fixation buffer (2% glutaraldehyde [Sigma-Aldrich, G5882],

2% paraformaldehyde [Electron Microscopy Sciences, 15710]) and sent to the Cincinnati

Children’s Hospital Medical Center Pathology Core for further processing. EM images were taken on a Hitachi 7650H microscope.

Flow cytometry

Drugs and reagents

Drugs include 4-hydroxytamoxifen (Sigma-Aldrich, H6278), bafilomycin A1 (Sigma-Aldrich,

88899-55-2), chloroquine (Sigma-Aldrich, C6628) doxorubicin (Pfizer, JF11C), cytarabine

(Mylan Institutional, 7801167), and DMA (Santa Cruz Biotechnology, sc-202459). Primary antibodies include LC3A/B (Cell Signaling Technology, 4108), ATG5 (Cell Signaling Technology,

12994), SQSTM1/p62 (Cell Signaling Technology, 8025), p-TRP53 (Cell Signaling Technology,

9284), CDKN1A (Cell Signaling Technology, 2947), cleaved CASP3 (Cell Signaling Technology,

9661), BCL2L1 (Cell Signaling Technology, 2764), BCL2 (Cell Signaling Technology, 2870), -

H2AFX (Cell Signaling Technology, 9718), RB1CC1/FIP200 (Proteintech Group, 17250-1-AP), mouse monoclonal anti-ACTB (Santa Cruz Biotechnology, sc-47778), RAB27A (Proteintech

Group, 17817-1-AP) and LAMP1 (Abcam, ab25245). Flow cytometry antibodies and reagents include 7-AAD (BD Biosciences, 5168981E), THY1/thy1.1-PE (BD Biosciences, 551401),

ITGAM/Mac-1-PE-Cy7 (BD Biosciences, 552850), c-Kit-APC (BD Biosciences, 553356),

ANXA5/annexin V-Pacific blue (BioLegend, 640918) and ANXA5/annexin V binding buffer (BD

Biosciences, 51-66121E). Other reagents include DAPI (4, 6 diamidino-2-phenylindole;

Invitrogen, D1306), MitoTracker® Red (Life Technologies, M7512), CellROX® (Life

Technologies, C10422), and CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS kit; Promega, G3580). Secondary antibodies for immunofluorescent staining including Alexa

Flour 488 goat anti-rabbit IgG (Life Technologies, A11008), Alexa Flour 568 goat anti-rabbit IgG

(Life Technologies, A11011), and Alexa Flour 568 goat anti-rat IgG (Life Technologies, A11077).

Secondary antibodies for western blot include goat anti-rabbit 680 (LI-COR Biosciences, 926-

68071), goat anti-Rabbit 800 (LI-COR Biosciences, 926-32211), goat anti-mouse 680 (LI-COR

Biosciences, 929-68070), and goat anti-mouse 800 (LI-COR Biosciences, 926-32210).

Statistical analysis

All data are presented as mean ± standard deviation (SD). Student’s t test was used for the comparison between 2 groups. One way ANOVA was used for multiple group comparison. Log- rank analysis was used for the Kaplan-Meier survival curve. Chi-square test was used for TEM data analysis. Analyses were performed with GraphPadPrism Software 6.0. P < 0.05 was considered as statistically significant. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

3.6 Acknowledgement

This study was funded in part by grants from the National Institutes of Health (R01 CA193350,

R01 AG040118, R01 HL111192, and P30 DK090971). We thank Xuan Zhou, and James

Johnson for offering technical assistance, Drs. Marie-Dominique Filippi, Maria Czyzyk-Krzeska,

Gang Huang and Daniel Starczynowski for helpful discussions. We also thank the Research

Flow Cytometry Core, the Comprehensive Mouse and Cancer Core and the Pathology Core at

Cincinnati Children’s Hospital Medical Center for their technical support.

Conflict-of- interest disclosure: The authors declare no competing financial interests.

3.7 Authorship

X.C. designed and performed experiments, analyzed data and wrote the manuscript. J. C.,

M.W., A. D., and C.F. performed experiments, analyzed data and edited the manuscript. S. C. provided key experimental reagents and tools. J.G., J.M., and A.K. designed experiments, analyzed data and edited the manuscript. Y.Z. designed experiments, analyzed data, wrote the manuscript and obtained the funding.

3.8 Tables

Table 3-1. Quantification of endolysosomes under TEM.

PBS control Endolysososome- Endolysosome- p value positive cell number negative cell number MA9-WT 15 151 MA9-atg5-/- 9 108 0.689 MA9-rb1cc1-/- 10 160 0.271

Chloroquine treatment Endolysososome- Endolysosome- p value positive cell number negative cell number MA9-WT 134 44 MA9-atg5-/- 123 28 0.177 MA9-rb1cc1-/- 138 34 0.266

Data were analyzed by Chi-square test. Difference between WT and MA9-atg5-/- or MA9-rb1cc1- /- was analyzed. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Table 3-2. Quantification of exocytosis under TEM.

Exocytosis-positive Exocytosis-negative p value cell number cell number PBS 7 166 Chloroquine (5 μM) 19 196 0.061 Chloroquine (10 μM) 22 143 0.002**

Data were analyzed by Chi-square test. Difference between PBS with chloroquine 5 μM or 10 μM was compared. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Table 3-3. Genotyping primers.

Genes Primer sequences MxCre P1: CAA AAC AGG TAG TTA TTC GG P2: CGA ATA GCC GAA ATT GCC AG Atg5 P1: GAA TAT GAA GGC ACA CCC CTG AAA TG P2: ACA ACG TCG AGC ACA GCT GCG CAA GG P3: GTA CTG CAT AAT GGT TTA ACT CTT GC P4: CAG GGA ATG GTG TCT CCC AC P1, P3 amplifies WT allele (~ 350 bp), P2,P3 amplifies floxed allele (~700 bp), P2, P4 amplifies KO allele (~ 300 bp) Rb1cc1 P1: GGAACCACG- CTGACATTTGACACTG P2: CAAAGAACAACGAGTGGCAGTAG P3: CATCAGATACACTAGAGCTGG-3 P1, P3 amplifies Rb1cc1 KO allele (~800 bp), P2 and P3 amplifies both WT (262 bp) and floxed (225 bp) allele.

3.9 Figures

Figure 3-1. MA9-induced leukemia cells exhibit a high autophagy flux. (A) MA9-transformed leukemia cells and empty vector-transduced normal low-density bone marrow cells were treated with chloroquine at the indicated dosages for 6 h followed by western blotting. LDBM, low- density bone marrow cells; CQ, chloroquine; MA9; MA9 retrovirally-transduced leukemia cells.

Quantification is LC3-II:ACTB ratio (n=4 mice). (B) Leukemia cells and LDBM cells described in

(A) were treated with CQ for 6 h at 25 μM before immunostaining for LC3. Scale bar: 10 μm.

Quantification is percentage of LC3 puncta positive cells. Cells with more than 1 punctum are

89 considered positive for quantification. (n=3 mice). (C) Leukemia cells and LDBM cells described in (A) were treated with bafilomycin A1 (BA) for 4 h at 20 nM followed by western blot analysis.

Quantification is the LC3-II:ACTB ratio (n=3 mice). Results are shown as mean  SD, * P < 0.05,

** P < 0.01, *** P < 0.001.

Figure 3-2. MA9 knock-in leukemia cells exhibit a high autophagy flux. (A) Low-density bone marrow cells from MA9 knock-in leukemia mice and their wild-type littermates were harvested and treated with chloroquine at the indicated dosages for 6 h followed by western blot analysis.

MA9-KI, MA9 knock-in leukemia cells. (B) Quantification of LC3-II:ACTB ratio from (A) (n=3 mice). AU, arbitrary units. (C) Wild-type BM cells and MA9-KI bone marrow leukemia cells described in (A) were treated with chloroquine for 6 h at 25 μM before immunostaining for LC3.

Scale bar: 10 μm. (D) Quantification of LC3 puncta-positive cells from (C). Cells with greater than one punctum are considered positive for quantification (n=3 mice). (B, D) Results are mean  SD, * P < 0.05, *** P < 0.001.

Figure 3-3. Atg5 is dispensable for MA9-AML cell growth and survival in vitro. (A) Clean Atg5- deleted MA9 cells were prepared through 4-OHT treatment and colony selection. MA9-Atg5+/+ and MA9-atg5-/- leukemia cells were treated with chloroquine at the indicated dosages for 6 h followed by western blot analysis. Numbers represent the densitometry quantification of protein levels normalized to ACTB (n=4 repeats). MA9-Atg5+/+, Atg5 wild-type MA9 leukemia cells;

MA9-atg5-/-, Atg5-deficient MA9 leukemia cells. (B) Basal cell growth rates of MA9-Atg5+/+ and

MA9-atg5-/- cells were analyzed by MTS assay at the indicated time points. OD: 490 nM (n=6 repeats). Results are mean  SD, * P < 0.05. (C) Five hundred MA9-Atg5+/+ or MA9-atg5-/- leukemia cells were plated in M3434 medium for 5 days followed by colony counting (n=3 repeats). Images show representative colonies. Images were taken by light microscopy

(Olympus, CKX41) under the 10X objective. Scale bar: 100 μm.

Figure 3-4. Atg5 is dispensable for MA9-AML cell growth and survival in vitro. (A) MA9-Atg5+/+ and MA9-atg5-/- cells were treated with chloroquine at 25 μM for 6 h followed by Immunostaining of LC3. Scale bar: 10 μm (n=3 repeats). (B) MA9-Atg5+/+ and MA9-atg5-/- cells stained with

ANXA5 and 7-AAD were analyzed by flow cytometry for apoptosis (n=5 repeats). (C) MA9-

Atg5+/+ and MA9-atg5-/- leukemia cells stained with CellROX Deep Red reagent were analyzed by flow cytometry for ROS levels at basal state. ROS, reactive oxygen species (n=4 repeats).

MFI, mean fluorescence intensity. (D) MA9-Atg5+/+ and MA9-atg5-/- cells under basal state were harvested and used for western blot analysis of the mitochondria protein COX4. (E) MA9-Atg5+/+ and MA9-atg5-/- leukemia cells stained with MitoTracker Red were analyzed by flow cytometry to determine mitochondria levels at basal state (n=4 repeats). (F) MA9-Atg5+/+ or MA9-atg5-/- cells were stressed in starvation media for 6 and 12 h followed by ANXA5 and 7-AAD staining for apoptotic analysis.

Figure 3-5. Atg5 disruption does not benefit MA9-AML mice survival. (A) Illustration of transplantation strategy: 1 million leukemia cells together with 0.25 million supporting cells were transplanted into BoyJ recipient mice after lethal irradiation. Intraperitoneal injection of polyI:C

(plpC) was started 20 days post transplantation at the dosage of 100 μg/g, every other day for 4 injections. (B) Kaplan-Meier survival curve for the primary transplantation (n=7 in Atg5f/f group, n=8 in Atg5f/fMxCre group). (C) Kaplan-Meier survival curve for the secondary transplantation

(n=6 in Atg5f/f group, n=5 in Atg5f/fMxCre group).

Figure 3-6. Atg5 disruption does not benefit MA9-AML mice survival. (A) Bone marrow cells aspirated 2 weeks post the last injection of polyI:C were analyzed by PCR to confirm the deletion of Atg5. (B-D) Peripheral blood cell counts were analyzed on a CBC counter (Hemavet,

Drew Scientific, FL, USA) 2 weeks post the last injection of polyI:C. Results are mean  SD, * P

< 0.05 (n=5 in MA9-Atg5f/f group, n=7 in MA9-Atg5f/fMxCre group). WBC, white blood cells; Hb, hemoglobin; PLT, platelets. (E) Percentage of GFP-labeled MA9 leukemia cells was determined by flow analysis at 2 weeks post the last injection of polyI:C.

Figure 3-7. Atg5 is dispensable for AE leukemia cell survival. (A) Wild-type Lin- cells transduced with a retrovirus expressing the AE oncogene labeled with THY1/Thy1.1 followed by flow cytometry analysis of THY1/Thy1.1 expression to confirm successful transduction. (B) AE-AML

CreER+ cells were treated with 4-OHT or ethanol as a control and plated for colony assay. 5000 cells were plated in each sample and colonies were counted on day 5 post plating (n=3 repeats).

(C) Cells collected from the colony assay described in (C) were analyzed by western blotting to confirm Atg5 gene deletion.

Figure 3-8. Rb1cc1 deficiency does not affect the maintenance of MA9-AML cells. (A) Clean

Rb1cc1-deleted cells were prepared through 4-OHT treatment and colony selection. MA9-

Rb1cc1+/+ and MA9-rb1cc1-/- leukemia cells were treated with chloroquine at the indicated dosages for 6 h before western blot analysis. Numbers represent the densitometry quantification of protein levels normalized to ACTB (n=3 repeats). MA9-Rb1cc1+/+, Rb1cc1 wild-type MA9 leukemia cells; MA9-rb1cc1-/-, Rb1cc1-deficient MA9 leukemia cells. (B) Basal cell growth rates of MA9-Rb1cc1+/+ and MA9-rb1cc1-/- cells were analyzed by MTS assay at the indicated time points (n=4 repeats). (C) MA9-Rb1cc1+/+ and MA9-rb1cc1-/- leukemia cells stained with CellROX

Deep Red reagent or MitoTracker Red were analyzed by flow cytometry for ROS or mitochondria levels at basal state, respectively (n=4 repeats). MFI, mean fluorescence intensity.

(D) MA9-Rb1cc1+/+ and MA9-rb1cc1-/- cells under basal state were harvested and used for western blot analysis of the mitochondria protein COX4.

Figure 3-9. Rb1cc1 deficiency does not affect the maintenance of MA9-AML cells. (A) MA9-

Rb1cc1+/+ and MA9-rb1cc1-/- cells were treated with chloroquine at 25 μM for 6 h followed by immunostaining of LC3. Scale bar: 10 μm (n=4 repeats). (B) MA9-Rb1cc1+/+ and MA9-rb1cc1-/- cells stained with ANXA5 and 7-AAD were analyzed by flow cytometry for apoptosis (n=5 repeats). (C) Five hundred MA9-Rb1cc1+/+ or MA9-rb1cc1-/- leukemia cells were plated in M3434 medium for 5 days followed by colony counting (n=3 repeats). (D) MA9-Rb1cc1+/+ or MA9- rb1cc1-/- cells were stressed in starvation media for 6 and 12 h followed by ANXA5 and 7-AAD staining for apoptotic analysis.

Figure 3-10. Atg5 or Rb1cc1 deficiency does not affect the lysosomal degradation pathway. (A)

MA9 wild-type, MA9-atg5-/- and MA9-rb1cc1-/- leukemia cells were treated with chloroquine at 25

μM for 6 h followed by TEM imaging. Scale bar: 500 nm. (B) MA9 wild-type, MA9-atg5-/- and

MA9-rb1cc1-/- leukemia cells cultured under basal condition were harvested and used for western blot analysis (n=2 repeats).

Figure 3-11. Atg5 or Rb1cc1 deficiency does not affect the lysosomal degradation pathway.

MA9 wild-type, MA9-atg5-/- and MA9-rb1cc1-/- leukemia cells were treated with chloroquine at 25

μM followed by immunostaining for LC3 and LAMP1. Scale bar: 10 μm (n=2 repeats).

100

Figure 3-12. Loss of Atg5 or Rb1cc1 does not sensitize MA9-AML cells to chemotherapy. MA9-

Atg5+/+ and MA9-atg5-/-, or MA9-Rb1cc1+/+ and MA9-rb1cc1-/- leukemia cells were treated with chemotherapy drugs or an ER stressor at the indicated dosages for 48 h followed by MTS assay.

AraC, cytarabine; DA, doxorubicin; Tuni, tunicamycin. Results are mean  SD, ** P < 0.01, *** P

< 0.001 (n=3 to 6 repeats).

101

Figure 3-13. Loss of Atg5 or Rb1cc1 does not sensitize MA9-AML cells to chemotherapy. Two day cell growth curves supplementary to Figure 6.

102

Figure 3-14. Chloroquine shows an autophagy-independent anti-leukemic effect in vitro, but is not potent in vivo. (A) MA9 knock-in leukemia cells (MA9-KI), MA9-Retro and wild-type Lin- bone marrow cells were treated with chloroquine at the indicated dosages for 48 h followed by

MTS assay (n=3 repeats). (B) MA9-Atg5+/+ and MA9-atg5-/- leukemia cells were treated with chloroquine at the indicated dosages for 48 h before MTS assay (n=4 repeats). Results are mean  SD, ** P < 0.01, *** P < 0.001. (C) Kaplan-Meier survival curve of chloroquine and AraC combinatory treatment in MA9-AML leukemia mice. AraC was injected intraperitoneally at 100 mg/kg once a day for 5 days. Chloroquine was injected at 50 mg/kg twice a day for 5 days (n=6 in each group). The transplantation method is as described in Fig. 3-5A. (D) For ex vivo assay, chloroquine was injected as described in (C). Bone marrow Lin- cells were harvested within 2 h after the last injection followed by western blot analysis. For in vitro assay, bone marrow Lin- cells were treated with chloroquine at 10 μΜ for 6 h followed by western blot analysis.

103

Quantification is the LC3-II:ACTB ratio (n=3 mice). Results are mean  SD, * P < 0.05. AU, arbitrary units.

104

Figure 3-15. Chloroquine (CQ) shows an anti-leukemic effect in vitro, but is not potent in vivo.

(A) Five hundred MA9-AML cells in each group were treated with chloroquine at the indicated

105 dosage and plated for a colony-forming assay. Colonies were quantified 5 days post plating.

Results are mean  SD, *** P < 0.001. (B) MA9-Rb1cc1+/+ and MA9-rb1cc1-/- leukemia cells were treated with chloroquine at the indicated dosages for 48 h before MTS assay (n=4 repeats).

(C,D) Hemoglobin and WBC levels of MA9-AML mice described in (F) were counted on a CBC counter. Samples were collected at 2 weeks post the last injection of chloroquine. (E)

Percentage of GFP+ cells in leukemia mouse bone marrow described in (F) was determined by flow cytometry at 2 weeks after the final chloroquine injection. (F) Kaplan-Meier survival curve of

MA9 leukemia mice with chloroquine treatment. Intraperitoneal injection of chloroquine to MA9-

AML recipient mice was started 20 days post transplantation at the dosage of 50 mg/kg twice a day for 5 days. The transplantation method is as described in Figure 3A. (G, H) MA9-AML cells were treated with the indicated drugs for 48 h followed by MTS assay. (I-J) MA9-AML cells were treated with the indicated drugs for 48 h followed by ANXA5 and 7-AAD staining and flow cytometry analysis. (G-J) Drug concentrations: chloroquine, 10 μM; AraC, 100 nM; DA, 10 nM.

Results are mean  SD, ** P < 0.01, *** P < 0.001. (K) Primary human patient KMT2A-SEPT6 cells were treated for 48 h with chloroquine at the indicated dosages followed by MTS assay. (L)

The recipient NRGS (NOD-Rag1-/-;γcnull, expressing human interleukin 3, human colony stimulating factor 2 and human KIT ligand) mice were conditioned with a single dose of intravenous busulfan at 30 mg/kg followed by intravenous injection of 1.25 million KMT2A-

SEPT6 leukemia cells to each recipient mouse. Treatment with the indicated drugs began 2 weeks after transplantation. AraC was injected intraperitoneally at 50 mg/kg once a day for 3 days due to observed toxicity; chloroquine was injected intraperitoneally at 50 mg/kg once a day for 3 days (n=5 in AraC group, n=6 in PBS, CQ and AraC+CQ groups).

106

Figure 3-16. The anti-leukemic activity of chloroquine is enhanced by exocytosis inhibition. (A)

MA9 leukemia cells were treated with chloroquine at 5 μM for 2 h or at 25 μM for 6 h followed by

TEM analysis. Scale bar: 2 μm. (B) Chloroquine and DMA combinatory treatment at the indicated dosages for 24 h followed by ANXA5 and 7-AAD staining for apoptosis analysis by flow cytometry. Results are mean  SD, *** P < 0.001 (n=6 repeats). (C) MA9 leukemia cells transduced with scramble or Rab27a shRNA were harvested after 48 h of puromycin selection for western blot analysis. Numbers represent the densitometry quantification of protein levels

107 normalized to ACTB. (D) MA9 cells described in (C) were treated with chloroquine at 10 μM for

24 h followed by ANXA5 and 7-AAD staining for apoptotic analysis.

108

3.10 Reference

1. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N. FIP200, a

ULK-interacting protein, is required for autophagosome formation in mammalian cells. J Cell

Biol 2008; 181:497-510.

2. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH. ULK-Atg13-

FIP200 complexes mediate mTOR signaling to the autophagy machinery. Mol Biol Cell 2009;

20:1992-2003.

3. Mercer CA, Kaliappan A, Dennis PB. A novel, human Atg13 binding protein, Atg101, interacts with ULK1 and is essential for macroautophagy. Autophagy 2009; 5:649-62.

4. Mizushima N, Kuma A, Kobayashi Y, Yamamoto A, Matsubae M, Takao T, Natsume T,

Ohsumi Y, Yoshimori T. Mouse Apg16L, a novel WD-repeat protein, targets to the autophagic isolation membrane with the Apg12-Apg5 conjugate. J Cell Sci 2003; 116:1679-88.

5. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E,

Ohsumi Y, Yoshimori T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000; 19:5720-8.

6. Nishida Y, Arakawa S, Fujitani K, Yamaguchi H, Mizuta T, Kanaseki T, Komatsu M, Otsu

K, Tsujimoto Y, Shimizu S. Discovery of Atg5/Atg7-independent alternative macroautophagy.

Nature 2009; 461:654-8.

7. Chittaranjan S, Bortnik S, Dragowska WH, Xu J, Abeysundara N, Leung A, Go NE,

DeVorkin L, Weppler SA, Gelmon K, et al. Autophagy inhibition augments the anticancer effects of epirubicin treatment in anthracycline-sensitive and -resistant triple-negative breast cancer.

Clin Cancer Res 2014; 20:3159-73.

8. Ma XH, Piao SF, Dey S, McAfee Q, Karakousis G, Villanueva J, Hart LS, Levi S, Hu J,

Zhang G, et al. Targeting ER stress-induced autophagy overcomes BRAF inhibitor resistance in melanoma. J Clin Invest 2014; 124:1406-17.

109

9. Wang J, Wu GS. Role of autophagy in cisplatin resistance in ovarian cancer cells. J Biol

Chem 2014; 289:17163-73.

10. Vogl DT, Stadtmauer EA, Tan KS, Heitjan DF, Davis LE, Pontiggia L, Rangwala R, Piao

S, Chang YC, Scott EC, et al. Combined autophagy and proteasome inhibition: a phase 1 trial of hydroxychloroquine and bortezomib in patients with relapsed/refractory myeloma. Autophagy

2014; 10:1380-90.

11. Rangwala R, Chang YC, Hu J, Algazy KM, Evans TL, Fecher LA, Schuchter LM,

Torigian DA, Panosian JT, Troxel AB, et al. Combined MTOR and autophagy inhibition: phase I trial of hydroxychloroquine and temsirolimus in patients with advanced solid tumors and melanoma. Autophagy 2014; 10:1391-402.

12. Rosenfeld MR, Ye X, Supko JG, Desideri S, Grossman SA, Brem S, Mikkelson T, Wang

D, Chang YC, Hu J, et al. A phase I/II trial of hydroxychloroquine in conjunction with radiation therapy and concurrent and adjuvant temozolomide in patients with newly diagnosed glioblastoma multiforme. Autophagy 2014; 10:1359-68.

13. Sotelo J, Briceno E, Lopez-Gonzalez MA. Adding chloroquine to conventional treatment for glioblastoma multiforme: a randomized, double-blind, placebo-controlled trial. Ann Intern

Med 2006; 144:337-43.

14. Briceno E, Calderon A, Sotelo J. Institutional experience with chloroquine as an adjuvant to the therapy for glioblastoma multiforme. Surg Neurol 2007; 67:388-91.

15. Levy JM, Thorburn A. Targeting autophagy during cancer therapy to improve clinical outcomes. Pharmacol Ther 2011; 131:130-41.

16. Willems L, Chapuis N, Puissant A, Maciel TT, Green AS, Jacque N, Vignon C, Park S,

Guichard S, Herault O, et al. The dual mTORC1 and mTORC2 inhibitor AZD8055 has antitumor activity in acute myeloid leukemia. Leukemia 2012; 26:1195-202.

17. Wei Y, Kadia T, Tong W, Zhang M, Jia Y, Yang H, Hu Y, Tambaro FP, Viallet J, O'Brien

S, et al. The combination of a histone deacetylase inhibitor with the Bcl-2 homology domain-3

110 mimetic GX15-070 has synergistic antileukemia activity by activating both apoptosis and autophagy. Clin Cancer Res 2010; 16:3923-32.

18. Torgersen ML, Engedal N, Boe SO, Hokland P, Simonsen A. Targeting autophagy potentiates the apoptotic effect of histone deacetylase inhibitors in t(8;21) AML cells. Blood

2013; 122:2467-76.

19. Watson AS, Riffelmacher T, Stranks A, Williams O, De Boer J, Cain K, MacFarlane M,

McGouran J, Kessler B, Khandwala S, et al. Autophagy limits proliferation and glycolytic metabolism in acute myeloid leukemia. Cell Death Discov 2015; 1.

20. Piya S, Kornblau SM, Ruvolo VR, Mu H, Ruvolo PP, McQueen T, Davis RE, Hail N, Jr.,

Kantarjian H, Andreeff M, et al. Atg7 suppression enhances chemotherapeutic agent sensitivity and overcomes stroma-mediated chemoresistance in acute myeloid leukemia. Blood 2016.

21. Mortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E, Stranks

AJ, Glanville J, Knight S, Jacobsen SE, et al. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med 2011; 208:455-67.

22. Liu F, Lee JY, Wei H, Tanabe O, Engel JD, Morrison SJ, Guan JL. FIP200 is required for the cell-autonomous maintenance of fetal hematopoietic stem cells. Blood 2010; 116:4806-14.

23. Warr MR, Binnewies M, Flach J, Reynaud D, Garg T, Malhotra R, Debnath J, Passegue

E. FOXO3A directs a protective autophagy program in haematopoietic stem cells. Nature 2013;

494:323-7.

24. Mortensen M, Ferguson DJ, Edelmann M, Kessler B, Morten KJ, Komatsu M, Simon AK.

Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo. Proc Natl Acad Sci U S A 2010; 107:832-7.

25. Gomez-Puerto MC, Folkerts H, Wierenga AT, Schepers K, Schuringa JJ, Coffer PJ,

Vellenga E. Autophagy proteins ATG5 and ATG7 are essential for the maintenance of human

CD34 hematopoietic stem-progenitor cells. Stem Cells 2016.

111

26. Pui CH, Carroll WL, Meshinchi S, Arceci RJ. Biology, risk stratification, and therapy of pediatric acute leukemias: an update. J Clin Oncol 2011; 29:551-65.

27. Kishi-Itakura C, Koyama-Honda I, Itakura E, Mizushima N. Ultrastructural analysis of autophagosome organization using mammalian autophagy-deficient cells. J Cell Sci 2014;

127:4089-102.

28. Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R,

Yokoyama M, Mishima K, Saito I, Okano H, et al. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 2006; 441:885-9.

29. Tal MC, Sasai M, Lee HK, Yordy B, Shadel GS, Iwasaki A. Absence of autophagy results in reactive oxygen species-dependent amplification of RLR signaling. Proc Natl Acad Sci

U S A 2009; 106:2770-5.

30. Miyoshi H, Kozu T, Shimizu K, Enomoto K, Maseki N, Kaneko Y, Kamada N, Ohki M.

The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript. EMBO J 1993; 12:2715-21.

31. Altman BJ, Jacobs SR, Mason EF, Michalek RD, MacIntyre AN, Coloff JL, Ilkayeva O,

Jia W, He YW, Rathmell JC. Autophagy is essential to suppress cell stress and to allow BCR-

Abl-mediated leukemogenesis. Oncogene 2011; 30:1855-67.

32. Maes H, Kuchnio A, Peric A, Moens S, Nys K, De Bock K, Quaegebeur A, Schoors S,

Georgiadou M, Wouters J, et al. Tumor vessel normalization by chloroquine independent of autophagy. Cancer Cell 2014; 26:190-206.

33. Maycotte P, Aryal S, Cummings CT, Thorburn J, Morgan MJ, Thorburn A. Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy. Autophagy 2012;

8:200-12.

34. Cambie G, Verdier F, Gaudebout C, Clavier F, Ginsburg H. The pharmacokinetics of chloroquine in healthy and Plasmodium chabaudi-infected mice: implications for chronotherapy.

Parasite 1994; 1:219-26.

112

35. Rosenfeld MR, Grossman SA, Brem S, Mikkelsen T, Wang D, Piao S, Davis LE,

O'Dwyer PJ, Amaravadi RK. Pharmacokinetic analysis and pharmacodynamic evidence of autophagy inhibition in patients with newly diagnosed glioblastoma treated on a phase I trial of hydroxychloroquine in combination with adjuvant temozolomide and radiation (ABTC 0603). J

Clin Oncol (Meeting Abstracts) 2010; 28:3086-.

36. McAfee Q, Zhang Z, Samanta A, Levi SM, Ma XH, Piao S, Lynch JP, Uehara T,

Sepulveda AR, Davis LE, et al. Autophagy inhibitor Lys05 has single-agent antitumor activity and reproduces the phenotype of a genetic autophagy deficiency. Proc Natl Acad Sci U S A

2012; 109:8253-8.

37. Zhang L, Zhang S, Yao J, Lowery FJ, Zhang Q, Huang WC, Li P, Li M, Wang X, Zhang

C, et al. Microenvironment-induced PTEN loss by exosomal microRNA primes brain metastasis outgrowth. Nature 2015; 527:100-4.

38. Ostrowski M, Carmo NB, Krumeich S, Fanget I, Raposo G, Savina A, Moita CF, Schauer

K, Hume AN, Freitas RP, et al. Rab27a and Rab27b control different steps of the exosome secretion pathway. Nat Cell Biol 2010; 12:19-30; sup pp 1-13.

39. Sehgal AR, Konig H, Johnson DE, Tang D, Amaravadi RK, Boyiadzis M, Lotze MT. You eat what you are: autophagy inhibition as a therapeutic strategy in leukemia. Leukemia 2015;

29:517-25.

40. Evangelisti C, Evangelisti C, Chiarini F, Lonetti A, Buontempo F, Neri LM, McCubrey JA,

Martelli AM. Autophagy in acute leukemias: a double-edged sword with important therapeutic implications. Biochim Biophys Acta 2015; 1853:14-26.

41. Sumitomo Y, Koya J, Kataoka K, Tsuruta-Kishino T, Morita K, Sato T, Kurokawa M.

Enhanced Autophagy Promotes Survival of Peripheral Blast Cells from Murine Acute Myeloid

Leukemia. Blood 2014; 124:2339-.

113

42. Mandelbaum J, Rollins N, Shah P, Bowman D, Lee JY, Tayber O, Bernard H, LeRoy P,

Li P, Koenig E, et al. Identification of a lung cancer cell line deficient in atg7-dependent autophagy. Autophagy 2015:0.

43. Ouyang DY, Xu LH, He XH, Zhang YT, Zeng LH, Cai JY, Ren S. Autophagy is differentially induced in prostate cancer LNCaP, DU145 and PC-3 cells via distinct splicing profiles of ATG5. Autophagy 2013; 9:20-32.

44. Eng CH, Wang Z, Tkach D, Toral-Barza L, Ugwonali S, Liu S, Fitzgerald SL, George E,

Frias E, Cochran N, et al. Macroautophagy is dispensable for growth of KRAS mutant tumors and chloroquine efficacy. Proc Natl Acad Sci U S A 2016; 113:182-7.

45. Solomon VR, Lee H. Chloroquine and its analogs: a new promise of an old drug for effective and safe cancer therapies. Eur J Pharmacol 2009; 625:220-33.

46. Jensen PB, Sorensen BS, Sehested M, Grue P, Demant EJ, Hansen HH. Targeting the cytotoxicity of topoisomerase II-directed epipodophyllotoxins to tumor cells in acidic environments. Cancer Res 1994; 54:2959-63.

47. Lee CM, Tannock IF. Inhibition of endosomal sequestration of basic anticancer drugs: influence on cytotoxicity and tissue penetration. Br J Cancer 2006; 94:863-9.

48. Zhou Q, McCracken MA, Strobl JS. Control of mammary tumor cell growth in vitro by novel cell differentiation and apoptosis agents. Breast Cancer Res Treat 2002; 75:107-17.

49. Boya P, Gonzalez-Polo RA, Poncet D, Andreau K, Vieira HL, Roumier T, Perfettini JL,

Kroemer G. Mitochondrial membrane permeabilization is a critical step of lysosome-initiated apoptosis induced by hydroxychloroquine. Oncogene 2003; 22:3927-36.

50. Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, Thomas-Tikhonenko

A, Thompson CB. Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. J Clin Invest 2007; 117:326-36.

114

51. Peters S, Reinthal E, Blitgen-Heinecke P, Bartz-Schmidt KU, Schraermeyer U. Inhibition of lysosomal degradation in retinal pigment epithelium cells induces exocytosis of phagocytic residual material at the basolateral plasma membrane. Ophthalmic Res 2006; 38:83-8.

52. Gan B, Peng X, Nagy T, Alcaraz A, Gu H, Guan JL. Role of FIP200 in cardiac and liver development and its regulation of TNFalpha and TSC-mTOR signaling pathways. J Cell Biol

2006; 175:121-33.

53. Kumar AR, Hudson WA, Chen W, Nishiuchi R, Yao Q, Kersey JH. Hoxa9 influences the phenotype but not the incidence of Mll-AF9 fusion gene leukemia. Blood 2004; 103:1823-8.

54. Goyama S, Schibler J, Cunningham L, Zhang Y, Rao Y, Nishimoto N, Nakagawa M,

Olsson A, Wunderlich M, Link KA, et al. Transcription factor RUNX1 promotes survival of acute myeloid leukemia cells. J Clin Invest 2013; 123:3876-88.

55. Krejci O, Wunderlich M, Geiger H, Chou FS, Schleimer D, Jansen M, Andreassen PR,

Mulloy JC. p53 signaling in response to increased DNA damage sensitizes AML1-ETO cells to stress-induced death. Blood 2008; 111:2190-9.

56. Wei J, Wunderlich M, Fox C, Alvarez S, Cigudosa JC, Wilhelm JS, Zheng Y, Cancelas

JA, Gu Y, Jansen M, et al. Microenvironment determines lineage fate in a human model of MLL-

AF9 leukemia. Cancer Cell 2008; 13:483-95.

57. Roychoudhury J, Clark JP, Gracia-Maldonado G, Unnisa Z, Wunderlich M, Link KA,

Dasgupta N, Aronow B, Huang G, Mulloy JC, et al. MEIS1 regulates an HLF-oxidative stress axis in MLL-fusion gene leukemia. Blood 2015; 125:2544-52.

115

Chapter 4 Summary and Perspectives

116

4.1 Summaries

To date, the importance of autophagy activity during normal HSPCs maintenance, proliferation, and differentiation is well known. Also in hematopoietic malignancies, dysregulation of autophagy contributes to leukemia development and the response to chemotherapy. However, there are still a lot of unknown areas, including the mechanism of autophagy regulation and function in normal hematopoiesis and the therapeutic potential of autophagy inhibition in AML.

To address these questions, we dissect the role of autophagy in normal and malignant hematopoiesis using clear-cut mouse models in this thesis work.

In normal hematopoiesis, we found that basal autophagy activity varies in different HSPCs compartments, high in primitive HSC cells and low in the more differentiated GMP population.

Upon mTOR knockout, which is the major suppressor of autophagy, there was no change of autophagy activity in HSC and GMP cells, while CMP cells showed increased autophagy activity.

In HSC and GMP, we concluded that the unchanged autophagy activity is due to the existence of compensatory pathways. When we treated HSC and GMP cells with a non-selective kinase inhibitor compound C, autophagy could be induced in mTOR knockout HSC, suggesting a kinase signaling is playing the compensatory role. We also found that autophagy regulation is dependent on mTOR kinase activity, not its protein structure, since HSPCs with an mTOR knockin genotype showed a similar autophagy phenotype to mTOR knockout cells. Through

Raptor knockout mouse model, we found that mTOR regulation of autophagy is most likely through mTORC1.

In hematopoietic malignancies, we demonstrated that both canonical and alternative autophagy pathways were dispensable for MA9-AML proliferation and survival, in vivo and in vitro, through genetic knockout of autophagy essential genes Atg5 and FIP200. MA9-AML cells showed unchanged mitochondria and ROS levels upon autophagy blockage. We also demonstrated that

117 autophagy blockage in MA9-AML did not sensitize leukemia cells to standard chemotherapy, or the ER-stressor.

Autophagy gene knockout and wild-type leukemia cells had similar responses to chloroquine treatment, suggesting that chloroquine has autophagy independent anti-leukemic effect. Under

TEM analysis, autophagy genes deleted MA9-AML cells showed similar ultrastructure to wild- type cells. Upon chloroquine blockage, both knockout and wild-type leukemia cells showed large endolysosomes formation under TEM, suggesting the existence of a compensatory vesicular transportation system in autophagy blocked leukemia cells, which transported cargos to lysosomes for degradation. This unknown compensatory vesicular transportation system maintained cellular homeostasis when the autophagy function was suppressed. We also observed that during chloroquine blockage, MA9-AML cells are actively exocytosing under- degraded lysosomal contents into extracellular spaces. We consider this activity as a way for cells to overcome chloroquine blockage at lysosomal stage. When we inhibit exocytosis activity through a pharmacological inhibitor or shRNA knockdown, leukemia cells had increased cell death during chloroquine treatment. Our research indicates that autophagy targeting will unlikely be a useful strategy in certain types of AML therapy and the autophagy inhibitor chloroquine has an autophagy independent anti-leukemia effect. Our research also provides a new insight into drug combinatory strategies for leukemia treatment: a combination of lysosomal and exocytosis inhibitors.

118

4.2 Discussion and Perspectives

4.2.1 Why do HSPCs subpopulations bear different levels of autophagy activity?

As a heterogeneous cell group, HSPCs show varied autophagy activity in its subpopulations.

The trend is that more primitive populations have higher basal autophagy level than more differentiated populations. From the very limited publication that investigates autophagy in HSC, similar but less detailed observation was also made.1, 2 The current explanation for high autophagy activity in HSC are that autophagy activity is essential in balancing stem cell quiescence, self-renewal and differentiation.3 However, little is known about the regulatory mechanisms governing the variance in autophagy activity in HSPCs subpopulations and its functional correlations. From the other point of view, the correlation between high autophagy activity and more primitive cells may offer a new tool for further subgrouping HSC population, helping to identify the most primitive HSC in hematopoietic system.

4.2.2 What is the role of mTOR in autophagy regulation in normal hematopoiesis?

Although mTOR is considered as the major suppressor of autophagy in many types of cells, the dependence on mTOR regulating autophagy varied in HSPCs subpopulations. Although CMP subpopulation may depend, HSC and CMP are independent of mTOR on autophagy regulation shown by clear-cut genetic knockout mouse models. However, a short-term mTOR pharmacological inhibitor treatment induces autophagy in HSC. The discrepancy between mTOR pharmacological inhibitor and genetic targeting could possibly be due to a compensatory pathway in the genetic knockout condition. A non-specific kinase inhibitor induces similar autophagy response between mTOR wildtype and knockout, suggesting that a kinase pathway is compensating upon mTOR loss. Akt signaling pathway could be one of the candidates, since activated Akt suppresses autophagy through Beclin1 phosphorylation.4 But more researches are needed before drawing the conclusion.

119

The independence of mTOR on autophagy regulation also indicates the importance of autophagy activity in these subpopulations of HSPCs; otherwise these cells would not develop a backup system to accurately balance the autophagy activity upon mTOR loss. As autophagy activity correlates with HSC stemness, identifying the compensatory pathway will also help us to understand and manipulate the stemness of HSC.

4.2.3 What are the potential benefits and challenges of autophagy targeting in AML treatment?

Targeting autophagy for the treatment of hematopoietic malignancies has been widely investigated and discussed. As autophagy could be a double-edge sword in caner progression and therapy, either inducing or inhibiting autophagy could be a potential therapeutic strategy in cancer treatment. On one hand, drugs and chemical compounds may exert anti-tumor effect by inducing autophagy or autophagic cell death in hematopoietic malignancies.5 On the other hand, autophagy inhibition has been shown effective in certain hematopoietic malignancies, such as chronic myeloid leukemia, and lymphoma.6, 7 In our study, we found that autophagy pathways have little effect on MA9-AML cell survival.

The mechanism for how the cells maintain homeostasis upon autophagy inhibition is still not clear, but there are a few possibilities that could account for this phenomenon. First, there may be a third autophagy pathway in addition to the currently known canonical and alternative autophagy pathways. In our Rb1cc1/FIP200 knockout cells, LC3II or LC3 puncta, which is a widely accepted autophagy marker, still exist. This could be attributed to an autophagy- independent function of LC3II, or it could be an indication of autophagy activity, despite the blockage of both alternative and canonical pathways. Second, other vesicular transportation system may be compensating for the suppressed autophagy function. For example, mutivesicular bodies (MVBs) can shuttle ubiquintinated proteins, like epridermal growth factor

120 receptor (EGFR) to lysosome for degradation.8 Vesicles with coating proteins, such as COPI,

COPII, and clathrin, shift cargo between different organelles.9, 10 These transportation systems are not affected upon autophagy suppression since they depend on different mechanisms. Third, the uniqueness of AML from solid tumors may be a reason for the autophagy resistance. Tumor cells utilized autophagy to overcome stress conditions, such as hypoxia and nutrient deprivation.

However, leukemia cells circulating in blood, which is an oxygen and nutrient rich environment, may not depend on autophagy for survival. These cells could acquire nutrients through direct endocytosis from blood and discard wastes extracellularly through exocytosis to maintenance homeostasis.

In addition to MA9-AML, we also show that AE-AML cells survive independent of autophagy.

Besides us, other groups have also found that autophagy is dispensable for the survival certain types of AML.11, 12 We speculate that there may be more types of AML that are independent of autophagy. However, since AML is a very heterogeneous group of malignancies, each type of

AML needs to be carefully investigated when considering autophagy targeting as a potential therapeutic strategy. Though our current understanding of the autophagy process is much more extensive than decades ago, the molecular mechanism is not fully understood yet and further investigation is still needed.

4.2.4 What are the potential benefits and challenges of lysosome targeting in AML treatment?

In this thesis, we also demonstrated that chloroquine, a lysosomotrophic drug, has autophagy- independent anti-leukemic effects, since autophagy gene knockout MA9 cells showed a similar response to chloroquine treatment as wildtype. We speculate that the anti-leukemic effect of chloroquine is through lysosomal blockage as we see large endolysosomes accumulation and cells trying to exocytose the un-degraded lysosomal contents. Blocking the exocytosis pathway

121 enhances the anti-leukemic effect of chloroquine. Based on our study results, we conclude that lysosomal inhibition, rather than autophagy inhibition, is a potential therapeutic strategy in AML treatment.

Indeed, targeting lysosomes for cancer treatment has been under investigation for decades.

Compounds that increase the permeability of lymsosomal membranes leads to cell apoptosis or apoptotic-like cell death.13-16 The fact that AML cells usually have larger lysosomes and overexpressed lysosomal biogenesis genes offers a therapeutic rationale for lysosomal targeting in AML.17 Studies have shown that mefloquine, by disrupting lysosomes, selectively kill

AML cells and AML stem cells in a panel of leukemia cell lines and in mice.17

The commonly used lysosomal targeting drugs are chloroquine, its derivative hydroxychloroquine, and other structurally similar compounds, including mefloquine and quinacrine, which were originally developed as anti-malarial drugs.18 Although this category of drug shows anti-cancer effects, their efficacy and toxicity need to be improved for wide-spread clinical use. The first novel optimization of chloroquine is done by Amarvadi and colleagues.

They constructed a bivalent aminoquinoline compound, Lys05, based on the structure of two chloroquine molecules fused together. Lys05 shows ten-fold improved potency over hydroxychloroquine both in vitro and in vivo.19 Later, another group synthesized new compounds using chloroquine as backbone and two of them were identified as superior to chloroquine in both efficacy and potency.20, 21

The improvement and identification of novel lysosomotropic agents is highly worth pursuing, because we speculate that a large part of anti-tumor effects observed with chloroquine/hydroxychloroquine treatment is virtually through lysosome blockage instead of autophagy inhibition. Besides the autophagy pathways, there are other uncharacterized

122 vesicular transportation pathways that transport cargos to lysosomes for degradation. Inhibition at the lysosome stage will block any and all pathways that converge on lysosomes. While the lysosomes are a potential effective target in cancer therapy, negative side effects such as cytotoxicity from the full inhibition of an essential organelle, also exist. Meanwhile, the resistance of cells to lysosomal inhibition, such as the exocytosis we observed in MA9 cells, should all be taken into consideration during drug discovery and designing new combinatory strategies for cancer treatment.

123

4.3 Reference

1. Salemi S, Yousefi S, Constantinescu MA, Fey MF, Simon HU. Autophagy is required for

self-renewal and differentiation of adult human stem cells. Cell Res 2012 Feb; 22(2):

432-435.

2. Warr MR, Binnewies M, Flach J, Reynaud D, Garg T, Malhotra R, et al. FOXO3A directs

a protective autophagy program in haematopoietic stem cells. Nature 2013 Feb 21;

494(7437): 323-327.

3. Guan JL, Simon AK, Prescott M, Menendez JA, Liu F, Wang F, et al. Autophagy in stem

cells. Autophagy 2013 Jun 1; 9(6): 830-849.

4. Wang RC, Wei Y, An Z, Zou Z, Xiao G, Bhagat G, et al. Akt-mediated regulation of

autophagy and tumorigenesis through Beclin 1 phosphorylation. Science 2012 Nov 16;

338(6109): 956-959.

5. Puissant A, Robert G, Auberger P. Targeting autophagy to fight hematopoietic

malignancies. Cell Cycle 2010 Sep 1; 9(17): 3470-3478.

6. Altman BJ, Jacobs SR, Mason EF, Michalek RD, MacIntyre AN, Coloff JL, et al.

Autophagy is essential to suppress cell stress and to allow BCR-Abl-mediated

leukemogenesis. Oncogene 2011 Apr 21; 30(16): 1855-1867.

7. Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, et al. Autophagy

inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. J

Clin Invest 2007 Feb; 117(2): 326-336.

8. Felder S, Miller K, Moehren G, Ullrich A, Schlessinger J, Hopkins CR. Kinase activity

controls the sorting of the epidermal growth factor receptor within the multivesicular body.

Cell 1990 May 18; 61(4): 623-634.

9. Nickel W, Brugger B, Wieland FT. Vesicular transport: the core machinery of COPI

recruitment and budding. J Cell Sci 2002 Aug 15; 115(Pt 16): 3235-3240.

124

10. Kirchhausen T. Three ways to make a vesicle. Nat Rev Mol Cell Bio 2000 Dec; 1(3):

187-198.

11. Piya S, Kornblau SM, Ruvolo VR, Mu H, Ruvolo PP, McQueen T, et al. Atg7

suppression enhances chemotherapeutic agent sensitivity and overcomes stroma-

mediated chemoresistance in acute myeloid leukemia. Blood 2016 Sep 1; 128(9): 1260-

1269.

12. Liu Q, Chen L, Atkinson JM, Claxton DF, Wang HG. Atg5-dependent autophagy

contributes to the development of acute myeloid leukemia in an MLL-AF9-driven mouse

model. Cell Death Dis 2016 Sep 08; 7(9): e2361.

13. Guicciardi ME, Leist M, Gores GJ. Lysosomes in cell death. Oncogene 2004 Apr 12;

23(16): 2881-2890.

14. Cirman T, Oresic K, Mazovec GD, Turk V, Reed JC, Myers RM, et al. Selective

disruption of lysosomes in HeLa cells triggers apoptosis mediated by cleavage of Bid by

multiple papain-like lysosomal cathepsins. J Biol Chem 2004 Jan 30; 279(5): 3578-3587.

15. Antunes F, Cadenas E, Brunk UT. Apoptosis induced by exposure to a low steady-state

concentration of H2O2 is a consequence of lysosomal rupture. Biochem J 2001 Jun 1;

356(Pt 2): 549-555.

16. Boya P, Andreau K, Poncet D, Zamzami N, Perfettini JL, Metivier D, et al. Lysosomal

membrane permeabilization induces cell death in a mitochondrion-dependent fashion. J

Exp Med 2003 May 19; 197(10): 1323-1334.

17. Sukhai MA, Prabha S, Hurren R, Rutledge AC, Lee AY, Sriskanthadevan S, et al.

Lysosomal disruption preferentially targets acute myeloid leukemia cells and progenitors.

J Clin Invest 2013 Jan; 123(1): 315-328.

18. Solomon VR, Lee H. Chloroquine and its analogs: a new promise of an old drug for

effective and safe cancer therapies. Eur J Pharmacol 2009 Dec 25; 625(1-3): 220-233.

125

19. McAfee Q, Zhang Z, Samanta A, Levi SM, Ma XH, Piao S, et al. Autophagy inhibitor

Lys05 has single-agent antitumor activity and reproduces the phenotype of a genetic

autophagy deficiency. Proc Natl Acad Sci U S A 2012 May 22; 109(21): 8253-8258.

20. Wang T, Goodall ML, Gonzales P, Sepulveda M, Martin KR, Gately S, et al. Synthesis of

improved lysomotropic autophagy inhibitors. J Med Chem 2015 Apr 9; 58(7): 3025-3035.

21. Goodall ML, Wang T, Martin KR, Kortus MG, Kauffman AL, Trent JM, et al. Development

of potent autophagy inhibitors that sensitize oncogenic BRAF V600E mutant melanoma

tumor cells to vemurafenib. Autophagy 2014 Jun; 10(6): 1120-1136.

126