DOCSLIB.ORG

Identification of an E-Box Motif As a Transcriptional Repressor Element in the Proximal Promoter Region of the GCLC Gene in Rat Lung Epithelial L2 Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of an E-Box Motif As a Transcriptional Repressor Element in the Proximal Promoter Region of the GCLC Gene in Rat Lung Epithelial L2 Cells 中国科技论文在线 http://www.paper.edu.cn Original Contribution Identification of an E-box motif as a transcriptional repressor element in the proximal promoter region of the GCLC gene in rat lung epithelial L2 cells Lin-Ling Chenga, Bing Lib, Jian-Dong Luoc, Hong-Bin Tub, Qi-Cai Liub, Pixin Rana,* aGuangzhou Institute of Respiratory Disease, Guangzhou Medical College, Guangzhou, Guangdong 510182, People’s Republic of China bThe Research Center for Experimental Medicine, Guangzhou Medical College, Guangzhou, Guangdong 510182, People’s Republic of China cDepartment of Pharmacology, Guangzhou Medical College, Guangzhou, Guangdong 510182, People’s Republic of China Received 11 January 2005; revised 24 April 2005; accepted 16 May 2005 Abstract Glutathione (GSH) is a critical antioxidant for protecting the airway epithelium from oxidant injury and its levels are mainly controlled by glutamate-cysteine ligase (GCL), which is the rate-limiting enzyme in GSH synthesis. A full understanding of the gene regulation mechanism of this important enzyme may disclose the role it plays in respiratory diseases. GCL is made up of two differentially regulated subunits, a catalytic or heavy subunit (GCLC) and a modifier or light subunit (GCLM). Many studies in this field led to the findings of important positive regulatory regions of the GCLC promoter. For a detailed analysis of this gene regulation in the respiratory system, we cloned a 1.76-kb 5V- flanking region of the rat GCLC gene, inserted into a luciferase reporter vector. Exonuclease III was used to cut the 5V-flanking region of the rat GCLC gene unidirectionally into deletion mutants of different lengths. Sequential deletion analysis revealed that regions from À403 to À111 and from À705 to À613 are involved in positive regulation and the region from À745 to À705 is involved in negative regulation of the GCL gene in rat lung epithelial L2 cells. Specific proteins binding to these regions were confirmed by electrophoretic mobility-shift assays (EMSAs) and antibody supershift assays. An E-box motif was found in the negative regulatory region À745 to À705. Site-directed mutagenesis proved that the functional element in this negative regulatory region was a putative E-box element. EMSA and supershift assays showed that USF1 and USF2 can specifically bind to the E-box element. Overexpression of USFs in L2 cells led to a decreased activity of the GCLC promoter. Western blotting demonstrated that the expression of GCLC protein was decreased in the retroviral USFs-expressing cells than in nontransfected (no DNA added) cells, suggesting that USF binding to the E-box at À729/À724 serves to trans-repress GCLC gene expression. These findings indicate that the E-box is an important transcriptional suppressor element in the GCLC promoter in rat lung epithelial L2 cells. Inhibition of interaction between the E-box and the USF may provide an effective means of ameliorating oxidant injury of the lung. D 2005 Elsevier Inc. All rights reserved. Keywords: E-box element; Upstream stimulatory factor; Glutamate-cysteine ligase; Glutathione; Oxidative stress; Chronic obstructive pulmonary disease Abbreviations: GCL, glutamate-cysteine ligase; GCLC, GCL catalytic or heavy subunit; GCLM, GCL modifier or light subunit; EMSA, electro- Introduction phoretic mobility-shift assay; COPD, chronic obstructive pulmonary disease; ELF, epithelial lining fluid; AP-1, activator protein 1; AP-4, activator protein 4; NF-nB, nuclear factor nB; NF1, nuclear factor 1; C/EBP, CAAT-enhancer- The lung is more liable to exposure to harmful sti- binding protein; MZF1, myeloid zinc finger 1; SP1, stimulating protein 1; mulators such as oxidants, than most other tissues. Cigarette 14 Arnt, aryl hydrocarbon receptor nuclear translocator; bHLHZip, basic helix- smoke is a very potent oxidant, as one puff contains 10 – loop-helix leucine zipper; ARE, antioxidant-response element; PCR, 1016 free radicals and has been implicated in the patho- polymerase chain reaction; FBS, fetal bovine serum; DTT, dithiothreitol; genesis and progression of chronic obstructive pulmonary PBS, phosphate-buffered sodium; SDS-PAGE, sodium dodecyl sulfate- polyacrylamide gel electrophoresis; HRP, horseradish peroxidase. disease (COPD) [1,2]. Both reactive oxygen species from * Corresponding author. Fax: +86 20 8134 0442. inhaled cigarette smoke and those endogenously formed by E-mail address: [email protected] (P. Ran). inflammatory cells constitute an increased intrapulmonary 0891-5849/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2005.05.025 转载 中国科技论文在线 http://www.paper.edu.cn L.-L. Cheng et al. / Free Radical Biology & Medicine 39 (2005) 1030–1040 1031 oxidant burden. Structural changes to essential components ison, WI). All restriction enzymes were purchased from either of the lung are caused by oxidative stress, contributing to Promega or New England Biolabs (Beverly, MA). The DIG irreversible damage of both parenchyma and airway walls gel-shift kit was purchased from Roche Molecular Bioche- [3]. Therefore, oxidative stress plays a pivotal role in the micals (Mannheim, Germany). pCMV, pCMV-USF1, and pathogenesis and progression of COPD. Antioxidant ther- pCMV-USF2 were kindly provided by Dr. Michele Sawa- apy strategies may provide an effective means of ameliorat- dogo. Antibodies used for supershift assays, including USF-1 ing lung dysfunction in COPD individuals. (sc-229), USF-2 (sc-862), c-Myc (sc-764), Arnt1 (sc-8077), Epithelial lining fluid (ELF) contains more than a 140-fold MyoD(sc-760), Mad1(sc-222),Max (sc-197), were purchased level of glutathione (GSH) compared with plasma [4,5], from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). and GSH appears to be a critical antioxidant in protecting the airway epithelium from oxidative injury [6]. The rate- Cell culture limiting enzyme in GSH synthesis is glutamate-cysteine ligase (GCL, also referred to as g-glutamylcysteine synthe- Rat lung epithelial L2 cells, initially derived from type II tase or g-GCS) [7], which is a heterodimer consisting of a pneumocytes [12,13], were obtained from the American catalytic or heavy subunit (GCLC, 73 kDa) and a regulatory Type Culture Collection (ATCC, Rockville, MD). L2 cells or light subunit (GCLM, 27.7 kDa) [8], The heavy subunit were grown in F-12K medium (Gibco-BRL Life Technol- contains all of the catalytic activity, and it has been ogies, Grand Island, NY) supplemented with 10% fetal investigated in more detail than the light subunit [9]. Both bovine serum. subunits can be induced by acute oxidative stress and inflammatory mediators [10,11]. Since GCL is a major Cloning of the 5V-flanking region of the rat GCLC gene determinant of the overall GSH synthesis capacity, regulation of GCL subunits has been a topic of extensive research. Primers were designed according to the sequence reported Using different strategies, many studies have reported that previously [14] (GenBank Accession No. AF218362) as substances such as oxidants, phenol antioxidants, cytokines, follows: ctggagaatctccagcatccag and atggccgcgtcctcctcctg. heavy metals, nitric oxide donors, ionizing radiation, chemo- Genomic DNA was extracted from rat peripheral blood with therapeutic agents, growth factors, hormone, oxidized low- the EZNA blood DNA kit (Omega, Guangzhou) and acted density lipoprotein, etc. can regulate transcription of the as the template for PCR amplification of the 5V-flanking GCLC gene by activating transcription factors such as NF-nB region of rat GCLC gene. The PCR condition was that after and AP-1, and thus regulating GCL holoenzyme synthesis initial denaturing at 95-C for 1 min, each cycle of [6]. These works demonstrated that the lung tissue can amplification consisted of denaturation at 95-C for 1 min, increase the expression of GCL to neutralize the adverse annealing at 55-C for 1 min, polymerization at 72-C for 1 effects of harmful stimulators. In the present study, we min, and a further polymerization for 10 min after 30 investigated the characterization of the 5V-flanking region of amplication cycles. The PCR product was purified on the rat GCLC and its transcriptional regulation in rat lung agarose gel, subcloned into pGEM-T easy vector (Promega) epithelial L2 cells. Our results proved that there are two with T4 DNA Ligase, and then sequenced using the positive regulatory regions which exist in À403 to À111 and automated ABI Prism dRhodamine Terminator cycle À705 to À613. Transcriptional factors NF1, C/EBP, MZF1, sequencer performed by Shanghai Sangon. A 1.76-kb 5V- AP-1, NF-nB, and SP1 were able to bind to positive flanking region of the rat GCLC gene was cloned into the regulatory regions. In addition to the classical positive SmaI site of promoterless pGL-3 enhancer vector (Promega) regulation elements, we report a negative regulatory region creating the recombinant plasmid À1758/+2 GCLC-luc. All which exists in À745 to À705 in the GCLC gene of rat lung the procedures, including PCR, restriction enzyme diges- epithelial L2 cells. Site-directed mutagenesis proved that the tion, isolation, ligation, transformation, extraction and functional element in this negative regulatory region was a purification of the plasmid, and agarose gel electrophoresis putative E-box element. Transcriptional factors USF1 and were performed according to the methods reported by USF2 were able to bind to the E-box motif and significantly Sambrook and Russell [15]. inhibited GCLC promoter activity and protein synthesis. This may represent a new pathway for
Load more

Recommended publications
  • Targets TFIID and TFIIA to Prevent Activated Transcription
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press The mammalian transcriptional repressor RBP (CBF1) targets TFIID and TFIIA to prevent activated transcription Ivan Olave, Danny Reinberg,1 and Lynne D. Vales2 Department of Biochemistry and 1Howard Hughes Medical Institute, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 USA RBP is a cellular protein that functions as a transcriptional repressor in mammalian cells. RBP has elicited great interest lately because of its established roles in regulating gene expression, in Drosophila and mouse development, and as a component of the Notch signal transduction pathway. This report focuses on the mechanism by which RBP represses transcription and thereby regulates expression of a relatively simple, but natural, promoter. The results show that, irrespective of the close proximity between RBP and other transcription factors bound to the promoter, RBP does not occlude binding by these other transcription factors. Instead, RBP interacts with two transcriptional coactivators: dTAFII110, a subunit of TFIID, and TFIIA to repress transcription. The domain of dTAFII110 targeted by RBP is the same domain that interacts with TFIIA, but is disparate from the domain that interacts with Sp1. Repression can be thwarted when stable transcription preinitiation complexes are formed before RBP addition, suggesting that RBP interaction with TFIIA and TFIID perturbs optimal interactions between these coactivators. Consistent with this, interaction between RBP and TFIIA precludes interaction with dTAFII110. This is the first report of a repressor specifically targeting these two coactivators to subvert activated transcription. [Key Words: RBP; transcriptional repression; TFIIA/TFIID targeting] Received November 17, 1997; revised version accepted April 1, 1998.
    [Show full text]
  • Polycomb Repressor Complex 2 Function in Breast Cancer (Review)
    INTERNATIONAL JOURNAL OF ONCOLOGY 57: 1085-1094, 2020 Polycomb repressor complex 2 function in breast cancer (Review) COURTNEY J. MARTIN and ROGER A. MOOREHEAD Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, ON N1G2W1, Canada Received July 10, 2020; Accepted September 7, 2020 DOI: 10.3892/ijo.2020.5122 Abstract. Epigenetic modifications are important contributors 1. Introduction to the regulation of genes within the chromatin. The poly- comb repressive complex 2 (PRC2) is a multi‑subunit protein Epigenetic modifications, including DNA methylation complex that is involved in silencing gene expression through and histone modifications, play an important role in gene the trimethylation of lysine 27 at histone 3 (H3K27me3). The regulation. The dysregulation of these modifications can dysregulation of this modification has been associated with result in pathogenicity, including tumorigenicity. Research tumorigenicity through the increased repression of tumour has indicated an important influence of the trimethylation suppressor genes via condensing DNA to reduce access to the modification at lysine 27 on histone H3 (H3K27me3) within transcription start site (TSS) within tumor suppressor gene chromatin. This methylation is involved in the repression promoters. In the present review, the core proteins of PRC2, as of multiple genes within the genome by condensing DNA well as key accessory proteins, will be described. In addition, to reduce access to the transcription start site (TSS) within mechanisms controlling the recruitment of the PRC2 complex gene promoter sequences (1). The recruitment of H1.2, an H1 to H3K27 will be outlined. Finally, literature identifying the histone subtype, by the H3K27me3 modification has been a role of PRC2 in breast cancer proliferation, apoptosis and suggested as a mechanism for mediating this compaction (1).
    [Show full text]
  • Dynamics and Function of DNA Methylation in Plants
    REVIEWS Dynamics and function of DNA methylation in plants Huiming Zhang1,2*, Zhaobo Lang1,2 and Jian- Kang Zhu 1,2,3* Abstract | DNA methylation is a conserved epigenetic modification that is important for gene regulation and genome stability. Aberrant patterns of DNA methylation can lead to plant developmental abnormalities. A specific DNA methylation state is an outcome of dynamic regulation by de novo methylation, maintenance of methylation and active demethylation, which are catalysed by various enzymes that are targeted by distinct regulatory pathways. In this Review, we discuss DNA methylation in plants, including methylating and demethylating enzymes and regulatory factors, and the coordination of methylation and demethylation activities by a so- called methylstat mechanism; the functions of DNA methylation in regulating transposon silencing, gene expression and chromosome interactions; the roles of DNA methylation in plant development; and the involvement of DNA methylation in plant responses to biotic and abiotic stress conditions. DNA methylation at the 5ʹ position of cytosine contrib- and regulatory factors are generally not lethal. However, utes to the epigenetic regulation of nuclear gene expres- DNA methylation appears to be more crucial for devel- sion and to genome stability1,2. Epigenetic changes, opment and environmental- stress responses in plants including DNA methylation, histone modifications and that have more complex genomes. Recent findings histone variants and some non- coding RNA (ncRNA) have uncovered important
    [Show full text]
  • I = Chpt 15. Positive and Negative Transcriptional Control at Lac BMB
    BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac B M B 400 Part Four: Gene Regulation Section I = Chapter 15 POSITIVE AND NEGATIVE CONTROL SHOWN BY THE lac OPERON OF E. COLI A. Definitions and general comments 1. Operons An operon is a cluster of coordinately regulated genes. It includes structural genes (generally encoding enzymes), regulatory genes (encoding, e.g. activators or repressors) and regulatory sites (such as promoters and operators). 2. Negative versus positive control a. The type of control is defined by the response of the operon when no regulatory protein is present. b. In the case of negative control, the genes in the operon are expressed unless they are switched off by a repressor protein. Thus the operon will be turned on constitutively (the genes will be expressed) when the repressor in inactivated. c. In the case of positive control, the genes are expressed only when an active regulator protein, e.g. an activator, is present. Thus the operon will be turned off when the positive regulatory protein is absent or inactivated. Table 4.1.1. Positive vs. negative control BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac 3. Catabolic versus biosynthetic operons a. Catabolic pathways catalyze the breakdown of nutrients (the substrate for the pathway) to generate energy, or more precisely ATP, the energy currency of the cell. In the absence of the substrate, there is no reason for the catabolic enzymes to be present, and the operon encoding them is repressed. In the presence of the substrate, when the enzymes are needed, the operon is induced or de-repressed.
    [Show full text]
  • Tnlo-Encoded Tet Repressor Can Regulate an Operator-Containing
    Proc. Nati. Acad. Sci. USA Vol. 85, pp. 1394-1397, March 1988 Biochemistry TnlO-encoded tet repressor can regulate an operator-containing plant promoter (cauliflower mosaic virus 35S promoter/electroporation/transient chloramphenicol acetyltransferase assays) CHRISTIANE GATZ* AND PETER H. QUAILt Departments of Botany and Genetics, University of Wisconsin, Madison, WI 53706 Communicated by Folke Skoog, October 26, 1987 (receivedfor review July S, 1987) ABSTRACT The TnlO-encoded tet repressor-operator The TnlO-encoded tet repressor regulates the expression system was used to regulate transcription from the cauliflower of the Tc resistance operon by binding to nearly identical mosaic virus (CaMV) 35S promoter. Expression was moni- operator sequences that overlap with three divergent pro- tored in a transient assay system by using electric field- moters (14, 15). The genes of the tet operon are only mediated gene transfer ("electroporation") into tobacco pro- transcribed in the presence of the inducer Tc, which pre- toplasts. The tet repressor, being expressed in the plant cells vents the repressor from binding to its operator sequences. under the control of eukaryotic transcription signals, blocks The tet repressor was chosen for regulating a plant promoter transcription of a CaMV 35S promoter chloramphenicol ace- for two reasons. (i) With a native molecular mass of 48 kDa, tyltransferase (cat) fusion gene when the two tet operators diffusion into the nucleus seemed likely (16). (ii) The high flank the "TATA" box. In the presence of the inducer equilibrium association constant of the repressor-inducer tetracycline, expression is restored to full activity. Location of complex ensures efficient induction at sublethal Tc concen- the operators 21 base pairs downstream of the transcription trations (17), thus making the system useful as an on/off start site does not significantly affect transcription in the switch for the specific regulation of transferred genes.
    [Show full text]
  • The General Transcription Factors of RNA Polymerase II
    Downloaded from genesdev.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW The general transcription factors of RNA polymerase II George Orphanides, Thierry Lagrange, and Danny Reinberg 1 Howard Hughes Medical Institute, Department of Biochemistry, Division of Nucleic Acid Enzymology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854-5635 USA Messenger RNA (mRNA) synthesis occurs in distinct unique functions and the observation that they can as- mechanistic phases, beginning with the binding of a semble at a promoter in a specific order in vitro sug- DNA-dependent RNA polymerase to the promoter re- gested that a preinitiation complex must be built in a gion of a gene and culminating in the formation of an stepwise fashion, with the binding of each factor promot- RNA transcript. The initiation of mRNA transcription is ing association of the next. The concept of ordered as- a key stage in the regulation of gene expression. In eu- sembly recently has been challenged, however, with the karyotes, genes encoding mRNAs and certain small nu- discovery that a subset of the GTFs exists in a large com- clear RNAs are transcribed by RNA polymerase II (pol II). plex with pol II and other novel transcription factors. However, early attempts to reproduce mRNA transcrip- The existence of this pol II holoenzyme suggests an al- tion in vitro established that purified pol II alone was not ternative to the paradigm of sequential GTF assembly capable of specific initiation (Roeder 1976; Weil et al. (for review, see Koleske and Young 1995).
    [Show full text]
  • Mechanisms of Prokaryotic Gene Regulation
    Overview: Conducting the Genetic Orchestra • Prokaryotes and eukaryotes alter gene expression in response to their changing environment • In multicellular eukaryotes, gene expression regulates development and is responsible for differences in cell types • RNA molecules play many roles in regulating gene expression in eukaryotes Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Fig. 18-1 1 Concept 18.1: Bacteria often respond to environmental change by regulating transcription • Natural selection has favored bacteria that produce only the products needed by that cell • A cell can regulate the production of enzymes by feedback inhibition or by gene regulation • Gene expression in bacteria is controlled by the operon model Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Fig. 18-2 Precursor Feedback inhibition trpE gene Enzyme 1 trpD gene Regulation of gene expression Enzyme 2 trpC gene trpB gene Enzyme 3 trpA gene Tryptophan (a) Regulation of enzyme (b) Regulation of enzyme activity production 2 Operons: The Basic Concept • A cluster of functionally related genes can be under coordinated control by a single on-off “switch” • The regulatory “switch” is a segment of DNA called an operator usually positioned within the promoter • An operon is the entire stretch of DNA that includes the operator, the promoter, and the genes that they control Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings • The operon can be switched off by a protein repressor • The repressor prevents gene transcription by binding to the operator and blocking RNA polymerase • The repressor is the product of a separate regulatory gene Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings 3 • The repressor can be in an active or inactive form, depending on the presence of other molecules • A corepressor is a molecule that cooperates with a repressor protein to switch an operon off • For example, E.
    [Show full text]
  • The Key Role of DNA Methylation and Histone Acetylation in Epigenetics of Atherosclerosis
    J Lipid Atheroscler. 2020 Sep;9(3):419-434 Journal of https://doi.org/10.12997/jla.2020.9.3.419 Lipid and pISSN 2287-2892·eISSN 2288-2561 Atherosclerosis Review The Key Role of DNA Methylation and Histone Acetylation in Epigenetics of Atherosclerosis Han-Teo Lee ,1,2,* Sanghyeon Oh ,1,2,* Du Hyun Ro ,1,2,3,* Hyerin Yoo ,1,2 Yoo-Wook Kwon 4,5 1Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science, Seoul National University, Seoul, Korea 2Interdisciplinary Program in Stem Cell Biology, Graduate School of Medicine, Seoul National University, Seoul, Korea 3Department of Orthopedic Surgery, Seoul National University Hospital, Seoul, Korea 4Strategic Center of Cell and Bio Therapy for Heart, Diabetes & Cancer, Biomedical Research Institute, Seoul National University Hospital, Seoul, Korea Received: May 8, 2020 5Department of Medicine, College of Medicine, Seoul National University, Seoul, Korea Revised: Sep 14, 2020 Accepted: Sep 15, 2020 Correspondence to ABSTRACT Yoo-Wook Kwon Biomedical Research Institute, Seoul National Atherosclerosis, which is the most common chronic disease of the coronary artery, constitutes University Hospital, 103 Daehak-ro, Jongno- a vascular pathology induced by inflammation and plaque accumulation within arterial vessel gu, Seoul 03080, Korea. E-mail: [email protected] walls. Both DNA methylation and histone modifications are epigenetic changes relevant for atherosclerosis. Recent studies have shown that the DNA methylation and histone *Han-Teo Lee, Sanghyeon Oh and Du Hyun Ro modification systems are closely interrelated and mechanically dependent on each other. contributed equally to this work. Herein, we explore the functional linkage between these systems, with a particular emphasis Copyright © 2020 The Korean Society of Lipid on several recent findings suggesting that histone acetylation can help in targeting DNA and Atherosclerosis.
    [Show full text]
  • Allostery and Applications of the Lac Repressor
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2014 Allostery and Applications of the Lac Repressor Matthew Almond Sochor University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons, and the Biophysics Commons Recommended Citation Sochor, Matthew Almond, "Allostery and Applications of the Lac Repressor" (2014). Publicly Accessible Penn Dissertations. 1448. https://repository.upenn.edu/edissertations/1448 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1448 For more information, please contact [email protected]. Allostery and Applications of the Lac Repressor Abstract The lac repressor has been extensively studied for nearly half a century; this long and complicated experimental history leaves many subtle connections unexplored. This thesis sought to forge those connections from isolated and purified components up ot functioning lac genetic switches in cells and even organisms. We first connected the genetics and structure of the lac repressor to in vivo gene regulation in Escherichia coli. We found that point mutations of amino acids that structurally make specific contacts with DNA can alter repressor-operator DNA affinity and even the conformational equilibrium of the repressor. We then found that point mutations of amino acids that structurally make specific contacts with effector molecules can alter repressor-effector affinity and the conformational equilibrium. Allesults r are well explained by a Monod, Wyman, and Changeux model of allostery. We next connected purified in vitro components with in vivo gene regulation in E. coli. We used an in vitro transcription assay to measure repressor-operator DNA binding affinity, repressor-effector binding affinity, and conformational equilibrium.
    [Show full text]
  • Transcription in Eukaryotes
    Transcription in eukaryotes Chromatin structure and its effects on transcription RNA polymerases Promoters General Transcription Factors Activators and Repressors Enhancers and Silencers Order of events leading to transcription initiation in eukaryotes at a specific promoter CRC The order of steps on the pathway to transcription initiation appears to be different for different promoters AlteraçãoAlteração estruturaestrutura cromatinacromatina Actividade génica ACETILAÇÃO DE HISTONAS COMPLEXOS DE REMODELAÇÃO DA CROMATINA (CRC) LysLys+ menor ligação do DNA às histonas nos nucleossomas Acção concertada de: -Activadores/ repressores ( proteínas auxiliares acessórias) -Proteínas de remodelação da cromatina -Capacidade de ligação dos factores gerais da transcrição Histone Histone acetylation is characteristic acetylation of actively transcribed chromatin Interaction with other histones and with DNA HAT- histone acetyltransferase HDAC- histone deacetylase Chromatin Remodeling Complexes (CRC) or Nucleosome remodeling factors ATPase/Helicase activity and DNA binding protein motifs Local alterations in chromatin structure directed by eucaryotic gene activator proteins Histone acetylation and nucleossome remodeling generally render the DNA package in chromatin more acessible to other proteins in the cell, including those required for transcription initiation. Specific patterns of histone modification directly aid in the assembly of the general transcription factors at the promoter. Enzymes that increase, even transiently, the acessibility of DNA
    [Show full text]
  • Mfd Regulates RNA Polymerase Association with Hard-To-Transcribe Regions in Vivo, Especially Those with Structured Rnas
    Supplementary Information for: Mfd regulates RNA polymerase association with hard-to-transcribe regions in vivo, especially those with structured RNAs Mark Ragheb, Christopher Merrikh, Kaitlyn Browning, Houra Merrikh Corresponding author: Houra Merrikh Email: [email protected] This PDF file includes: Expanded Materials and Methods Figures S1 to S12 Tables S1 to S5 Legends for Datasets S1 to S7 SI References Expanded Materials and Methods Detailed strain construction In order to construct marker-less point mutation (L522A) of Mfd in B. subtilis, the pminiMAD2 plasmid was used as previously described (1). Briefly, HM2916 was constructed by transforming pHM707 into HM1 and grown at in LB broth containing MLS antibiotics at 22°C, the permissive temperature. B. subtilis strains were then incubated for 12 hours at 42°C while maintaining MLS selection. Cells were serially diluted and passaged multiple times at 22°C. Individual colonies were plated on LB plates with or without MLS to identify colonies which were MLS sensitive and had evicted the plasmid. HM2769 was constructed by transforming pHM430 and pHM439 into HM2747. HM2771 was constructed by transforming pHM430 and pBRα into HM2747. HM2773 was constructed by transforming pHM439 and pACλCI into HM2747. HM2965 was constructed by transforming pHM431 and pHM439 into HM2747. HM2932 was constructed by transforming the HM2916 plasmid into HM1. HM3157 was constructed using the transformation of SOE PCR product into HM1. First, Mfd- myc amplicon was generated using primers HM3759 and HM3760 and HM1 genomic DNA as a template in order to add a 1x myc sequence to the Mfd gene. Erm resistance cassette was amplified using pCAL215 plasmid DNA as a template and primers HM3854 and HM3969.
    [Show full text]
  • DNA Methylation in the Gene Body Influences Mecp2-Mediated Gene Repression
    DNA methylation in the gene body influences MeCP2-mediated gene repression Benyam Kindea, Dennis Y. Wub, Michael E. Greenberga,1, and Harrison W. Gabelb,1 aDepartment of Neurobiology, Harvard Medical School, Boston, MA 02115; and bDepartment of Neuroscience, Washington University School of Medicine, St. Louis, MO 63110 Contributed by Michael E. Greenberg, November 21, 2016 (sent for review June 22, 2016; reviewed by Anne Brunet and Li-Huei Tsai) Rett syndrome is a severe neurodevelopmental disorder caused by MBD of MeCP2 as essential for the high-affinity interaction be- mutations in the methyl-CpG binding protein gene (MECP2). MeCP2 tween MeCP2 and methylcytosine (6, 7). For many years methyl- is a methyl-cytosine binding protein that is proposed to function as ation of cytosines in the CpG dinucleotide context (mCG) has been a transcriptional repressor. However, multiple gene expression stud- thought to represent the majority of DNA methylation in mam- ies comparing wild-type and MeCP2-deficient neurons have failed to malian cells and to be the major site of MeCP2 binding in neurons. identify gene expression changes consistent with loss of a classical It has recently been shown that in the brain, high levels of non- transcriptional repressor. Recent work suggests that one function of CG methylation (predominantly mCA) also contribute to the “ ” MeCP2 in neurons is to temper the expression of the longest genes neuronal methylome, with the number of mCA sites at late stages of neuronal maturation approaching the number of mCG in the genome by binding to methylated CA dinucleotides (mCA) – within transcribed regions of these genes.
    [Show full text]