DOCSLIB.ORG

Ventralized Zebrafish Embryo Rescue by Overexpression of Zic2a

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ventralized Zebrafish Embryo Rescue by Overexpression of Zic2a ZEBRAFISH Volume 1, Number 3, 2004 © Mary Ann Liebert, Inc. Ventralized Zebrafish Embryo Rescue by Overexpression of Zic2a EVDOKIA DODOU,1 KATE F. BARALD,2 and JOHN H. POSTLETHWAIT1 ABSTRACT The neuroectoderm arises during gastrulation as a population of undifferentiated proliferating neuroepithelial cells. As development continues, neuroepithelial cells leave the cell cycle and differentiate into neurons and glia of the functioning central nervous system. What processes establish the spatial distribution of proliferating neu- roepithelial cells? To investigate this question, zic2a was isolated from zebrafish, a homolog of the Drosophila pair-rule gene odd-paired, which is involved in nervous system patterning. At shield stage, zic2a was expressed in the zebrafish organizer and the blastoderm margin, and became restricted to the axial mesoderm in mid-gas- trula. Expression of zic2a appeared in the prospective neuroectoderm during gastrulation, and later demarcated the presumptive forebrain. This expression pattern suggests that zic2a may function early in the organizer and later in the neural plate to demarcate the population of proliferating neuroectoderm. Consistent with a function for zic2a in transducing signals from the organizer, overexpression of zic2a resulted in an expansion of prolifer- ating neuroectoderm. Furthermore, zic2a overexpression rescued the ventralized phenotype of chordino mutant embryos, which lack a functional chordin gene. Early expression of zic2 in the zebrafish organizer, and the phe- notype resulting from overexpression, show a role for zic2a downstream of chordin or other secreted organizer proteins in establishing the initial size of the population of neuroectoderm cells. INTRODUCTION system. The formation of the neuroectoderm from the dorsal ectoderm depends on induc- he vertebrate central nervous system con- tive signals from the dorsal organizer at the Ttains multipotent precursor cells capable of early gastrula stage and secreted factors from differentiating into a variety of neuronal and the ventral portion of the embryo. glial fates.1,2 Because neural stem cells initially In Xenopus, dorsalizing signals that originate arise by processes that drive normal embryonic from the organizer include Noggin, Follistatin, development, and these embryonic mecha- Nodal-related-3 (Xnr3), Chordin, and Grem- nisms may persist in later life to help control lin.4–8 These signals act by antagonizing the se- reserve cells that maintain homeostasis of the creted Bone Morphogenetic Proteins (BMPs), central nervous system after perturbation from which play a role in the specification of non- disease or injury,3 it is important to understand neural, ventral cell fates in Xenopus9,10 and ze- the initial developmental processes that estab- brafish.11–14 Not only do these secreted BMP lish the extent of the embryonic central nervous antagonists play an important role in the early 1Institute of Neuroscience, University of Oregon, Eugene, Oregon. 2Department of Cell and Developmental Biology, University of Michigan, Ann Arbor, Michigan. Supported by NIH grants R01RR10715 and P01HD22486 (JHP), and NIH NIH/NIDCD, RO1 DC04184 and NIH/NIDCD, R01 DC05939 (KFB). The authors thank the NIH (1-G20-RR11724), NSF (STI-9602828), M. J. Murdock Charitable Trust (96127:JVZ:02/27/97), and W. M. Keck Foundation (961582) for supporting renovation of the University of Oregon Zebrafish Facility. 239 240 DODOU ET AL. stages of embryonic axis specification, they also zic2a in the specification hierarchy of dorsoven- help to specify other organ systems that de- tral patterning, we expressed zic2a in ventral- pend on symmetry, including the developing ized chordino mutants. Results showed that zic2a vertebrate inner ear.15 Follistatin and Chordin rescued these ventralized mutant embryos. antagonize BMP4 activity by physically associ- Based on the expression pattern of zic2a, the ef- ating with BMP4, thereby blocking the binding fects of zic2a overexpression in wild-type em- of BMP4 to its receptor.16–18 Genetic evidence bryos, and the ability of zic2a message to res- for this interaction also exists in zebrafish: the cue ventralized mutant embryos, we propose ventralized mutant, chordino (dino),19 lacks a that zic2a functions in promoting dorsal cell functional chordin gene,20 but dino interacts ge- fates and increasing the size of the proliferat- netically with the dorsalized mutant swirl,21,22 ing prospective neural-plus-glial cell popula- which contains a mutation in the bmp2b tion. gene.11,13 Members of the Zic gene family are good candidates to function downstream of Chordin MATERIALS AND METHODS and BMPs. In Xenopus, Zic1 was cloned as a downstream target of Chordin.23 Chick Zic1, 2, Library Screening and 3 genes are widely expressed in the cen- A cDNA library prepared from 6–10 hpf em- tral nervous system, neural crest, and inner bryos (provided by B.W. Draper, unpublished.) ear, where Chordin-expressing cells are found was screened by degenerate PCR. The primers to interdigitate with longitudinal stripes of were designed with the application CODEHOP Zic1-expressing cells in the hindbrain.24 Verte- available in the BLOCKS web server (www. brate Zic genes encode zinc-finger transcription blocks.fhcrc.org) of the Fred Hutchinson Cancer factors of the Gli super-family, thought to be Research Center in Seattle, WA. The primers involved in patterning the neural tube.25–29 Ze- were: zic2-F: CCCCGGCGCCTTCTTYMGN- brafish zic1 is strongly expressed in the pre- TAYATG and zic2-R: GGGCAAAGATCTTCC- sumptive forebrain at mid-gastrula.30 We re- CRCANCCNGG. The annealing temperature ported the isolation of zebrafish zic2a (GenBank was 57°C, salt concentration 3mM and primer Accession number AF151535, submitted 14- concentration 1␮M. The expected product is May-1999) and this gene was independently 317 bp and spans the five zinc finger domains. isolated by Grinblat and Sive,31 and Toyama et Screening this cDNA library in a gridded for- al.32 recently isolated an additional zic2 para- mat provided a full length zic2a clone. The full log, zic2b (zic2.2). length zic2a cDNA (3132 bp long) was flanked To more fully understand the role of zic2 in by untranslated regions of 347 bp at the 5 prime dorsoventral patterning and to define how zic2 and 1447 bp at the 3 prime side. The accession fits into the regulatory network that controls number for zic2a is AF151535. cell fate decisions in the early gastrula, we pre- sent data indicating that zebrafish zic2a func- Whole-Mount in Situ Hybridization tions in early processes specifying the dorso- ventral axis and the size of the neural plate. We Expression analysis was performed essen- show that zic2a is expressed in the organizer re- tially as in Oxtoby and Jowett.33 Two-color in gion of the early gastrula, and zic2a transcripts situ hybridizations were performed according persist in the presumptive axial mesendoderm to Jowett and Yan.34 To make zic2a probe for in until the end of gastrulation. This expression situ hybridizations, zic2a 3ЈUTR sequences (nt. pattern suggests the hypothesis that zic2a may 1795 to 2983), which should be gene-specific be involved in organizer function at this early and different from other paralogs, were ampli- stage in zebrafish development. To test this hy- fied with the polymerase chain reaction (PCR) pothesis, zic2a was overexpressed in zebrafish using gene-specific primers (F: GCGTCTAG- embryos, and we discovered that this treatment ACCTACATCGACAGAAGAAACG (nt. 1795 dorsalized wild-type zebrafish embryos, ex- to 1815, with an XbaI site at the 5Ј), R: GC- panding the neuroectodermal domain. To place CAAGCTTCTGACAGCTCTTAGTTTTGCG Zic2a OVEREXPRESSION 241 (nt. 2983 to 2963, with an XbaI site at the 5Ј). traub, unpublished results). In vitro transcrip- The PCR fragment was digested with XbaI/ tion was performed with the SP6 MESSAGE HindIII and cloned into XbaI/HindIII-digested MACHINE kit (Ambion, Austin, TX) according KSϩ Bluescript vector. Antisense RNA probes to manufacturer’s instructions. After removal were synthesized from cDNA encoding zic2a of DNA template by treatment with RNase-free (this paper), zic1,30 krox20,33 foxd3,35 dlx3b,36 DNase, the mRNAs were purified with RNeasy gata1,37 pax2a,38 gsc,39 and chordin.20 Mini Kit (QIAGEN, Valencia, CA) and dis- solved in RNase-free water. About 25 pg of Zebrafish Strains capped mRNA was injected per embryo. Wild-type (AB, C32, WIK, SJD) and mutant Mapping and Linkage Analysis zebrafish (Danio rerio) were obtained from the University of Oregon Zebrafish Facility. Mu- The zic2a gene was mapped by designing Ј tants were obtained from intercrosses of heter- specific primers to amplify the 3 untranslated ozygous carriers.40 Embryos were maintained region (forward:GCGTCTAGACAAGTGTAC- at 28.5°C and staged by hours (h) or days (d) AATCTTTACAAC, reverse:GCCAAGCTTGA- postfertilization using standard morphological TAATTCAGCGCTATCTGC). These primers criteria.41 The following ENU-induced muta- were used to amplify members of a doubled tions identified in the Tübingen mutagenesis haploid mapping panel,47 and a polymorphism screen42 were used: dino (tt250),19 a recessive was detected by single strand conformation lethal mutation caused by a small 104-bp dele- polymorphism (SSCP)48 and compared to sev- tion in the zebrafish ortholog of chordin;20 swirl eral thousand other DNA polymorphisms pre- (ta72)22 is a zygotic semidominant mutation viously scored on this panel.47 Map positions caused by a single base-pair change in the stop were determined by using Map Manager,49 codon of bmp2b;13 snailhouse (ty68a)22 is a hy- http://mcbio.med.buffalo.edu/mapmgr.html). pomorphic mutation that displays a Val Ǟ Gly substitution in a conserved motif of the Bmp7 prodomain.43,44 RESULTS Phylogenetic and Genomic Analyses Isolation and Phylogenetic Analysis of the Zebrafish zic2a Gene Sequences for phylogenetic analysis were col- lected using the tblastn search program of NCBI To address the role of zic2 in ectodermal pat- BLAST (http://www.ncbi.nlm.nih.gov/cgi bin/ terning, we cloned a zebrafish ortholog of the BLAST/nph-newblast) to find amino acid se- vertebrate Zic2 gene using redundant primers quences similar to zebrafish zic2a.
Load more

Recommended publications
  • 1A Multiple Sclerosis Treatment
    The Pharmacogenomics Journal (2012) 12, 134–146 & 2012 Macmillan Publishers Limited. All rights reserved 1470-269X/12 www.nature.com/tpj ORIGINAL ARTICLE Network analysis of transcriptional regulation in response to intramuscular interferon-b-1a multiple sclerosis treatment M Hecker1,2, RH Goertsches2,3, Interferon-b (IFN-b) is one of the major drugs for multiple sclerosis (MS) 3 2 treatment. The purpose of this study was to characterize the transcriptional C Fatum , D Koczan , effects induced by intramuscular IFN-b-1a therapy in patients with relapsing– 2 1 H-J Thiesen , R Guthke remitting form of MS. By using Affymetrix DNA microarrays, we obtained and UK Zettl3 genome-wide expression profiles of peripheral blood mononuclear cells of 24 MS patients within the first 4 weeks of IFN-b administration. We identified 1Leibniz Institute for Natural Product Research 121 genes that were significantly up- or downregulated compared with and Infection Biology—Hans-Knoell-Institute, baseline, with stronger changed expression at 1 week after start of therapy. Jena, Germany; 2University of Rostock, Institute of Immunology, Rostock, Germany and Eleven transcription factor-binding sites (TFBS) are overrepresented in the 3University of Rostock, Department of Neurology, regulatory regions of these genes, including those of IFN regulatory factors Rostock, Germany and NF-kB. We then applied TFBS-integrating least angle regression, a novel integrative algorithm for deriving gene regulatory networks from gene Correspondence: M Hecker, Leibniz Institute for Natural Product expression data and TFBS information, to reconstruct the underlying network Research and Infection Biology—Hans-Knoell- of molecular interactions. An NF-kB-centered sub-network of genes was Institute, Beutenbergstr.
    [Show full text]
  • Chromosome 13 Introduction Chromosome 13 (As Well As Chromosomes 14, 15, 21 and 22) Is an Acrocentric Chromosome. Short Arms Of
    Chromosome 13 ©Chromosome Disorder Outreach Inc. (CDO) Technical genetic content provided by Dr. Iosif Lurie, M.D. Ph.D Medical Geneticist and CDO Medical Consultant/Advisor. Ideogram courtesy of the University of Washington Department of Pathology: ©1994 David Adler.hum_13.gif Introduction Chromosome 13 (as well as chromosomes 14, 15, 21 and 22) is an acrocentric chromosome. Short arms of acrocentric chromosomes do not contain any genes. All genes are located in the long arm. The length of the long arm is ~95 Mb. It is ~3.5% of the total human genome. Chromosome 13 is a gene poor area. There are only 600–700 genes within this chromosome. Structural abnormalities of the long arm of chromosome 13 are very common. There are at least 750 patients with deletions of different segments of the long arm (including patients with an associated imbalance for another chromosome). There are several syndromes associated with deletions of the long arm of chromosome 13. One of these syndromes is caused by deletions of 13q14 and neighboring areas. The main manifestation of this syndrome is retinoblastoma. Deletions of 13q32 and neighboring areas cause multiple defects of the brain, eye, heart, kidney, genitalia and extremities. The syndrome caused by this deletion is well known since the 1970’s. Distal deletions of 13q33q34 usually do not produce serious malformations. Deletions of the large area between 13q21 and 13q31 do not produce any stabile and well–recognized syndromes. Deletions of Chromosome 13 Chromosome 13 (as well as chromosomes 14, 15, 21 and 22) belongs to the group of acrocentric chromosomes.
    [Show full text]
  • X-Linked Transposition of the Great Arteries and Incomplete Penetrance Among Males with a Nonsense Mutation in ZIC3
    European Journal of Human Genetics (2000) 8, 704–708 y © 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00 www.nature.com/ejhg ARTICLE X-linked transposition of the great arteries and incomplete penetrance among males with a nonsense mutation in ZIC3 Andr´e M´egarban´e1, Nabiha Salem1, Edouard Stephan2, Ramzi Ashoush3, Didier Lenoir4, Val´erie Delague1, Roland Kassab4, Jacques Loiselet1 and Patrice Bouvagnet4,5 1Unit´e de G´en´etique M´edicale, Facult´e de M´edecine, Universit´e Saint-Joseph, Beirut; 2Facult´e de M´edecine, Universit´e Saint-Joseph, Beirut; 3Service de Chirurgie Cardio-Vasculaire et de Cardiologie, Hˆotel-Dieu de France, Beirut, Lebanon; 4Laboratoire de G´en´etique Mol´eculaire Humaine, Facult´e de M´edecine et Pharmacie, Universit´e Claude Bernard, Lyon; 5Service de Cardiologie P´ediatrique, Hˆopital Louis Pradel, Bron, France We report on a Lebanese family in which two maternal cousins suffered and died very early in life from cardiac malformations. Both presented with a transposition of the great arteries associated with one or several other cardiac defects. Various minor midline defects were also observed, but there were no situs abnormalities other than a persistent left superior vena cava in one. A maternal uncle of these two babies was born cyanotic and died on the third post-natal day. Analysis of the ZIC3 gene, revealed the presence of a mutation in the second exon leading to a truncation of the protein. Surprisingly, another maternal uncle of the two affected cousins also had the mutation but was not clinically affected.
    [Show full text]
  • The Unfolding Clinical Spectrum of Holoprosencephaly Due To
    European Journal of Human Genetics (2010) 18, 999–1005 & 2010 Macmillan Publishers Limited All rights reserved 1018-4813/10 www.nature.com/ejhg ARTICLE The unfolding clinical spectrum of holoprosencephaly duetomutationsinSHH, ZIC2, SIX3 and TGIF genes Aime´e DC Paulussen*,1, Constance T Schrander-Stumpel1, Demis CJ Tserpelis1, Matteus KM Spee1, Alexander PA Stegmann1, Grazia M Mancini2, Alice S Brooks2, Margriet Colle´e2, Anneke Maat-Kievit2, Marleen EH Simon2, Yolande van Bever2, Irene Stolte-Dijkstra3, Wilhelmina S Kerstjens-Frederikse3, Johanna C Herkert3, Anthonie J van Essen3, Klaske D Lichtenbelt4, Arie van Haeringen5, Mei L Kwee6, Augusta MA Lachmeijer6, Gita MB Tan-Sindhunata6, Merel C van Maarle7, Yvonne HJM Arens1, Eric EJGL Smeets1, Christine E de Die-Smulders1, John JM Engelen1, Hubertus J Smeets1 and Jos Herbergs1 Holoprosencephaly is a severe malformation of the brain characterized by abnormal formation and separation of the developing central nervous system. The prevalence is 1:250 during early embryogenesis, the live-born prevalence is 1:16 000. The etiology of HPE is extremely heterogeneous and can be teratogenic or genetic. We screened four known HPE genes in a Dutch cohort of 86 non-syndromic HPE index cases, including 53 family members. We detected 21 mutations (24.4%), 3 in SHH,9inZIC2 and 9 in SIX3. Eight mutations involved amino-acid substitutions, 7 ins/del mutations, 1 frame-shift, 3 identical poly-alanine tract expansions and 2 gene deletions. Pathogenicity of mutations was presumed based on de novo character, predicted non- functionality of mutated proteins, segregation of mutations with affected family-members or combinations of these features.
    [Show full text]
  • Inhibition of Myogenesis by a Soluble Wnt Antagonist
    Development 126, 4257-4265 (1999) 4257 Printed in Great Britain © The Company of Biologists Limited 1999 DEV2454 Functional association of retinoic acid and hedgehog signaling in Xenopus primary neurogenesis Paula G. Franco*, Alejandra R. Paganelli*, Silvia L. López and Andrés E. Carrasco‡ Laboratorio de Embriología Molecular, Instituto de Biología Celular y Neurociencias, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, 3° piso, 1121, Buenos Aires, Argentina *These authors have contributed equally to this work and are listed in alphabetical order ‡Author for correspondence (e-mail: [email protected]) Accepted 17 July; published on WWW 7 September 1999 SUMMARY Previous work has shown that the posteriorising agent downregulated Gli3 and upregulated Zic2. Thus, retinoic retinoic acid can accelerate anterior neuronal acid and hedgehog signaling have opposite effects on the differentiation in Xenopus laevis embryos (Papalopulu, N. prepattern genes Gli3 and Zic2 and on other genes acting and Kintner, C. (1996) Development 122, 3409-3418). To downstream in the neurogenesis cascade. In addition, elucidate the role of retinoic acid in the primary retinoic acid cannot rescue the inhibitory effect of neurogenesis cascade, we investigated whether retinoic acid NotchICD, Zic2 or sonic hedgehog on primary neurogenesis. treatment of whole embryos could change the spatial Our results suggest that retinoic acid acts very early, expression of a set of genes known to be involved in upstream of sonic hedgehog, and we propose a model for neurogenesis. We show that retinoic acid expands the N- regulation of differentiation and proliferation in the neural tubulin, X-ngnr-1, X-MyT1, X-Delta-1 and Gli3 domains plate, showing that retinoic acid might be activating and inhibits the expression of Zic2 and sonic hedgehog primary neurogenesis by repressing sonic hedgehog in the neural ectoderm, whereas a retinoid antagonist expression.
    [Show full text]
  • Mutations in ZIC2 in Human Holoprosencephaly: Description of a Novel ZIC2 Specific Phenotype and Comprehensive Analysis of 157 Individuals
    Mutations in ZIC2 in human holoprosencephaly: description of a novel ZIC2 specific phenotype and comprehensive analysis of 157 individuals. Benjamin Solomon, Felicitas Lacbawan, Sandra Mercier, Nancy Clegg, Mauricio Delgado, Kenneth Rosenbaum, Christèle Dubourg, Véronique David, Ann Haskins Olney, Lars-Erik Wehner, et al. To cite this version: Benjamin Solomon, Felicitas Lacbawan, Sandra Mercier, Nancy Clegg, Mauricio Delgado, et al.. Mu- tations in ZIC2 in human holoprosencephaly: description of a novel ZIC2 specific phenotype and comprehensive analysis of 157 individuals.. Journal of Medical Genetics, BMJ Publishing Group, 2010, 47 (8), pp.513-24. 10.1136/jmg.2009.073049. inserm-00439659 HAL Id: inserm-00439659 https://www.hal.inserm.fr/inserm-00439659 Submitted on 9 Dec 2009 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Mutations in ZIC2 in Human Holoprosencephaly: Comprehensive Analysis of 153 Individuals and Description of a Novel ZIC2-Specfic Phenotype Benjamin D. Solomon1#, Felicitas Lacbawan1,2#, Sandra Mercier3,4, Nancy J. Clegg5, Mauricio R. Delgado5, Kenneth Rosenbaum6, Christèle Dubourg3, Veronique David3, Ann Haskins Olney7, Lars-Erik Wehner8,9, Ute Hehr8,9, Sherri Bale10, Aimee Paulussen11, Hubert J. Smeets11, Emily Hardisty12, Anna Tylki-Szymanska13, Ewa Pronicka13, Michelle Clemens14, Elizabeth McPherson15, Raoul C.M.
    [Show full text]
  • COVERSHEET TITLE: Roles of Zic2 and Zic3 in Early Development
    COVERSHEET TITLE: Roles of Zic2 and Zic3 in early development DEPARTMENT: Department of Zoology MENTOR: Yevgenya Grinblat DEPARTMENT: Department of Zoology MENTOR(2): ________________________ DEPARTMENT(2): _______________________ {The following statement must be included if you want your paper included in the library's electronic repository.) The author hereby grants to University of Wisconsin-Madison the permission to reproduce and to distribute publicly paper and electronic copies of this thesis document in whole or in part in any medium now known or hereafter created. ABSTRACT Roles of Zic2 and Zic3 in early development The Hedgehog (Hh) signaling pathway plays a crucial role in modulating embryonic development. Malfunctions in the vertebrate Hh pathway involving Sonic Hedgehog Homolog (Shh) have been linked to cancers including basal cell carcinoma and developmental disorders like holoprosencephaly. Zic3, a zinc-finger transcription factor, is hypothesized to activate Shh- mediated Hh signaling. This is based on data demonstrating ZIC3 often binds to GLI consensus motif, and Zic3-depleted embryos express lower levels of Shlz. To test this hypothesis, a line ofzebrafish embryos carrying a nonsense mutation of Zic3 was examined for morphology ofthe forebrain and retina. Unexpecte.{lly, no visible defects were found in embryos homozygous for the mutant allele through five days of development, and an expression assay of three Hh pathway genes (Shh, Hhip, and G/i2a) via in situ hybridization in Zic3 mutants showed normal patterns of Hh target expression. These data suggest Zic3 has redundant functions or gene compensation is occurring, in comparison to ZicJ-depleted embryos. In a parallel approach, we are investigating A/xi, a candidate target of Zic2.
    [Show full text]
  • Mutations in the BMP Pathway in Mice Support the Existence of Two Molecular Classes of Holoprosencephaly Marie Fernandes1, Grigoriy Gutin1, Heather Alcorn2, Susan K
    RESEARCH REPORT 3789 Development 134, 3789-3794 (2007) doi:10.1242/dev.004325 Mutations in the BMP pathway in mice support the existence of two molecular classes of holoprosencephaly Marie Fernandes1, Grigoriy Gutin1, Heather Alcorn2, Susan K. McConnell3 and Jean M. Hébert1,* Holoprosencephaly (HPE) is a devastating forebrain abnormality with a range of morphological defects characterized by loss of midline tissue. In the telencephalon, the embryonic precursor of the cerebral hemispheres, specialized cell types form a midline that separates the hemispheres. In the present study, deletion of the BMP receptor genes, Bmpr1b and Bmpr1a, in the mouse telencephalon results in a loss of all dorsal midline cell types without affecting the specification of cortical and ventral precursors. In the holoprosencephalic Shh–/– mutant, by contrast, ventral patterning is disrupted, whereas the dorsal midline initially forms. This suggests that two separate developmental mechanisms can underlie the ontogeny of HPE. The Bmpr1a;Bmpr1b mutant provides a model for a subclass of HPE in humans: midline inter-hemispheric HPE. KEY WORDS: Telencephalon, Dorsal midline, Choroid plexus, Cortical hem, Holoprosencephaly, BMP, SHH INTRODUCTION Whereas Lrp2 and Chrd;Nog mutants exhibit excessive dorsal The cerebral hemispheres, the seat of higher cognitive function in midline features such as BMP expression and apoptosis (Furuta et mammals, develop from the embryonic telencephalon. The al., 1997; Anderson et al., 2002; Spoelgen et al., 2005), the dorsal telencephalon becomes divided into morphologically distinct left midline appears to be lost in the holoprosencephalic Zic2 and Fgf8 and right hemispheres shortly after neural tube closure. Dorsally, the hypomorphic mutants (Nagai et al., 2000; Storm et al., 2006).
    [Show full text]
  • An Evolutionarily Conserved Mesodermal Enhancer in Vertebrate Zic3 Received: 11 May 2018 Yuri S
    www.nature.com/scientificreports OPEN An Evolutionarily Conserved Mesodermal Enhancer in Vertebrate Zic3 Received: 11 May 2018 Yuri S. Odaka1, Takahide Tohmonda1, Atsushi Toyoda 2 & Jun Aruga1,3 Accepted: 25 September 2018 Zic3 encodes a zinc fnger protein essential for the development of meso-ectodermal tissues. In Published: xx xx xxxx mammals, Zic3 has important roles in the development of neural tube, axial skeletons, left-right body axis, and in maintaining pluripotency of ES cells. Here we characterized cis-regulatory elements required for Zic3 expression. Enhancer activities of human-chicken-conserved noncoding sequences around Zic1 and Zic3 were screened using chick whole-embryo electroporation. We identifed enhancers for meso-ectodermal tissues. Among them, a mesodermal enhancer (Zic3-ME) in distant 3′ fanking showed robust enhancement of reporter gene expression in the mesodermal tissue of chicken and mouse embryos, and was required for mesodermal Zic3 expression in mice. Zic3-ME minimal core region is included in the DNase hypersensitive region of ES cells, mesoderm, and neural progenitors, and was bound by T (Brachyury), Eomes, Lef1, Nanog, Oct4, and Zic2. Zic3-ME is derived from an ancestral sequence shared with a sequence encoding a mitochondrial enzyme. These results indicate that Zic3-ME is an integrated cis-regulatory element essential for the proper expression of Zic3 in vertebrates, serving as a hub for a gene regulatory network including Zic3. Zic family of zinc fnger proteins is a versatile toolkit for metazoan development1. Tey are involved in the regu- lation of gene expression during cell-fate decision, regulation of cell proliferation and physiology2–4.
    [Show full text]
  • Discovery of Biased Orientation of Human DNA Motif Sequences
    bioRxiv preprint doi: https://doi.org/10.1101/290825; this version posted January 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Discovery of biased orientation of human DNA motif sequences 2 affecting enhancer-promoter interactions and transcription of genes 3 4 Naoki Osato1* 5 6 1Department of Bioinformatic Engineering, Graduate School of Information Science 7 and Technology, Osaka University, Osaka 565-0871, Japan 8 *Corresponding author 9 E-mail address: [email protected], [email protected] 10 1 bioRxiv preprint doi: https://doi.org/10.1101/290825; this version posted January 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 11 Abstract 12 Chromatin interactions have important roles for enhancer-promoter interactions 13 (EPI) and regulating the transcription of genes. CTCF and cohesin proteins are located 14 at the anchors of chromatin interactions, forming their loop structures. CTCF has 15 insulator function limiting the activity of enhancers into the loops. DNA binding 16 sequences of CTCF indicate their orientation bias at chromatin interaction anchors – 17 forward-reverse (FR) orientation is frequently observed. DNA binding sequences of 18 CTCF were found in open chromatin regions at about 40% - 80% of chromatin 19 interaction anchors in Hi-C and in situ Hi-C experimental data.
    [Show full text]
  • Link Between the Causative Genes of Holoprosencephaly: Zic2 Directly
    www.nature.com/scientificreports OPEN Link between the causative genes of holoprosencephaly: Zic2 directly regulates Tgif1 expression Received: 20 October 2017 Akira Ishiguro1,2, Minoru Hatayama1,3, Maky I. Otsuka1 & Jun Aruga1,3 Accepted: 15 January 2018 One of the causal genes for holoprosencephaly (HPE) is ZIC2 (HPE5). It belongs to the zinc fnger Published: xx xx xxxx protein of the cerebellum (Zic) family of genes that share a C2H2-type zinc fnger domain, similar to the GLI family of genes. In order to clarify the role of Zic2 in gene regulation, we searched for its direct target genes using chromatin immunoprecipitation (ChIP). We identifed TGIF1 (HPE4), another holoprosencephaly-causative gene in humans. We identifed Zic2-binding sites (ZBS) on the 5′ fanking region of Tgif1 by in vitro DNA binding assays. ZBS were essential for Zic2-dependent transcriptional activation in reporter gene assays. Zic2 showed a higher afnity to ZBS than GLI-binding sequences. Zic2-binding to the cis-regulatory element near the Tgif1 promoter may be involved in the mechanism underlying forebrain development and incidences of HPE. Holoprosencephaly (HPE) is known as a common forebrain defect in human development1,2. At least 13 chro- mosomal loci are associated with nonsyndromic HPE2,3. SHH, ZIC2, SIX3, and TGIF1 have been identifed to be four causative genes in the HPE loci (HPE3, HPE5, HPE2, and HPE4, respectively) and have been investigated with respect to clinical spectrum4 and genetic interactions5. Among the major HPE-associated genes, the roles of TGIF1 and ZIC2 in forebrain development have been elusive until recently1. However, recent studies have revealed clues as to its roles in forebrain development.
    [Show full text]
  • The Role of Zi2 During Neural Tube and Neural Crest Development
    Gerald Muca, GJMB, 2019 2:6 Review Article GJMB (2019) 2:6 Global Journal of Molecular Biology (ISSN:2637-5141) The role of Zi2 during neural tube and neural crest development Gerald Muca* Department of Morfofunctional Modules, Faculty of Veterinary Medicine, Agricultural University of Tirana, Koder Kamez, 2021 Tirana-Albania ABSTRACT The transcription factor Zic2 is member of Zic family, at early *Correspondence to Author: stages it has been involved in several processes during embry- Gerald Muca onic development and later on in morphogenesis and organo- genesis. An important role has been attributed to Zic2 during the Department of Morfofunctional development of the neural system. It has been involved in neural Modules, Faculty of Veterinary tube and neural crest formation. Both process structures will Medicine, Agricultural University form the central and peripheral neural system. Mutation of Zic2 of Tirana Koder Kamez, 2021 Tira- provokes holoprosencephaly in humans and in mouse also spina bifida. To date, there is not well elaborated the specific mech- na-Albania anisms under which Zic2 affect neural tube formation and the differences may exist between mouse and human phenotype. Almost the same ambiguity is for the specific role of Zic2 during neural crest development. Here is given are resumed latest stud- How to cite this article: ies and are given new insight about the role of Zic2 in these two Gerald Muca.The role of Zi2 during processes and its new target genes. neural tube and neural crest devel- opment. Global Journal of Molecu- Keywords: lar Biology, 2019, 2:6 Zic2; neural tube; neural crest; cell proliferation; development eSciPub LLC, Houston, TX USA.
    [Show full text]