ADHERENCE and ALKALINIZATION by Elizabeth Hwang

TWO EARLY PROCESSES DURING INFECTION BY THE FUNGAL PATHOGEN CANDIDA GLABRATA: ADHERENCE AND ALKALINIZATION

By Elizabeth Hwang-Wong

A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy

Baltimore, Maryland November, 2016

Abstract

Candida glabrata is a yeast pathogen of increasing diagnostic incidence. Its intrinsic resistance to antifungal agents used in standard clinical settings compels a need to further characterize and understand the pathogenesis of this species. The ability of C. glabrata to adhere to both abiotic surfaces and host cells is an essential early step in establishment of infection. It is also postulated that the capability of this pathogen to externally alkalinize an acidic environment, such as that found within an immune effector’s phagolysosome, could provide an evasive mechanism to resist initial onslaught of an innate immune response.

Members of a major class of adhesins encoded by the C. glabrata genome were previously described as Epithelial Adhesins (Epas). Earlier studies have demonstrated the existence of more than 20 members of this class, many of which are encoded in subtelomeric regions of the pathogen’s genome. A major sequencing project has now defined a total complement of 25 members, a newly described one of which is shown to function as a major adhesin across multiple host cell types. In fact, functional adherence of all putative adhesins encoded in the subtelomeres of C. glabrata has been tested, and with minor exception, all are EPAs. The ligand specificities of these functional adhesins were further tested utilizing glycan arrays, and revealed clues identifying a specific EPA responsible for mediating adherence to macrophages. Deletion of these adhesins was finally shown to abrogate colonization in a murine infection model.

Previous experiments investigating external alkalinization mediated by fungal pathogens described only distant phylogenetic relatives of C. glabrata, like Candida albicans. Akin to its distant cousins, C. glabrata also alkalinizes its environment when grown with amino acids as its only available carbon source. Mediation of this phenomenon likely functions by the ability of the pathogen to import basic amino acids. Organ colonization by mutants impermeable to this subset of amino acids is decreased.

PHD DISSERTATION REFEREES FOR ELIZABETH HWANG-WONG

Brendan P. Cormack, PhD: Professor, Department of Molecular Biology and Genetics at Johns

Hopkins School of Medicine (faculty sponsor)

Jeffry Corden, PhD: Professor, Department of Molecular Biology and Genetics at Johns Hopkins

School of Medicine (reader)

iii

Acknowledgements

I cannot express enough thanks to one of the most intelligent individuals I have had the honor of knowing - my advisor, Dr. Brendan Cormack. He had the wisdom to recommend the project that forms the majority of this thesis, and his infectious curiosity is a driving force for the entire lab. I am indebted to my reader, Dr. Jeffry Corden, who reviewed my work at the eleventh hour, and was the most generous neighboring mentor any graduate student could ask for. Thank you also to my committee members, Drs. Ronald Schnaar, Fidel Zavala, and Peter Espenshade, who provided wise suggestions and counsel.

I am blessed to have been part of a very supportive and collegial lab. Thank you to Dr. Brian

Green, who is not the well-known theoretical physicist but is equally as brilliant. Brian spearheaded the sequencing project that forms the basis for the work in Chapters 2-5, and was an instrumental second mentor for much of my early work on Epa family members. Thank you also to Dr. Rebecca Zordan, who marvels at minds that are “like a steel trap!” while I marvel at her equally well-endowed intelligence. Her constructive analyses, both big and small, aided my work in immeasurable ways.

I also need to thank previous graduate students in the lab. I never had the pleasure of meeting

Dr. Margaret Zupancic, but the heterologous expression experiments and microarray analyses were an expansion of her work on previously characterized proteins. I was lucky enough to spend a few years with Dr. Shih-Jung Pan, who was the resident expert at most of the relevant assays performed in our lab. Thank you for teaching me countless techniques. Thank you to the rest of the lab as well, for providing moments of levity, kindness, and consideration.

I have made some lifelong and irreplaceable bonds with fellow classmates, both within my program and without. I am indebted to my roommate Nina Rajpurohit, who is quite possibly the

iv best person I have ever known. Thank you to the CVP crew – Cassie, Vy, Nina, YaWen, Hoku,

Emily, Ouma, Sophie, Rob, Meredith, and Jose. They have been there through the toughest and most joyous events of these past few years, both professional and personal, and often over an ethanol-imbued poison of choice. I hope that the tradition continues, and that distance only opens up more places for us to explore.

I am also immensely grateful to the administrators of my program, specifically Dr. Carolyn

Machamer and Dr. Arhonda Gogos, who continually go beyond their call of duty. This work would not have been possible without their professional, social, and emotional support.

My first personal thanks go to my grandmother, Jang Soo Kwak. She was a woman of remarkable strength and character, who raised a family in a war-torn country and overcame challenges I will luckily never have to face. While many grandparents joke about marching to school a few miles uphill both ways, my grandmother was a woman who fled an invading army with three small children and an infant in tow (my mother). Years later, she raised me along with my two siblings in a strange but remarkable country. Thanks to my parents, Sook Hee

Hwang and Joon Sik Hwang, who stressed the value of education, and reared three children who all reached for postgraduate degrees. Thank you to my sister, Dr. Jean Hwang, for the free medical advice and for shared laughter and tears. Thanks to my husband, Vinson Wong, for partnering with me in the greatest adventure of our lives – parenthood.

Lastly and most importantly, I thank my two young children Zoey and Margaret. Their tenacious inquisitiveness reminds me every day that experimentation and delight at discovery is universal.

Table of Contents

Section 1: Adhesins encoded by Candida Glabrata

Chapter 1: Background and Significance

The yeast cell wall

Adhesin structure and function

Subtelomeres in other microorganisms

Subtelomeres in Candida glabrata

Conclusion

Chapter 2: Heterologous Expression of subtelomeric GPI-CWPs

Defining the complement of subtelomeric GPI-CWPs

Construction of expression vectors

Expression test

Adherence to Cells

Experimental Procedures

Conclusion

Chapter 3: Transcriptional Profile of Subtelomeric GPI-CWPs

Sir2 Deletion

Experimental Procedures

Conclusion

Chapter 4: Ligand Specificity of Subtelomeric Adhesins

Glycan arrays

Multiple sequence alignment analyses

Whole cell adherence to arrays

Epa12 specificty and inhibition

Experimental Procedures

Conclusion

Chapter 5: Deletion of all major Epas

Adherence to cells

Murine Infection Model

Experimental Procedures

Conclusion

Section 2, Chapter 6: External alkalinization of C. glabrata

Background and significance

Candida glabrata alkalinizes in response to amino acids as a sole carbon source

Mutants in putative alkalinization pathways

Results

Conclusion and Future Directions

vii

List of Figures

Fig 1: The C. glabrata cell wall…………………………………………………………….page 3

Fig 2: Diagram of ALS gene structure…………………………………………….…….page 11

Fig 3: Structure of GPI-CWP Expression constructs……………………..……...page 32

Fig 4: Expression of GPI-CWP Fusion constructs…………………………...…...page 41

Fig 5: Adherence to cell lines………………………………………………………………page 43

Fig 6: Summary of Strongest Adhesins…………………………………………….…page 55

Fig 7: Pwp family binding to various cell lines………………………………….…page 56

Fig 8: Location of EPA genes in the C. glabrata genome……………….……page 66

Fig 9: Subtelomeric transcript abundance as a function of

distance to first telomeric repeat in a Sir2Δ strain…………...……page 70

Fig 10: Multiple sequence alignments of Epa proteins……………………….page 84

Fig 11: Glycan Arrays for whole yeast hybridization of Epa1, Epa6,

Epa7, Epa12, Epa15, Epa16, Epa23, Epa24, Epa25,

and Epa26…………………………………………………………………………..…page 86

Fig 12: Inhibition of Epa12 binding to bone marrow-derived

macrophages by sulfated GAGs…………………………………….………page 108

Fig 13: Adherence of Epa deletion mutants to Lec2 cells………….………..page 124

Fig 14: Adherence of Epa deletion mutants to various cell types………..page 126

Fig 15: Organ colonization of C. glabrata infected BALB/c mice by

Epa deletion strains……………………………………………………………….page 131

Fig 16: Putative ammonia-production and extrusion pathways

in C. glabrata………………………………………………………………………..page 147

Fig 17: Optical density and pH changes in response to

viii

different carbon sources………………………………………………………page 154

Fig 18: Growth of C. glabrata WT and permease mutant strains in

the presence of canavanine…………………………………………………page 156

Fig 19: External alkalinization by deletion mutants in response to

growth with amino acids……………………………………………………..page 158

Fig 20: Organ colonization of C. glabrata infected BALB/c mice

by a quadruple amino acid permease deletion strain………….page 161

List of Tables

Table 1: Heterologous expression srains……………………………………..……page 34

Table 2: Primer table for heterologous expression strains…………..…..page 36

Table 3: Subtelomeric GPI-CWP qRT-PCR primers……………………..….….page 67

Table 4: Percent change in transcript abundance of subtelomeric

GPI-CWPs in a Sir2Δ strain………………………………………….…………page 71

Table 5: Glycan Array hits for Epa1, Epa6, Epa7, Epa12, Epa 15,

Epa16, Epa 23, Epa24, Epa25 and Epa26………………………………..page 92

Table 6: EPA deletion strains constructed…………………………………………..page 119

Table 7: Primers used to create EPA deletion strains………………………….page 121

Table 8: C. glabrata and alkalinization mutant strains………………………..page 151

SECTION I: Adhesins encoded by Candida glabrata

Section I Chapter 1: Background & Significance

Candida glabrata is one of the most prevalent emergent fungal pathogens causative to oral, urogenital, and invasive candidiasis in humans (Miceli et al, 2011). Candida species are known to form biofilms, transition from one morphological state to another, and adhere to a variety of surfaces – traits proven to be influential in the infection process. Macromolecules involved in the latter process are located in the outermost compartment of the yeast, the cell wall, where they can interact with ligands on abiotic surfaces, host cells, or to other yeast.

The cell wall is comprised of β1-3 glucan cross-linked to chitin, the complex of which is bound to other polysaccharides. This part of the cell wall is bound closer to the plasma membrane, forming an alkali-insoluble layer (Latge and Beauvais, 2014). Amorphous polysaccharides are bound closer to the outer face, and these comprise an alkali-soluble portion of the cell wall (Latge and Beauvais, 2014). The distribution of specific linkages in the two layers varies from pathogen to pathogen – for example, Aspergillus fumigatus contains galactomannans and β1-3 and β1-4 glucans bound to the glucan-chitin complex in the base layer, while Candida albicans primarily contains β1-6 glucans

(Latge, 2010).

Previous research has shown that environmental cues lead to modifications in cell wall structure. For example, glucose limitation results in the downregulation of β1-3 glucan synthase activity in A. fumigatus, resulting in a low concentration of β1-3 glucan in the cell wall. This is correlated with increased resistance to certain antifungal drugs (Latge and Beauvais, 2014). While broad changes in cell wall structure have been studied extensively, characterization of the mannoprotein content in the outer layer of the cell wall remains a largely pathogen-specific enterprise.

Figure 1: The C. glabrata cell wall. The polysaccharide cell wall is a distinct compartment of C. glabrata. It is comprised of two distinct layers - the base layer contains structural linkages, while the outermost layer is highly amorphous. The latter contains mannoproteins covalently cross-linked to cell wall components, many of which are known virulence factors.

Unlike members of the CTG clade, C. glabrata is phylogenetically distantly related to fungal pathogens classified under the same genus, and is also more morphologically similar to its avirulent cousin, Saccharomyces cerevisiae. While these two organisms are closely related, cell wall architecture seems to differ in noteworthy ways. C. glabrata cell walls contain 50% more mannoprotein than baker’s yeast, and include an exceptionally large number of GPI anchored proteins (deGroot et al, 2008). These are covalently linked through β1-6 and β1-3 glucans in the cell wall. It is intriguing to postulate that the differential mannoprotein content could account for virulence factors present in C glabrata but not in S. cerevisiae.

It is known that the pathogen expresses a number of cell wall compartmentalized, GPI- linked adhesins implicated in adherence to epithelial and endothelial cells (Cormack et al, 1999; Frieman et al, 2002; Domergue et al, 2005; Kaur et al, 2007, Desai et al, 2011).

Previous work has shown that a family of these adhesins, Epas (Epithelial adhesins), play a major role in virulence of this pathogen. However, the full complement of genes encoding EPA family members was previously undefined.

Adhesin Structure and Function

Canonical adhesins are often those found at cell junctions, responsible for maintaining confluent layers of cells that comprise living tissue. Adhesins can interact with themselves on the same cell, with cognate molecules on other cells, or with completely disparate ligands present cis and trans. The most prevalent adhesins are cadherins, which have been implicated in cell migration, differentiation, proliferation, and disease pathogenesis (Beavon, 2000). These encompass a family of transmembrane glycoproteins expressed in a variety of cell types, each with different tissue specificities.

E-cadherin, widely conserved across species and known to be expressed in epithelial

4 cells, is understood to harbor five tandemly repeated extracellular domains, alphanumerically denoted EC1-EC5 (Beavon, 2000). N-cadherin, initially characterized in neuronal cell development but also expressed in endothelial cells, is structured similarly (Langer et al, 2012). The most distal subdomain, EC1, is responsible for binding to other cadherin molecules. All five domains are known to be vital for cadherin adhesive properties, and each EC domain contains two conserved calcium binding sites.

The cadherin molecules can be involved in cis interactions on the cell membrane or trans binding interactions with apposing cells (Beavon, 2000). Hypo- or hyper- glycosylation patterns on specific EC domains have been linked to alteration of binding patterns in the progression of different types of tumors (Langer et al, 2012). Once bound, α, β, and/or γ-catenin molecules interact with cytoplasmic domains of the cadherins to modulate actin interactions and cytoskeletal remodeling. Downstream effects of this interaction include cell proliferation or internalization of cadherin-bound cells (Beavon, 2000).

Interestingly, adhesins expressed by a variety of human pathogens have been found to hijack the cadherin-catenin system. Fusobacterium nucleatum is an opportunistic, gram- negative commensal anaerobe overrepresented in colorectal carcinoma, known to invade epithelial and endothelial cells. Recent research has shown that F. nucleatum utilizes an adhesin, FadA, to modulate E-cadherin/β-catenin signaling in colorectal cancer cells. This modulation leads to tumor proliferation, as shown through host and pathogen-side deletions (Rubinstein et al, 2013). N-cadherin interactions with fungal pathogens have also been implicated in virulence. C. albicans hyphae have been found to interact with N-cadherin, causing endocytosis by endothelial cells (Phan et al, 2005).

This is mediated by a specific adhesin, Als3p, which is described in a subsequent section (Phan et al, 2007).

Many structurally distinct classes of bacterial adhesins exist, often encoded on pathogenicity islands present in bacterial genomes and expressed as cell-surface proteins. Fimbriae, also termed pili, remain the largest class of well-characterized bacterial adhesins (Jaglic et al, 2014). Type I fimbriae are assembled from subunits as long hollow extensions with terminal, adherent peptides. These can be involved in adherence to abiotic surfaces, plant cells, and other cell types. Subunits are encoded by the fim gene cluster, with fimA encoding a 17 kDa structural unit and fimH encoding adhesive subunits (Ledeboer et al, 2006). SEF17, also known as TafI (Thin Aggressive

Fimbriae I) in Salmonella enterica are involved in cell-cell interaction, aggregation, and biofilm formation. SEF14 fimbriae in Salmonella enteritidis has been shown to modulate adherence to murine epithelial cells, while Lpf (Long Polar Fimbriae) expression in

Salmonella species confer adherence to murine intestinal cells (Jaglic et al, 2014).

Of bacterial pathogens, gram positive species are likely more similar in outer wall architecture to fungal pathogens than gram negative species. Listeria monocytogenes is a gram positive, opportunistic human pathogen that can cause gastroenteritis in immunocompetent individuals and systemic disease in immunocompromised individuals

(Niemann et al, 2004; Jaglic et al, 2014). This pathogen encodes a large repertoire of surface expressed adhesins, most notably a family of proteins termed invasins. These are known to interact with E-cadherin and other ligands present on a variety of host cell types. The canonical LPXTG motif in the C terminal domain of some invasins is required for covalent linkage to the cell wall. N terminal effector domains contain tandem repeats of a leucine and isoleuce rich region, or LRR. Polymorphisms in this region are known to mediate binding to specific subsets of ligands (Niemann et al, 2004).

Adhesins in fungal pathogens are remarkably similar in that most follow a three domain structure – an N-terminal functional domain expressed above the cell surface that

6 contains a protein-ligand binding region, a large central domain comprised of highly glycosylated serine and/or threonine repeats that serve to push the functional domain above the cell wall, and a C terminal domain containing a GPI anchor site (Verstrepen et al, 2006). Calcium is a known cofactor for many of these adhesins, and C-type lectins form a large subcategory within this class.

Each fungal pathogen can employ several strategies to optimize adherence mediated by these adhesins. Major adhesin families often encode several proteins within each species, and different strains within a species can encode different subsets of adhesins.

For diploid species, allelic variation has also been shown to play a major role in the adherence profile for individual strains (Hoyer et al, 2008).

C. albicans adhesins

A well-defined adhesin class in one of the most prevalent fungal pathogens is the agglutinin-like sequence (ALS) family found in C. albicans, and more recently found to be encoded by Candida dubliniensis, Candida tropicalis, and Candida parapsilosis as well (Hoyer, 2001). This adhesin family includes at least 8 genes, each encoding very large glycoproteins at least 1000 amino acids in length (deGroot et al, 2013). Earlier studies on this family estimate different counts of family members, obfuscated by the presence of multiple alleles in the diploid organism and by misassembled genomic sequence. The previously described ALS8 gene was recently redefined as an allele of

ALS3, and ALS10, ALS11, and ALS12 were hybrid assemblies of previously defined

ALS genes (Hoyer et al, 2008). ALS genes have the three domain structure characteristic of fungal adhesins, with very large 5’ functional regions about 1300 base pairs in length. These can share 55-90% nucleic acid identity (Hoyer, 2001). ALS1,

ALS5, and ALS3/8 share 85% identity in the 5’ domain, while ALS7 is most unique in this

7 region, sharing only 55-60% identity with other ALS genes. This region includes immunoglobulin-like domains important for interaction with host cell ligands (de Groot,

2013).

The central region of each ALS gene is characterized by tandem repeats, with variable numbers of a 108 base pair motif. Central tandem repeat regions are used to further classify the ALS genes into subcategories. ALS1-4 central regions cross hybridize with

ALS1 central region sequence, while ALS5-7 cross hybridize with ALS5. ALS9 has a distinctive tandem repeat unmatched by another ALS (Hoyer, 2001). These regions are known to be important in facilitating aggregation and interacting with hydrophobic surfaces (deGroot, 2013).

3’ domains are more variable in length and sequence, but all encode serine/threonine rich regions. While this region is more variable, pairs of ALS genes show high conservation. For example, ALS2 and ALS4 3’ regions are >95% identical, while ALS5 and ALS9 are 93% identical. Uniquely, ALS7 encodes a 137-147 amino acid motif tandemly repeated in this domain, which includes a nested five amino acid repeat – Val-

Ala-Ser-Glu-Ser, abbreviated VASES (Hoyer, 2001).

ALS1, ALS2, ALS4, ALS5, and ALS9 are encoded on chromosome 6. ALS6 and ALS7 are encoded on chromosome 3, while ALS3 and ALS8 are encoded on chromosome R

(Hoyer et al, 2001). Genomic location for these genes has not yet been implicated in the regulation of these adhesins, but it is known that ALS2 and ALS4 are located within the terminal 100 kilobases of chromosome 6, with the remaining ALS genes encoded on that chromosome within 250 kilobases. It was noted that sequence assemblies for ALS2 and ALS4 were exceptionally problematic, attributed to high sequence similarity in long tandem repeat regions and nearly identical 3’ regions (Hoyer et al, 2008). ALS6 and

ALS7 are located within the terminal 400 kilobases of chromosome 3, while ALS3/8 is located centromerically on chromosome R (www.candidagenome.org).

It is known that expression of these genes is regulated by external nutrient status, morphological form, and growth stage. In C. albicans, a small number of ALS genes are concurrently expressed in vitro. Interestingly, in C. dubliniensis, ALS transcripts seem to be expressed constitutively, suggesting alternative methods of regulation in these two species. ALS gene variability can also influence functionality and consequently, pathogenicity. For example, the size of ALS1 has been shown to vary between strains or even within the same strain due to differences in the number of tandem repeat copies present in the central domain. Longer repetitive domains could push functional domains further away from the cell wall, and influence ligand sampling. Sequence polymorphisms have also been shown to exist in ALS5, which could also impact ligand binding (Hoyer, 2001).

In vitro and in vivo studies have showed that ALS proteins are linked to β1-6 glucan in the cell wall, and are heavily N – and O-glycosylated in the serine/threonine rich regions

(Hoyer, 2001).

Functionally, the N terminal domains have been shown to be important in C. albicans’ adhesive properties. Als1p, Als2p, Als3p, Als4p, and Als9p have been shown via deletion studies to be important in binding to endothelial cells, while Als1p and Als3p are also important for binding to epithelial cells (deGroot et al, 2013). Interestingly, deletion mutants of Als5p, Als6p, and Als7p were hyperadherent to epithelial and endothelial cells. It is tempting to speculate that compensation, functional redundancy, and/or reciprocal expression of other Als family members may be responsible for these phenotypes. This is strongly evidenced by transcriptional data showing tandem

9 increases and decreases of ALS family subsets in response to specific extracellular cues

(Hoyer et al, 2008). Als1p, Als3p, Als5p, and Als9p were found to bind to ECM components like fibronectin, laminin, and collagen. All ALS family members were found to contribute to binding to abiotic surfaces like glass and plastics (deGroot et al, 2013).

C. albicans encodes another noteworthy class of adhesins – hyphal wall proteins, or

Hwps. As indicated by their name, these are cell wall mannoproteins expressed only during germ tube and hyphal stages (Staab et al, 1999; de Groot et al 2013). These morphologic forms are known virulence factors employed by C. albicans, and it was observed that colonization of buccal epithelial cells by these forms was covalent and irreversible. Hwp1p was found to be a substrate for host cell-expressed transglutaminase. The enzyme catalyzes a covalent attachment between the glutamine- rich amine terminal domain of Hwp1p and a substrate on host buccal epithelia (Staab et al, 1999). ECM proteins bound to epithelial cells were identified as apposing substrates in the transglutamination reaction with Hwp1p (Ponniah et al, 2007, de Groot et al,

2013).

Eap1p has been characterized as a member of the Hwp family by presence of a conserved 42 amino acid domain in the putative effector region. This domain has been linked to amyloid-forming patches, and is thought to be involved in adhesin oligomerization (de Groot et al, 2013). Different domains of Eap1p are involved in yeast cell-cell adherence, invasive growth on agar, epithelial cell adherence, and adherence to polystyrene (Li and Palecek, 2008). Remarkably, both Eap1p and Hwp1p have been implicated in binding to Streptococcus gordonii, a bacterium known to colonize the oral cavity (Nobbs et al, 2010; de Groot et al, 2013).

Fig 2: Diagram of ALS gene structure. 5’ functional regions are colored in green, tandem repeat regions are colored in pink, and 3’ regions are colored in blue. All regions are drawn approximately to scale. Similar textures indicate high levels of sequence identity. Nearly all 5’ regions are similar in length, ranging from 1299-1308 bp

(Hoyer, 2001). The most commonly found length of tandem repeats is depicted, with ranges found in allelic variants indicated in brackets where known. VASES=Val-Ala-Ser-

Glu-Ser repeats found in the 3’ region of ALS7. VB1 = variable block 1, VB2 = variable block 2. These are not found in all allelic variants. Modified figure from Hoyer et al,

2008.

S. cerevisiae adhesins

Since S. cerevisiae and C. glabrata are closely related from an evolutionary standpoint, examination of the adhesin complement in the non-pathogenic S. cerevisiae could provide some important reductionist clues regarding adhesin virulence factors encoded by C. glabrata. The largest adhesin class in S. cerevisiae is the FLO family of genes.

Family members were identified in the industrial fermentation process as important for cell-cell adhesion – these are instrumental for yeasts to form visible “flocs” composed of thousands of cells. Yeast flocs sediment to the bottom of fermentation vats in lager strains, or float to the surface in ale strains, making it easy to separate yeast from fermentation products (Verstrepen et al, 2006). Five FLO genes exist in S. cerevisiae –

FLO1, FLO5, FLO9, FLO10, and FLO11. The first four genes encode proteins important for cell-cell adhesion, or flocculation. Sequences for these genes are quite similar. The last is known to be important for binding to other substrates.

While not formally included amongst the FLO family of genes, two other genes were identified with the same domain structure as FLO11. FIG2 and AGA1 are known to encode proteins involved with mating type switching, but were found to function in a similar capacity as adhesins in this event (Guo et al, 2000),. Fig2p is involved in cell-cell interaction and is hypothesized to function in sterically ensuring mating between a single pair of MATa and MATα cells (Jue et al, 2002). Aga1p is covalently linked to soluble

Aga2p peptides on the surface of MATa cells. This complex interacts with Sag1p on

MATα cells in order to facilitate adherence (Guo et al, 2000).

C. glabrata adhesins

The first member of the major adhesin family in C. glabrata was described in 1999 with the discovery of EPA1, identified through a forward genetic screen using adherence to

12 an epithelial human laryngeal carcinoma cell line as a read-out (Cormack et al, 1999).

The same study identified Ca2+ as a required cofactor for adherence, and that this adhesin acts as a lectin. N-acetyllactosamine or N-acetyllactosamine-containing glycoconjugates were determined as ligands via binding inhibition assays (Cormack et al, 1999). Two in vivo murine infection models were tested – vaginal and gastrointestinal. In both, an EPA1Δ strain showed no difference in colonization.

However, in vitro experiments showed Epa1p was responsible for 95% of adherence to cells. This suggested to the investigators that similar to ALS profiles in C. albicans, functional redundancy likely existed in C. glabrata, and that other EPA genes might be encoded by the glabrata genome (Cormack et al, 1999).

Subsequent studies identified more family members. Discovery of an additional four

EPA genes, consecutively numbered, also revealed a striking phenomenon that would provide important clues regarding regulation of family members (de Las Penas et al,

2003). These EPA genes were located in clusters in subtelomeres, with EPA1, EPA2, and EPA3 located in a 24 kb cluster approximately 6 kb from one telomere, and EPA4 and EPA5 encoded as a near perfect inverted repeat approximately 4 kb from another telomere (de Las Penas et al, 2003). Genes were discovered by homology to EPA1, and gene proximity to EPA1 in the first cluster was discovered by chromosome walking from the EPA1 locus. Location of these genes in subtelomeres was noteworthy as they are subject to subtelomeric silencing mediated by the Sir family of proteins (described in the subsequent section). Consistent with this hypothesis, transcripts for these genes were undetectable during logarithmic phase growth in vitro (de Las Penas et al, 2003).

Functionally, deletion of either cluster had a modest 3-5 fold effect on kidney colonization in a murine infection model. Colonization of spleens and livers were unaffected when compared to a wild-type strain (de Las Penas, 2003).

Genome sequencing of the C. glabrata clinical isolate CBS138 was finished in 2004 by the Genolevures Consortium (Dujon et al, 2004). This facilitated discovery of 10 additional EPA1-like sequences, although whether these sequences encoded full length

GPI-CWPs was not yet determined (Castano et al, 2005). It is important to note that while assembly of the type strain was finished, the genome was annotated from subtelomere to subtelomere, with incomplete sequence at the ends of each chromosome.

Two of the ten additional EPA sequences encoded proteins that were characterized in simultaneous papers as major functional adhesins (Castano et al, 2005, Iraqui et al,

2005). EPA6 and EPA7 genes were identified in a screen for functionally redundant adhesins in an EPA1Δ background, using LEC2, T-24, and A-498 host cell lines

(Castano et al, 2005). Both genes were found to be subject to subtelomeric silencing, consistent with experiments performed on previously characterized EPA genes. These same Epa proteins were implicated in a major paper identifying a key induction signal for subtelomerically-repressed genes as essential for C. glabrata adherence in a murine model for urinary tract infection (Domergue et al, 2005). Epa6p was also identified as the major adhesin involved in C. glabrata biofilm formation via an independent screen

(Iraqui et al, 2005).

Analysis of the genome sequence of another C. glabrata isolate, BG2, led to the delineation of a total of 23 EPA or EPA-like genes, 17 of which were also in the type strain (Kaur et al, 2005). These were identified by amino acid sequence homology of N- terminal ligand binding domains. To date, this was the known complement of EPA genes encoded by the C. glabrata genome.

Although progress in defining putative members of the EPA family was made, identification of substrates for these adhesins remained relatively unknown since the initial characterization of Epa1p in the late 1990’s. A methodical study using new glycan array technology uncovered key insights, exploring differences between Epa1p, Epa6p, and Epa7p binding to different glycan moieties (Zupancic et al, 2008). Since the large number of EPA family members renders a deletion model tricky to utilize, the investigators opted to exploit the relatively non-adherent S. cerevisiae in a heterelogous expression model. Each Epa was expressed as a fusion protein, with N-terminal functional domains fused to an HA tag, followed by the C-terminal domain for Cwp2p, a cell wall protein robustly cross-linked to the cell wall in S. cerevisiae. Using labeled whole yeast binding to an array covalently printed with over 250 different glycans, the two terminal residues in glycan structures were found to be binding determinants. All three Epa proteins bound to terminal galactose residues, but the identity and type of linkage to the penultimate residue differed. Epa6p had the broadest specificity and adhered to galactose bound in α or β1-3 and β1-4 glycosidic linkages with glucose, galactose, or N-acetylated derivatives of the two. Epa1p and Epa7p exclude α-linked moieties, with Epa7p preferentially binding Gal β1-4-Glc (lactose), Gal β1-3-Gal, and N- acetylated derivatives thereof (Zupancic et al, 2008).

The differences in Epa6p and Epa7p specificities were striking, as they are highly related proteins, sharing 92% amino acid identity. Using domain swapping and sugar inhibition experiments, the investigators were able to determine two hypervariable regions responsible for mediating specificities. Interestingly, both hypervariable regions fell into a known motif, PA14 (Zupancic et al, 2008). Part of the anthrax toxin protective antigen, this motif is found to mediate sugar binding in a range of eukaryotic and bacterial proteins,a variant of which is contained in Flo proteins of S. cerevisiae (Rigden et al,

2004). Upon sequence comparison with other Epa family members, PA14 was found in the majority (Zupancic et al, 2008).

Since this study, the crystal structure for Epa1p has been solved in complex with different carbohydrate ligands (Maestre-Reyna et al, 2012). Epa1p specificity was fine tuned, showing primary binding to Gal β1-3 linkages at nonreducing ends. Binding is mediated by five loops, CBL1, CBL2, L1, L2, and L3. CBL1 and 2 are important for calcium binding and ligand recognition, the latter of which is found in one of the formerly defined hypervariable regions included in the PA14 domain. Residues 226-229 in CBL2 form direct interactions with glycans, and are largely responsible for substrate promiscuity of specific Epa proteins. L1, L2, and L3 are outer loops that control solvent accessibility to CBL1 and CBL2 (Maestre-Reyna et al, 2012).

Both studies support binding of Epa proteins to T antigen, whose terminal disaccharide structure is Gal β1-3 GalNAc. This is of particular interest as T antigen is present on mammalian cells, at particularly high concentrations on colorectal cells. Epa protein- mediated binding could be responsible for the commensal population’s colonization of the native host niche. In corollary experiments to structural results, it was found that

Epa1p and Epa6p mediated binding to an epithelial, human colorectal adenocarcinoma cell line, CACO-2 (Maestre-Reyna et al, 2012).

While the EPA gene family includes the most members and has been found to include the most virulence factors, it is important to note that other adhesins have been identified in the C. glabrata genome. The PA14 domain-containing wall protein, or PWP, class of genes includes 7 members encoded by C. glabrata. Several members of this family were initially identified in an in silico screen for GPI-linked cell wall proteins as a member of a large class of putative adhesive proteins (Weig et al, 2004). These were later

16 defined as a distinct class based on homology of N terminal, predicted effector domains

(de Groot et al, 2008). Functionally, gene deletion of PWP7 reduces the ability of C. glabrata to adhere to human umbilical vein endothelial cells (Desai et al, 2011). Other family members have yet to be characterized.

Adhesin-like wall proteins, or Awp proteins, form another group of adhesins although they share little homology. Four family members were initially identified in a tandem mass spectrometry experiment using peptide fragments obtained directly from the cell wall (de Groot et al, 2008). Since then, this class has been expanded to include an additional three members (Kraneveld et al, 2011). Sequence analysis showed subsets of these proteins belonged to distinct subgroups, with Awp1p and Awp3p included in one subfamily, and Awp2p and Awp4p in another subfamily, both of which contain additional members (de Groot et al, 2008; de Groot et al, 2013). Like PWP7, gene deletion of

AWP5, also known as AED1, has been shown to reduce adherence to human umbilical vein endothelial cells (Desai et al, 2011). Awp2p, Awp4p, Awp5p, and Awp6p have been identified in tandem mass spectrometry experiments investigating proteins expressed in biofilms. Awp7p may also be implicated in biofilm formation, although it is not yet clear as the peptides identified were not unique to the protein (Kraneveld et al,

2011).

Subtelomeres in Other Microorganisms

There exists little consensus in the scientific community regarding what constitutes a subtelomere. Reasons for this include subtelomeric mosaicism that is virtually ubiquitous across genera and species. Nearly all eukaryotes harbor tandem and/or dispersed repeats near chromosome ends, and these regions tend to be highly polymorphic even within a species. There also exists a lack of complete sequence in

17 this area for many eukaryotic microorganisms, even amongst species whose genome sequences are considered “finished.” Nevertheless, it has been observed that subtelomeres are composed of two basic sections – DNA nearest to telomeric repeats tends to include sequence shared by many chromosome ends within the organism, and can contain long stretches of repetitive DNA. Areas just centromeric to this sequence can include repetitive DNA as well, but harbor sequence less well shared amongst the ends (Farman, 2007).

Even without a global, formal definition for a subtelomere, several gene families in successful pathogens are encoded in loci understood to be subtelomeric. For these, gene location is often intimately associated with regulation, expression, or antigenicity- related gene expansion. The var, rif, and stevor genes encoded by the malaria parasite

Plasmodium falciparum are well characterized examples (Barry et al, 2003; Smith et al,

2013). Proteins encoded by these genes are known to evoke an adaptive immune response in an infected host, evidenced by antibodies obtained in serum from infected individuals. Approximately 60 different var genes are found in the P. falciparum genome, with at least one var gene in the subtelomere of each chromosome. Genes are organized in a two exon format, with the 5’ exon encoding polymorphic extracellular peptide stretches (Smith et al, 2013). Each gene encodes a unique version of P. falciparum erythrocyte protein 1, or PfEMP-1, which mediates adhesion to a variety of host cell types. Expression is controlled by monoallelic selection, in which a single var gene is activated at a given point in time (Guizetti and Scherf, 2013). Monoallelic selection occurs partly via an epigenetic mechanism, whereby Sir2, a histone deacetylase known to be important in subtelomeric silencing and described in detail in the subsequent section, mediates repression of the remaining var genes (Guizetti and

Scherf, 2013). Antigenic variation mediated by switching between var genes is a known

18 immune evasion tactic. Repetitive interspersed family (rif) and subtelomeric variant open reading frame (stevor) genes in P. falciparum are also encoded in subtelomeres, and while monoallelic expression does not seem to apply to these families, subsets of both are known to be transcribed with var genes in distinct stages of the infective cycle

(Jemmelly et al, 2010). RIF proteins are known to function during rosetting, in which an infected erythrocyte binds to an uninfected erythrocyte. STEVOR proteins are known cytoadhesins (Jemmelly et al, 2010).

Trypanosoma brucei is a parasite that causes African sleeping sickness, a disease spread by the tsetse fly. This pathogen encodes over 1600 variant surface glycoprotein, or VSG, genes, by far the largest set of contingency genes identified in a pathogen

(Barry et al, 2003; Morrison et al, 2009). These glycoproteins form a coat around the organism, and function to shield other nonvariant immunogens from host immune recognition. As in monoallelic expression, only a single VSG expression site is active at a given time, transcribing an antigenically unique VSG. These functional expression sites are found adjacent to telomeres, with silenced VSG gene arrays found at other subtelomeres. Interestingly, T. brucei also employs aneuploidy in the form of approximately 100 copies of mostly inert minichromosomes – these harbor VSGs at their subtelomeres as well. Since gene conversion via recombination has been established as a switching mechanism, it is thought that this pool of VSG genes has allowed a recombination based expansion of the VSG repertoire during the pathogen’s evolution

(Morrison et al, 2009).

The fungal parasite Pneumocystis carinii is an opportunistic pathogen causing pneumonia in rats, closely related to Pneumocystis jirovecii – the causative agent in humans. The pathogen encodes about 80 disparate major surface glycoproteins, or

Msgs, which are found as clusters at the ends of chromosomes (Barry et al, 2003; Keely

19 and Stringer, 2009). As in T. brucei, only a single, telomere-proximal expression site is active at a given point in time. This site contains two conserved sequences – an upstream conserved sequence (UCS) followed by a conserved recombination junction element (CRJE). It is thought that the CRJE functions as a recombinational target, facilitating switching from one MSG gene to another (Keely and Stringer, 2009).

Subtelomeres in Candida glabrata

To date, there are no published studies delineating or analyzing subtelomeric DNA in C. glabrata. However, several studies have explored subtelomeric silencing within the pathogen, and concluded this region plays host to more than a few virulence factors.

Akin to S. cerevisiae, C. glabrata employs an epigenetic silencing mechanism at its subtelomeres. In S. cerevisiae, Rap1p binds to consensus telomeric repeat sites to initiate silencing (Rusche et al, 2003). The Rap1p complex recruits silent information regulator, or Sir, proteins whose oligomerization continues towards the centromere.

Sir2p is a known histone deacetylase and is responsible for deacetylation of the N termini of histones 3 and 4, allowing Sir3p and Sir4p to bind. The complex of Rap and

Sir proteins is thought to form a compact structure inhibitive to transcription. This method is also responsible for silencing at mating type loci and at rDNA arrays (Rusche et al, 2003). Rap1p is known to interact with two additional proteins, Rif interacting factors 1 and 2, or Rif1p and Rif2p. These are responsible for maintaining telomere length – deletion strains of these proteins in S. cerevisiae were shown to increase length of telomeres and derepress subtelomeric genes (Rusche et al, 2003).

SIR3 and RIF1 genes were identified in a C. glabrata screen for hyperadherent mutants

(de Las Penas et al, 2003; Castano et al, 2005). Sir3Δ and rap1Δ strains were found to transcriptionally derepress the normally silent EPA2-5 genes (de Las Penas et al, 2003),

20 while sir3Δ and rif1Δ were found to derepress EPA6 and EPA7 (Castano et al, 2005).

The first set of EPA genes was determined to be encoded in subtelomeric clusters, with

EPA1, EPA2, and EPA3 encoded as adjacent ORFs on the right arm of chromosome E.

EPA4 and 5 are encoded as nearly perfect inverted ORFs on chromosome I. To show that subtelomeric silencing was important in transcriptional regulation, the investigators used a URA3 reporter system in which the URA3 locus was placed intergenically at various distances from the first telomeric repeat. Silencing of the locus was determined by growth on the counterselective medium 5-FOA. Growth in a wild type background was dependent on the distance of URA3 from the first telomeric repeat – while there was little to no growth in silencing factor deletion strains (de Las Penas et al, 2003).

Telomeres in a rif1Δ mutant were found to be longer than those found in a wild-type strain. The hyperadherent phenotype mediated by EPA6 and EPA7 found in this mutant was attributed to titration of silencing factors away from the subtelomere (Castano et al,

2005).

Conclusion

Like adhesins expressed across genera, Epa proteins are anchored into the outermost compartment of C. glabrata, the cell wall, where they can sample the microenvironment and interact with a multitude of putative ligands. All known fungal adhesins are GPI anchored CWPs, as are Epa proteins.

The remainder of this section of my thesis will focus on describing the complete complement of EPA genes encoded by the C. glabrata genome, determined by exhaustive sequencing of C. glabrata subtelomeres, bioinformatic adhesion prediction, and functional characterization. Chapter two will focus on the heterologous expression of specific C. glabrata wall proteins in S. cerevisiae, in order to determine sufficiency of

21 individually encoded proteins to mediate binding to cells. These experiments incorporate all putative GPI anchored CWPs encoded by C. glabrata subtelomeres, including many non-EPA ORFs. Chapter three will analyze the dependence of expression of these ORFs in a background compromised for subtelomeric silencing.

Chapter four will delineate ligand specificity as determined by binding to glycan arrays for the adherent subset of subtelomeric ORFs. Results from this and previous chapters will form the basis for an inhibition assay in the latter section of chapter four, to explore

Epa12p binding to macrophages. The final chapter in this section will explore phenotypic effects of combinatorial deletion of EPA genes, in vitro and in vivo.

References

Barry, J.D., Ginger, M.L., Burton, P., McCulloch, R. (2003) Why are parasite contingency

genes often associated with telomeres? Int J Parasitol 33:29-45. Review.

Beavon, I.R.G. (2000) The E-cadherin-catenin complex in tumour metastasis: structure,

function, and regulation. Eur J Cancer 36: 1607-20. Review.

Castano, I., Pan, S.J., Zupancic, M., Hennequin, C., Dujon, B., Cormack, B.P. (2005)

Telomere length control and transcriptional regulation of subtelomeric adhesins

in Candida glabrata. Mol Microbiol 55: 1246-58.

Cormack, B.P., Ghori, N., and Falkow, S. (1999) An adhesin of the yeast pathogen

Candida glabrata mediating adherence to human epithelial cells. Science 285:

578-582.

De Groot, P.W., Bader, O., de Boer, A.D., Weig, M., Chauhan, N. (2013) Adhesins in

human fungal pathogens: glue with plenty of stick. Eukaryot Cell 12: 470-81.

De Groot, P.W., Kraneveld, E.A., Yin, Q.Y., Dekker, H.L., Gross, U., Crielaard, W., de

Koster, C.G., Bader, O., Klis, F.M., Weig, M. (2008) The cell wall of the human

pathogen Candida glabrata: differential incorporation of novel adhesin-like wall

proteins. Eukaryot Cell 7:1951-1964.

De Las Penas, A., Pan, S.J., Castano, I., Alder, J., Cregg, R., and Cormack, B.P. (2003)

Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata

are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent

transcriptional silencing. Genes Dev 17: 2245-2258.

Desai, C., Mavrianos, J., Chauhan, N. (2011) Candida glabrata Pwp7p and Aed1p are

required for adherence to human endothelial cells. FEMS Yeast Res 11: 595-

601.

Domergue, R., Castano, I., De Las Penas, A., Zupancic, M., Lockatell, V., Hebel, J.R.,

Johnson, D., Cormack, B.P. (2005) Nicotinic acid limitation regulates silencing of

Candida adhesins during UTI. Science 308: 866-70.

Dujon, B., Sherman, D., Fischer, G., Durrens, P., Casaregola, S., Lafontaine, I., De

Montigny, J., Marck, C., Neuveglise, C., Talla, E., et al. (2004) Genome evolution

in yeasts. Nature 430: 35-44.

Farman, M.L. (2007) Telomeres in the rice blast fungus Magnaporthe oryzae: the world

of the end as we know it. FEMS Microbiol Lett 273: 125-32.

Frieman, M.B., McCaffery, J.M., Cormack, B.P. (2002) Modular domain structure in the

Candida glabrata adhesin Epa1p, a beta1,6 glucan-cross-linked cell wall protein.

Mol Microbiol 46: 479-92.

Guizetti, J., Scherf, A. (2013) Silence, activate, poise and switch! Mechanisms of

antigenic variation in Plasmodium falciparum. Cell Microbiol 15: 718-26.

Hoyer, L.L. (2001) The ALS gene family of Candida albicans. Trends Microbiol 9: 176-

80. Review.

Hoyer, L.L., Green, C.B., Oh, S.H., Zhao, X.M. (2008) Discovering the secrets of the

Candida albicans agglutinin-like sequence (ALS) gene family – a sticky pursuit.

Med Mycol 46: 1-15.

Iraqui, I., Garcia-Sanchez, S., Aubert, S., Dromer, F., Ghigo, J.M., d’Enfert, C., Janbon,

G. (2005) The Yak1p kinase controls expression of adhesins and biofilm

formation in Candida glabrata in a Sir4p-dependent pathway. Mol Microbiol 55:

1259-71.

Jaglic, Z., Desvaux, M., Weiss, A., Nesse, L.L., Meyer, R.L., Demnerova, K., Schmidt,

H., Giaouris, E., Sipailiene, A., Teixeira, P., Kacaniova, M., Riedel, C.U.,

Knochel, S. (2014) Surface adhesins and exopolymers of selected foodborne

pathogens. Microbiology 160: 2561-82.

Jemmelly, N.Y., Niang, M., Preiser, P.R. (2010) Small variant surface antigens and

Plasmodium evasion of immunity. Future Microbiol 5: 663-82.

Kaur, R., Domergue, R., Zupancic, M.L., Cormack, B.P. (2005) A yeast by any other

name: Candida glabrata and its interaction with the host. Curr Opin Microbiol 8:

378-84. Review.

Kaur, R., Ma, B., Cormack, B.P. (2007) A family of glycosylphosphatidylinositol-linked

aspartyl proteases is required for virulence of Candida glabrata. Proc Natl Acad

Sci 104: 7628-33.

Keely, S.P., Stringer, J.R. (2009) Complexity of the MSG gene family of Pneumocystis

carinii. BMC Genomics 10: 367-88.

Kraneveld, E.A., de Soet, J.J., Deng, D.M., Dekker, H.L., de Koster, C.G., Klis, F.M.,

Crielaard, W., de Groot, P.W. (2011) Identification and differential gene

Expression of adhesion-like wall proteins in Candida glabrata biofilms.

Mycopathologia 172: 415-27.

Langer, M.D., Guo, H., Shashikanth, N., Pierce, J.M., Leckband, D.E. (2012)

N-glycosylation alters cadherin-mediated intercellular binding kinetics. J Cell Sci

125: 2478-85.

Latge, J.P. (2010) Tasting the fungal cell wall. Cell Microbiol 12: 863-72.

Latge, J.P., Beauvais, A. (2014) Functional duality of the cell wall. Curr Opin Microbiol

10: 111-7.

Ledeboer, N.A., Frye, J.G., McClelland, M., Jones, B.D. (2006) Salmonella enteric

serovar Typhimurium requires the Lpf, Pef, and Tafi fimbriae for biofilm formation

on HEp-2 tissue culture cells and chicken intestinal epithelium. Infect Immun 74:

3156-3169.

Li, F., Palecek, S.P. (2008) Distinct domains of the Candida albicans adhesin Eap1p

mediate cell-cell and cell-substrate interactions. Microbiology 154: 1193-1203.

Maestre-Reyna, M., Diderrich, R., Veelders, M.S., Eulenburg, G., Kalugin, V., Bruckner,

S., Keller, P., Rupp, S., Mosch, H.U., Essen, L.O. (2012) Structural basis for

promiscuity and specificity during Candida glabrata invasion of host epithelia.

Proc Natl Acad Sci U S A 109: 16864-9.

Miceli, M.H., Diaz, J.A., Lee, S.A. (2011) Emerging opportunistic yeast infect. Lancet

Infect Dis 11: 142-151.

Morrison, L.J., Marcello, L., McCulloch, R. (2009) Antigenic variation in the African

Trypanosome: molecular mechanisms and phenotypic complexity. Cell Microbiol

11: 1724-34.

Niemann, H.H., Schubert, W.D., Heinz, D.W. (2004) Adhesins and invasins of

pathogenic bacteria: a structural view. Microbes Infect 6: 101-12. Review.

Nobbs, A.H., Vickerman, M.M., Jenkinson, H.F. (2010) Heterologous expression of

Candida albicans cell wall-associated adhesins in Saccharomyces cerevisiae

revelas differential specificites in adherence and biofilm formation and in binding

oral Streptococcus gordonii. Eukaryot Cell 9: 1622-34.

Phan, Q.T., Fratti, R.A., Prasadarao, N.V., Edwards, J.E. Jr., Filler, S.G. (2005)

N-cadherin mediates endocytosis of Candida albicans by endothelial cells. J Biol

Chem 280: 10455-61.

Phan, Q.T., Myers, C.L., Fu, Y., Sheppard, D.C., Yeaman, M.R., Welch, W.H., Ibrahim,

A.S., Edhwards, J.E.Jr., Filler, S.G. (2007) Als3 is a Candida albicans invasin

that binds to cadherins and induces endocytosis by host cells. PLoS Biol 5: e64.

Ponniah, G., Rollenhagen, C., Bahn, Y.S., Staab, J.F., Sundstrom, P. (2007) State of

differentiation defines buccal epithelial cell affinity for cross-linking to Candida

albicans Hwp1. J Oral Pathol Med 36: 456-67.

Rigden, D.J., Mello, L.V., Galperin, M.Y. (2004) The PA14 domain, a conserved all-β

domain in bacterial toxins, enzymes, adhesins, and signaling molecules. Trends

Biochem Sci 29: 335-339.

Rubinstein, M.R., Wang, X., Liu, W., Hao, Y., Cai, G., Han, Y.W. (2012) Fusobacterium

nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-

catenin signaling via its FadA adhesin. Cell Host Microbe 14: 195-206.

Rusche, L.N., Kirchmaier, A.L., Rine, J. (2003) The establishement, inheritance, and

function of silenced chromatin in Saccharomyces cerevisiae. Annu Rev Biochem

72: 481-516. Review.

Smith, J.D., Rowe, J.A., Higgins, M.K., Lavstsen, T. (2013) Malaria’s deadly grip:

Cytoadhesion of Plasmodium falciparum-infected erythroyctes. Cell Microbiol 15:

1976-83.

Staab, J., Bradway, S.D., Fidel, P.L., Sundstrom, P. (1999) Adhesive and mammalian

transglutaminase substrate properties of Candida albicans Hwp1. Science 283:

1535-38.

Verstrepen, K.J., Klis, F.M. (2006) Flocculation, adhesion, and biofilm formation in

Yeasts. Mol Microbiol 60: 5-15.

Weig, M., Jansch, L., Grob, U., de Koster, C.G., Klis, F.M., de Groot, P.W. (2004)

Systematic identification in silico of covalently bound cell wall proteins and

analysis of protein-polysaccharide linkages of the human pathogen Candida

glabrata. Microbiology 150: 3129-44.

Zupancic, M.L., Frieman, M., Smith, D., Alvarez, R.A., Cummings, R.D., Cormack, B.P.

(2008) Glycan microarray analysis of Candida glabrata adhesion ligand

specificity. Mol Microbiol 68: 547-59.

Section I Chapter 2: Heterologous expression of subtelomeric GPI-CWPs

Defining the complement of subtelomeric GPI-CWPs

Since it is already known that subtelomeres encode functionally relevant adhesins in C. glabrata, defining the full complement of adhesins encoded in the subtelomeres could lead to characterization of novel adhesins. This requires a definition for the centromeric boundary of each subtelomere, with the first telomeric repeat serving as the other. For the related yeast S. cerevisiae, the most precise definition available was made by Louis et al in 1995, when he defined the subtelomere as the most distal 25 kb of DNA not composed of telomeric repeats (Louis et al, 1995). To account for evolution of these regions in C. glabrata, and to make a generous definition that would include any subtelomere specific repeat regions and account for differential sizes of the chromosomes, we have defined the subtelomeres as the regions at chromosome ends proximal to telomeric repeats, yet telomeric to syntenic regions in ancestor. Since all fungal adhesins are known to be GPI anchored CWPs, analysis of subtelomeric sequence for secreted GPI anchored proteins would yield potential candidate adhesins.

The majority of EPAs are encoded in subtelomeric regions of the C. glabrata genome.

Previously published sequencing efforts have yielded incomplete data in these regions, as assembly of standard whole genome shotgun reads is complicated by repeat heavy regions characteristic of chromosome ends and by genomic instability resultant from highly similar ends. To circumvent this, we have systematically subcloned the subtelomeres from each of the thirteen chromosomes into 26 fosmids. These fosmids were randomly integrated with Tn7, and transposon-specific primers were utilized to create standard Sanger reads. These were assembled to produce sequence with high coverage and confidence. While both strains CBS and BG2 were used to create

30 separate assemblies, BG2 sequence was utilized for all subsequent experiments, as it is known to encode a larger complement of EPA genes.

Analysis of the collective subtelomeres showed the presence of 218 ORFs (open reading frames), bioinformatically defined as sequences containing an ATG start codon, one of the three canonical stops, and constituting greater than 100 amino acids in length. The 218 subtelomeric ORFs were subsequently filtered for sequences containing a secretory signal peptide at the N terminus, which would indicate extraplasmic expression of the region. The method uses a HMM (Hidden Markov

Model) to predict signal peptide sites based on canonical 8-12 hydrophobic residue tracts in the N terminal regions (http://www.cbs.dtu.dk/services/SignalP) (Emanuelsson et al, 2007). ORFs that were secretory signal positive were passed through additional analysis to determine the presence of an omega site, a C-terminal tract of hydrophobic amino acids signaling addition to a GPI (glycophosphatidylinositol) lipid anchor

(http://mendel.imp.ac.at/gpi/fungi_server.html). The method used is taxon specific, and already robustly assessed for several other fungal species (Eisenhaber at al, 2004). Of

218 ORFs existent in the subtelomeres, we have identified 51 that encode GPI-anchored proteins.. The borders of low complexity repeat regions within each ORF were assessed by using dotplot analysis on DNA sequence

(http://www.vivo.colostate.edu/molkit/dnadot). Functional domains of each of the 51

ORFs were defined as sequence from the start codon to the N terminal edge of the repeat regions, as determined by dotplot analysis.

The collection of putative GPI-CWPs includes the vast majority of EPA genes, including three newly identified (EPA 24, EPA25, and EPA26) and several for which the entire

ORF was previously unmapped. To be complete, all subsequent experiments include three centromerically-encoded Epa proteins (Epa8, Epa9, and Epa10). It is interesting

31 to note that this 51 ORF subset also includes AWP2, two homologues of AWP3, AWP5,

AWP6, AWP7, and PWP6. Awp5p and a different member of the Pwp class have been shown to mediate adherence to human umbilical vein endothelial cells (Desai et al,

2011).

Construction of expression vectors

Primers were designed to clone out the functional domains of each ORF with flanking attB recombination sequences for use in the Gateway recombination system (Invitrogen)

(Table 1, Table 2). Fragments were PCR amplified from BG2 genomic DNA and recombined with pDONR201 to create entry vectors in a BP reaction. These were then recombined in a LR reaction with previously made destination vectors, in which these functional domains were placed immediately 5’ to universal 3’ fusion domains.

Figure 3: Structure of GPI-CWP expression constructs. Each functional domain was cloned in frame upstream to an HA tag, a uniform Epa1 Ser/Thr rich domain, and Cwp2

C-terminal domain from S. cerevisiae. Modified from Zupancic et al, 2008.

In order to analyze the sufficiency of functional domains to mediate adherence, we expressed each singly in the relatively non-adherent S. cerevisiae. All 51 were cloned and heterologously expressed from the uniform expression plasmid background described above, containing a CEN/ARS sequence for replication in S. cerevisiae and a

URA3 auxotrophic marker to maintain positive selection. Functional domains were expressed as fusion constructs previously described (Zupancic, 2008), with effector domains fused to a hemagglutinin (HA) tag, a uniform serine/threonine rich region derived from Epa1 sequence, and a Cwp2 C-terminal domain to ensure efficient GPI- anchor addition in S. cerevisiae (Fig 3).

All constructs were expressed under the strong TEF promoter. These GPI-anchored fusion proteins were first examined for expression strength using a fluorescently tagged antibody against the cell wall exposed HA tag. Relative fluorescence units were assessed for each strain via flow cytometry, against an empty vector control strain. All constructs fluoresced at double to several thousand fold over the control strain, indicating robust expression (Fig 4).

Preliminary experiments using the Lec2 CHO-derived cell line indicated that, as predicted based on previous experiments, EPA family members functioned as adhesins.

In addition, the only subtelomeric PWP family member also seemed to function as a moderate adhesion (Fig 5a). We therefore chose to include the additional, centromerically-encoded members of both families. Specifically, these included EPA8,

EPA9, and EPA10, which are encoded on chromosomes A and C. PWP genes numbered 1-5 and 7 are encoded as two distinct clusters on chromosome I.

Table 1: Heterologous expression strains. S. cerevisiae strains singly express the functional domains of the GPI-CWP from BG2 listed under Accession Num. Where known, the identity of the gene is listed. Fosmids indicate which isolated subtelomere clone contains the ORF utilized. Expression and entry vectors are constructs built during Gateway cloning. S. cerevisiae strain BY4742 transformed with the corresponding expression vector results in strains listed at the far right. These strains are used in subsequent FACS and adherence assays. Grey shaded boxes indicate genes in BG2 located on different chromosomes than their orthologues in CBS.

Expression Entry Accession Num Gene Fosmid vector vector Strain CAGL0A00159g EPA19 B1907 pMZ199 pMZ191 SC119 CAGL0A00162g EPA24 B1907 pEH067 pEH057 SC608 CAGL0A01284g EPA10 centromeric pMZ90 pMZ88 SC58 CAGL0A01386g EPA9 centromeric pMZ72 pMZ30 SC39 CAGL0A04834g B2401 pEH065 pEH055 SC604 CAGL0B00159g B2142 pEH027 pEH001 SC591 CAGL0B05054g B2110 pEH028 pEH002 SC592 CAGL0C00110g EPA6 B1908 pMZ69 pMZ27 SC33 CAGL0C00209g AWP7 B1908 pEH061 pEH051 SC636 CAGL0C00269g B1908 pEH069 pEH059 SC612 CAGL0C00847g EPA8 centromeric pMZ198 pMZ190 SC118 CAGL0C05595g EPA25 B1909 pEH068 pEH058 SC610 CAGL0C05620 EPA26 B1909 pEH015 pEH003 SC580 unassigned B1932 pEH082 pEH074 SC624 CAGL0D00148g B1932 pEH022 pEH004 SC587 CAGL0D06715g EPA21 B1933 pMZ200 pMZ192 SC120 CAGL0C05643g EPA7 B2154 pMZ70 pMZ28 SC35 CAGL0E00187g B2154 pEH085 pEH077 SC630 CAGL0E00269g B2154 pEH083 pEH075 SC626 CAGL0E00275g EPA20 B2154 pMZ216 pMZ208 SC130 CAGL0E06600g BG2ER/B2184 pEH086 pEH078 SC632 CAGL0E06644g EPA1 BG2ER/B2184 pMZ77 pBC544 SC49 CAGL0E06666g EPA2 BG2ER/B2184 pMZ75 pMZ42 SC45 CAGL0E06688g EPA3 BG2ER/B2184 pMZ67 pMZ23 SC29 CAGL0F00170g EPA16 B2140 pEH023 pEH005 SC588 CAGL0F00181g B2140 pEH062 pEH052 SC600 CAGL0F09231g B1934 pEH016 pEH006 SC581

CAGL0E00181g B2405 pEH079 pEH071 SC618 CAGL0G10175g AWP6 B1935 pEH063 pEH053 SC602 CAGL0G10180g B1935 pEH017 pEH007 SC582 CAGL0H00214g B2109 pEH024 pEH008 SC589 CAGL0H10607 EPA17 B2080 pMZ71 pMZ29 SC37 CAGL0I00214g B2083 pEH018 pEH009 SC583 CAGL0I00220g EPA23 B2083 pMZ201 pMZ193 SC121 CAGL0I10992g EPA5 B2145 pMZ68 pMZ25 SC31 CAGL0I11000g EPA4 B2145 pMZ76 pMZ43 SC47 CAGL0I10995g B2141 pEH025 pEH010 SC616 CAGL0J11885g AWP3a B2183 pEH084 pEH076 SC628 CAGL0J11896g AWP3b B2183 pEH070 pEH060 SC614 CAGL0J11968g EPA15 B2183 pMZ295 pMZ212 SC229 CAGL0J11973g B2183 pEH026 pEH011 SC590 CAGL0K00110g AWP2 B2148 pEH019 pEH012 SC584 CAGL0K00170g EPA22 B2148 pMZ217 pMZ213 SC131 CAGL0K13002g B2152 pEH064 pEH054 SC634 CAGL0K13007g AWP5 B2152 pEH020 pEH013 SC585 CAGL0I10995g B2141 pEH080 pEH072 SC620 CAGL0L13311g EPA11 B2271 pMZ73 pMZ31 SC41 CAGL0L13333g EPA13 B2271 pMZ74 pMZ32 SC43 CAGL0L13426g EPA14 B2515 pMZ214 pMZ209 SC128 CAGL0F09234 B2159 pEH021 pEH014 SC586 CAGL0M00132g EPA12 B2159 pMZ78 pMZ44 SC51 CAGL0M14069g PWP6 B2270 pEH081 pEH073 SC622 CAGL0I10098g PWP7 centromeric pEH098 pEH092 SC697 CAGL0I10197g PWP1 centromeric pEH093 pEH087 SC687 CAGL0I10200g PWP3 centromeric pEH095 pEH089 SC691 CAGL0I10274g PWP2 centromeric pEH094 pEH088 SC689 CAGL0I10340g PWP5 centromeric pEH097 pEH091 SC695 CAGL0I10362g PWP4 centromeric pEH096 pEH090 SC693

Table 2: Primer Table for Heterologous Expression strains. Accession numbers are assigned as per deposition to the Genolevures Consortium. Primers include leading sequences with appropriate spacers and attB recombination sites required for subsequent Gateway cloning. Sense primers include the following leader sequence:

GGGGACAAGTTTGTACAAAAAAGCAGGCTAAAACC. Antisense primers include the following leader sequence: GGGGACCACTTTGTACAAGAAAGCTGGGTGT. Grey shaded boxes indicate genes in BG2 located on different chromosomes than their orthologues in CBS.

Accession Num Gene Sense primer Antisense primer GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0A00159g EPA19 AGGCTAAAACCATGAACTGGAAAA AGCTGGGTGTGGAGCCAGAT TATTATTGTTT GAATTAATATCTTG GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0A00162g EPA24 AGGCTAAAACCATGATTTATTTCAG AGCTGGGTGTTCGACTACAGT GAACCATTGG ACAAGAAATTTG GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0A01284g EPA10 AGGCTAAAACCATGAACGAGAAGA AGCTGGGTGTATAATAGATGG TCTTTCGGTAT TTATTACATCTGA GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0A01386g EPA9 AGGCTAAAACCATGAACGAGAAGA AGCTGGGTGTATCTTCGGGG TCTTTTGGTAT GTGTAGCAGATATT GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0A04834g AGGCTAAAACCATGAGATTCAAAA AGCTGGGTGTGTAATCAGGTT GGATACTTTC CGATGATAGG GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0B00159g AGGCTAAAACCATGATGAAGAAAA AGCTGGGTGTAATTTGGTTGT AATTAACATTATCG GTGATGTTCTGGT GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0B05054g AGGCTAAAACCATGAAGTACAAAA AGCTGGGTGTGTATGTTGCCG CCCACCCTCCC TATTATTGGATAT GGGGACAAGTTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAA CAGL0C00110g EPA6 CAGGCTAAAACCATGAATTTATCAT AGCTGGGTGTTGTTATCAGAG CTTTTACACCA TCGAGAGTTTTGTTGTTG GGGGACAAGTTTGTACAAAAAAGC GGGGACCACTTTGTACAAGAA CAGL0C00209g AWP7 AGGCTAAAACCATGAAGTTATCAA AGCTGGGTGTAACAAAAGAC AGTCATTGG GAGAAAGTTGAATC

Accession Num Gene Sense primer Antisense primer GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0C00269g GCAGGCTAAAACCATGAAACTT CTGGGTGTGTAAGTTTGAACTTTA TATCCGATACTTAG CTTGTCG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0C00847g EPA8 GCAGGCTAAAACCATGATTGCA CTGGGTGTAGGAGATGATGATAG CTATCATTGTTGGTT GCCCGGAGG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0C05595g EPA25 GCAGGCTAAAACCATGATTTATT CTGGGTGTACTACAGTACAAGAAA TCAGGAACCATTGG TTTGATG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0C05620 EPA26 GCAGGCTAAAACCATGTTAAGC CTGGGTGTAATGGTGTCGTTTGAG AAGTTAGTTGTTTGT CTACTGCT GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG unassigned GCAGGCTAAAACCATGCACCAT CTGGGTGTAGCTTGTGAAGGCTG CAGCTTCGAATTC AGACTGTG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0D00148g GCAGGCTAAAACCATGAAAGAT CTGGGTGTGTCGAAAGCAGATGA AATCCACCATTTTCG GGTCATGTT GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0D06715g EPA21 GCAGGCTAAAACCATGTTTTCCT CTGGGTGTTGTAATGGTGTGACCA TTTTTTTGCACTTC TCAGATGT GGGGACAAGTTTTGTACAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0C05643g EPA7 AGCAGGCTAAAACCATGAATTT CTGGGTGTTGTTATCAGAGTCGAG ATCATCTTTTACACCA ACTGTTGTTGTTG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0E00187g GCAGGCTAAAACCATGAGTACA CTGGGTGTGCTTAGCAACAATAAA CCAAATTCATCAC GCTAACAAG GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0E00269g GCAGGCTAAAACCATGAAATAC CTGGGTGTGTAGCTAATAACCAAA AAAGAGGTTTTTAAGG TACTCAG GGGGACAAGTTTTGTACAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0E00275g EPA20 AGCAGGCTAAAACCATGTCATG CTGGGTGTATAACCGTCTGTACAT GGCGTTGATTTATGC ATCGTTGC GGGGACAAGTTTGTACAAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0E06600g GCAGGCTAAAACCATGAAAGCG CTGGGTGTTTCTTCGATTTTTGGA ATTGACATTCGCAACATTG ATCCATGG GGGGACAAGTTTTGTACAAAAA GGGGACCACTTTGTACAAGAAAG CAGL0E06644g EPA1 AGCAGGCTAAAACCATGATTTT CTGGGTGTAGATGATGTGTTTATT AAATCCAGCTCTATTTTTG GTTACACA

Accession Num Gene Sense primer Antisense primer GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0E06666g EPA2 GGCTAAAACCATGAACTGGAAAATA GCTGGGTGTGCTGCTAGATGATT GCACTGTTT TATTTTCCTG GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0E06688g EPA3 GGCTAAAACCATGTTCAACTGGATT GCTGGGTGTGTCCTCGGGTTTTG ATCGTATGT GATAGTAGCATGT GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0F00170g EPA16 GGCTAAAACCATGCTAACAAAGAGT GCTGGGTGTGCTACTTAAATTAG TTTATATAC GCCTTATTTT GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0F00181g GGCTAAAACCATGATGAGAAAAAAG GCTGGGTGTTATATCTGATGTAG CCACCG ACTTGTCTGT GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0F09231g GGCTAAAACCATGAGATTTAGAAAT GCTGGGTGTGGGATTTTCTAAAG ATATTATTATTAGCTGCC ATATAGGGTG GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0E00181g GGCTAAAACCATGCTATTGCGAAAT GCTGGGTGTAAGTGGAGCAGTA ATTTACC GAGGTAATGG GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0G10175g AWP6 GGCTAAAACCATGAAGCTATCCAAC GCTGGGTGTTGGCCAGGCAGTA GCATTGGC ACAATACCTGC GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0G10180g GGCTAAAACCATGAAAGGGATATTT GCTGGGTGTGTAATCTTCTTTTT ATTTGCCTG TGCATATTGT GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0H00214g GGCTAAAACCATGAAGAGAAAGCCA GCTGGGTGTAGAAGCTGTTGCA CCTTTTTCT GGTTCCCCCAA GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0H10607 EPA17 GGCTAAAACCATGCTCAGAATACCA GCTGGGTGTGTTTCTGATGTTAT AAAAAGTGC CAGAGTCGAG GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0I00214g GGCTAAAACCATGAGATTTAGAAAT GCTGGGTGTGGGATTTTCTGATG ATATTATTATTAGCTGCC GTATTGGTTG GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0I00220g EPA23 GGCTAAAACCATGAACAGTATTAAT GCTGGGTGTTGTCTTTACGCAGG ATTCTGACT AGTTTGCTAT GGGGACAAGTTTGTACAAAAAAGCA GGGGACCACTTTGTACAAGAAA CAGL0I10992g EPA5 GGCTAAAACCATGAACTGGAAAATA GCTGGGTGTGCTGCTAGATGAAT GTATTGTTT TAATATCTTG

Accession Num Gene Sense primer Antisense primer GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0I11000g EPA4 GCTAAAACCATGAACTGGAAAATAGT CTGGGTGTGCTGCTAGATGAATT ATTGTTT AATATCTTGACTTG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0I10995g GCTAAAACCATGAAAAAAAGACTCCC CTGGGTGTCGTAAGATATATCAC ATTCCCC ACCGTCTGG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0J11885g AWP3a GCTAAAACCATGAAAGTAGGGACATC CTGGGTGTAATGGTGGAGGTGT TGTG GTATACTAATTG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0J11896g AWP3b GCTAAAACCATGATTTCGTTTGTAACA CTGGGTGTACTCGTTGAGATAAA CTTTTAGC TTTTGTAG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0J11968g EPA15 GCTAAAACCATGAGAAATATCCAAATT CTGGGTGTCGGATCAAAAAACAG CATTGG ATCTGATGG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0J11973g GCTAAAACCATGAGGAGAAAGCCTCC CTGGGTGTGTCATCAATTGCTTT ATTTACA CGAGGATTT GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0K00110g AWP2 GCTAAAACCATGAGGAAACTACCATT CTGGGTGTGGTTTCATTGATGCT GTTCATG GGATGCAAG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0K00170g EPA22 GCTAAAACCATGTTTAACTGGATTATT CTGGGTGTTTCAGGTTTTGGGTC GTCAGT CTCAGGTTT GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0K13002g GCTAAAACCATGAAACTTACCGGATTA CTGGGTGTTGGGTCAATTGTGGG TTAAAG ATACTTCG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0K13007g AWP5 GCTAAAACCATGAGGCTTTATCGGTGT CTGGGTGTGGGTCCGCCATCCAT TTTTCA GTCAGGACC GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0I10995g GCTAAAACCATGAGATTTAGAAACATA CTGGGTGTATCGGAATTTTCTGA TTATTATTAGC GGATATAGG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0L13311g EPA11 GCTAAAACCATGCTGTCCAATTTTTTC CTGGGTGTTGTTGTATAATCATC ATATGC CTCTGGAGG GGGGACAAGTTTGTACAAAAAAGCAG GGGGACCACTTTGTACAAGAAAG CAGL0L13333g EPA13 GCTAAAACCATGTGGCTCTGCTTTATT CTGGGTGTCGTAGTAATGTAATC GTTCCT AGGTTCAGG

Accession Num Gene Sense primer Antisense primer GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0L13426g EPA14 CAGGCTAAAACCATGTGGAATTG CTGGGTGTTGGTGATGGGGATG GTTAGTTGTCAGC GTGTTGGTTT GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0F09234 CAGGCTAAAACCATGCCCCAAAT CTGGGTGTGATATTTGATATTAG ATTTAAAATAGGA TTCTGTCAT GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0M00132g EPA12 CAGGCTAAAACCATGTATTCCAA CTGGGTGTCGATGATGGTATAGG AACAACATTTACT AGGGAGAGG GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0M14069g PWP6 CAGGCTAAAACCATGAATAAAAA CTGGGTGTAGTAATTGGTTTCCC TATGAATGCTTTC ATTAGAG GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0I10098g PWP7 CAGGCTAAAACCATGTTTTCAAA CTGGGTGTTCTTGTTAGTATAAC CGTCATTAACTTTTG TACTGGCATACC GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0I10197g PWP1 CAGGCTAAAACCATGTACTGTAT CTGGGTGTTAAAGGTGGTGGACT TATAAGATTATG ATATTTGG GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0I10200g PWP3 CAGGCTAAAACCATGAGACAGAC CTGGGTGTTGATGTATGTGGTGG AACAATGCTTTGG ATCTGG GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0I10274g PWP2 CAGGCTAAAACCATGCTAATTGA CTGGGTGTGGGTACGCCTTCTTT CTGTATACTG GTTTGTGG GGGGACAAGTTTGTACAAAAAAG GGGGACCACTTTGTACAAGAAAG CAGL0I10340g PWP5 CAGGCTAAAACCATGCCCCTCAT CTGGGTGTTATAAATTGTCCATC AGGAAAATATTTTC TGCGTTGG

Figure 4: Expression of GPI-CWP fusion constructs. All heterologous expression strains were tested for expression using flow cytometry. Uniform staining against the HA epitope in fusion constructs was utilized. Shown are mean relative fluorescence units over an empty vector background.

Heterologous expression strains were individually tested in technical triplicates against various cell lines for their ability to adhere (Fig 51a-k). Cell lines were chosen as representative of tissues normally colonized during different presentations of candida infection. Several host cell types were used – Lec2 cells are a CHO-derived epithelial cell line deficient in terminal sialidase, thus enriched for glycan structures with alternative terminal sugars. These cells served as a baseline for adherence. HRGEC cells are a human renal glomerular endothelial cell line, representative of cells colonized in kidney vasculature. HBEC cells are a human brain endothelial cell line, included as other candida spp. have been known to cause fungal meningitis (Jong et al, 2001). HUVEC cells are a human umbilical vein endothelial cell line previously shown to bind C. glabrata via AWP and PWP family members (Desai et al, 2011). A-498 and T-24 are uroepithelial cell lines from the kidney and bladder, respectively, and were previously implicated in Epa family member binding (Domergue et al, 2005; Zupancic et al, 2008).

CACO2T cells are a colorectal cancer cell line. Binding to these cells could reveal adhesins involved in commensal colonization of the gut. To explore a possible link between individual adhesins and potential immune effector binding, we included the macrophage like cell line J774A.1 and bone marrow-derived macrophages differentiated from murine primary cells. With both types of macrophages, interferon-γ exposed and naive cells were assessed as potential ligands may be present in one activation phase and not the other.

Figure 5: Adherence to cell lines. Adherence to fixed cell lines was assessed in technical triplicate in 24 well plates. Binding indices are calculated as the ratio of colony forming units (CFU) obtained compared to an empty vector control. (a) LEC2 cells, (b)

HRGEC cells, (c) HBEC cells, (d) HUVEC cells, (e) A-498 cells, (f) T-24 cells, (g)

CACO2-T cells, (h) J774A.1 cells – interferonγ, (i) J774A.1 cells + interferonγ, (j) Bone marrow derived macrophages – Interferon-γ, (k) Bone marrow derived macrophages +

Interferon- γ

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

(i)

(j)

(k)

Figure 6: Summary of Strongest Adhesins

Fig 7: PWP family binding to various cell lines. Adherence to fixed cell lines was assessed in technical triplicate in 24 well plates. Binding indices are calculated as the ratio of colony forming units (CFU) obtained compared to an empty vector control.

Experimental Procedures

Flow Cytometry

All strains were grown to mid log phase in Casamino Acid (CAA) medium with 2% dextrose. 1.5 * 10^6 yeast were spun down and incubated with 20 uL of mouse anti-HA antibody (Hopkins serum core) at a 1:1 dilution in PBS. Strains were incubated rotating at 4C for 30 minutes, then washed twice with 1X PBS. Strains were pelleted and supernatants were aspirated. Pellets were resuspended in 20 uL of FITC-conjugated anti-mouse antibody (Jackson laboratories) diluted 1:1. Strains were incubated rotating at 4C for 30 minutes, washed twice with 1X PBS, and assessed for fluorescence on a

FACScalibur flow cytometer (BD Biosciences). Data were analyzed using FlowJo software. An empty vector transformed strain of S. cerevisiae was subjected to the same protocol and used to gate all other samples.

Cell Culture for Adherence Assays

The following cell lines were maintained in these media:

Lec2 (ATCC #CRL-1736): αMEM (Mediatech) supplemented with 10% Heat Inactivated

FBS (Sigma) and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality Biological)

T-24 (ATCC #HTB-4): McCoy’s 5A Medium (Mediatech) supplemented with 10% Heat

Inactivated FBS (Sigma) and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality

Biological)

A-498 (ATCC #HTB-44): Eagle’s MEM (Quality Biological) supplemented with 10%

Heat Inactivated FBS (Sigma), 1% MEM-Nonessential Amino Acids (Quality Biological),

1 mM Sodium Pyruvate (Mediatech), and 100 U/mL penicillin, 100 ug/mL streptomycin

(Quality Biological)

HUV-EC-C (ATCC #CRL-1730): Ham’s F12 Medium (Mediatech) supplemented with

10% Heat Inactivated FBS (Sigma), 2 mM L-Glutamine (Mediatech), 1% ECGS

(Sciencell), 100 ug/mL Heparin (Sigma), and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality Biological)

HRGEC (Sciencell #4000)*: Endothelial Basal Medium (Sciencell) supplemented with

5% FBS, 1% ECGS, and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality

Biological)

HBEC (Gift from Kim Lab)**: RPMI 1640 (Mediatech) supplemented with 10% Heat

Inactivated FBS (Sigma), 10% NuSerum IV (Becton Dickinson), 2 mM L-Glutamine

(Mediatech), 1% MEM-Nonessential Amino Acids (Quality Biologicals), 1% MEM

Vitamins (Sigma), 1 mM Sodium Pyruvate (Mediatech), and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality Biological)

CACO2-T (Gift from Rao Lab): Eagle’s MEM (Quality Biological) supplemented with

20% Heat Inactivated FBS (Sigma), 10 mM HEPES (Quality Biological), and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality Biological)

J774A.1 (ATCC #TIB-67): Dulbecco’s MEM (Invitrogen) supplemented with 10% Heat

Inactivated FBS (Sigma) and 100 U/mL penicillin, 100 ug/mL streptomycin (Quality

Biological)

Bone Marrow Macrophages (differentiated from primary cells): Dulbecco’s MEM

(Invitrogen) supplemented with 20% L929 cell conditioned medium, 10% heat inactivated FBS (Sigma), 10 mM HEPES (Quality Biological), 1 mM Sodium Pyruvate

(Mediatech), 2 mM L-Glutamine (Mediatech), 100 U/mL penicillin and 100 ug/mL streptomycin (Quality Biological)

All cell lines, with the exception of Bone Marrow Macrophages, were maintained in T75 flasks for up to six generations. Cells from nine confluent flasks were used to seed twenty 24-well plates, at a concentration of about 2 * 10^5 cells/well. These were allowed to grow to confluence, then fixed with 2% PFA for two hours. Half the J774A.1 cells were treated with 100 U/mL Interferon- γ 24 hours prior to fixation. All monolayers were washed four times with 1X PBS, then stored in PBS + 100 U/mL penicillin and 100 ug/mL streptomycin at 4C until use in adherence assays.

Femurs from 5 adult C57Bl/6 female mice were harvested immediately post sacrifice, for differentiation into Bone Marrow Macrophages. Marrow cells from femurs were flushed in cold DMEM, centrifuged at 1100 rpm x 5 minutes at 4C, and resuspended in Bone

Marrow Macrophage Media (as above). 11 days post harvest, cells were pooled, washed, and seeded into twenty 24 well plates, at a density of 3.0 * 105 cells/well.

Media was changed the following day, with half the plates receiving media supplemented with 100 U/mL Interferon-γ. Cells were allowed to incubate for 24 more hours, at which point they were fixed in 2% PFA as above.

*HRGECs were maintained and seeded in 24 well plates coated with fibronectin

(Sigma).

**HBECs were seeded into 24 well plates coated with rat tail collagen (Becton

Dickinson).

Adherence Assays

Logarithmic phase cultures of yeast strains were grown in CAA (Casamino Acid)

Medium supplemented with 2% dextrose prior to the start of the experiment. Strains were washed 3X with 1X HBSS + 5 mM CaCl2 and OD600 was measured to determine culture density. Cultures were diluted to an OD600 of 0.1 (10^6 cells/mL) to create

59 inocula. Each strain was tested across three wells, with 1.0 mL of inoculum added to each well. Inocula were spun down onto mammalian cells at low speed (100-200 rpm) for 1 minute, and allowed to incubate at room temperature for 10 minutes. Cells were subsequently washed four times with 1X HBSS + 5 mM CaCl2. 0.5 mLs of Lysis Buffer

(1X PBS + .05% Triton-X100 + 10 mM EDTA) was added to each well, and cells were thoroughly scraped and resuspended. These were serially diluted in water and plated at multiple dilutions onto CAA Agar. CFUs (Colony Forming Units) were determined after plate incubation at 30C for 2-3 days. S. cerevisiae transformed with an empty vector control and S. cerevisiae expressing the functional domain for Epa1p were used in each experiment as non-adherent and adherent standards, respectively.

Conclusion

Interestingly, functional adhesins amongst all subtelomeric GPI-CWPs assessed in these adherence assays were mostly Epa proteins, with the exception of Pwp6p.

Several novel findings arose from these data. Epa16p is a major adhesin responsible for mediating adherence to kidney endothelial and epithelial cell lines, human brain endothelial cell lines, and macrophage-like cells (Fig 5a-k, Fig 6). Epa24p and Epa25p, two closely related, newly identified Epa family members, function as adhesins to human umibilical vein endothelial cells (Fig 5d), and are likely to bind other non-sialic glycan structures unrepresented in the cells assayed, as suggested by strong Lec2 binding.

Notably, the ability of Epa12 to bind very strongly to macrophages is a new finding that could lead to important insights regarding immune activation during systemic infection

(Fig 5j and 5k). These results agree with previously published data that show Epa1p,

Epa6p, and Epa7p are major adhesins. It was also known that an intermediate class of

Epa proteins, most notably Epa12p, Epa15p, and Epa23p, bind to host cells as well

(unpublished data, Cormack lab).

A novel, non-EPA result was the binding of Pwp6 to Lec2 cells (Fig 5a). This is the first functional characterization of this protein, and it is striking that the only non-Epa binder in our assays also harbors a PA14 domain in its effector region. To be complete, we also assessed Pwp1-5p and Pwp7p binding to all cell lines. None of these showed appreciable binding to any of the cell lines tested (Fig 7).

Surprisingly, Awp5p and Pwp7p did not bind to human umbilical vein endothelial cells as reported elsewhere (Fig 5d, Fig 7) (Desai et al, 2011). Differential binding can be attributed to dissimilar experimental methods, possibly increased stringency in our methods. The use of fixed cell lines here could also influence results, as ligand movement would be limited in our assays.

While functional adhesion in these assays is noteworthy, it is not yet known what expression patterns for Epa proteins are, as a whole. Are specific subsets turned on in response to individual cues? Does reciprocal expression play a role in pathogenesis?

Are there expression regions that are mutually exclusive, as in Plasmodium and

Trypaonsome spp? Marrying the sufficiency of particular Epa proteins to mediate adherence with expression data will provide important clues on pathogenicity and colonization by C. glabrata.

References

Desai, C., Mavrianos, J., Chauhan, N. (2011) Candida glabrata Pwp7p and Aed1p are

required for adherence to human endothelial cells. FEMS Yeast Res 11: 595-

601.

Domergue, R., Castano, I., De Las Penas, A., Zupancic, M., Lockatell, V., Hebel, J.R.,

Johnson, D., Cormack, B.P. (2005) Nicotinic acid limitation regulates silencing of

Candida adhesins during UTI. Science 308: 866-70.

Eisenhaber, B., Schneider, G., Wildpaner, M., Eisenhaber, F. (2004) A sensitive

predictor for potential GPI lipid modification sites in fungal protein sequences and

its application to genome-wide studies for Aspergillus nidulans, Neurospora

crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe. J Mol

Biol 337: 243-53.

Emanuelsson, O., Brunak, S., von Heijne, G., Nielsen, H. (2007) Locating proteins in the

cell using TargetP, SignalP and related tools. Nat Protoc 2:953-71.

Jong, A.Y., Stins, M.F., Huang, S.H., Chen, S.H.M., Kim, K.S. (2001) Traversal of

Candida albicans across human blood-brain barrier in vitro. Infect Immun 69:

4536-44.

Louis, E.J. (1995) The chromosome ends of Saccharomyces cerevisiae. Yeast 11:

1553-73.

Zupancic, M.L., Frieman, M., Smith, D., Alvarez, R.A., Cummings, R.D., Cormack, B.P.

(2008) Glycan microarray analysis of Candida glabrata adhesion ligand

specificity. Mol Microbiol 68: 547-59.

Section I Chapter 3: Transcriptional Profile of Subtelomeric GPI-CWPs

Introduction

In the previous chapter, we defined the sufficiency of each GPI-CWP encoded in C. glabrata subtelomeres to mediate adherence to various cell lines. However, the ability of particular Epa proteins to adhere to cells does not necessarily portend a role for said proteins during the infection process. In order for these adhesins to be functionally relevant, they need to be transcribed during physiologically germane stages.

We know that subtelomeric silencing is important in transcriptional regulation of some known adhesins. This became clear with the discovery of the hyperadherent rif1Δ mutant, in which longer telomeres titrated silencing factors away from strong adhesins encoded by EPA6 and EPA7 (Castano et al, 2005). A broader role for this method of transcriptional regulation can be inferred from URA3 reporter system studies in which the URA3 locus was placed intergenically at various distances from the first telomeric repeats. Silencing of the locus was determined by growth on the counterselective medium 5-FOA, and was dependent on the distance of the gene from the telomeres (de

Las Penas et al, 2003). Terminal loci of subtelomeres are enriched for adhesins – most of the strongest functional adhesins are encoded in the telomeric three ORFs of their resident chromosomes. In addition, restriction of a key subtelomeric silencing factor by cofactor (Nicotinic Acid) limitation was correlated with pathogenicity in a murine urinary tract infection model (Domergue et al, 2005). This is physiologically relevant as bioavailability of NA in colonized niches is quite low.

While transcription of specific subtelomeric adhesins were determined in previous experiments via qRT-PCR (Castano et al, 2005; de Las Penas et al, 2003; Domergue et al, 2005), analysis of subtelomere-wide silencing was challenging. Recent sequencing of CBS and BG2 allows appropriate and specific design of primers in subtelomere- located genes. Using these specific qRT-PCR primers, we are able to determine

64 transcript abundance of each ORF in a background compromised for subtelomeric silencing. As locations of these ORFs are now mapped with high confidence, we can determine if there is a telomere position effect in subtelomeric silencing across all subtelomeres.

Figure 8: Location of EPA genes in the C. glabarata genome. Blue boxes indicate location of EPA genes, with numerical designations in parentheses to the right of each chromosome. Adapted from http://www.genolevures.org/cagl.html#.

Table 3: Subtelomeric GPI-CWP qRT-PCR Primers. Sense and antisense primers were designed in the 5’ functional domains of each ORF to create products 100-300 bp long. Light grey shaded boxes indicate genes in BG2 located on different chromosomes than their orthologues in CBS. The dark grey shaded box highlights EPA5. Transcript abundance for this ORF is by subtraction of EPA4 signal, as independently-bound primers could only be designed for EPA4.

Accession Num Gene Sense primer Antisense primer ON Fwd ON Rev AGAACAATGTCCAG GTGAGAATGAGTCG CAGL0A00159g EPA19 PON294 PON295 GAAGTG GAGGAT TTCATATCCATGTT ATATGGCTTGACAA CAGL0A00162g EPA24 PON296 PON297 GGGATT CCTTTC ATACCCCTCCAGAC ATATTCCATCCATG CAGL0A04834g PON372 PON373 GACACC CCGGTG TCCTCTGTTGTCGC CTTCTGTAAGCCTG CAGL0B00159g PON334 PON335 ATTAAG CAAGAC TTACCACTTATCGG TGGATTGCCGTGCA CAGL0B05054g PON326 PON327 AACGAC CATCTA AAGGATGACTATTC GGATTCGATCCTGA CAGL0C00110g EPA6 PON300 PON301 TTCCTC TTTCAA TGGTAACACTAGCC GATGAAGAGGTAG CAGL0C00209g AWP7 PON298 PON299 CATTGT GCCATGC AGGTATTATACGGC TGATTCAAGAAGCG CAGL0C00269g PON302 PON303 ACTGCA TCGCAG TTCATATCCATGTT ATATGGCTTGACAA CAGL0C05595g EPA25 PON306 PON307 GGGATC CCTTTT AACACCCTGCAGCC ACAGAAGATGGGCC CAGL0C05620 EPA26 PON304 PON305 AGAGTA GACCGA ATGCACCATCAGCT CATCAGTACCTGTA unassigned PON310 PON311 TCGAAT TACAAT TGTTGGCTCACAGG ACCTGAACCGCGGA CAGL0D00148g PON308 PON309 TCGCTA AAACGG AGGGTGCAGTCCG CTGTCGAGATGTAA CAGL0D06715g EPA21 PON312 PON313 GTAGACA CGGGCC

TACCCATGTTGGGA GGGTAATTATAGCT CAGL0C05643g EPA7 PON350 PON351 TGCCGC TGCCGG GGTTCTTCTTCCAC TACTGAACTAGTAT CAGL0E00187g PON348 PON349 TTCTGG GTGAGT GATAATACTACGGC TTCGAAGCTGCTGG CAGL0E00269g PON346 PON347 CTCTGT CGTATT ACTCGACTAGCGTC CTAGCTATATCCGT CAGL0E06600g PON380 PON381 CACTCA CGTGTA CCCCTATGTGGCTC ATTGGTCCGTATGG CAGL0E06644g EPA1 PON382 PON383 TGGGTT GCTAGG ACTATAACTACCAC CATACATCTCTAAT CAGL0E06666g EPA2 PON376 PON377 TGCGCT GGGGTT CGATACTACATGCA TTGGCAACTAGGTG CAGL0E06688g EPA3 PON378 PON379 GGAGTA TTTGGG ATAACACATCATGC GTTGTTGACGCACC CAGL0F00170g EPA16 PON330 PON331 GCCTCG GCATGG CAACCCTACTGGGT ACAAATAAAGCGTG CAGL0F00181g PON328 PON329 ATGATG GCTAGA TATATTGGCGTGTA AGTTAGCAACAATT CAGL0F09231g PON314 PON315 TGCAGA CCAGGC ACTTACTATCCGGC AGGGTCACTACTCG CAGL0E00181g PON374 PON375 GAGATA CTAGAA ACAGCAACCACCAA TGAGGTTTCACGGT CAGL0G10175g AWP6 PON318 PON319 GCCTGT TCCAGA TCTCATTTGGCGTA TGGTGGAGGGCATT CAGL0G10180g PON316 PON317 CTAGGA GGACAT TTCCCCCATTTCCC TTTGGTGGCGGTCC CAGL0H00214g PON324 PON325 GGTCAA GTTATA TCGAGGTGCTGAAA ACAACTGAAGCATC CAGL0I00214g PON322 PON323 AGTGAA AAATAC TAGCAAACTCCTGC TGGGTCTTCAGGGG CAGL0I00220g EPA23 PON320 PON321 GTAAAG TCTCGA CAATAGGTTGTTCA TCAATTATGCCGTT CAGL0I10992g EPA5 PON384 PON385 CCTCAG GACTCG CAATAGGTTGTTCA TCAATTATGCCGTT CAGL0I11000g EPA4 PON386 PON387 CCTCAG GACTCC ACGATATCCTGGTA GGTAGTTTATTACG CAGL0I10995g PON332 PON333 CATAAC GTGGTT GTCAACGATAGTTG CTGACCCACTAACT CAGL0J11885g AWP3a PON356 PON357 CCCCTC GGACCG CAATGGAGCGGTAA CACAGCGATTGACG CAGL0J11896g AWP3b PON358 PON359 GCGGAG TAACAC

CACAGCTCAAGCGT GGCCTCATAACCGA CAGL0J11968g EPA15 PON360 PON361 TGCCAT GTTTGG GTTATATACAAGGG TACCAATCATGGGC CAGL0J11973g PON362 PON363 ACCACC AGGTTG TTGTCGTTGATGAC TGAAAACTGAATTT CAGL0K00110g AWP2 PON338 PON339 CGGAGA TCGCCC TATCTCTATTCCGTT GTCAAGAAACCCTC CAGL0K00170g EPA22 PON336 PON337 CCGGA CCTCGC AGTCCCACGGCCGA GTTAGTGTCCCACC CAGL0K13002g PON342 PON343 ACTAAC CCTGTT ATCAGGGGCCGTTA CATGTCAGGACCAC CAGL0K13007g AWP5 PON344 PON345 CCCATC TAGGTA CGTCACCACAGGTG ATCACCTTGTACGT CAGL0I10995g PON364 PON365 GGTTTC ATCCTG GCTGAACAGTTCCG TATCGCATTCTCCG CAGL0L13311g EPA11 PON368 PON369 TTAAAT TAGAGG ACTGCGGCATCATA CGACTTTTCGTTCC CAGL0L13333g EPA13 PON370 PON371 CGATCA GCTGGA TTAGCTGATGTGCT TTGACAAATGTCTG CAGL0F09234 PON354 PON355 ACACAT GTGCCT CATGGATCAGAGCG ACCAGAAGGGCAG CAGL0M00132g EPA12 PON352 PON353 CATAAC TCCAGTC GGTGTTGGCACTGC CAATGTGACCACAT CAGL0M14069g PWP6 PON366 PON367 GTACTT CACTGG GTGGTAGTCTTACT AGTAGTTGGCGAAG CAGL0I10098g PWP7 ON5945 ON5946 GCTTCC GAACGA GCTTACCTACTAGC AGGGAACTAACAG CAGL0I10197g PWP1 ON5935 ON5936 GTAAAA GGTACGG TTCCAACCCAATCC GTTTGGTCCCGCTA CAGL0I10200g PWP3 ON5939 ON5940 GGTATG GGATCT GCCTTCGCGTGACG GATGTTGCAGGCTC CAGL0I10274g PWP2 ON5937 ON5938 ACTCAT GGAATG GCGATCTATCCGCA CGTTCCAGTTCGTG CAGL0I10340g PWP5 ON5943 ON5944 TGGCCT CGTTTG ATCTATTGGAACCG AGGTAGTACGGTAA CAGL0I10362g PWP4 ON5941 ON5942 ATGACT TCGTGA

Figure 9: Subtelomeric transcript abundance as a function of distance to first telomeric repeat in a Sir2Δ strain. Transcript abundance was determined by qRT-

PCR analysis of cDNA from wild-type BG2 (Cg2781) and Sir2Δ strains (Cg1216). The x- axis denotes the distance from the first telomeric repeat to the ATG start codon of each

ORF. The same gene is indicated in a vertical plane, with transcript levels in wild-type

BG2 denoted as black diamonds and transcript levels in a Sir2Δ denoted as red squares. Transcript abundance is mapped as log10 arbitrary units (a.u.) as they indicate a ratio of total pg sample over a tubulin standard. Trendlines displayed are power regressions for BG2 (black) and Sir2Δ (red).

Table 4: Percent change in transcript abundance of subtelomeric GPI-CWPs in a

Sir2Δ strain. The table is ordered by the distance from each ORF’s ATG start codon to the first telomeric repeat, found in the third column. Genolevures assigned accession number for each ORF is found in the first column, with encoded gene found in the second column where known. Percentage change is calculated by the difference in transcript abundance of the Sir2Δ strain and WT BG2, divided by total transcript abundance in WT BG2.

Distance from Accession # Gene telomere % change CAGL0C05620g EPA26 4552 9877 CAGL0C00110g EPA6 4595 32669 CAGL0C05604g EPA7 4658 53834 CAGL0E06688g EPA3 5873 3093 CAGL0K00110g AWP2 5901 10001 CAGL0F00170g EPA16 5940 124405 CAGL0K13007g AWP5 6476 7319 CAGL0B00159g 6614 33509 CAGL0B05054g 6615 138948 CAGL0G10180g 7245 83898 CAGL0J11973g 7554 656 CAGL0I11000g EPA4 7990 204 CAGL0L00269g 8166 4212 CAGL0H00214g 8260 72361 CAGL0F09231g 8693 7626 CAGL0I00214g 8719 5680 CAGL0D06715g EPA21 8876 1005 CAGL0F09234g 10706 238 CAGL0D00148g 11888 81 CAGL0K13002g 12569 7 CAGL0F00181g 13450 22090 CAGL0K00225g EPA22 14228 1704 CAGL0E00187g 14904 10 CAGL0E06666g EPA2 14964 39242 CAGL0C00209g AWP7 15159 14 CAGL0C05595g EPA25 15227 281 CAGL0I10992g EPA5 15364 8094

CAGL0I00220g EPA23 15649 3 CAGL0I10995g 17475 6142 CAGL0A00159g EPA19 18453 1737 CAGL0G10175g AWP6 18587 9 CAGL0E00181g 20080 848 CAGL0J11968g EPA15 21418 -13 CAGL0E06644g EPA1 24184 471 CAGL0C00269g 25649 20 CAGL0M00132g EPA12 26366 123 CAGL0J11896g AWP3b 28694 30 CAGL0A00162g EPA24 30010 27 CAGL0E00269g 30689 64 CAGL0E06600g 30840 21 CAGL0J11885g AWP3a 33706 31

Experimental Procedures

RNA extraction

Strains Cg2781 (WT BG2) and Cg1216 (Sir2Δ BG2) were grown in 5 mLs of YPD until they were in deep stationary phase, approximately 21 hours. Yeast were spun down at

4000 rpm x 5 minutes and washed once with DEPC-treated water. Pellets were resuspended in a buffer containing acid phenol and SDS and incubated shaking x one hour at 65ºC. Yeast lysates were placed on ice for 10 minutes, then spun down at 4ºC and 13,200 rpm. Supernatants were subjected to an additional round of acid phenol extraction. An equivalent volume of chloroform was added to the extracted supernatant, vortexed, incubated on ice for 5 minutes, then spun down at 4ºC and 13,200 rpm.

Aqueous layers were ethanol precipitated and nucleic acid pellets were resuspended in

DEPC-treated water. These were treated to two subsequent rounds of DNAse I digestion (New England Biolabs), 20 minutes and 30 minutes long, respsectively, as initial qRT-PCR tests post first DNAse digestion showed genomic DNA contamination.

DNAse digests were phenol-chloroform extracted. RNA were ethanol preciptated from the resultant aqueous layer and resuspended in DEPC treated water. All experiments were performed with biological triplicates.

First strand synthesis

100 ng of each RNA sample was run on an agarose gel and showed clear 28S and 18S rRNA bands. To create cDNA, eight separate reactions were set up per strain, each containing 3 µg RNA, 5 µM Oligo dT (Operon), and 1 mM dNTP mix. These were incubated at 65ºC for 5 minutes, then placed on ice for 5 minutes. Synthesis mix containing RT Buffer, 10 mM MgCl2, and 20 µM DTT was added to each sample in a 1:1 ratio. 1 µL Superscript III Reverse Transcriptase (Invitrogen) was added to four

73 reactions for + RT samples, and 1 µL of DEPC-treated water was added to the remaining four reactions for –RT samples. Incubated reactions for 50 minutes at 50ºC, then 5 minutes at 85ºC. Reactions were chilled on ice. 1 µL of RNAse H (New England

Biolabs) was added to each tube, then incubated for 20 minutes at 37ºC. Like samples were pooled and diluted 10X with DEPC treated water. qRT PCR

Reactions were set up on ice in 96 well plates, with seriallly diluted BG2 genomic DNA run with each primer set for quantification purposes. Tubulin standards were also included on each plate for normalization. 25 µL reactions were composed of standard

PCR buffer, 5 µL of cDNA, 1 µM of each primer, 1X EvaGreen Dye (Biotium), 1 mM

MgCl2, 200 µM dNTP mix, and 0.5 µL homemade Taq polymerase. 2-step PCR was performed on a BioRad CFX96 thermal cycler with an initial denaturation for 2 minutes at

95ºC, followed by 40 cycles of 15 second denaturation at 95ºC and 30 seconds of annealing/extension at 60ºC. SYBR wavelength fluorescence was read for each well after each cycle. When cycles were complete, a melt curve was performed from 65 ºC to 95ºC, with 0.5ºC intervals. qRT-PCR experiments were performed in technical duplicates with biological triplicates.

Conclusion

It has been shown that environmental availability of Nicotinic Acid regulates expression of some subtelomeric adhesins. Since C. glabrata is an NA auxotroph, limitation of extracellular NA causes intracellular NA levels to fall. The derepression of subtelomeric adhesins is likely a direct result of impaired Sir2p function, since NA is a required cofactor for this histone deacetylase. Here we extend those results to show that the subtelomeric genes in general are subject to Sir2-mediated transcriptional repression, and that there is a strong correlation of the extent of silencing with proximity to the telomere

(Fig 9). Telomere-proximal genes show the greatest change in transcript abundance, with EPA16 transcript levels showing the second highest percentage change in overall transcript levels across the subtelomeric ORFs. Epa16p is encoded by the terminal

ORF on chromosome F Left (Fig 8). This remarkable transcript increase is noteworthy as Epa16p was described as a novel, strong adhesin with broad specificity in Chapter 2.

Strong adhesins Epa6p and Epa7p are also amongst the most highly induced in the

Sir2Δ strain (Fig 9, Table 4).

While these data support a clear trend, it is also clear that there is not a linear correlation between transcript abundance and distance of the originating ORF from the first telomeric repeat. Perhaps this is unsurprising, as it has been found that over 10% of transcription factors concentrate at subtelomeres in chromatin immunoprecipitation studies conducted in S. cerevisiae (Mak et al, 2009). Recent research has also shown the presence of cis-acting protosilencer sequences in C. glabrata subtelomeres (Juarez-

Reyes et al, 2012). It is intriguing to postulate that broad transcriptional de-repression may be mediated by the Sir silencing complex, while these other regulatory mechanisms may act locally to fine-tune transcription of specific genes.

Future transcript studies using specific stressors may provide more clues regarding additional levels of regulation. While we have used a genetic deletion background here as a proxy for compromised Sir repression, nicotinic acid limitation may have different effects than we have shown. In addition, stressors that mimic specific niches may tell us more about the adhesin complement important for colonization in particular contexts.

For example, hypoxic conditions may upregulate particular adhesins important for gut colonization, or for interaction with other gut flora.

Finally, while the majority of this thesis is focused on subtelomeric adhesins, exhaustive interpretation of these data compels several questions. The most transcriptionally induced GPI-CWP in the Sir2Δ strain is a terminal ORF on chromosome B, of unknown function. Does this encode a pathogenically relevant protein? Two Awp proteins are amongst the most induced, as well (Table 4). AWP family members have been implicated in biofilm formation (Kraneveld et al, 2011), and it is known that biofilm formation is dependent on Sir protein-mediated pathways (Iraqui et al, 2005). Using some of the reagents generated here, collaborators have shown that Awp2p and Awp7p are important for adhesion of C. glabrata to C. albicans (Tati et al, 2016). Further interactions with other microbes may involve subtelomerically encoded GPI-CWPs.

Finally, Epa26p is encoded by a terminal ORF on chromosome C and is highly induced in a Sir2Δ strain, but has not been shown to adhere to any specific cell line tested in

Chapter 2. Does this protein function in another capacity related to survival in the host?

References

Castano, I., Pan, S.J., Zupancic, M., Hennequin, C., Dujon, B., Cormack, B.P. (2005)

Telomere length control and transcriptional regulation of subtelomeric adhesins

in Candida glabrata. Mol Microbiol 55: 1246-58.

De Las Penas, A., Pan, S.J., Castano, I., Alder, J., Cregg, R., and Cormack, B.P. (2003)

Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata

are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent

transcriptional silencing. Genes Dev 17: 2245-2258.

Domergue, R., Castano, I., De Las Penas, A., Zupancic, M., Lockatell, V., Hebel, J.R.,

Johnson, D., Cormack, B.P. (2005) Nicotinic acid limitation regulates silencing of

Candida adhesins during UTI. Science 308: 866-70.

Iraqui, I., Garcia-Sanchez, S., Aubert, S., Dromer, F., Ghigo, J.M., d’Enfert, C., Janbon,

G. (2005) The Yak1p kinase controls expression of adhesins and biofilm

formation in Candida glabrata in a Sir4p-dependent pathway. Mol Microbiol 55:

1259-71.

Juarez-Reyes, A., Ramirez-Zavaleta, C.Y., Medina-Sanchez, L., De Las Penas, A.,

Castano, I. (2012) A protosilencer of subtelomeric gene expression in Candida

Glabrata with unique properties. Genetics 190: 101-11.

Kraneveld, E.A., de Soet, J.J., Deng, D.M., Dekker, H.L., de Koster, C.G., Klis, F.M.,

Crielaard, W., de Groot, P.W. (2011) Identification and differential gene

Expression of adhesion-like wall proteins in Candida glabrata biofilms.

Mycopathologia 172: 415-27.

Mak, H.C., Pillus, L., Ideker, T. (2009) Dynamic reprogramming of transcription factors to

and from the subtelomere. Genome Res 19: 1014-25.

Tati, S., Davidow, P., McCall, A., Hwang-Wong, E., Rojas, I.G., Cormack, B., Edgerton,

M. (2016) Candida glabrata binding to Candida albicans hyphae enables its

development in oropharyngeal candidiasis. PLOS Pathog 12: e1005522.

Section I Chapter 4: Ligand Specificity of Subtelomeric Adhesins

Introduction

While functional adherence is now defined for all putative subtelomeric adhesins to quite a few cell types, identification of specific ligands on these cells could provide some important clues regarding other cell types that might be bound during infection. Since it is known that Epa proteins are C type lectins, glycoconjugates are likely binding partners. Identification of the specifically bound glycans could provide information not only for glycoconjugates on cells, but also regarding putative ECM component substrates, or substrates present on other microbial species. The first experiments exploring Epa binding partners used glycan array technology to delineate similarities and differences between Epa1p, Epa6p, and Epa7p binding to various glycan moieties

(Zupancic et al, 2008). These experiments were conducted using arrays containing approximately 250 different glycans, provided by the Consortium for Functional

Glycomics, or CFG. A subsequent set of experiments married structural data with binding specificity, and utilized a later version of these glycan arrays, printed with over

450 glycan types (Maestre-Reyna et al, 2012). The current version of arrays, version

6.0, includes 611 distinct glycans and is utilized in this chapter to determine ligand character for Epa12, Epa16, Epa24, and Epa25 (Smith et al, 2010).

Since the large number of EPA family members rendered a deletion model tricky to utilize, the first experiments used the heterologous expression model also used in adherence assays described in Chapter 2. Epa1, Epa6 and Epa7 proteins were expressed as fusion constructs, with N-terminal functional domains fused to an HA tag, followed by the C-terminal domain for Cwp2p, a cell wall protein robustly cross-linked to the cell wall in S. cerevisiae. Yeast were stained with DiOC6, a cell permeant lipophilic

79 dye, and hybridized to an array covalently printed with over 250 different glycans. The two terminal residues in glycan structures were found to be binding determinants. All three Epa proteins bound to terminal galactose residues, but the identity and type of linkage to the penultimate residue differed. Epa6p displayed the broadest specificity, adhering to galactose bound in α or β1-3 and β1-4 glycosidic linkages with glucose, galactose, or N-acetylated derivatives of the two. Epa1p and Epa7p excluded α-linked moieties, with binding observed to Gal β1-4-Glc (lactose), Gal β1-3-Gal, and N- acetylated derivatives thereof (Zupancic et al, 2008).

Domain swapping and sugar inhibition experiments revealed that two hypervariable regions were responsible for mediating specificities. Interestingly, both hypervariable regions fell into the known PA14 motif (Zupancic et al, 2008). Part of the anthrax toxin protective antigen, this motif is found to mediate sugar binding in a range of eukaryotic and bacterial proteins, many of which are known adhesins (Rigden et al, 2004; de Groot and Klis, 2008). The majority of Epa proteins contain these domains (Zupancic et al,

2008).

The crystal structure for Epa1p, which was solved as a recombinant protein complexed with different carbohydrate ligands, fine-tuned Epa1p specificity. Primary binding to Gal

β1-3 linkages was shown at nonreducing ends. Interactions are mediated by five loops,

CBL1, CBL2, L1, L2, and L3. The latter three are outer loops that control solvent accessibility to CBL1 and CBL2 (Maestre-Reyna et al, 2012).

CBL1 and 2 are important for calcium binding and ligand recognition, the latter of which is found in one of the formerly defined hypervariable regions included in the PA14 domain. Residues within CBL2, which spans a five amino acid stretch, are numbered I-

IV starting with the second residue, as the first residue is invariant across all family

80 members. An inner binding subsite, which interacts with a ligand’s terminal galactose, is formed with CBL1, Ca2+, the R at position I of CBL2, and the W at the second amino acid position in L3. These coordinating residues are very well conserved across Epa sequences, suggesting that terminal galactose is the preferred substrate for most members of the class.

The latter four residues in CBL2 form direct interactions with glycans, and are largely responsible for substrate promiscuity of specific Epa proteins. This promiscuity was explored by a limited subset of domain swapping experiments, and was defined by the binding properties of an outer binding subsite (Maestre-Reyna et al, 2012). Specifically, positions II and III of CBL2 select for glycosidic linkage type – an E at position II and Y at position III select for β1-3 glycosidic bonds, while polar amino acids at position III increase promiscuity, and may permit sulfated galactoses to bind. Amino acids at position IV have been posited to limit the allowed modifications on the terminal galactose

(Maestre-Reyna et al, 2012).

These four residues have also been used to define subtypes within the Epa family. The

Epa1 subtype, which encompasses Epa1p, Epa6p, and Epa7p, has either REYD or

RDND in its CBL2 sequence. The Epa2 subtype encompasses Epa2p, Epa4p, and

Epa5p, and includes RDNN at the locus. The Epa3 subtype encompasses Epa3 and

Epa22, and has a more divergent sequence with IGKD in CBL2. The Epa9 subtype encompasses Epa9p and Epa10p, and is defined by RDYH at CBL2 but also is characterized by a long L1 sequence. While other Epa protein sequences were included in the analysis, these others were not binned into particular subtypes (Maestre-Reyna et al, 2012). It is noteworthy that while all members of the Epa1 subtype have been found to function as adhesins, no known function is yet known for the rest of the Epa subtypes, other than a weak adherence phenotype by Epa10p in this study.

In the second part of this chapter, we follow up on the significant binding of Epa12 to bone marrow macrophages, and the ligand specificity found in the first part of this chapter. Previous studies show that fungal species are phagocytosed by innate immune effectors like macrophages. Initial binding to these effectors can be mediated by numerous host molecules, such as the C-type lectin-like receptor Dectin-1, which recognizes cell wall β-glucan, the Macrophage Mannose Receptor, which recognizes fungal mannans, and toll-like receptors 2, 3, 4, 6, 7, and 9, combinations of which recognize β-glucan and other various cell wall components on different fungal species, some of which are unknown (Bourgeois and Kuchler, 2012; Kuhn and Vyas, 2012).

Recent research has made the interaction between C. glabrata and host macrophages even more interesting. Studies using human monocyte-derived macrophages show that

C. glabrata is able to replicate intracellularly, and also able to subvert acidification in the phagolysosomal compartment. This supports the idea that C. glabrata persists within macrophages and is able to evade immune clearance strategies (Seider et al, 2011).

But how exactly is C. glabrata bound by effector-expressed ligands, or vice versa? We know general mechanisms from studies of other pathogens, but C. glabrata-specific means were unclear.

Two recent studies provide intriguing lines of evidence. Human donor-derived peripheral blood mononuclear cells and human macrophage-like lines Thp1 and U937 were used to tease out the contribution of different molecules to binding between macrophages and C. glabrata. Beyond cell wall structural component sensors like Dectin-1, Epa1p was a major adherence factor to macrophage like cells (Kuhn and Vyas, 2011). In addition, a separate study observed that murine macrophages required mannan but not glucan to recognize fungal pathogens, suggesting that mannose side chains or mannoproteins

82 potentially GPI-CWPs, present in the cell wall are key players in the C. glabrata – macrophage interaction (Keppler-Ross et al, 2010).

Beyond the growing evidence present in Candida-centered research, it is known that both peritoneal and bone-marrow derived macrophages from mice synthesize and secrete glycosaminoglycans, or GAGs. While there is some variability depending on the deriving mouse strain, the predominant form of GAG secreted by macrophages is dermatan sulfate, also known as chondroitin sulfate B (Michelacci and Petricevich,

1991). As these GAGs contain highly branched polysaccharides, these could be potential binding partners for Epa family members.

Figure 10: Multiple sequence alignments of Epa proteins. The alignment was constructed as an exhaustive multi-way pairwise assembly using Neighbor-Joining phylogeny, scored with a BLOSUM62 matrix. (a) Dendrogram of Epa proteins, based on the N terminal 330 amino acids (b) Alignments showing binding pocket regions predicted based on recombinant Epa1 structure (adapted from Maestre-Reyna et al, 2012).

(a)

(b)

Figure 11: Glycan Arrays for whole yeast hybridization of Epa1, Epa6, Epa7,

Epa12, Epa15, Epa16, Epa23, Epa24, Epa25, and Epa26. S. cerevisiae strains heterologously expressing Epa fusion proteins were stained with the lipophilic fluorescent dye DiOC6 and hybridized to version 6.0 glycan arrays provided by the

Consortium for Functional Glycomics. Below are graphs depicting the Relative

Fluorescence Units (RFU) of each spot in these arrays. (a) CFG Slide 15259 (Sc49:

Epa1) (b) CFG Slide 15267 (Sc33: Epa6) (c) CFG Slide 15015 (Sc35: Epa7) (d) CFG

Slide 15540 (Sc51: Epa12) (e) CFG Slide 15275 (Sc229: Epa15) (f) CFG Slide 14788

(Sc588:Epa16) (g) CFG Slide 14794 (Sc121: Epa23) (h) CFG Slide 14133 (Sc608:

Epa24) (i) CFG Slide 14134 (SC610: Epa25) (j) CFG Slide 14156 (Sc580: Epa26)

(a)

Epa1 45000

40000

35000

30000

25000

RFU RFU RFU RFU 20000

15000

10000

5000

71 81 11 21 31 41 51 61 91

291 301 511 101 111 121 131 141 151 161 171 181 191 201 211 221 231 241 251 261 271 281 311 321 331 341 351 361 371 381 391 401 411 421 431 441 451 461 471 481 491 501 521 531 541 551 561 571 581 591 601 611 Array Spot Number

(b)

Epa6

20000

18000

16000

14000

12000

10000 RFU 8000

6000

4000

2000

21 91 11 31 41 51 61 71 81

161 551 101 111 121 131 141 151 171 181 191 201 211 221 231 241 251 261 271 281 291 301 311 321 331 341 351 361 371 381 391 401 411 421 431 441 451 461 471 481 491 501 511 521 531 541 561 571 581 591 601 611 Array Spot Number

(c)

Epa7

60000

50000

40000

30000 RFU

20000

10000

11 21 31 41 51 61 71 81 91

171 321 471 101 111 121 131 141 151 161 181 191 201 211 221 231 241 251 261 271 281 291 301 311 331 341 351 361 371 381 391 401 411 421 431 441 451 461 481 491 501 511 521 531 541 551 561 571 581 591 601 611 Array Spot Number

(d)

Epa12

40000

35000

30000

25000

20000 RFU

15000

10000

5000

51 11 21 31 41 61 71 81 91

121 291 461 101 111 131 141 151 161 171 181 191 201 211 221 231 241 251 261 271 281 301 311 321 331 341 351 361 371 381 391 401 411 421 431 441 451 471 481 491 501 511 521 531 541 551 561 571 581 591 601 Array Spot Number

(e)

Epa15 35000

30000

25000

20000

15000RFU

10000

5000

31 11 21 41 51 61 71 81 91

211 381 561 101 111 121 131 141 151 161 171 181 191 201 221 231 241 251 261 271 281 291 301 311 321 331 341 351 361 371 391 401 411 421 431 441 451 461 471 481 491 501 511 521 531 541 551 571 581 591 601 611 Array Spot Number

(f)

Epa16 45000

40000

35000

30000

25000

RFU 20000

15000

10000

5000

81 11 21 31 41 51 61 71 91

191 301 411 521 101 111 121 131 141 151 161 171 181 201 211 221 231 241 251 261 271 281 291 311 321 331 341 351 361 371 381 391 401 421 431 441 451 461 471 481 491 501 511 531 541 551 561 571 581 591 601 611 Array Spot Number

(g)

Epa23 18000

16000

14000

12000

10000

RFU 8000

6000

4000

2000

11 21 31 41 51 61 71 81 91

191 291 481 581 111 121 131 141 151 161 171 181 201 211 221 231 241 251 261 271 281 301 311 321 331 341 351 361 371 381 391 401 411 421 431 441 451 461 471 491 501 511 521 531 541 551 561 571 591 601 611 101 Array Spot Number

(h)

Epa24

60000

50000

40000 RFU 30000

20000

10000

31 11 21 41 51 61 71 81 91

391 461 531 101 111 121 131 141 151 161 171 181 191 201 211 221 231 241 251 261 271 281 291 301 311 321 331 341 351 361 371 381 401 411 421 431 441 451 471 481 491 501 511 521 541 551 561 571 581 591 601 611 Array Spot Number

(i)

Epa25

60000

50000

40000 RFU 30000

20000

10000

81 11 21 31 41 51 61 71 91

131 341 551 101 111 121 141 151 161 171 181 191 201 211 221 231 241 251 261 271 281 291 301 311 321 331 351 361 371 381 391 401 411 421 431 441 451 461 471 481 491 501 511 521 531 541 561 571 581 591 601 611 Array Spot Number

(j)

Epa26

40000

35000

30000

25000

20000 RFU

15000

10000

5000

11 21 31 41 51 61 71 81 91

151 231 441 521 101 111 121 131 141 161 171 181 191 201 211 221 241 251 261 271 281 291 301 311 321 331 341 351 361 371 381 391 401 411 421 431 451 461 471 481 491 501 511 531 541 551 561 571 581 591 601 611 Array Spot Number

Table 5: Glycan Array hits for Epa1, Epa6, Epa7, Epa12, Epa 15, Epa16, Epa 23,

Epa24, Epa25 and Epa26. Hits are ordered by descending average fluorescence, using

10,000 RFU as a cutoff.

Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 549 19670 13376 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp24 159 Galb1-4GalNAcb1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 19421 3355 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 17460 4240 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 486 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 16318 19954 4(Fuca1-6)GlcNAcb-Sp24

44 (6S)Galb1-4GlcNAcb-Sp8 14646 9817 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)Galb1- 303 14448 9136 4GlcNAc-Sp0 156 Galb1-4(6S)Glcb-Sp0 13906 9919 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)GalNAca- 19 13807 11364 Sp8 136 Neu5Aca2-6(Galb1-3)GalNAca-Sp8 13387 8873 42 (6S)Galb1-4Glcb-Sp0 13320 8873 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 587 4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1-3Galb1- 11849 17834 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb- Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 582 10290 11550 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp19

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev Gala1-4Galb1-4GlcNAcb1-2Mana1-6(Gala1-4Galb1- 405 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp24 17017 709 122 Gala1-4Galb1-4GlcNAcb-Sp8 16812 1043 382 Galb1-3GalNAca1-3(Fuca1-2)Galb1-4GlcNAc-Sp0 15647 433 143 Galb1-3GalNAcb-Sp8 15401 3274 381 Galb1-3GalNAca1-3(Fuca1-2)Galb1-4Glc-Sp0 15400 763 Galb1-3GlcNAcb1-2Mana1-6(GlcNAcb1-4)(Galb1- 477 3GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sc33, Sp21 15360 1624 Epa6, 15267 522 Gala1-3Galb1-4GlcNAcb1-2Mana-Sp0 15354 1710 146 Galb1-3GalNAcb1-4Galb1-4Glcb-Sp8 15317 1185 Galb1-4GlcNAcb1-3Galb1-4(Fuca1-3)GlcNAcb1- 162 3Galb1-4(Fuca1-3)GlcNAcb-Sp0 15286 1970 Galb1-4GlcNAcb1-2Mana1-6(GlcNAcb1-4)(Galb1- 437 4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1- 4GlcNAcb1-4GlcNAc-Sp21 15053 2433 167 Galb1-4GlcNAcb1-6(Galb1-3)GalNAca-Sp8 14928 703 Galb1-3GlcNAcb1-3Galb1-4(Fuca1-3)GlcNAcb1- 387 6(Galb1-3GlcNAcb1-3)Galb1-4Glc-Sp21 14882 421

121 Gala1-4Galb1-4GlcNAcb-Sp0 14778 1440 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 580 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4(Fuca1-6)GlcNAcb-Sp24 14741 845 145 Galb1-3GalNAcb1-4(Neu5Aca2-3)Galb1-4Glcb-Sp0 14656 915 123 Gala1-4Galb1-4Glcb-Sp0 14513 7218 305 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 14428 1012 539 Galb1-3GalNAcb1-3Gal-Sp21 14361 2092 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)(Galb1-4GlcNAcb1-4(Galb1- 439 4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc- Sp21 14292 762 Gala1-4Galb1-3GlcNAcb1-2Mana1-6(Gala1-4Galb1- 404 3GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp19 14252 596 120 Gala1-4(Fuca1-2)Galb1-4GlcNAcb-Sp8 14104 2354 406 Gala1-3Galb1-4GlcNAcb1-3GalNAca-Sp14 13913 1370 334 Gala1-4Galb1-4GlcNAcb1-3Galb1-4Glcb-Sp0 13804 878 116 Gala1-3Galb1-4GlcNAcb-Sp8 13711 1208 Gala1-3Galb1-4GlcNAcb1-2Mana1-6(Gala1-3Galb1- 364 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp20 13661 821 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)Galb1-4GlcNAcb1-4(Gal b1-4GlcNAcb1- 509 2)Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAc- Sp21 13274 2181 306 Galb1-4GlcNAcb1-6Galb1-4GlcNAcb-Sp0 13240 2000 Gala1-3Galb1-4GlcNAcb1-2Mana1-6(Gala1-3Galb1- 561 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAc- Sp24 12896 893 164 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb-Sp0 12545 1108 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 486 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4(Fuca1-6)GlcNAcb-Sp24 12536 2668 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2)Mana1-6(Galb1- 560 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Mana1- 4GlcNAcb1-4GlcNAc-Sp24 12395 680 490 Gala1-3Galb1-3GlcNAcb1-6GalNAca-Sp14 12379 2423 144 Galb1-3GalNAcb1-3Gala1-4Galb1-4Glcb-Sp0 12345 824 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 578 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 12331 316

Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 459 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp19 12325 1321 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 566 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp25 12287 1158 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 549 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp24 12213 1298 118 Gala1-3Galb1-4Glc-Sp10 12180 1145 114 Gala1-3Galb1-4(Fuca1-3)GlcNAcb-Sp8 12141 295 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 576 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 12035 1376 126 Galb1-2Galb-Sp8 12020 1199 Galb1-3GlcNAcb1-6(Galb1-3GlcNAcb1-2)Mana1- 429 6(Galb1-3GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp19 11724 1874 106 Gala1-3(Fuca1-2)Galb1-4GlcNAc-Sp0 11478 1717 1 Gala-Sp8 11397 477 147 Galb1-3Galb-Sp8 11366 1194 356 (6S)GlcNAcb1-3Galb1-4GlcNAcb-Sp0 11346 1026 141 Galb1-3GalNAca-Sp14 11339 821 Galb1-4GlcNAcb1-6(Fuca1-2Galb1-3GlcNAcb1- 430 3)Galb1-4Glc-Sp21 11330 2568 Galb1-3GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 383 3GlcNAcb1-3)Galb1-4Glcb-Sp0 11270 1196 Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 54 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp12 11182 2079 103 Gala1-3(Fuca1-2)Galb1-3GlcNAcb-Sp8 11033 2856 496 Gala1-3Galb1-4GlcNAcb1-6GalNAca-Sp14 10875 2245 124 Gala1-4GlcNAcb-Sp8 10655 816 511 Galb1-3(6S)GlcNAcb-Sp8 10593 3815 Neu5Aca2-6Galb1-4GlcNAcb1-6(Galb1-3GlcNAcb1- 478 3)Galb1-4Glcb-Sp21 10516 1253 168 Galb1-4GlcNAcb1-6(Galb1-3)GalNAc-Sp14 10359 1071 426 Gala1-3Galb1-3GlcNAcb1-3GalNAc-Sp14 10167 2685 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)GalNAca- 19 Sp8 10103 845

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 388 6(Galb1-4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1- 34377 1234 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp21 136 Neu5Aca2-6(Galb1-3)GalNAca-Sp8 34066 2897 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 459 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 30152 5559 4GlcNAcb-Sp19 167 Galb1-4GlcNAcb1-6(Galb1-3)GalNAca-Sp8 29882 2887 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)(Galb1-4GlcNAcb1-4(Galb1- 439 27665 3345 4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc- Sp21 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 569 27655 3542 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp25 146 Galb1-3GalNAcb1-4Galb1-4Glcb-Sp8 27636 4434 Sc35, Galb1-4GlcNAcb1-2Mana1-6(GlcNAcb1-4)(Galb1- Epa7, 437 4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1- 26312 890 15015 4GlcNAcb1-4GlcNAc-Sp21 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 576 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 26311 1189 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 140 Galb1-3GalNAca-Sp8 25967 3956 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)Galb1-4GlcNAcb1-4(Gal b1- 509 25745 2303 4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAc-Sp21 132 Galb1-4GlcNAcb1-6GalNAca-Sp8 25669 2611 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 486 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 25387 4481 4(Fuca1-6)GlcNAcb-Sp24 159 Galb1-4GalNAcb1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 25214 4355 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 549 24472 946 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp24 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)GalNAca- 19 24458 329 Sp8

Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAb1- 589 24430 4184 2)Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp24 305 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 23392 4681 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 582 23194 1877 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp19 301 Galb1-3Galb1-4GlcNAcb-Sp8 22786 7609 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 543 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 22713 705 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAb1-2)Mana1-6(Galb1- 583 22671 1536 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)Galb1- 303 22584 1886 4GlcNAc-Sp0 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 580 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 22392 1639 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4(Fuca1-6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 566 22239 1020 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp25 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 578 22029 1176 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 551 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 20217 1925 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp25 164 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb-Sp0 20132 6229 143 Galb1-3GalNAcb-Sp8 19224 4216 Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 370 4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1- 18686 2062 4GlcNAc-Sp21

Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 585 3Galb1-4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1- 18328 615 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 587 4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1-3Galb1- 17840 2671 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb- Sp24 382 Galb1-3GalNAca1-3(Fuca1-2)Galb1-4GlcNAc-Sp0 17520 12293 Galb1-3GlcNAcb1-2Mana1-6(Galb1-3GlcNAcb1- 325 16134 2507 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp19 306 Galb1-4GlcNAcb1-6Galb1-4GlcNAcb-Sp0 15613 17117 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 438 6(GlcNAcb1-4)(Galb1-4GlcNAcb1-2Mana1-3)Manb1- 11154 6487 4GlcNAcb1-4GlcNAc-Sp21 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)GalNAc- 20 11073 8752 Sp14

Strain, Hits Over 10,000 RFU Epa, & Glyca n Chart Ave Array Num Structure RFU StDev 443 (6S)Galb1-3GlcNAcb-Sp0 35918 3521 44 (6S)Galb1-4GlcNAcb-Sp8 29753 1919 118 Gala1-3Galb-Sp8 28888 2507 42 (6S)Galb1-4Glcb-Sp0 28452 3088 43 (6S)Galb1-4Glcb-Sp8 27477 2226 297 (6S)Galb1-4(6S)GlcNAcb-Sp0 26804 2944 110 Gala1-3GalNAca-Sp8 26558 3463 12 Galb-Sp8 26493 2104 Sc51, 108 Gala1-3(Fuca1-2)Galb-Sp18 26426 7576 Epa12, 15540 112 Gala1-3GalNAcb-Sp8 26241 2722 290 Galb1-4(Fuca1-3)(6S)GlcNAcb-Sp0 24968 4817 114 Gala1-3Galb1-3GlcNAcb-Sp0 24690 2128 444 (6S)Galb1-3(6S)GlcNAc-Sp0 24457 2196 45 (6S)Galb1-4(6S)Glcb-Sp8 24029 2301 115 Gala1-3Galb1-4GlcNAcb-Sp8 23692 3007 489 Gala1-3Galb1-3GlcNAcb1-6GalNAca-Sp14 23432 2227 156 Galb1-4(6S)Glcb-Sp8 22598 3212 1 Gala-Sp8 22450 1891

123 Gala1-4GlcNAcb-Sp8 22440 1584 300 Galb1-3Galb1-4GlcNAcb-Sp8 21610 4756 22 6S(3S)Galb1-4(6S)GlcNAcb-Sp0 21540 5619 527 Gala1-3Galb1-3GlcNAcb1-2Mana-Sp0 20717 1869 510 Galb1-3(6S)GlcNAcb-Sp8 20639 1577 116 Gala1-3Galb1-4Glcb-Sp0 20564 1821 155 Galb1-4(6S)Glcb-Sp0 20184 1011 169 Galb1-4GlcNAcb-Sp8 19837 1817 150 Galb1-3GlcNAcb-Sp8 19758 2865 304 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 19682 1720 149 Galb1-3GlcNAcb-Sp0 19479 5616 220 Fuca1-2(6S)Galb1-4GlcNAcb-Sp0 19373 6078 117 Gala1-3Galb1-4Glc-Sp10 19100 4862 174 GlcNAca1-6Galb1-4GlcNAcb-Sp8 18504 1878 113 Gala1-3Galb1-4(Fuca1-3)GlcNAcb-Sp8 17682 4876 204 GlcAb1-6Galb-Sp8 16524 2574 425 Gala1-3Galb1-3GlcNAcb1-3GalNAc-Sp14 15828 3517 194 GlcNAcb1-6Galb1-4GlcNAcb-Sp8 15793 3234 391 Galb1-3GlcNAcb1-3GalNAca-Sp14 15470 7378 170 Galb1-4GlcNAcb-Sp23 15033 3066 521 Gala1-3Galb1-4GlcNAcb1-2Mana-Sp0 14996 5057 107 Gala1-3(Fuca1-2)Galb-Sp8 14943 2309 440 Galb1-6Galb-Sp10 14284 1379 495 Gala1-3Galb1-4GlcNAcb1-6GalNAca-Sp14 14218 2840 146 Galb1-3Galb-Sp8 14171 1365 291 Galb1-4(Fuca1-3)(6S)Glcb-Sp0 14073 2172 109 Gala1-4(Gala1-3)Galb1-4GlcNAcb-Sp8 13635 1716 405 Gala1-3Galb1-4GlcNAcb1-3GalNAca-Sp14 13599 975 119 Gala1-4(Fuca1-2)Galb1-4GlcNAcb-Sp8 13384 2760 122 Gala1-4Galb1-4Glcb-Sp0 13161 3836 221 Fuca1-2Galb1-4(6S)GlcNAcb-Sp8 13138 3149 267 Neu5Aca2-6Galb1-4(6S)GlcNAcb-Sp8 13023 5277 124 Gala1-6Glcb-Sp8 12359 1638 100 Gala1-2Galb-Sp8 12049 2025 Gala1-4Galb1-3GlcNAcb1-2Mana1-6(Gala1-4Galb1- 403 3GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp19 11872 1505 171 Galb1-4Glcb-Sp0 11832 2952 168 Galb1-4GlcNAcb-Sp0 11151 2331 222 Fuca1-2(6S)Galb1-4(6S)Glcb-Sp0 11082 3804 219 (3S)Galb1-4(Fuca1-3)(6S)GlcNAcb-Sp8 11077 3738 121 Gala1-4Galb1-4GlcNAcb-Sp8 11025 488 35 (3S)Galb1-4(6S)GlcNAcb-Sp8 10875 1522 125 Galb1-2Galb-Sp8 10541 1095

305 Galb1-4GlcNAcb1-6Galb1-4GlcNAcb-Sp0 10430 2014

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev 45 (6S)Galb1-4(6S)Glcb-Sp8 31137 3136 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 27658 7373 44 (6S)Galb1-4GlcNAcb-Sp8 24244 2576 43 (6S)Galb1-4Glcb-Sp8 18493 3584 167 Galb1-4GlcNAcb1-6(Galb1-3)GalNAca-Sp8 16417 2826 22 6S(3S)Galb1-4(6S)GlcNAcb-Sp0 15196 3768 305 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 15158 888 301 Galb1-3Galb1-4GlcNAcb-Sp8 14199 2026 132 Galb1-4GlcNAcb1-6GalNAca-Sp8 12991 4572 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- Sc229, 576 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- Epa15, 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 11933 2914 15275 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 585 3Galb1-4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 11829 4196 205 GlcAb1-6Galb-Sp8 11699 1039 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAb1-2)Mana1-6(Galb1- 583 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 11482 4381 143 Galb1-3GalNAcb-Sp8 10647 4137

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 34328 8428 42 (6S)Galb1-4Glcb-Sp0 31348 8342 156 Galb1-4(6S)Glcb-Sp0 27962 5016 Sc588, 43 (6S)Galb1-4Glcb-Sp8 27085 4570 Epa16, 14788 268 Neu5Aca2-6Galb1-4(6S)GlcNAcb-Sp8 27000 2852 45 (6S)Galb1-4(6S)Glcb-Sp8 26717 731 22 6S(3S)Galb1-4(6S)GlcNAcb-Sp0 26368 1932 157 Galb1-4(6S)Glcb-Sp8 26160 2243

100

44 (6S)Galb1-4GlcNAcb-Sp8 24423 1637 511 Galb1-3(6S)GlcNAcb-Sp8 23595 1538 205 GlcAb1-6Galb-Sp8 21744 1039 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAb1- 589 21251 14171 2)Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAb1-2)Mana1-6(Galb1- 583 19616 11461 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 444 (6S)Galb1-3GlcNAcb-Sp0 18871 1482 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)Galb1- 303 18629 17416 4GlcNAc-Sp0 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 576 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 17957 11785 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 445 (6S)Galb1-3(6S)GlcNAc-Sp0 17257 2470 221 Fuca1-2(6S)Galb1-4GlcNAcb-Sp0 17203 2503 158 Galb1-4GalNAca1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 16558 4929 159 Galb1-4GalNAcb1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 14609 2461 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 587 4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1-3Galb1- 13223 15189 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb- Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 543 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 12795 8978 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp24

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev Sc121, 45 (6S)Galb1-4(6S)Glcb-Sp8 15647 769 Epa23, 445 (6S)Galb1-3(6S)GlcNAc-Sp0 11661 1386 14794 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 10452 607

101

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 566 41199 4175 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp25 45 (6S)Galb1-4(6S)Glcb-Sp8 38226 5189 445 (6S)Galb1-3(6S)GlcNAc-Sp0 30947 6132 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 580 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 26478 20679 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4(Fuca1-6)GlcNAcb-Sp24 136 Neu5Aca2-6(Galb1-3)GalNAca-Sp8 25644 5786 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 589 25256 14968 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAb1- 2)Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4G 168 Galb1-4GlcNAcb1-6(Galb1-3)GalNAc-Sp14 25071 11974 Sc608, Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- Epa24, 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 551 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 24696 15427 14133 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp25 159 Galb1-4GalNAcb1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 24592 1787 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2)Mana1-6(Galb1- 560 22704 13966 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Mana1- 4GlcNAcb1-4GlcNAc-Sp24 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 582 21076 5652 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp19 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 569 20886 21529 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp25 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAb1-2)Mana1-6(Galb1- 583 19825 15262 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24

102

44 (6S)Galb1-4GlcNAcb-Sp8 19008 7628 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 18428 20978 305 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 17086 16714 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 587 16904 16746 4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb- 143 Galb1-3GalNAcb-Sp8 16592 14193 301 Galb1-3Galb1-4GlcNAcb-Sp8 15756 14011 43 (6S)Galb1-4Glcb-Sp8 15288 15280 137 Neu5Aca2-6(Galb1-3)GalNAca-Sp14 14905 17271 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)Galb1-4GlcNAcb1-4(Gal b1-4GlcNAcb1- 509 14812 6750 2)Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAc- Sp21 157 Galb1-4(6S)Glcb-Sp8 14425 10122 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 486 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 14417 11747 4(Fuca1-6)GlcNAcb-Sp24 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)Galb1- 303 13460 12291 4GlcNAc-Sp0 147 Galb1-3Galb-Sp8 13079 8275 Mana1-6(Galb1-4GlcNAcb1-2Mana1-3)Manb1- 352 13072 8687 4GlcNAcb1-4GlcNAcb-Sp12 306 Galb1-4GlcNAcb1-6Galb1-4GlcNAcb-Sp0 11694 6603 1 Gala-Sp8 11386 3688 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 542 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 11378 545 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp12 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 549 11067 15759 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp24 171 Galb1-4GlcNAcb-Sp23 11006 8085 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 388 6(Galb1-4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1- 10891 14802 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp21 124 Gala1-4GlcNAcb-Sp8 10416 11788 Galb1-4GlcNAcb1-2Mana1-6(GlcNAcb1-4)(Galb1- 437 4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1- 10388 8488 4GlcNAcb1-4GlcNAc-Sp21 Gala1-3Galb1-4GlcNAcb1-2Mana1-6(Gala1-3Galb1- 561 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAc- 10037 6152 Sp24 444 (6S)Galb1-3GlcNAcb-Sp0 10009 12600

103

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev 137 Neu5Aca2-6(Galb1-3)GalNAca-Sp14 29194 2346 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 543 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp24 28179 633 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 542 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp12 26818 1898 298 (6S)Galb1-4(6S)GlcNAcb-Sp0 24882 1182 221 Fuca1-2(6S)Galb1-4GlcNAcb-Sp0 23059 5641 175 GlcNAca1-6Galb1-4GlcNAcb-Sp8 22551 800 159 Galb1-4GalNAcb1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 22528 1099 445 (6S)Galb1-3(6S)GlcNAc-Sp0 22148 10482 42 (6S)Galb1-4Glcb-Sp0 22109 3767 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 459 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp19 22083 1227 GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 546 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp12 21667 1452 Sc610, Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- Epa25, 486 6(Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 14134 4(Fuca1-6)GlcNAcb-Sp24 21650 347 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2)Mana1-6(Galb1- 560 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Mana1- 4GlcNAcb1-4GlcNAc-Sp24 21647 1826 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 388 6(Galb1-4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1- 3)Manb1-4GlcNAcb1-4GlcNAcb-Sp21 21315 2761 Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 370 4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1- 4GlcNAc-Sp21 21142 2317 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 589 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAb1- 2)Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4G 20675 836 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 582 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1- 6)GlcNAcb-Sp19 20508 1211

104

Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 6(GlcNAcb1-4)Galb1-4GlcNAcb1-4(Gal b1-4GlcNAcb1- 509 2)Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAc- Sp21 19901 2179 158 Galb1-4GalNAca1-3(Fuca1-2)Galb1-4GlcNAcb-Sp8 19801 9494 305 Galb1-4GlcNAca1-6Galb1-4GlcNAcb-Sp0 19770 4296 43 (6S)Galb1-4Glcb-Sp8 19030 2087 44 (6S)Galb1-4GlcNAcb-Sp8 18699 2546 157 Galb1-4(6S)Glcb-Sp8 18517 1654 Gala1-4Galb1-3GlcNAcb1-2Mana1-6(Gala1-4Galb1- 404 3GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp19 18378 824 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 587 4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb- 18206 1590 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 549 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp24 17988 664 444 (6S)Galb1-3GlcNAcb-Sp0 17438 2653 156 Galb1-4(6S)Glcb-Sp0 17417 1649 136 Neu5Aca2-6(Galb1-3)GalNAca-Sp8 17327 2231 Galb1-4GlcNAcb1-2Mana1-6(GlcNAcb1-4)(Galb1- 437 4GlcNAcb1-4(Galb1-4GlcNAcb1-2)Mana1-3)Manb1- 4GlcNAcb1-4GlcNAc-Sp21 17256 1192 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 566 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb- Sp25 17072 4086 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-6(Galb1- 4GlcNAcb1-3Galb1-4GlcNAb1-2)Mana1-6(Galb1- 583 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 16891 5893 223 Fuca1-2(6S)Galb1-4(6S)Glcb-Sp0 16608 9248 Neu5Aca2-6Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-6(Neu5Aca2-6Galb1- 607 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp12 16579 4004 45 (6S)Galb1-4(6S)Glcb-Sp8 16545 1902 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 551 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4GlcNAcb-Sp25 16508 5613

105

Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 54 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp12 16437 3821 Galb1-4GlcNAcb1-3Galb1-4(Fuca1-3)GlcNAcb1- 162 3Galb1-4(Fuca1-3)GlcNAcb-Sp0 16127 9968 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1- 569 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 2Mana1-3)Manb1-4GlcNAcb1-4GlcNAcb-Sp25 16012 1823 141 Galb1-3GalNAca-Sp14 15848 2168 135 GlcNAcb1-6(Galb1-3)GalNAca-Sp14 14870 10901 301 Galb1-3Galb1-4GlcNAcb-Sp8 14656 10725 171 Galb1-4GlcNAcb-Sp23 14503 12382 205 GlcAb1-6Galb-Sp8 14421 3302 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 576 6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 14355 4324 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 548 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4GlcNAcb-Sp12 14337 541 Galb1-3GalNAcb1-4(Neu5Aca2-8Neu5Aca2-3)Galb1- 412 4Glcb-Sp0 14304 9088 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-3)GalNAca- 19 Sp8 14115 2648 Galb1-3GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-6(Galb1-3GlcNAcb1-3Galb1-4GlcNAcb1- 572 3Galb1-4GlcNAb1-2)Mana1-6(Galb1-3GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 14050 3051 164 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb-Sp0 13679 12005 568 Galb1-3GlcNAcb1-6(Galb1-3)GalNAc-Sp14 12959 3458 124 Gala1-4GlcNAcb-Sp8 12888 9983 160 Galb1-4GlcNAcb1-3GalNAca-Sp8 12669 11347 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-6(Galb1- 580 4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-2Mana1-3)Manb1-4GlcNAcb1- 4(Fuca1-6)GlcNAcb-Sp24 12639 1509 165 Galb1-4GlcNAcb1-3Galb1-4Glcb-Sp0 11786 6566 167 Galb1-4GlcNAcb1-6(Galb1-3)GalNAca-Sp8 11461 6014 Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-2Mana1-6(Galb1-4GlcNAcb1-3Galb1- 578 4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1-3)Manb1- 4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 11285 2113 Galb1-4GlcNAcb1-6(Galb1-4GlcNAcb1-2)Mana1- 439 6(GlcNAcb1-4)(Galb1-4GlcNAcb1-4(Galb1- 4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc- 11065 6512

106

Sp21

Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1- 4GlcNAcb1-6(Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1- 585 3Galb1-4GlcNAb1-2)Mana1-6(Galb1-4GlcNAcb1- 3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb1-2Mana1- 3)Manb1-4GlcNAcb1-4(Fuca1-6)GlcNAcb-Sp24 11017 1142 Neu5Aca2-8Neu5Aca2-3Galb1-3GalNAcb1- 453 4(Neu5Aca2-8Neu5Aca2-3)Galb1-4Glcb-Sp0 10965 7033 173 Galb1-4Glcb-Sp8 10071 6810

Strain, Hits Over 10,000 RFU Epa, & Glycan Chart Ave Array Num Structure RFU StDev Sc580, 94 GalNAca1-4(Fuca1-2)Galb1-4GlcNAcb-Sp8 31892 3782 Epa26, 14156 4 GalNAca-Sp8 27627 6950

107

Figure 12: Inhibition of Epa12 binding to bone marrow-derived macrophages by sulfated GAGs. Sc51, an Epa12 fusion construct-expressing heterologous strain was assessed for adherence in the presence of increasing doses of three epimeric sulfated glycosaminoglycans. Sc49 (Epa1) and an empty control-transformed strain without the presence of any exogenous glycosaminoglycan were also included as binding controls on plates (data not shown). IC50 doses were assessed as half the concentration required to inhibt 50% of maximal binding, defined in the presence of no glycosaminoglycan.

100000 IC50 =12.95 mM Dermatan Sulfate

10000

IC50 =7.73 mM Chondroiti

CFU n Sulfate A 1000 IC50 = 0.46 mM Chondroiti n 6 Sulfate 100 0.25 10.25 20.25 30.25 40.25 mM Glycosaminoglycan

108

Experimental Procedures

Whole yeast binding to glycan arrays

Heterologous expression strains were grown to mid log phase in Casamino Acid medium

+ 2% dextrose and subcultured overnight, such that the OD600 the following day at harvest would be 1.0. 50 uL of 25 mg/mL DiOC6 dye stock was directly added to 50 mLs of OD600 = 1.0 culture, swirled, then pelleted at 4000 rpm for 12 minutes. Strains were washed 4 times with 1X PBS, then once with 1X HBSS + 5 mM CaCl2. Yeast were hybridized to glycan arrays with gentle agitation for 1.5 hours, then washed gently 3 times with 1X HBSS + 5 mM CaCl2. Arrays were air dried and sent to the Consortium for Functional Genomics for analysis.

Glycosaminoglycan inhibition of binding to bone marrow-derived macrophages

Fixed bone marrow-derived macrophages were prepared in 24 well plates as previously described in chapter 2. Strains Sc49 (Epa1), Sc51 (Epa12), and an empty vector transformed S. cerevisiae control strain were grown overnight in Casamino acid liquid medium supplemented with 2% dextrose. Subcultures were outgrown for 5-6 hours to ensure cultures were in a logarithmic phase of growth. Strains were washed three times with 1X HBSS + 5 mM CaCl2. Sc51 was diluted out to an OD600 = 0.2 in 0, 0.25, 1.0,

16, and 32 mM sulfated glycosaminoglycan in 1X HBSS + 5 mM CaCl2. The empty vector transformed strain and Sc49 were included in each plate without the presence of sulfated glycosaminoglycan as additional controls.

1.0 mL of each yeast solution was added in triplicate to each well of a 24 well fixed macrophage plate. The plate was spun down at 100 rpm for one minute then allowed to incubate at room temperature for 10 minutes. Supernatant was aspirated from plates.

Wells were washed 4X with 0.5 mLs of 1X HBSS + 5 mM CaCl2. 0.5 mLs of 1X PBS +

109

0.05% Triton + 10 mM EDTA was added to each well. Yeast and cells were scraped into this lysis solution, resuspended well, then diluted in water. Appropriate dilutions were plated onto Casamino acid + 2% dextrose agar plates for yeast colony forming unit counts. Plates were incubated at 30ºC and colonies were counted two days later. The same protocol and strains were used with chondroitin sulfate A, chondroitin sulfate B, and chondroitin 6 sulfate as the sulfated glycosaminoglycan.

Conclusion

Akin to Epa1p, the other family members Epa12p, Epa16p, Epa24p, and Epa25p likely coordinate terminal galactose moieties similarly. The sequence at CBL1, the R at position I of CBL2, and the W at the second amino acid position in L3 are perfectly conserved in these Epa proteins (Fig 10a and 10b).

Interestingly, the three newly defined adhesins seem to defy categorization into subtypes previously defined by other Epa amino acid sequences in the CBL2 region. While overall sequence identity relates Epa16p most closely with Epa1p, Epa6p, and Epa7p

(Fig 10a), its CBL2 sequence is an exact match to Epa12p – NRDYY, which most closely resembles the previously defined Epa9 subclass (Fig 10b). In addition, the relatively strong adhesins Epa24p and Epa25p are exact matches to the Epa9 subclass

CBL2 sequence – NRDYH, although the members of this class have been empirically defined as weak adhesins at best. It is noteworthy that the long L1 regions characteristic of the Epa9 subclass are absent in both Epa24p and Epa25p, which may have an effect on binding pocket accessibility. In addition, Epa24p and Epa25p are more conserved at the CBL1 locus, with the canonical ADDL motif, while Epa9p and Epa10p replace the L with a bulky F group (Fig 10b).

110

Interpretation of glycan array results are somewhat complicated as highly branched glycans are represented by some spots, and fluorescence may reflect an additive effect of multiply bound yeasts to different branch ends. Single branched moieties are most informative, and as an arbitrary cutoff we can assign 10,000 relative fluorescence units as “strongly” fluorescent spots (Table 5). When using these criteria, glycan array results for Epa1p and Epa7p are consistent with previous results – these bind Galβ1-3GalNAc, or T antigen, as well as Galβ1-4 glycans (Fig 11a and 11c). Also consistent with previous results is the relative promiscuity of Epa6p, which binds with galactose in an α or β linkage with glucose, galactose, or an N-acetylated derivative (Fig 11b, Table 5).

Most interesting is the highly specific binding pattern of Epa12 to glycans that are terminally Gal-sulfated, a hallmark of a subset of glycosaminoglycans, or GAGs – all three of the only stringent hits for Epa12p have this characteristic (Fig 11d, Table 5).

By glycan array analysis, the other newly defined Epa adhesins have a broader specificity, while they can bind sulfated Gal moieties as well. Epa16p seems to prefer sulfated glycans as the top ten most strongly fluorescent spots are single branched sulfated glycans (Fig 11f, Table 5). However, Epa16p seems capable of binding in a similar profile to Epa1 and Epa7 proteins, as other Galβ-connected glycans are represented as high hits, as well. Unsuprisingly, Epa24p and Epa25p have very similar binding profiles, as they are highly related proteins. Binding capacity for both these proteins are similar to Epa16p, but neither display Epa16p’s strong preference for sulfated glycans (Fig 11h, 11i, Table 5). Interestingly, Epa12p, Epa16p, Epa24p, and

Epa25p harbor tyrosines in position III of CBL2, and not polar amino acids like lysine or asparagine. This suggests that properties of these residues alone may not be sufficient for determining binding characteristics to putative ligands.

111

As a follow-up to the remarkable adherence mediated by Epa12 to bone marrow macrophages, and the extraordinary specificity shown by glycan arrays, inhibition assays using epimeric sulfated GAGs were performed on fixed bone marrow-derived macrophages (Fig 12). Adapted from adherence assays performed in chapter two,

Epa12-expressing fusion strains were opsonized with each sulfated GAG prior to binding at several different doses. While chondroitin sulfate A and chondroitin 6 sulfate showed modest inhibition of binding at only the highest concentration of s-GAG, dermatan sulfate was able to inhibit binding of the Epa12-expressing strain in a steady, dose dependent manner. Concentrations at which 50% of binding was inhibited differed by over an order of magnitude for dermatan sulfate vs. other sulfated GAGs, and overall colony forming units at the highest concentration of dermatan sulfate were decreased to 2.5% that of the Epa12-expressing strain without any GAG opsonization. These results correlate nicely with the observation that dermatan sulfate is the major GAG produced by macrophages, and with glycan array results shown here.

While these studies were performed using macrophages, it is known that macrophages are not the only innate immune effectors that interact with C. glabrata. Dendritic cells were recently used to uncover potent release of the cytokine IFN-β in response to C. glabrata internalization. This was largely mediated by phagosomal TLR7 activation

(Bourgeois et al, 2011). While this study elegantly describes the syk-dependent pathway to cytokine release, initial engagement of yeast is not explored in depth. It is intriguing to note that 6-sulfated LacNAc was discovered as the major carbohydrate modification of P selectin glycoprotein ligand 1, or PSGL-1, on human dendritic cells

(Schakel et al, 2002). This particular structure, structurally denoted (6S)Galβ1-4GlcNAc, is represented in CFG array version 6.0 as spot #44, and is present in the highest hits

112 for Epa1p, Epa12p, Epa16p, Epa24p, and Epa25p. Most notably, it is the third highest hit in the glycan array for Epa12p (Fig 11, Table 5).

The ligands determined by glycan array analysis and by subsequent inhibition experiments can provide information regarding other macromolecules recognized by these Epa proteins, which may harbor the same or similar glycosylation patterns. As the complete complement of glycans in the human glycome is an ongoing area of research

(Cummings, 2009), it is likely these reagents and techniques will continue to provide further insight regarding the adherence-related pathogenicity of C. glabrata.

113

References

Bourgeois, C., Kuchler, K. (2012) Fungal pathogens – a sweet and sour treat for toll-like

receptors. Front Cell Infect Microbiol 2:142 Review.

Bourgeois, C., Majer, O., Frohner, I.E., Lesiak-Markowicz, I., Hildering, K.S., Glaser, W.,

Stockinger, S., Decker, T., Akira, S., Muller, M., Kuchler, K. (2011) Conventional

dendritic cells mount a type I IFN response against Candida spp. requiring novel

phagosomal TLR7-mediated IFN-β signaling. J Immunol 186: 3104-12.

Cummings, R.D. (2009) The repertoire of glycan determinants in the human glycome.

Mol Biosyst 5: 1087-104. Review. deGroot, P.W., Klis, F.M. (2008) The conserved PA14 domain of cell wall-associated

fungal adhesins governs their glycan-binding. Mol Microbiol 68: 535-7.

Keppler-Ross, S., Douglas, L., Konopka, J.B., Dean, N. (2010) Recognition of yeast by

murine macrophages requires mannan but not glucan. Eukaryot Cell 9: 1776 –

1787.

Kuhn, D.M., Vyas, V.K. (2012) The Candida glabrata adhesion Epa1p causes adhesion,

phagocytosis, and cytokine secretion by innate immune cells. FEMS Yeast Res

12: 398-414.

Maestre-Reyna, M., Diderrich, R., Veelders, M.S., Eulenburg, G., Kalugin, V., Bruckner,

114

S., Keller, P., Rupp, S., Mosch, H.U., Essen, L.O. (2012) Structural basis for

promiscuity and specificity during Candida glabrata invasion of host epithelia.

Proc Natl Acad Sci U S A 109: 16864-9.

Michelacci, Y.M., Petricevich, V.L. (1991) Glycosaminoglycan profile of peritoneal and

bone marrow-derived macrophages. Changes associated with macrophage

activation. Comp Biochem Physiol B 100: 617-25.

Rigden, D.J., Mello, L.V., Galperin, M.Y. (2004) The PA14 domain, a conserved all-β

domain in bacterial toxins, enzymes, adhesins, and signaling molecules. Trends

Biochem Sci 29: 335-339.

Schakel, K., Kannagi, R., Kniep, B., Goto, Y., Mutsuoka, C., Zwirner, J., Soruri, A., von

Kietzell, M., Rieber, E. (2002) 6-Sulfo LacNAc, a novel carbohydrate modification

Of PSGL-1, defines an inflammatory type of human dendritic cells. Immunity 17:

289-301.

Seider, K., Brunke, S., Schild, L., Jablonowski, N., Wilson, D., Majer, O., Barz, D., Haas,

A., Kuchler, K., Schaller, M., Hube, B. (2011) The facultative intracellular

pathogen Candida glabrata subverts macrophage cytokine production and

phagolysosome maturation. J Immunol 187: 3072 – 86.

Smith, D.F., Song, X., Cummings, R.D. (2010) Use of glycan microarrays to explore

115

specificity of glycan-binding proteins. Methods Enzymol 480: 417-44.

Zupancic, M.L., Frieman, M., Smith, D., Alvarez, R.A., Cummings, R.D., Cormack, B.P.

(2008) Glycan microarray analysis of Candida glabrata adhesion ligand

specificity. Mol Microbiol 68: 547-59.

116

Section I Chapter 5: Deletion of all Major Epas

Introduction

In the previous chapters, we have determined the complement of functional adhesins encoded by subtelomeric GPI-CWPs in C. glabrata. These were shown in chapter three to be at least partially regulated by epigenetic transcriptional silencing mediated by the

Sir family of proteins at telomere ends, and is generally dependent on the distance of the location of the gene to the first telomeric repeat. For newly identified Epa adhesins, and for Epa12p, we have identified carbohydrate ligands utilizing glycan arrays, and for

Epa12p we have shown direct inhibition of adherence by the addition of exogenous ligand. What remains is to determine whether these characterized adhesins are relevant in the native pathogen as virulence factors. Previous work in this thesis also focused on the sufficiency of specific Epa proteins to bind to cell types or particular ligands – here, the focus is on the necessity of these proteins in vitro and in vivo.

Previous experiments using gene deletions of EPA family members showed that while strong adherence phenotypes exist in vitro, in vivo infection models failed to show as drastic effects. This was attributed to compensation by other EPA family members

(Cormack et al, 1999) The most dramatic in vivo effects were seen under conditions that would derepress many family members, such as Nicotinic Acid limitation or SIR and RIF gene deletions (Castano et al, 2005; Domergue et al, 2005).

In this final chapter of this section, we delete all the major functional Epa adhesins in strain BG2, singly and in combination. While previous experiments have characterized individual gene deletions or subsets of EPA genes, the complement of adhesins encoded in this family was previously undefined. As we have been able to define the complement here, rational design of pan Epa-adhesin knockout strains was feasible.

117

Deletion strains are then tested for adherence to various cell lines, and subsequently tested for colonization in a murine infecction model.

118

Table 6: EPA deletion strains constructed. Deletion strains utilized in adherence assays and in vivo infections were generated using homologous recombination of fusion fragments containing approximately 500 bp of gene flanking sequence along with the appropriate half of a cassette encoding nourseothricin resistance, flanked by FRT sites.

Strains were screened by functional nourseothricin resistance and checked via PCR at

5’ and 3’ junctions. Presence of each gene was also checked via PCR with gene internal primers. Nourseothricin cassettes were subsequently recombined out via transient expression of an episomally encoded Flippase. White background: strains used in adherence assays. Light grey background: strains used in murine infection models. Dark grey background: intermediate strains showing lineage of EPA(11)Δ strains.

Strain Parent Number Genotype Notes Auxotrophies strain Cg676 SIR3Δ URA Cg966 SIR3Δ, EPA1/6/7Δ URA Cg967 SIR3Δ, EPA1/6/7Δ URA Cg4098 SIR3Δ, EPA12Δ URA Cg676 Cg4099 SIR3Δ, EPA12Δ URA Cg676 Cg3528 SIR3Δ, EPA1/6/7/12Δ URA Cg966 Cg3425 SIR3Δ, EPA15Δ URA Cg676 Cg3426 SIR3Δ, EPA15Δ URA Cg676 Cg3399 SIR3Δ, EPA1/6/7/15Δ URA Cg966 Cg3400 SIR3Δ, EPA1/6/7/15Δ URA Cg966 Cg3401 SIR3Δ, EPA16Δ URA Cg676 Cg3402 SIR3Δ, EPA16Δ URA Cg676 Cg3403 SIR3Δ, EPA1/6/7/16Δ URA Cg966 Cg3404 SIR3Δ, EPA1/6/7/16Δ URA Cg966 Cg4092 SIR3Δ, EPA24Δ URA Cg676 Cg4093 SIR3Δ, EPA24Δ URA Cg676 Cg4061 SIR3Δ, EPA1/6/7/24Δ URA Cg966 Cg4062 SIR3Δ, EPA1/6/7/24Δ URA Cg966 Cg4065 SIR3Δ, EPA25Δ URA Cg676 Cg4066 SIR3Δ, EPA25Δ URA Cg676

119

Cg4094 SIR3Δ, EPA1/6/7/25Δ URA Cg966 Cg4095 SIR3Δ, EPA1/6/7/25Δ URA Cg966 also referred SIR3Δ, to as SIR3Δ, Cg4413 EPA1/6/7/10/12/15/16/20/23/24/25Δ EPA(11)Δ URA Cg4400 also referred SIR3Δ, to as SIR3Δ, Cg4414 EPA1/6/7/10/12/15/16/20/23/24/25Δ EPA(11)Δ URA Cg4401 Cg2781 BG2 (wild type) Cg4260 EPA1/6/7Δ, sir3::SIR3 Cg966 Cg4261 EPA1/6/7Δ, sir3::SIR3 Cg966 also referred EPA1/6/7/10/12/15/16/20/23/24/25Δ, to as Cg4399 sir3::SIR3 EPA(11)Δ Cg4384 also referred EPA1/6/7/10/12/15/16/20/23/24/25Δ, to as Cg4402 sir3::SIR3 EPA(11)Δ Cg4397 SIR3Δ, Cg4400 EPA1/6/7/12/15/16/20/23/24/25Δ URA Cg4144 SIR3Δ, Cg4401 EPA1/6/7/12/15/16/20/23/24/25Δ URA Cg4144 Cg4144 SIR3Δ, EPA1/6/7/12/15/16/23/24/25Δ URA Cg4123 Cg4123 SIR3Δ, EPA1/6/7/12/15/16/23/24Δ URA Cg4090 Cg4090 SIR3Δ, EPA1/6/7/12/15/16/23Δ URA Cg4056 Cg4056 SIR3Δ, EPA1/6/7/15/16/23Δ URA Cg3540 Cg3540 SIR3Δ, EPA1/6/7/15/16Δ URA Cg3404 EPA1/6/7/10/12/15/16/20/23/24/25Δ, Cg4384 sir3::SIR3 URA Cg4327 EPA1/6/7/10/12/15/16/20/23/24/25Δ, Cg4397 sir3::SIR3 URA Cg4372 EPA1/6/7/12/15/16/20/23/24/25Δ, Cg4327 sir3::SIR3 URA Cg4253 EPA1/6/7/12/15/16/20/23/24/25Δ, Cg4325 sir3::SIR3 URA Cg4251 EPA1/6/7/12/15/16/23/24/25Δ, Cg4253 sir3::SIR3 URA Cg4145 EPA1/6/7/12/15/16/23/24/25Δ, Cg4251 sir3::SIR3 URA Cg4144 Cg4145 SIR3Δ, EPA1/6/7/12/15/16/23/24/25Δ URA Cg4124 Cg4124 SIR3Δ, EPA1/6/7/12/15/16/23/24Δ URA Cg4091 Cg4091 SIR3Δ, EPA1/6/7/12/15/16/23Δ URA Cg4051 Cg4051 SIR3Δ, EPA1/6/7/12/16/23Δ URA Cg3533 Cg3533 SIR3Δ, EPA1/6/7/16/23Δ URA Cg3403

120

Table 7: Primers used to create EPA deletion strains. Deletion strains utilized in adherence assays and in vivo infections were generated using homologous recombination of fusion fragments containing approximately 500 bp of gene flanking sequence along with the appropriate half of a cassette encoding nourseothricin resistance, flanked by FRT sites. Strains were screened by functional nourseothricin resistance and checked via PCR at 5’ and 3’ junctions. Presence of each gene was also checked via PCR with gene internal primers. Nourseothricin cassettes were subsequently recombined out via transient expression of an episomally encoded

Flippase. (a) Primers used to amplify out flanking regions (b) Primers used to check correct integration of the NAT cassette. ON6112 = AATTCAACGCGTCTGTGAGG;

ON6113 = GACATCATCTGCCCAGATGC.

(a)

Forward Reverse Forward Primer Reverse Primer Accession Num Region Primer Primer Sequence Sequence Name Name CACGGCGCGCCT EPA10, TGGGAAATGCGCT AGCAGCGGTCTC ON6792 ON6793 5' GCATGGG CGTGTATTAAATT CAGL0A01284g TTGTTAG GTCAGCGGCCGCA EPA10, TGAAGCTGCTCC TCCCTGCACCCTTT ON6794 ON6795 CGTGATGG 3' GGCAGTTGACAAG CACGGCGCGCCT EPA12, AACTTTCAGCGATT AGCAGCGGCGCA ON6260 ON6261 5' TGAAGC ATTTACTGGTCTC CAGL0M00132 ATA g GTCAGCGGCCGCA EPA12, TCCCTGCTAGTTAC TAGTCGCAATAT ON6262 ON6263 3' TTCATCTATATCAT GGTCAAGG CAAATATTCG CACGGCGCGCCT EPA15, CGGCCTCACTATAA AGCAGCGGCTTC ON6162 ON6163 5' CCTCAC GTATTTCACAAAA GCAC CAGL0J11968g GTCAGCGGCCGCA EPA15, TCCCTGCTAGTTAC GTCGAGGCCTTT ON6164 ON6165 3' TTCATCTATATCAT CTAGACAC CAAATATTCG

121

CACGGCGCGCCT EPA16, CCTTTATAGGCAAG AGCAGCGGCAAT ON6168 ON6169 5' CATAAC AGCTTATACCAG CAGL0F00170g TTTTTCC GTCAGCGGCCGCA EPA16, GGCAGGGTAACT TCCCTGCTAAAGTG ON6170 ON6171 TCGATTGG 3' TACTAGTTCTGTG CACGGCGCGCCT EPA20, TAGTGCTGTCTATT AGCAGCGGTTTC ON6278 ON6279 5' GATGAG ACATCAATATACA CAGL0E00275g GAAGAC GTCAGCGGCCGCA EPA20, TCTAGCACAGAA TCCCTGCTGATCTT ON6280 ON6281 GACAAACC 3' GGAAGGTAACAAA CACGGCGCGCCT EPA23, GATATTCTGCAGCC AGCAGCGGGATT ON6266 ON6267 5' CATAGC TTTAATTCAATAT CTTAGTTTTATTC CAGL0I00220g GTCAGCGGCCGCA EPA23, TCCCTGCTAACATT ATTCCAGAGTCC ON6268 ON6269 3' ATTACCATTATGTG AGTGTTAC TCTTTAACAGC CACGGCGCGCCT EPA24, TATGATATTACGCC AGCAGCGGCTCG ON6174 ON6175 5' ATGGTG AGAATGTATAGAT CAGL0A00162g ATC GTCAGCGGCCGCA EPA24, TCCTTGGAATGC TCCCTGCTAATCGT ON6176 ON6177 CAGATCTC 3' ATCTAATTAGGTT CACGGCGCGCCT EPA25, TGCTATCACCAATG AGCAGCGGCTCG ON6180 ON6181 5' TCTTAC AGAATGTATAGAT CAGL0C05595g ATC GTCAGCGGCCGCA EPA25, TCTCTAGGGCAT TCCCTGCTAATCGT ON6182 ON6183 TCACAAGC 3' ATCTAATTAGGTT

122

(b)

Border Check NAT primer Border Check primer primer Accession Num Region name sequence used EPA10, ON6796 AATTGCCACTATGCCCATCC ON6112 5' CAGL0A01284g EPA10, ON6797 AAGCATCGGCACATATTCGG ON6113 3' EPA12, ON6264 TGGCTATAACGCCAAGTACC ON6112 5' CAGL0M00132g EPA12, ON6265 TAGTTGCTGGTAGTAGTGAG ON6113 3' EPA15, ON6166 CCTGGAGTTGTGGCTAGATA ON6112 5' CAGL0J11968g EPA15, ON6167 TCAGTCTGTCCAGCAATTGT ON6113 3' EPA16, ON6172 GATACTCACGAATCTCATTG ON6112 5' CAGL0F00170g EPA16, ON6173 TCATGGCTGGACGAACGTTT ON6113 3' EPA20, ON6284 CCGGCTGTATTCAAGTGTAG ON6112 5' CAGL0E00275g EPA20, ON6285 GGTGCCACACTAACCTTACG ON6113 3' EPA23, ON6270 TGACATGCCAAACCGACAAG ON6112 5' CAGL0I00220g EPA23, ON6271 TTGACGCAGTTTGATATCCC ON6113 3' EPA24, ON6178 GTGCTCTTGCAACAATACAG ON6112 5' CAGL0A00162g EPA24, ON6179 CGTAGATGGCATAGTCACAG ON6113 3' EPA25, ON6184 GTGCCCAAGTTTGTAATCTC ON6112 5' CAGL0C05595g EPA25, ON6185 CGTAGATGGCATAGTCACAG ON6113 3'

123

Figure 13: Adherence of Epa deletion mutants to Lec2 cells. Adherence of strains was assessed in technical triplicates in 24 well plates, against confluent monolayers of cells. Epa deletion strains were tested in biological duplicates when available (depicted in adjacent bars), and technical triplicates across all strains. Binding indices are calculated as the ratio of colony forming units (CFU) compared to a maximally binding control (Cg676: SIR3Δ). (a) Adherence of single EPA deletion strains against Lec2 cells

(b) Adherence of quadruple EPA deletion strains against Lec2 cells.

(a)

124

(b)

125

Figure 14: Adherence of Epa deletion mutants to various cell types. Adherence of strains was assessed in technical triplicates in 24 well plates, against fixed confluent monolayers of cells. Epa deletion strains were tested in biological duplicates. Binding indices are calculated as the ratio of colony forming units (CFU) compared to the maximally binding control (Cg676: SIR3Δ). S. cerevisiae WT strain BY4742 was used as a non-adherent control (S.c.). SIR3Δ, EPA(11)Δ is a strain deleted for SIR3, EPA1,

EPA6, EPA7, EPA10. EPA12, EPA15, EPA16, EPA20, EPA23, EPA24, and EPA25.

(a) Lec2 (b) HRGEC (c) HBEC (d) HUVEC (e) A-498 (f) T-24 (g) Caco2-T (h) Bone marrow-derived macrophages

(a)

126

(b)

(c)

127

(d)

(e)

128

(f)

(g)

129

(h)

130

Figure 15: Organ colonization of C. glabrata infected BALB/c mice by Epa deletion strains. Shown are CFU counts of organs harvested from individual mice infected with WT (BG2), Epa1,6,7Δ, or Epa1,6,7,10,12,15,16,20,23,24,25Δ (Epa(11)Δ) strains, 7 days post infection. Diamonds = WT, Circles = Epa1,6,7Δ, Squares =

Epa(11)Δ. Colors denote strain growth condition: Grey = +NA (SC + 3.25 µM NA +

0.04% dextrose) or –NA (SC + 2% dextrose) medium. Black bars indicate geometric means. Top and bottom panels indicate two separate biological replicates. (a) Spleen

(b) Liver (c) Kidney

131

(a)

132

(b)

133

(c)

134

Experimental Procedures

Strain construction

All further Epa deletion strains were constructed from Cg676, a ura- SIR3Δ background, or Cg966, a ura- SIR3Δ, EPA1Δ, EPA6Δ, EPA7Δ parent previously described in

Castano et al, 2005. EPA deletions were obtained by homologous replacement of each

ORF with a NAT cassette encoding nourseothricin resistance, delivered via transformation of PCR products containing the NAT sequence flanked by FRT sites and approximately 500 bp of up and downstream gene flanking sequences. Transformants were outgrown on YPD agar for 1 day at 30C to allow for expression of the resistance gene, then replica plated onto YPD containing 100 ug/mL Nat. Transformants were streaked to single colonies on YPD containing 100 ug/mL Nat, then checked via PCR at the 5’ junction, 3’ junction, and with internal ORF primers for correct replacement of each gene. NAT cassettes were excised by transforming a ura+ non-propagating plasmid encoding the flip recombinase, pRD16. Loss of Nat resistance and Ura auxotrophy was monitored in two successive passes via replica plating onto YPD (for strain preservation), 100 ug/mL Nat YPD (for loss of the NAT cassette), and CAA agar (for loss of pRD16).

For strains used in disseminated mouse infections, SIR3 was restored at its native locus by transformation with the ura containing plasmid pIC103 digested with BstEII in a two- step integration, as previously described in Castano et al, 2005. The first integration was selected for using the uracil deficient medium, CAA agar. Selection was released by outgrowth on YPD agar, then the second integration looping out the plasmid backbone was selected for using ura counterselection on 5-FOA. The endogenous URA locus was subsequently restored by transformation with pBC34.1 digested with PstI.

135

Replacements were monitored by growth on ura dropout medium CAA agar and G418 sensitivity.

Adherence assays

The following strains were used in these assays: Sc4742 (S. cerevisiae WT strain 4742),

Cg676 (SIR3Δ), Cg966 and Cg967 (SIR3Δ, EPA1/6/7Δ), Cg3403 and Cg3404 (SIR3Δ,

EPA1/6/7/16Δ), Cg4413 and Cg4414 (SIR3Δ, EPA1/6/7/10/12/15/16/20/23/24/25Δ).

Each strain was cultured overnight in YPD broth, rotating at 30ºC. These were subcultured the following morning into fresh YPD broth and outgrown for four hours, such that the OD600 was approximately 1.0 at the start of the experiment.

Strains were washed 3X with 1X HBSS + 5 mM CaCl2 and OD600 was measured to determine culture density. Cultures were diluted to an OD600 of 0.1 (10^6 cells/mL) to create inocula. Each strain was tested across three wells, with 1.0 mL of inoculum added to each well. Inocula were spun down onto mammalian cells at low speed (100-

200 rpm) for 1 minute, and allowed to incubate at room temperature for 10 minutes.

Cells were subsequently washed four times with 1X HBSS + 5 mM CaCl2. 0.5 mLs of

Lysis Buffer (1X PBS + .05% Triton-X100 + 10 mM EDTA) was added to each well, and cells were thoroughly scraped and resuspended. These were serially diluted in water and plated at multiple dilutions onto YPD Agar. CFUs were determined after plate incubation at 30ºC for 2-3 days.

Mouse infection

The following strains were used in these assays: Cg2781 (wild-type clinical isolate BG2, ura+), Cg4260 and Cg4261 (Epa1/6/7Δ, sir3::SIR3, ura+), Cg4399 and Cg4402

(Epa1/6/7/10/12/15/16/20/23/24/25Δ, sir3::SIR3,ura+). Infections were performed in two

136 separate rounds with Cg2781, Cg4260, and Cg4399 in the first round, and Cg2781,

Cg4261, and Cg4402 in the second round, for biological duplicates.

Strains were inoculated into 5 mLs of SC (Synthetic Complete) medium supplemented with 10 µM NA (Nicotinic Acid) and 2% dextrose and grown overnight rotating at 30ºC.

These were subcultured the following day into fresh SCD + 10 µM NA, and allowed to grow for five hours. Cultures were washed 2X with NA deficient SC broth, spec’ed to determine culture density, then subcultured into 30-50 mLs of +NA medium (SC + 3.25

µM NA + 0.04% dextrose) or –NA medium (SC + 2% dextrose) at a starting OD600 =

0.05. Cultures were grown shaking at 30ºC for approximately 14 hours.

Cultures were washed 2X with 1X PBS, then resuspended in PBS for an OD600 = 10.0 to create inocula. 9 adult Balb/c female mice were infected per strain grown with and without NA via tail vein injection with 0.1 mLs of appropriate inocula (54 mice per experiment, 108 mice total). Mice were sacrificed 7 days post infection via CO2 inhalation. Liver, kidney, and spleen were homogenized in 1.0 mL of PBS and plated at appropriate dilutions on YPD agar plates supplemented with pen/strep. Plates were incubated at 30ºC then counted for CFUs.

137

Conclusion

While evidence was provided in previous chapters regarding the sufficiency of specific

Epa proteins to mediate adherence, necessity of each and/or a subset of these Epa proteins is not yet delineated. To explore this, EPA deletions were constructed either in a SIR3Δ background or in a SIR3Δ , EPA1Δ, EPA6Δ, and EPA7Δ background. These mutants were chosen as starting points to tease out the contribution of each Epa in a maximally adherent background, and the same background with previously defined major adhesins deleted, respectively (Castano et al, 2005; de Las Penas et al, 2003).

Using the major adhesins determined in heterologous expression adhesion assays and glycan array analyses, single EPA deletions were created in both backgrounds. These were constructed using unique primers to PCR amplify approximately 500 bp of 5’ and 3’ flanking regions to each EPA gene. These were fused to 5’ and 3’ fragments of the nourseothricin resistance cassette, flanked by FRT sites with a 314 bp overlapping segment. Equimolar amounts of each fragment were transformed into competent cells made from background strains and correct transformants were selected for on nourseothricin containing plates. Clones obtained after this selection were checked via

PCR at each junction, and for the presence of the gene with gene-internal primers.

Nourseothricin resistance cassettes were recombined out via the transient expression of a flippase from an episomal, URA marked vector. Appropriate recombination and loss of the episome was assessed via loss of growth on nourseothricin containing and URA- plates (Table 6).

Initial experiments with these mutants assessed adherence on Lec2 cells (Fig 13). The loss of Epa12p and Epa15p singly did not seem to confer any loss of adherence in a

Sir3Δ background. Loss of Epa16p, Epa24p, and Epa25p seem to confer a slight loss of

138 adherence in this background, although results were highly variable across replicates

(Fig 13a). Absence of a significant phenotype in this background is unsurprising, as functional redundancy and/or strong adherence mediated by Epa1p, Epa6p, and Epa7p may mask adherence mediated by assayed Epa deletion strains.

Adherence results in the SIR3Δ, EPA1/6/7Δ background are more informative (Fig 13b).

When compared to the triple Epa deletion strain, deletion of EPA15 seems to have little or no effect. Deletion of EPA24 or EPA25 leads to a modest loss in adherence against

Lec2 cells. Deletion of EPA16, however, leads to a significant drop in adherence.

Since Epa16p was found to be the next strongest adhesin after Epa1p, Epa6p, and

Epa7p, the quadruple gene deletion was utilized in adherence assays against multiple cell lines (Fig 14), along with the triple Epa1,6,7 mutant as well as an 11 EPA deletion strain, in which EPA1, 6, 7, 10, 12, 15, 16, 20, 23, 24, and 25 genes were deleted. A

SIR3Δ background was used in these expierments.

Deletion of the top three adhesins, Epa1p, Epa6p, and Epa7p, diminished binding to

Lec2 cells by almost a log in a repetition of the previous experiment (Fig 14a). Deletion of Epa16p in addition to these three brought CFU counts down yet another log, suggesting that much of the residual binding is attributable to Epa16p. Suprisingly, deletion of the rest of the Epa adhesins determined in chapter 2 made little to no difference in binding to Lec2 cells, despite results suggesting that these other Epa proteins are sufficient to confer binding, alone. This suggests that these proteins may not be expressed under our specific growth conditions, or if they are, may not be stable or are masked by cis interactions with other glabrata-specific cell wall proteins (Fig 14a).

This same drastic drop with the quadruple EPA deletion strain is seen for HRGEC cells and Bone marrow-derived macrophages (Fig14b and h). Interestingly, the additional

139

EPA genes seem to play a greater role in adherence to human brain endothelial cells and the uroepithelial A-498 cell line (Fig 14c and e), evidenced by greater decreases of the EPA(11)Δ from the quadruple deletion CFU count. Although we expected to see a drop from the quadruple strain in EPA(11)Δ adherence to bone marrow-derived macrophages, as this would further implicate Epa12p as a major adhesin for this cell type, we saw little to no difference between these strains. We can theorize that we may be at the limit of detection for C. glabrata in these assays, which may not directly mirror the adherence profile of S. cerevisiae, as it is known their cell wall structures differ.

Supporting this hypothesis, it was noted by independent researchers that Epa1p- mediated binding to macrophage-like cells was masked by Dectin-1 interaction with β- glucan (Kuhn and Vyas, 2012).

Mouse infection results provide some valuable insights (Fig 15). Strains were grown in

NA replete and depleted conditions, as a kidney hypervirulence phenotype is known to exist under limiting NA conditions (Domergue et al, 2005; unpublished data, Cormack lab). This phenotype was thought to be the result of derepression of EPA genes at the subtelomeres, due to limitation of NA cofactor-dependent silencing machinery. A strain deleted for relevant Epa adhesins would show a drop in colonization under these conditions. Interestingly, the results suggest that alternative EPA genes are important for colonization across organ types in replete conditions, with the most drastic effect shown in spleens. However, EPA genes beyond EPA1, EPA6, and EPA7 seem dispensable for colonization under limiting NA conditions. Conservatively, this could indicate that there may be involvement of alternative EPA genes not defined as adhesins in our assays. Less conservatively, these data may suggest that the hypervirulence phenotype may be due to alternative mechanisms.

140

References

Castano, I., Pan, S.J., Zupancic, M., Hennequin, C., Dujon, B., Cormack, B.P. (2005)

Telomere length control and transcriptional regulation of subtelomeric adhesins

in Candida glabrata. Mol Microbiol 55: 1246-58.

Cormack, B.P., Ghori, N., and Falkow, S. (1999) An adhesin of the yeast pathogen

Candida glabrata mediating adherence to human epithelial cells. Science 285:

578-582.

De Las Penas, A., Pan, S.J., Castano, I., Alder, J., Cregg, R., and Cormack, B.P. (2003)

Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata

are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent

transcriptional silencing. Genes Dev 17: 2245-2258.

Domergue, R., Castano, I., De Las Penas, A., Zupancic, M., Lockatell, V., Hebel, J.R.,

Johnson, D., Cormack, B.P. (2005) Nicotinic acid limitation regulates silencing of

Candida adhesins during UTI. Science 308: 866-70.

Kuhn, D.M., Vyas, V.K. (2012) The Candida glabrata adhesion Epa1p causes adhesion,

phagocytosis, and cytokine secretion by innate immune cells. FEMS Yeast Res

12: 398-414.

141

SECTION II: External alkalinization of Candida glabrata

142

Section II Chapter 6: Background and Significance

In the previous section, adherence to host cells was explored as an early event important in virulence. For many Candida species, virulence is aided by the ability of the pathogen to adapt to different niches. These adaptations can take many forms to enable appropriate responses to different environmental cues. Some fungal species can switch between different morphologies for optimal colonization of various locales, while others can express specific cell wall glycoproteins allowing for immune escape (Davis, 2003;

Hung et al, 2007). An important environmental trigger sensed by many pathogens is pH

– both acidic and alkaline. Enterically acquired pathogens need to survive highly acidic environs such as the stomach, and pathogens that moonlight as commensal gut organisms may need to survive more alkaline milieus present in different areas of the intestine (Merrell and Camilli, 2002).

On an immunologically relevant level, pathogens that are phagocytosed by innate immune effectors during the early infection process must find ways to survive the phagosomal environment, and eventual acidification as the pathogen-containing phagosome fuses with lysosomal compartments (Fairn and Grinstein, 2012). It is hypothesized that the phagosomal environment is glucose poor, with amino acids being a potential carbon source (Vylkova et al, 2011). The production of reactive oxygen and nitrogen species, as well as the activation of several different acid hydrolases and various antimicrobial peptides, provide additional stressors for an engulfed pathogen inside an innate effector cell (Soldati and Neyrolles, 2012).

It is known that C. glabrata is able to survive and even replicate within one type of primary immune effector - macrophages (Seider et al, 2011; Rai et al, 2012). However, the process(es) by which C glabrata is able to resist and/or subvert the macrophage’s

143 antimicrobial onslaught is only starting to be understood. Recent research has just begun to explore possible C. glabrata escape of the immune response, including phosphatidylinositol 3 kinase-mediated inhibition of phagolysosome maturation (Rai et al, 2015). In this section, we perform preliminary experiments to elucidate early mechanisms by which C. glabrata is able to survive the carbon restricted, acidifying and free-radical rich environment of the macrophage’s phagosome. In the final pages, we propose experiments based on these preliminary results that could lead to key insights regarding C. glabrata survival mechanisms within a host.

External pH modulation by pathogens

Although internal microbial responses to differing environmental pH have been studied extensively in the context of many different pathogens, not much information exists regarding the ability of specific pathogens to actively modify the pH of their immediate microenvironments. It is known that Helicobacter pylori is able to maintain neutral cytosolic and periplasmic pH by expressing a urease partly on its cell surface. The urease functions to convert urea to ammonia, thereby creating an alkalinized niche surrounding the bacterium, and allowing it to colonize very acidic surroundings like the stomach (Pflock et al, 2006). A limited number of yeast species have been found to externally alkalinize to a very restricted extent. Metarhizium anisopliae, a fungal pathogen of insects, requires about 3 days to neutralize media from pH 4.5 (St Leger et al, 1999). As with H.pylori, alkalinization by this microbe is dependent on ammonia production. This in turn creates a surrounding pH optimal for the activity of subtilisin proteases, important for penetration of the insect cuticle by M. anisopliae (St Leger et al,

1999). S. cerevisiae, the close avirulent cousin to C. glabrata, was found in one study to require 12 days to neutralize acidic media (Palkova et al, 2002).

144

The most complete study of external alkalinization by a fungal pathogen was performed using C. albicans, previously described in section I as another prevalent fungal pathogen of humans (Vylkova et al, 2011). The investigators found C. albicans was able to alkalinize media relatively quickly, and that this alkalinization was carbon-source dependent. Only when amino acids were provided as sole carbon source was C. albicans able to neutralize acidic media, conditions reminiscent of those found in intraphagosomal C. albicans engulfed by macrophages. To explore whether this is also the case with C. glabrata, we examine alkalinization of media initially at pH 4.0, with glucose, ethanol, glycerol, or casamino acids as sole carbon sources. It is also known that in C. albicans, L-glutamine or L-arginine availability is essential for external alkalinization by at least two pH units (Vylkova et al, 2011). As the amine groups of these amino acids are known to be extruded as ammonia to neutralize external acidic pH, modulation of intermediate steps in these catalytic reactions would shed some light regarding possible alkalinization pathways in C. glabrata.

Identifying key components in C. glabrata external alkalinization

For C. albicans, it is known that alkalinization requires the formation and extrusion of ammonia (Vylkova et al, 2011). This has been genetically confirmed by deleting the urease gene, DUR1,2, which catabolizes urea into ammonia and carbon dioxide. In addition, unidirectional ammonia transporter genes have also been deleted in C. albicans. Deletion of ATO5 – one of ten family members termed Ammonia Transport

Outwards, showed a stronger phenotype than deletion of other ATO genes. Both

DUR1,2Δ and ATO5Δ exhibited alkalinization defects in vitro. C. glabrata encodes one

DUR1,2 gene (CAGL0M05533g), as well as a DUR3 gene (CAGL0K03157g), the orthologue of which is annotated as a urea and polyamine transporter in S. cerevisiae.

Lack of a secretory signal peptide in the C. glabrata DUR1,2 gene indicates that unlike

145 the urease found in H.pylori, Cg Dur1,2p is not likely secreted. Modulation of the substrate pool for Dur1,2p by Dur3p transport into and/or out of the cell would likely affect the production of ammonia. C. glabrata also encodes three Ammonia Transport

Outward genes, ATO1 (CAGL0M03465g), ATO2 (CAGL0M03465g), and ATO3

(CAGL0A03212g). Transcript profiling of C. glabrata internalized by the J774A.1 macrophage-like cell line shows that ATO1 is induced 80-fold at 2 hours post infection

(Kaur et al, 2007).

Upstream in the ammonia production cascade, L-arginine is converted to ornithine and urea by the catalytic action of arginase. This is a metabolic enzyme known to have a critical role in the pathogenesis of many infectious microbes, including other fungal species (Das et al, 2010). It is important to note that mammalian cells encode their own arginases. Two isoforms exist – arginase I is expressed in the cytosol of erythrocytes, while mature arginase II is expressed in mitochondria of various tissue types, including macrophages. In macrophages, arginase can compete with inducible Nitric Oxide

Synthase (iNOS) for L-arginine as a substrate. iNOS converts L-arginine into citrulline and NO·, a critical antimicrobial agent known to be induced against pathogens like

Mycobacterium tuberculosis and Salmonella enterica. In order to subvert production of

NO·, pathogens can upregulate expression of their own arginases to compete for the L- arginine substrate pool. They can also induce overexpression of the host’s own arginase, skewing metabolism away from nitric oxide production. C. albicans is known to encode several arginases, some of which are secreted upon infection and thought to sequester L-arginine away from the NO· production pathway (Das et al, 2010). C. glabrata encodes a single arginase, CAR1 (CAGL0J07062g), the sequence of which does not include a secretory signal. The role of this gene product has not yet been characterized in the context of infection.

146

Figure 16: Putative ammonia-production and extrusion pathways in C. glabrata.

Pathways are based on known biosynthetic, catalytic, or transport-related pathways in S. cerevisiae (www.yeastgenome.org) and C. albicans (Vylkova et al, 2011).

147

Besides the utilization of L-arginine by varied, competing enzymes in order to favor pathogen survival, C. glabrata may also limit bioavailability of amino acid pools by differentially regulating several amino acid permeases. C. albicans has been shown to upregulate basic amino acid permeases during the alkalinization process. Three similar permeases are known to exist in C. glabrata (CAGL0J08162g, CAGL0J08184g,

CAGL0M00154g), and bear homology to known lysine-arginine permeases Lyp1p,

Can1p, and Alp1p in S. cerevisiae. One of these C. glabrata-encoded permease genes

(in our shorthand, LCA permeases) is encoded in the subtelomere of chromosome M

Left. This chromosomal location is noteworthy as subtelomeres have been shown in our lab to be enriched for large families of other virulence factors, as described in the previous section. Functional characterization of these proteins as arginine permeases in

C. glabrata has not been examined, although the subtelomerically encoded permease has been examined as a cystine transporter (Yaddav and Bachharwat, 2011) It should be noted that the same locus is referred to in this paper as CYN1 – here, we refer to this gene as SLCA. Defining relative permeability of these proteins for arginine, and possibly for other amino acids that may be important in the alkalinization process, could shed some light on subversion of acidification by the pathogen. Additionally, a general amino acid permease Gap1p is known to be a transporter of L- amino acids in S. cerevisiae. In

C. glabrata, the cognate (CAGL0L03267g) transcript is upregulated 30-fold at two hours post infection. Characterization of this gene product, particularly in its uptake of arginine and the subsequent effect on alkalinization, would provide additional information on arginine flux between pathogen and host.

Arginine permeases have been previously identified by the use of canavanine selection in yeast (Carrillo et al, 2010). Canavanine is an arginine analogue - integration of this amino acid into nascent peptides creates misfolded proteins, resulting in toxicity. In this

148 section we assess the resistance of specific permease deletion mutants to growth in canavanine. Mutants defective for arginine uptake would be resistant to the toxic effects of growth with this analogue.

In addition to permeability for arginine, permeability for glutamine may affect arginine pools. Arginine can be synthesized from a glutamine precursor, and growth on glutamine as sole carbon source was also shown in the C. albicans alkalinization study to support external alkalinization (Vylkova et al, 2011). A high affinity glutamine transporter is encoded by C. glabrata – AGP2 (CAGL0C00539g).

It has been shown in our lab (Cormack lab, unpublished data; Kaur et al, 2007) and other labs (Lorenz et al, 2004) that the biosynthesis of L-Arginine seems to be important in the etiology of macrophage infection by Candida species. Most of the published literature focuses on transcript profiling of Candida passaged through macrophage-like cell lines or subjected to alkalinizing conditions. From microarray studies with C. glabrata, we know that ARG3 (CAGL0I10791g) and ARG1 (CAGL0C05115g) mRNA are upregulated 3-fold at two hours post infection, increasing to 7-fold at six hours. These arginine biosynthetic genes encode enzymes that are responsible for cycling ornithine

(the other catalytic product of arginase) back into L-arginine, and could be responsible for increased downstream production of urea. ARG2 (CAGL0H02871g) can also feed into this pathway – it is an acetylglutamate synthase that catalyzes the biosynthesis of ornithine from glutamate. In addition, this same microarray study shows that CPA1

(CAGL0109592g) and CPA2 (CAGL0C04917g) are increasingly upregulated in macrophages. These genes encode glutamine-hydrolyzing arginine biosynthetic proteins. Since it is known in C. albicans that glutamine is the amino acid invoking the strongest alkalinization phenotype (Vylkova et al, 2011), and that complete catalysis of a single glutamine molecule would yield two moles of ammonia (Raushel et al, 1999),

149 characterization of the contribution of these gene products to the alkalinization process would be interesting.

Since ammonia extrusion is implicated in multiple pathogens as integral to subversion of host defense tactics, strains lacking the above pathways may be impaired for survival in the host. We assess the impact or contribution of these genes to alkalinization by exploring the ability of gene deletion strains to neutralize acidic pH, comparative to an isogenic wild-type. The ability of one such mutant to survive within a host is assessed via a small-scale systemic mouse infection.

Alkalinization in C. albicans has been linked to induction of yeast to hyphal morphogenesis, an important virulence attribute. C. glabrata does not undergo this transition, but it is tempting to speculate that broad transcriptional and/or metabolic changes occur in the same context, affecting virulence. In this final chapter, we present a promising line of investigation exploring processes involved in external alkalinization by C. glabrata, with several future proposed experiments.

150

Table 8: C. glabrata and alkalinization mutant strains. Deletion strains originate via homologous recombination from a ura3 derivative of C. glabrata strain BG2 (BG14). 5-

700 nucleotide homologous regions immediately 5’ and 3’ to each target gene were amplified out by PCR, and fused to an FRT-flanked NAT1 gene, which encodes nourseothricin resistance. Targeting DNA was transformed into BG14 and transformants screened by selection on YPD plates containing 100 µg/mL Nat. NAT1 cassettes were recombined out by transforming correct mutants with a non-propagating, ura+ vector containing FLP1 recombinase (pRD16). Mutants were transformed with pBC34.1/PstI to restore uracil prototrophy at the native locus.

Genoty Auxo- Resist- Back- Experiments Strain # pe trophies ances ground Gene Accession # used Alkalinization response to different carbon Cg2781 BG2 BG2 n/a sources; Murine disseminated infection Alkalinization Cg411 CBS CBS n/a response to different carbon sources BG14 Cg430 Ura BG2 n/a Canavanine WT sensitivity SLCA:: Cg3427 Ura Nat Cg430 CAGL000154g Canavanine NAT sensitivity LCA1:: Cg3429 Ura Nat Cg430 CAGL0J08162g Canavanine NAT sensitivity LCA2:: Cg3431 Ura Nat Cg430 CAGL0J08184g Canavanine NAT sensitivity GAP1:: Cg3552 Ura Nat Cg430 CAGL0L03267g Canavanine NAT sensitivity SLCAΔ, CAGL000154g, Canavanine Cg3554 GAP1:: Ura Nat Cg3443 CAGL0L03267g sensitivity NAT

151

LCA1Δ, CAGL0J08162g, Cg3556 GAP1:: Ura Nat Cg3445 Canavanine CAGL0L03267g NAT sensitivity LCA2Δ, CAGL0J08184g, Cg3589 GAP1:: Ura Nat Cg3447 CAGL0L03267g Canavanine NAT sensitivity Alkalinization Cg4373 BG14+ Cg430 (BG14 ura restored) by deletion mutants Alkalinization Cg4388 SLCAΔ Cg3444 CAGL000154g by deletion mutants Alkalinization Cg4389 LCA1Δ Cg3445 CAGL0J08162g by deletion mutants Alkalinization Cg4391 LCA2Δ Cg3447 CAGL0J08184g by deletion mutants CAGL000154g, SLCAΔ, Alkalinization CAGL0J08162g, Cg4387 LCA1Δ, Cg3782 by deletion CAGL0J08184g, LCA2Δ, mutants GAP1Δ CAGL0L03267g Alkalinization Cg4405 AGP2Δ Cg3776 CAGL0C00539g by deletion mutants Alkalinization Cg4404 ATO1Δ Cg3702 CAGL0M03465g by deletion mutants Alkalinization Cg4354 ATO2Δ Cg3703 CAGL0L07766g by deletion mutants Alkalinization Cg4356 ATO3Δ Cg4148 CAGL0A03212g by deletion mutants Alkalinization ATO1Δ, CAGL0M03465g, Cg4358 Cg3771 by deletion ATO2Δ CAGL0L07766g mutants ATO1Δ, CAGL0M03465g, Alkalinization Cg4403 ATO2Δ, Cg4323 CAGL0L07766g, by deletion ATO3Δ CAGL0A03212g mutants Alkalinization DUR1,2 Cg4362 Cg3714 CAGL0M05533g by deletion Δ mutants Alkalinization Cg4394 DUR3Δ Cg3700 CAGL0K03157g by deletion mutants

152

Alkalinization Cg4364 ACH1Δ Cg3774 CAGL0J04268g by deletion mutants Alkalinization Cg4375 ARG1Δ Cg3778 CAGL0C05115g by deletion mutants Alkalinization Cg4376 ARG2Δ Cg4047 CAGL0H02871g by deletion mutants Alkalinization Cg4378 ARG3Δ Cg3785 CAGL0I10791g by deletion mutants Alkalinization Cg4409 CARΔ Cg3639 CAGL0J07062g by deletion mutants Alkalinization Cg4407 CPA1Δ Cg4041 CAGL0I09592g by deletion mutants Alkalinization Cg4408 CPA2Δ Cg4043 CAGL0C04917g by deletion mutants Alkalinization CAGL0I09592g, Cg4406 CPA1Δ, Cg4121 by deletion CAGL0C04917g CPA2Δ mutants CAGL000154g, SLCAΔ, Murine CAGL0J08162g, Cg4379 LCA1Δ, Cg3781 disseminated CAGL0J08184g, LCA2Δ, infection GAP1Δ CAGL0L03267g

153

Figure 17: Optical density and pH changes in response to different carbon sources. C. glabrata cultures were grown in YNB media at a starting pH of 4.0 and

OD600 of 0.2, with the following carbon sources: 2% dextrose, 2% glycerol, 2% ethanol,

1% casamino acids, or no carbon source. Growth and alkalinization are assessed by optical density and pH meter readings, respectively, after 24 hours rotating at 37C.

OD600 (green) and pH (blue) are depicted on the Y axis, with carbon sources on the X axis. (a) clinical isolate BG2 (b) clinical isolate CBS

(a)

154

(b)

155

Figure 18: Growth of C. glabrata WT and permease mutant strains in the presence of canavanine. 0, 10 ug/mL, 50 ug/mL and 150 ug/mL canavanine (Sigma, C9758-1G) was added to standard synthetic complete liquid medium supplemented with 2% dextrose (SCD). Logarithmic phase cultures of C. glabrata strains grown in SCD were subcultured into 8 mLs of plain SCD or canavanine containing SCD at a starting OD600 of .05. Cultures were grown rotating at 30ºC. Growth was asssessed by optical density using a spectrophotometer at regular intervals. (a) WT growth in various concentrations of Canavanine; (b) Growth of single LCA deletion mutants in 150 µg/mL Canavanine; (c)

Growth of GAPΔ mutants in 150 µg/mL Canavanine

(a)

156

(b)

(c)

157

Figure 19: External alkalinization by deletion mutants in response to growth with amino acids. Strains were grown in YNB media at a starting pH of 4.0 and OD600 of

0.2, with 1% casamino acids as a carbon source. Alkalinization was assessed by pH meter readings after 24 hours rotating at 37C. pH is depicted on the Y axis, with mutant identity on the X axis.

(a)

158

(b)

(c)

159

(d)

160

Figure 20: Organ colonization of C. glabrata infected BALB/c mice by a quadruple amino acid permease deletion strain. Shown are CFU counts of spleen, liver, and kidney from female Balb/c mice infected with a WT (BG2: 2 mice, grey spots) or a

SLCAΔ, LCA1Δ, LCA2Δ, GAPΔ (4PermΔ: 4 mice, red spots) strain. Strains were grown in synthetic complete medium lacking nicotinic acid, supplemented with 2% dextrose, and injected via tail vein with approximately 2x107 yeast. Spleens, livers, and kidneys were harvested 7 days post infection, homogenized, and plated to quantify organ load.

Strains per organ are depicted on the X axis, colony forming units (CFU) are depicted on the Y axis.

161

Experimental Procedures

Alkalinization of C. glabrata strains in response to different carbon sources

The method is derived from a published study on C. albicans (Vylkova et al, 2011).

Minimal YNB liquid media is supplemented with each of the following carbon sources:

2% dextrose, 2% glycerol, 2% ethanol, 1% casamino acids, or no carbon source. Media is adapted to a starting pH of 4.0 with HCl or NaOH, and log-phase C. glabrata strains

BG2 and CBS are inoculated into these media at a starting OD600 of 0.2. Growth and alkalinization are assessed by optical density and pH meter readings, respectively, after

24 hours rotating at 37C. Cultures are taken directly, or diluted to be in the active range, for optical density measurements. Cultures are spun down at 4000 rpm x 10 minutes and supernatant is transferred to another tube for pH readings.

Strain generation

Deletion strains originate via homologous recombination from a ura3 derivative of C. glabrata strain BG2 (BG14). 5-700 nucleotide homologous regions immediately 5’ and

3’ to each target gene were amplified out by PCR, and fused to an FRT-flanked NAT1 gene, which encodes nourseothricin resistance. Targeting DNA were transformed into

BG14 and transformants screened by selection on YPD plates containing 100 µg/mL

Nat. Nourseothricin resistant isolates were screened via PCR across integration junctions and for loss of a gene-internal band for correct recombinations. The NAT1 cassettes were recombined out by transforming correct mutants with a non-propagating, ura+ vector containing FLP1 recombinase (pRD16). Transformants were passaged twice and assessed for growth on YPD, Nat YPD, and CAA (ura-) agar media.

Transformants lacking growth on the latter two media types, with positive growth on

162

YPD, were considered strains with markers appropriately flipped out. Mutants were transformed with pBC34.1/PstI to restore uracil prototrophy at the native locus.

Growth sensitivity in response to Canavanine

Growth responsiveness was assessed with a dose response curve. 0, 10 ug/mL, 50 ug/mL and 150 ug/mL canavanine (Sigma, C9758-1G) was added to standard synthetic complete liquid medium supplemented with 2% dextrose (SCD). Logarithmic phase cultures of C. glabrata strains grown in SCD were subcultured into 8 mLs of plain SCD or canavanine containing SCD at a starting OD600 of .05. Cultures were grown rotating at 30ºC. Growth was asssessed by optical density using a spectrophotometer at regular intervals.

Alkalinization of deletion strains

Experiments were performed exactly as described above in “alkalnization in response to different carbon sources,” using only casamino acids as a carbon source.

Mouse infection

The following strains were used in these assays: Cg2781 (wild-type clinical isolate BG2, ura+) and Cg4379 (SLCAΔ, LCA1Δ, LCA2Δ, GAP Δ, ura+).

Strains were inoculated into 5 mLs of SC (Synthetic Complete) medium supplemented with 10 µM NA (Nicotinic Acid) and 2% dextrose and grown overnight rotating at 30ºC.

These were subcultured the following day into fresh SCD + 10 µM NA, and allowed to grow for four hours. Cultures were washed 2X with NA deficient SC broth, spec’ed to determine culture density, then subcultured into –NA medium (SC + 2% dextrose) at a starting OD600 = 0.05. Cultures were grown shaking at 30ºC for approximately 15 hours.

163

Cultures were washed 2X with 1X PBS, then resuspended in PBS for an OD600 = 10.0 to create inocula. 2 adult Balb/c female mice were infected with Cg2781, 4 mice with

Cg4379, via tail vein injection with 0.1 mLs of appropriate inocula. Mice were sacrificed

7 days post infection via CO2 inhalation. Liver, kidney, and spleen were homogenized in

1.0 mL of PBS and plated at appropriate dilutions on YPD agar plates supplemented with pen/strep. Plates were incubated at 30ºC for two days, then counted for CFUs.

164

Results

As with C. albicans, growth of C. glabrata in the presence of Casamino acids induced alkalinization of acidic media to a neutral pH (Fig 17). This phenomenon was consistent across strain types – both strains BG2 and CBS138 displayed similar phenotypes in the presence of amino acids. Growth and pH change was largely dependent on the type of available carbon source – without carbon, there was no growth and no alkalinization.

With dextrose, the commonly used carbon source in standard yeast media, there was abundant growth with concomitant acidification. With glycerol as a carbon source, strains differed in their ability to grow. CBS seemed to grow on glycerol almost as well as on dextrose, while BG2 seemed not to be able to grow at all on this carbon source within the timeframe of the assay. Like growth in the presence of dextrose, glycerol induced acidification of the media. Ethanol seemed to be a less preferred carbon source, with little to no growth, and slight associated acidification of media (Fig 17).

Amongst amino acid permease deletion strains generated, arginine-conductive permeases were determined by obstruction of growth in the presence of the toxic arginine analogue, canavanine. A wild-type C. glabrata strain was grown in the presence of 0, 10, 50, or 150 µg/mL canavanine (Fig 18). At 10 µg/mL canavanine, there was little effect on growth. At 50 µg/mL canavanine, there was a modest effect on growth for the first 300 minutes, with OD600 differences becoming more obvious at 390 minutes. Canavanine media concentration of 150 µg/mL was still permissive for growth, but differences became apparent at much earlier timepoints – around two hours from initial exposure. By 6.5 hours, OD600 of this culture was half that of an unexposed culture (Fig 18).

165

Since 150 µg/mL canavanine showed the greatest effect, this concentration was used to test permease mutants to assess their permeability for arginine. SlcaΔ, lca1Δ, and gapΔ single mutants seemed to have no effect on canavanine sensitivity. However, lca2Δ seemed to show some resistance to canavanine (Fig 18b). The phenotype was not improved by additional deletion of GAP in this background, suggesting that Lca2p is the primary permease for arginine (Fig 18c).

Consistent with the above observation, and with prior studies showing the importance of arginine in alkalinization, an LCA2Δ strain was the most attenuated for alkalinization amongst all the single permease deletion strains, although the effect was modest (Fig

19a). A strain deleted for all three basic amino acid permeases as well as the general amino acid permease showed a more severe phenotype. None of the ATO deletion strains failed to alkalinize, even when all three were deleted (Fig 19b).

C. glabrata urea amidolyase, Dur1,2p, as well as the urea transporter Dur3p, seem to be dispensable for the alkalinization phenotype when deleted alone (Fig 19c). This is also true for most of the arginine biosynthetic genes, with a modest phenotype shown for an

ARG1Δ mutant (Fig 19d). An ACH1Δ mutant displayed the most pronounced phenotype, failing to alkalinize beyond a pH of 5.11 (Fig 19c).

To examine the in vivo effect of an arginine limited strain, the quadruple permease deletion strain was used to infect Balb/c mice in a disseminated candidiasis model (Fig

20). Inocula were delivered via tail vein injection, and spleens, livers, and kidneys were harvested 7 days later to quantify organ colonization. Surprisingly, an increase in colonization of spleens and livers was observed, while a decrease in kidney colonization occurred.

166

Conclusion & Future Directions

While phenotypes appear modest for the mutants examined thus far, there are promising leads that indicate external alkalinization is mediated by arginine availability and that import has a direct affect on candidiasis. The quadruple permease mutant shows phenotypes in multiple assays performed, and seems to evoke a loss of colonization in the kidneys in the murine infection model. Cultures for this experiment were grown under nicotinic acid starvation conditions, under which a kidney hypervirulence phenotype is known (Cormack lab, unpublished data). These results seem to suggest that basic amino acid permeases are implicated in this responsiveness to starvation.

ACH1 encodes an acetyl-coenzyme A hydrolase, implicated in the general catalysis of amino acids, and was also noted in C. albicans as a mutant that failed to alkalinize

(Vylkova et al, 2011). Although the phenotype of this mutant in the alkalinization assay was remarkable, interpretation of this result is obfuscated by its reported role in mitochondrial acetate detoxification, which can affect viability and pH (Fleck and Brock,

2009).

Surprisingly, none of the ammonia transport outwards gene deletion strains showed a phenotype in the alkalinization assay. This may be due to redundancy in function by another protein family implicated in ammonia extrusion. C. glabrata encodes two copies of an ammonium transporter, MEP3 (CAGL0I0747g and CAGL0D04928g). Deletion of these transporter in an ATO1Δ, ATO2Δ, ATO3Δ background may show a more significant phenotype.

The lack of a phenotype for single arginine biosynthetic gene deletions is less surprising, as there are a large number of redundancy pathways and import mechanisms yet to be explored. C. glabrata encodes a dicarboxylic amino acid permease, DIP5

167

(CAGL0A01199g), whose encoded orthologue in S. cerevisiae is permeable to glutamine as well as to other amino acids. The ability to transport glutamine into the yeast, beyond that controlled by Agp2p, may further modulate the downstream availability of arginine. ARG4 (CAGL0108987g) encodes another arginine biosynthetic enzyme, is upregulated 3-fold at two hours post infection, and remains upregulated at the same rate at six hours.

Mutants described here, as well as putative additional mutants described immediately above, may be used in a number of informative assays. One such assay directly measures the ability of these strains to counter antimicrobial methods employed by a phagocyte against the engulfed yeast.

A C. glabrata-containing phagosome appears to mature regularly in the first few hours of infection, as measured by appropriate localization of early and late endosomal markers

(Seider et al, 2011). Early Endosomal Antigen 1, EEA1, co-localizes with the C. glabrata containing phagosome within the first ten minutes of internalization. Lysosomal

Associated Membrane Protein 1, LAMP1, is a late endosomal marker that co-localizes with the C. glabrata containing phagosome within the first ninety minutes of internalization. However, the lysosomal acid hydrolase cathepsin D failed to associate with the phagosome. It is hypothesized C. glabrata blocks phagolysosome fusion, possibly associated with a failure to acidify to a low enough pH, or success in alkalinizing acidifying media. It is also known that in response to many different pathogens, v-

ATPases are recruited to nascent phagosomes (Kinchen and Ravichandran, 2008).

These serve not only to acidify compartments, but also to traffic along with anti-microbial hydrolases.

168

Macrophages can be cultured and infected with BG2 and putative alkalinization mutants.

These can be fixed at several timepoints post infection, and stained with α-EEA1, α-

LAMP1, α-Cathepsin D, and α-v-ATPase antibodies as previously described (Seider et al, 2011). Mutants that fail to alkalinize may recruit cathepsin D and v-ATPases to their phagosomes to a greater extent than a wild-type BG2 strain.

It is also possible to directly measure intraphagosomal acidification when macrophages are infected with C. glabrata. This can be approached two ways – the first would utilize pH-sensitive fluorescent dyes directly conjugated to the yeast cell wall. Fluorescein

Isothiocyanate (FITC) labeling of C. glabrata has been previously described (Seider et al, 2011), and used in the context of tracking acidification. The ratio of FITC fluorescence intensity when excited at 490 nm vs 440 nm can be used to score pH, and has been determined to reliably differentiate between pHs in a range of 5.0 to 7.5

(Steinberg and Grinstein, 2007). Fluorescence ratios can be compared to a standard curve generated using BG2 infected BMMΦs in the presence of nigericin-containing buffer with varying pH. The second approach would utilize acidotropic dyes to stain host cell compartments. Lysotracker Red has been used in the context of C. glabrata successfully to visualize phagosomes with a pH below 5.5 (Seider et al, 2011).

Another potential experiment explores host-derived production of nitric oxide. Given that arginine serves as a substrate for the host cell’s iNOS to produce antimicrobial NO·, NO· released by the host cell against mutants deficient for uptake of arginine may be increased. Macrophages infected with BG2 or alkalinization mutants can be assessed at multiple timepoints for NO· release into supernatant, as previously described (Ding et al,

1988).

169

C. glabrata mutants unable to alkalinize their microenvironments will likely be subjected to lower pH conditions in the phagosome, and possibly the phagolysosome. This acidification is associated with activation of multiple host-derived anti-microbial agents.

Viability of mutants unable to neutralize these conditions sufficiently may be impaired in their ability to colonize a host, and preliminary evidence supports that this is true for at least some alkalinization mutants. Further experiments would provide key insights regarding the ability of C. glabrata to survive or even persist within innate effector cells.

170

References

Carrillo, C., Canepa, G.E., Giacometti, A., Bouvier, L.A., Miranda, M.R., de los Milagros

Camara, M., Pereira, C.A. (2010) Trypanosoma cruzi amino acid transporter

TcAAAP411 mediates arginine uptake in yeasts. FEMS Microbiol Lett 306: 97-

102.

Das, P., Lahiri, A., Lahiri, A., Chakravorty, D. (2010) Modulation of the arginase pathway

in the context of microbial pathogenesis: a metabolic enzyme moonlighting as an

immune modulator. Plos Pathog 6:e1000899.

Davis, D. (2003) Adaptation to environmental pH in Candida albicans and its relation to

pathogenesis. Curr Genet 44: 1-7. Review.

Ding, A.H., Nathan, C.F., Stuehr, D.J. (1988) Release of reactive nitrogen intermediates

And reactive oxygen intermediates from mouse peritoneal macrophages.

Comparison of activating cytokines and evidence for independent production. J

Immunol 141: 2407-12.

Fairn, G.D., Grinstein, S. (2012) How nascent phagosomes mature to become

phagolysosomes. Trends Immunol 33: 397-405.

Fleck, C.B., Brock, M. (2009) Re-characterisation of Saccharomyces cerevisiae Ach1p:

Fungal CoA-transferases are involved in acetic acid detoxification. Fungal Genet

171

Biol 46: 473-85.

Hung, C.Y., Xue, J., Cole, G.T. (2007) Virulence mechanisms of coccidiodes. Ann N Y

Acad Sci 1111: 225-35. Review.

Kaur, R., Ma, B., Cormack, B.P. (2007) A family of glycosylphosphatidylinositol-linked

aspartyl proteases is required for virulence of Candida glabrata. Proc Natl Acad

Sci 104: 7628-33.

Kinchen, J.M., Ravichandran, K.S. (2008) Phagosome maturation: going through the

acid test. Nat Rev Mol Cell Biol 9: 781-95.

Lorenz, M.C., Bender, J.A., Fink, G.R. (2004) Transcriptional response of Candida

albicans upon internalization by macrophages. Eukaryot Cell 3: 1076-87.

Merrell, D.S., Camilli, A. (2002) Acid tolerance of gastrointestinal pathogens. Curr Opin

Microbiol 5: 51-5. Review.

Palkova, Z., Devaux, F., Ricicova, M., Minarikova, L., Le Crom, S., Jacq, C. (2002)

Ammonia pulses and metabolic oscillations guide yeast colony development. Mol

Biol Cell 13: 3901-14.

Pflock, M., Kennard, S., Finsterer, N., Beier, D. (2006) Acid-responsive gene regulation

in the human pathogen Helicobacter pylori. J Biotechnol 126:52-60.

Rai, M.N., Balusu, S., Gorityala, N., Dandu, L., Kaur, R. (2012) Functional genomic

172

analysis of Candida glabrata-macrophage interaction: role of chromatin

remodeling in virulence. Plos Pathog 8: e1002863.

Rai, M.N., Sharma, V., Balusu, S., Kaur, R. (2015) An essential role for phosphatidyl 3-

kinase in the inhibition of phagosomal maturation, intracellular survival and

virulence in Candida glabrata. Cell Microbiol 17: 269-87.

Raushel, F.M., Thoden, J.B., Holden, H.M. (1999) The amidotransferase family of

enzymes: molecular machines for the production and delivery of ammonia.

Biochemistry 38: 7891-9. Review.

Seider, K., Brunke, S., Schild, L., Jablonowski, N., Wilson, D., Majer, O., Barz, D., Haas,

A., Kuchler, K., Schaller, M., Hube, B. (2011) The facultative intracellular

pathogen Candida glabrata subverts macrophage cytokine production and

phagolysosome maturation. J Immunol 187: 3072 – 86.

Soldati, T., Neyrolles, O. (2012) Mycobacteria and the intraphagosomal environment:

take it with a pinch of salt(s)! Traffic 13: 1042-52.

Steinberg, B.E., Grinstein, S. (2007) Assessment of phagosome formation and

maturation by fluorescence microscopy. Methods Mol Biol 412: 289-300.

St. Leger, R.J., Nelson, J.O., Screen, S.E. (1999) The entomopathogenic fungus

Metarhizum anisolpliae alters ambient pH, allowing extracellular protease

173

production and activity. Microbiology 145: 2691-9.

Vylkova, S., Carman, A.J., Danhof, H.A., Collette, J.R., Zhou, H., Lorenz, M.C. (2011)

The fungal pathogen Candida albicans autoinduces hyphal morphogenesis by

raising extracellular pH. MBio 2:e00055-11.

Yaddav, A.K., Bachhawat, A.K. (2011) CgCYN1, a plasma membrane cystine-specific

Transporter of Candida glabrata with orthologues prevalent among pathogenic

Yeast and fungi. J Biol Chem 286: 19714-23.

174

ELIZABETH HWANG-WONG [email protected] Ph: 516.902.4325 CURRICULUM VITUS The Johns Hopkins University School of Medicine November 2016

Educational History Ph.D. 2016 Program in Biochemistry, Cell, & Molecular Biology Johns Hopkins School of Medicine, Dept of Mol Bio & Genetics Mentor: Brendan Cormack, Ph.D. Project: Subtelomeric adhesins in Candida glabrata are major virulence factors M.A. 2006 Biology City University of New York at Hunter College B.A. 2003 Major: English with a concentration in British Literature Minor: Biology

Other Professional Experience Research Technician II 2008-2009 Columbia University, Jessell Lab Projects: Defining interneurons in motor neuron circuits, Transcription factor mutants that effect step cycle in mice Research Technician I 2006-2008 Cornell University SOM, Ehrt Lab Projects: Mycobacterium tuberculosis BioA mutants are attenuated in virulence, Proteasomal requirement in infection with Mycobacterium tuberculosis

Scholarships & Funding NIH Predoctoral Training Grant 2009-2012 Grant #5T32GM007445-35 ASM Travel Award 2012 11th ASM Conference on Candida & Candidiasis

Publications 1. Hwang-Wong E, Green B, Zupancic M, Benoit N, Cormack BP. Epithelial adhesins encoded in the subtelomeres of Candida glabrata are major virulence factors. To be submitted. 2. Tati S, Davidow P, McCall A, Hwang-Wong E, Rojas IG, Cormack B, Edgerton M. Candida glabrata binding to Candida albicans hyphae enables its development in oropharyngeal candidiasis. PLoS Pathog. 2016 Mar 30;12(3):e1005522. 3. Beese-Sims SE, Pan SJ, Lee J, Hwang-Wong E, Cormack BP, Levin DE. Mutants in the Candida glabrata glycerol channels are sensitized to cell wall stress. Eukaryot Cell. 2012 Dec; 11(12):1512-9.

Talks & Posters 1. Hwang-Wong E, Green B, Zupancic M, Benoit N, Cormack BP. Talk. Defining the complement of adhesins encoded in the subtelomeric regions of Candida glabrata and the relation to virulence. 11th ASM Conference on Candida & Candidiasis. 2012 Mar, San Francisco.

175

2. Hwang-Wong E, Green B, Zupancic M, Benoit N, Cormack BP. Poster. Towards defining the complement of adhesins encoded in the subtelomeric regions of Candida glabrata. Conference on Microbial Pathogenesis and Host Response. 2011 Sept, Cold Spring Harbor Laboratories.

Service & Leadership Treasurer, Graduate Student Association 2012-2013 Co-Founder, Hopkins Brew Club 2012-2013 Acquisitions Editor, Restriction Digest (Hopkins Newsletter) 2012-2013 BCMB Program Representative, Graduate Student Association 2010-2012

Teaching Experience Instructor, Genomics. Center for Talented Youth, Johns Hopkins University Summer 2014

176