Molecular Phylogenetic Analysis of Japanese Miscanthus (Poaceae)

ISSN 1346-7565 Acta Phytotax. Geobot. 68 (2): 83–92 (2017) doi: 10.18942/apg.201703

1 2 3,† 2 Hidenori Nakamori , Miki Tomita , Hiroshi Azuma , Takehiro Masuzawa 2,* and Toru Tokuoka

1Graduate School of Integrated Science and Technology, Shizuoka University, Ohya, Suruga-ku, Shizuoka, 422-8529, Japan; 2Department of Biological Science, Faculty of Science, Shizuoka University, Ohya, Suruga-ku, Shizuoka, 422-8529, Japan. *[email protected] (author for corresponding); 3Department of Botany, Graduate School of Science, Kyoto University, Kitashirakawa-oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan; †Present Name & address: Hiroshi Suzuki; Liberal arts and Sciences, Faculty of Engineering, Toyama Prefectural University, 5180 Kurokawa, Imizu-shi, Toyama 939-0398, Japan

Miscanthus (Poaceae) comprises about 20 species, of which seven species and two forms occur in Japan. There is controversy whether M. condensatus is a separate species or a variety or subspecies of M. sinensis. To determine its taxonomic status, we conducted a molecular phylogenetic analysis using DNA sequences of the atpB-rbcL, psbC-trnS(UGA), rpl20-rps12, trnL(UAA)-trnF(GAA), trnS(GGA)- trnT(UGU), and nuclear ITS regions, and the Adh1 gene from 31 samples of the seven Japanese species of Miscanthus. The neighbor-joining (NJ) tree based on the cpDNA sequences shows that M. condensatus and M. sinensis share two haplotypes, and that the nuclear ITS and Adh1 sequences of the two species are identical, making it difficult to distinguishM. condensatus from M. sinensis based on DNA sequences. The evidence indicates that hybridization between the two species has proceeded rapidly, or that M. condensatus is derived from a diverging lineage of M. sinensis. The status of M. condensatus remains controversial, but our findings support provisionally treating M. condensatus as the infraspecific taxon, M. sinensis var. condensatus.

Key words: Miscanthus, Miscanthus condensatus, Miscanthus sinensis, molecular phylogeny, Poaceae

Miscanthus Andersson (Poaceae), which some count for five Miscanthus( condensatus, M. comprises about 20 species, occurs mainly in floridulus, M. oligostachyus, M. sinensis, and M. Southeast Asia (Clayton & Renvoize 1986). Sev- tinctorius) is 2n = 38. A chromosome count of 2n en species, as well as two forms, of Miscanthus = 57 has also been reported for M. condensatus occur in Japan (Osada 1989). It has been proposed (Adati 1958), but Hirayoshi et al. (1959) reported that Miscanthus be separated into three sections never having observed such a count. For M. inter- (for review, see Nishiwaki & Nadir 2014). With medius, counts of 2n = 76 and 114 have been re- respect to the Japanese species of Miscanthus, M. ported, and for M. sacchariflorus, 2n = 76 (Hi- sacchariflorus was assigned to section Triarrhe- rayoshi et al. 1956, 1959, 1960, 1964, for review na; M. floridulus, M. sinensis, and M. condensat- see Nishiwaki & Nadir 2014). Based on these us were assigned to section Eumiscanthus, and studies, it has been inferred that M. intermedius M. tinctorius, M. oligostachyus, and M. interme- and M. sacchariflorus formed via interspecific dius were assigned to section Kariyasua. hybridization (Hirayoshi et al. 1956, 1959, 1960, The cytology of the genus has also been stud- 1964). ied to determine the relationships among the spe- The biological and agricultural aspects of the cies. Of the seven Japanese species, the chromo- three Japanese species of Miscanthus in section 84 Acta Phytotax. Geobot. Vol. 68

Eumiscanthus have also been well studied. Of the tus accessions from the 40 M. sinensis acces- three, Miscanhus sinensis is a dominant perenni- sions. However, that study did not include sam- al grass and its ecology has been thoroughly ex- ples from mainland Japan. To understand the amined (e.g. Ministry of the Environment et al. phylogeography of M. sinensis and to clarify the 2007, Stewart et al. 2009, Quinn et al. 2012, Clark taxonomic status of M. condensatus, it is neces- et al. 2014, 2015). Miscanthus floridulus was in- sary to combine the approaches of the previous vestigated as a potential biofuel energy crop studies to produce an integrated dataset that gives (Bullard 1996, Bullard et al. 1997, Christian et al. a clearer picture of the situation. 1997), and in other studies the genetic variation Here, we present molecular phylogenetic among the Japanese populations was found to be analyses, based on sequencing of the chloroplast minimal (Ibaragi et al. 2013). The taxonomy of and nuclear DNA regions, of the seven Japanese the third species, M. condensatus, has been con- species of Miscanthus. They represent all three troversial. Many authors treat M. condensatus as sections of Miscanthus that occur on mainland a distinct species that is specialized to grow near Japan. In addition, we discuss the taxonomic seashores (Ohwi 1965, 1975, 1982, Osada 1989). treatment of M. condensatus. Others have treated it as a variant or subspecies of M. sinensis, because of the morphological simi- larity between the two (Ohwi 1953, Makino 1961, Materials and Methods Clayton & Renvoize 1986, Koyama 1987). More- over, Osada (1989) reported intermediate forms Taxon sampling, DNA extraction, amplification, between the two species occurring with low fre- and sequencing quency in transitional habitats between the coast DNA sequences of the five cpDNA regions and inland areas. For clarity, in this study we use atpB- rbcL, psbC- trnS(UGA), rpl20- rps12, the name M. condensatus throughout, following trnL(UAA)-trnF(GAA), trnS(GGA)-trnT(UGU), the convention of Osada (1989). the nuclear ITS regions, and Adh1 gene of 31 sam- Some phylogeographic studies of Miscanthus ples from the seven Japanese species of Miscan- sinensis have been conducted based on DNA thus were used for the molecular phylogenetic markers (Chiang et al. 2003, Iwata et al. 2005a, b, analyses (Table 1). Fresh leaves collected from Slavov et al. 2012, Shimono et al. 2013, Clark et wild plants were dried and preserved in silica gel. al. 2014, 2015). Shimono et al. (2013) reported DNA samples were extracted from the dried that nine haplotypes occur in Japan, based on 636 leaves. Voucher specimens for this study were samples from 30 populations, and using four re- deposited at Kyoto University (KYO). gions of chloroplast DNA (cpDNA). Two of the Total genomic DNA was extracted using the nine haplotypes were widely distributed across modified cetyltrimethylammonium bromide mainland Japan and within most populations. In (CTAB) method of Doyle & Doyle (1987). The contrast, Hayakawa et al. (2014) reported that the DNA regions used in this study were amplified populations on mainland Japan comprise a mono- using polymerase chain reaction (PCR). The PCR phyletic group, based on analyses using nuclear mixture (20 μL) contained 1 μL template DNA, internal transcribed spacer (ITS) sequences. 1.6 μL dNTPs (2.5 mM each), 0.2 μL of each However, the report included no mention of the primer (10 μM), 2 μL of 10× Taq buffer (contain- taxonomic treatment of M. condensatus. It is un- ing 20 mM MgCl2), 0.5 U Taq polymerase (Ex- clear whether it was included in the analyses, as Taq; Takara Bio, Japan). The PCR was performed an infraspecies, or excluded as an independent with a T100 Thermal Cycler (Bio-Rad Laborato- species. Chiang et al. (2003) estimated the DNA ries), using 35 cycles, each with 1 min denatur- sequence variation of the nuclear Adh1 locus in ation at 94°C, 1 min annealing at 55°C , an exten- both M. sinensis and M. condensatus and found sion of 1 min at 72°C, and a final extension of 5 strong support for separating the 10 M. condensa- min at 72°C. After checking for a single band us- June 2017 Nakamori & al.–Phylogeny of Japanese Miscanthus 85 ing electrophoresis on 0.5% agarose TAE gel comprised 597 characters; 22 sites were variable stained with Midori Green DNA Stain (NIPPON among all samples (Table 4). Genetics Co, Ltd), the PCR products were puri- In the data matrix for the five cpDNA regions, fied via enzyme treatment. A 2-μL mixture con- six of the Miscanthus condensatus samples taining 0.3 U Exonuclease I (Takara Bio) and 0.3 (CO_1 to 6), two of the M. sinensis samples (SI_7 U calf intestine alkaline phosphatase (Toyobo, & 8), and two of the M. tinctorius samples (TI_1 Japan) was added to each PCR tube to degrade & 2) (hereafter, cpDNA group 1) were identical. remaining primers and dephosphorylate any re- Other groups that were identical in these regions maining dNTPs. The tubes were incubated at were: i) four of the M. floridulus samples (FL_1 37°C for 30 min, and then enzymes were dena- to 4; cpDNA group 2); ii) six M. sinensis samples tured at 80°C for 15 min. (SI_1 to 6) and three M. condensatus samples Direct sequencing of both strands was con- (CO_7 to 9) (cpDNA group 3); iii) three M. oli- ducted on an ABI 3100 Genetic Analyzer (Ap- gostachyus samples (OL_1 to 3; cpDNA group 4); plied Biosystems) using the BigDye Terminator and iv) two M. intermedius samples (IN_1 & 2; version 3.1 Cycle Sequencing Ready Reaction Kit cpDNA group 5). In the data matrix for the nucle- (Applied Biosystems Japan) following the manu- ar ITS sequences, all species except M. oli- facturer’s protocol. Primers for amplification gostachyus showed no variation. There was also and/or sequencing are listed in Table 2. We man- no variation between M. sinensis and M. conden- ually aligned the DNA sequences obtained using satus. With respect to the nuclear Adh1 gene se- MEGA v. 6.06 (Tamura et al. 2013). quences, four samples of M. sinensis samples and five of M. condensatus were identical (see acces- Phylogenetic analysis sion nos. in Table 1). The phylogenetic tree of cpDNA was con- We compared the sequence data with data structed by the neighbor-joining method (NJ) im- from previous studies (Shimono et al. 2013, Hay- plemented in MEGA v.6.06 (Tamura et al. 2013) akawa et al. 2014). In the data matrix for the four using the Tamura 3-parameter model (Tamura cpDNA regions used from NJ, the DNA sequence 1992). We also added the nine haplotypes identi- of haplotype A1 and A2 (Shimono et al. 2013) fied by Shimonoet al. (2013) into our data matrix. was the same as that fro cpDNA group 1 under In this analysis, trees were constructed using all the conditions of our DNA sequence alignment. five cpDNA regions and using four cpDNA re- The sequence of haplotype A4 was the same as gions except for the atpB-rbcL, which was not ex- the DNA sequences of Miscanthus floridulus (cp- amined in Shimono et al. (2013). Bootstrap val- DNA group 2), and haplotype B1 was identical to ues were calculated based on 10,000 replicates. that of cpDNA group 3. In the data matrix of nu- Insertions and deletions (Indels) were coded us- clear ITS sequences, the DNA sequences of nine ing simple indel coding (SIC; Simmons et al. samples of M. sinensis and eight of M. condensa- 2007). A network tree of the nuclear Adh1 geno- tus were the same as the E type (Hayakawa et al. type was constructed using a statistical parsimo- 2014). ny network in TCS v.1.21 (Clement et al. 2000). Phylogenetic analyses In the NJ phylogenetic tree based on the cp- Results DNA sequences (Fig. 1), cpDNA group 1 and the haplotypes A1 and A2 were sister to the haplo- DNA sequence variation type A3. This clade was sister to Miscanthus The aligned data matrix of the five cpDNA re- floridulus (cpDNA group 2) and haplotype A4. A gions comprised 4,062 characters. Twenty seven clade comprising cpDNA group 3 and the haplo- sites were variable among all samples (Table 3). type B1 was sister to the clade of haplotypes B2 The aligned data matrix of nuclear ITS sequences and B3. The cpDNA sequences of three M. sac- 86 Acta Phytotax. Geobot. Vol. 68

Table 1. Species of Japanese Miscanthus used in this study, collection data, sample name and accession number. Accession No. Taxon Locality Voucher Sample name ITS adh1 psbC-trnS trnS-trnT trnL-trnF rpl20-rps12 atpB-rbcL Miscanthus condensatus Hack. Tokyo: Hachijo,Mitsune Tomita hm22 CO 1 LC113993 LC171387 LC114247 LC114242 LC114223 LC114239 LC114232 Tokyo: Hachijo,Mitsune Tomita hm23 CO 2 LC113993 LC171387 LC114247 LC114242 LC114223 LC114239 LC114232 Tokyo: Hachijo,Sueyoshi Tomita hm25 CO 3 LC113993 LC114247 LC114242 LC114223 LC114239 LC114232 Tokyo: Hachijo,Sueyoshi Tomita hm26 CO 4 LC113993 LC171387 LC114247 LC114242 LC114223 LC114239 LC114232 Tokyo: Hachijo,Mitsune Tomita hm36 CO 5 LC113993 LC171387 LC114247 LC114242 LC114223 LC114239 LC114232 Shizuoka: Izu,Yagisawa Matsumoto Y156 CO 6 LC113993 LC114247 LC114242 LC114223 LC114239 LC114232 Tokyo: Hachijo,Mitsune Tomita hm12 CO 7 LC113993 LC114248 LC114245 LC114231 LC114241 LC114238 Tokyo: Hachijo,Sueyoshi Tomita hm28 CO 8 LC113993 LC171387 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Shimoda,Kakisaki Matsumoto Y230 CO 9 LC113993 LC114248 LC114245 LC114231 LC114241 LC114238 Miscanthus floridulus (Labill.) Warb. ex K.Schum. et Lauterb. Shizuoka: Kosai Mizuno 80804 FL 1 LC113994 LC114248 LC114242 LC114223 LC114239 LC114233 Shizuoka: Hamamatsu, Waji Mizuno 80807 FL 2 LC113994 LC114248 LC114242 LC114223 LC114239 LC114233 Shizuoka: Hamamatsu, Mikkabi Nakamori 150606010 FL 3 LC113994 LC114248 LC114242 LC114223 LC114239 LC114233 Shizuoka: Hamamatsu, Tsuzuki Nakamori 150606011 FL 4 LC113994 LC114248 LC114242 LC114223 LC114239 LC114233 Miscanthus intermedius (Honda) Honda Niigata: Minamiuonuma, Mikunitouge Nakamori m52 IN 1 LC113995 LC114248 LC114243 LC114224 LC114240 LC114234 Nigata: Uonuma Nakamori m57 IN 2 LC113995 LC114248 LC114243 LC114225 LC114240 LC114235 Miscanthus oligostachyus Stapf Shizuoka: Gotenba, Mt.fuji Nakamori m34 OL 1 LC113996 LC114248 LC114244 LC114226 LC114240 LC114236 Shizuoka: Gotenba, Mt.fuji Nakamori m35 OL 2 LC113997 LC114248 LC114244 LC114227 LC114240 LC114236 Shizuoka: Gotenba, Mt.fuji Nakamori m38 OL 3 LC113996 LC114248 LC114244 LC114226 LC114240 LC114236 Miscanthus sacchariflorus (Maxim.) Benth Shizuoka: Shizuoka, Aoi-ku Mizuno 10093 SA_1 LC113998 LC114248 LC114244 LC114228 LC114240 LC114236 Shizuoka: Shizuoka, Aoi-ku Mizuno 10096 SA_2 LC113998 LC114248 LC114244 LC114229 LC114240 LC114236 Shiga: Maibara Mizuno 101004 SA_3 LC113998 LC114249 LC114244 LC114230 LC114240 LC114237 Miscanthus sinensis Andersson Shizuoka: Shizuoka, Suruga-ku Matsumoto Y007 SI_1 LC113993 LC171387 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Fujinomiya, Awakura Matsumoto Y163 SI_2 LC113993 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Gotenba, Nakabata Matsumoto Y169 SI_3 LC113993 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Ito, Yukawa Matsumoto Y259 SI_4 LC113993 LC171387 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Atami, Kamitaga Matsumoto Y268 SI_5 LC113993 LC171387 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Gotenba, Mt.fuji Nakamori m39 SI_6 LC113993 LC171387 LC114248 LC114245 LC114231 LC114241 LC114238 Shizuoka: Gotenba, Kawashimata Matsumoto Y177 SI_7 LC113993 LC114247 LC114242 LC114223 LC114239 LC114232 Shizuoka: Shizuoka, Shimizu-ku Matsumoto Y228 SI_8 LC113993 LC114247 LC114242 LC114223 LC114239 LC114232 Miscanthus tinctorius (Steud.) Hack. Fukui: Fukui Botanical Garden Nakamori m69 TI_1 LC113999 LC114247 LC114242 LC114223 LC114239 LC114232 Gifu: Gujo, Hiruganokougen Nakamori m72 TI_2 LC114000 LC114247 LC114242 LC114223 LC114239 LC114232

chariflorussamples were closely sim- Table 2. Primer sequences used in this study. ilar to those of Miscanthus oli- Region Sequence (5'-3') Direction Reference gostachyus. atpB-rbcL GACTCGCACTTGATTTCGTTGC forward this study CGGGGTGTAGTAAGTCAATTTATA reverse this study In the NJ tree using the ITS se- psbC-trnS(UGA) GGTCGTGACCAAGAAACCAC forward Demesure et al.(1995) quences (Fig. 2), Miscanthus sinensis CTGGACCAGAAGCTTCTCAA forward this study and M. condensatus, which carry GGTTCGAATCCCTCTCTCTC reverse Demesure et al.(1995) ACCATACAAATGCACGGCGA reverse this study identical DNA, were sister to M. rpl20-rps12 TTTGTTCTACGTCTCCGAGC forward Hamilton (1999) floridulus. Although the cpDNA of M. GTCGAGGAACATGTACTAGG reverse Hamilton (1999) tinctorius was identical to the group 1 trnL(UAA)-trnF(GAA) CGAAATCGGTAGACGCTACG forward Taberlet et al. (1991) ATTTGAACTGGTGACACGAG reverse Taberlet et al. (1991) sequence of M. sinensis and M. con- trnS(GGA)-trnT(UGU) CGAGGGTTCGAATCCCTCTC forward Demesure et al.(1995) densatus, two ITS sequences of M. TCTATGGTTAACTAATTGTC forward this study AGAGCATCGCATTTGTAATG reverse Demesure et al.(1995) tinctorius were closely related to that CGCCGTCTGGGAGCTTTACC reverse this study of M. intermedius. ITS GGAAGTAAAAGTCGTAACAAGG forward White et al. (1990) The network of the nuclear Adh1 TCCTCCGCTTATTGATATGC reverse White et al. (1990) Adh1 AGATCAACCCTGAGGCTCCC forward this study gene is shown in Fig. 3 in reference to GGGACAAAGGGGTGAGCTAC reverse this study data from Chiang et al. (2003). The June 2017 Nakamori & al.–Phylogeny of Japanese Miscanthus 87

Table 3. Polymorphic sites in the aligned sequences of five chloroplast DNA from the Japanese Miscanthus.

atpB-rbcL psbC-trnS(UGA) trnS(GGA)-trnT(UGU) trnL(UAA)-trnF(GAA) rpl20-rps12 species sample 510- 25 35-37 49 184 209 353 511 606 183 216 441 1158 212 394 422 1003 1035 271 389 394 669 704 781 82 177 676 M. condensatus CO-1 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

CO-2 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

CO-3 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

CO-4 C TT- A T T C T- T G T T A - A C Indel*2 G T A A - Indel*5 AG - G C

CO-5 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

CO-6 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

CO-7 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

CO-8 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

CO-9 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

M.floridulus FL-1 C TT- A T A C - T A T C A - A C Indel*3 G T A A - Indel*5 AG - G C

FL-2 C TT- A T A C - T A T C A - A C Indel*3 G T A A - Indel*5 AG - G C

FL-3 C TT- A T A C - T A T C A - A C Indel*3 G T A A - Indel*5 AG - G C

FL-4 C TT- A T A C - T A T C A - A C Indel*3 G T A A - Indel*5 AG - G C

M.intermedius IN-1 A - C T A C TT - A T C A - G T Indel*3 T T C A - Indel*6 - - G A

IN-2 A - C T A C T- - A T C A - G T Indel*3 T T C A - Indel*7 - - G A

M.oligostachyus OL-1 A - C G A C - - A T C A Indel*2 G C - G G C T - Indel*8 AG - G A

OL-2 A - C G A C - - A T C A Indel*2 G C - G G C T - Indel*9 AG - G A

OL-3 A - C G A C - - A T C A Indel*2 G C - G G C T - Indel*8 AG - G A

M.sacchariflorus SA-1 A - C G A C - - A T C G Indel*2 G C - G G C T - Indel*10 AG - G A

SA-2 A - C G A C - - A T C A Indel*2 G C - G T C A - Indel*11 AG - G C

SA-3 A - C G T T - - A C C G Indel*2 G C - G G C T - Indel*12 AG - G C

M.sinensis SI-1 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-2 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-3 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-4 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-5 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-6 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-7 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

SI-8 C TTT C G A C - - A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

M.tinctorius TI-1 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

TI-2 C TT- A T T C T- T G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

A1*1 na na na na na na na na G T T A - A C Indel*3 G T A A - Indel*5 AG - G C

A2*1 na na na na na na na na G T T A - A C Indel*3 G T A A - Indel*13 AG - G C

A3*1 na na na na na na na na A T T A - A C Indel*3 G T A A - Indel*5 AG - G C

A4*1 na na na na na na na na A T C A - A C Indel*3 G T A A - Indel*5 AG - G C

B1*1 na na na na na na na na A T C A - G C Indel*3 G T C A Indel*4 - AG - T C

B2*1 na na na na na na na na A T C A Indel*2 G C Indel*3 G T C A Indel*4 - AG - T C

B3*1 na na na na na na na na A T C A Indel*2 G C Indel*3 G T C T Indel*4 - AG - T C

B4*1 na na na na na na na na A T C A - G C Indel*3 G T C A - - AG - T C

C1*1 na na na na na na na na A T C A - G C Indel*3 G T C A Indel*4 Indel*14 AG Indel*15 G C Abbreviations: Indel; insertion or deletion. *1The nine haplotypes indicated by Shimono et al. (2013). *2GGGAA. *3GTAACACAATGGA. *4CTTATGCTAATTAAT. *5------TTTTATTTATTTTATTTCTTTTTT------. *6ATTTCTTT----TTTTATTTATTTTATTTAT------. *7ATTTCTTT----TTTTATTTATTTTATTTATTTATTTATTTATTTATTTTATTTAT------. *8ATTTCTTTTTTTTTTTATTTATTTTATTTTTTTTTTATTTCTTTTTTTTTTATTTATTTCTTTTTT. *9ATTTCTTTTTTTTTTTATTTATTTTCTTTTTTTTTTATTTCTTTTTTTTTTATTTATTTCTTTTTT. *10ATTTCTTTTTTTTTTTATTTATTTTATTTTTTTTTTTT------ATTTATTTCTTTTTT. *11ATTTCTTTTTT-TTTTATTTATTTTATTTCTTTTTT------. *12ATTTCTTTTTTTTTTTATTTATTTTATTTTTTTTTTT---ATTTATTTTTTATTTATTTCTTTTTT. *13------TTTTATTTATTTTATTTCTTTTTT------TTTTATTTATTTTATTTCTTTTTT. *14------TTTATTTATTTTATTTCTTTTTTTT------ATTTCTTTTTT. *15TAACCC. 88 Acta Phytotax. Geobot. Vol. 68

Table 4. Polymorphic sites in the aligned sequences of ITS from the Japanese Miscanthus. ITS Species Sample 27 31 32 34 44 56 86 92 148 157 160 179 181 200 206 398-399 401 433 439 496-498 525 560 M. condensatus CO-1 C C G G C G C G C C G G T T T - T C A CGA C T CO-2 C C G G C G C G C C G G T T T - T C A CGA C T CO-3 C C G G C G C G C C G G T T T - T C A CGA C T CO-4 C C G G C G C G C C G G T T T - T C A CGA C T CO-5 C C G G C G C G C C G G T T T - T C A CGA C T CO-6 C C G G C G C G C C G G T T T - T C A CGA C T CO-7 C C G G C G C G C C G G T T T - T C A CGA C T CO-8 C C G G C G C G C C G G T T T - T C A CGA C T CO-9 C C G G C G C G C C G G T T T - T C A CGA C T M.floridulus FL-1 C C G G C G C G C C G G T T T - T C G CGA C T FL-2 C C G G C G C G C C G G T T T - T C G CGA C T FL-3 C C G G C G C G C C G G T T T - T C G CGA C T FL-4 C C G G C G C G C C G G T T T - T C G CGA C T M.intermedius IN-1 T C A G C G T A C C A G C T T - G T G CGA C A IN-2 T C A G C G T A C C A G C T T - G T G CGA C A M.oligostachyus OL-1 C T G G T T C G A T A A T T T - G C G CGA C A OL-2 C C G G T T C G A T A A T T T - G C G CGA C A OL-3 C T G G T T C G A T A A T T T - G C G CGA C A M.sacchariflorus SA-1 C C G G C G C G C C A G T C C AG G C G CGA C A SA-2 C C G G C G C G C C A G T C C AG G C G CGA C A SA-3 C C G G C G C G C C A G T C C AG G C G CGA C A M.sinensis SI-1 C C G G C G C G C C G G T T T - T C A CGA C T SI-2 C C G G C G C G C C G G T T T - T C A CGA C T SI-3 C C G G C G C G C C G G T T T - T C A CGA C T SI-4 C C G G C G C G C C G G T T T - T C A CGA C T SI-5 C C G G C G C G C C G G T T T - T C A CGA C T SI-6 C C G G C G C G C C G G T T T - T C A CGA C T SI-7 C C G G C G C G C C G G T T T - T C A CGA C T SI-8 C C G G C G C G C C G G T T T - T C A CGA C T M.tinctorius TI-1 T C G A C G C G C C A G T T T - G T G - C A TI-2 T C G A C G C G C C A G T T T - G T G - T A

Adh1 gene sequence of Miscanthus sinensis and for the differences in the nuclear genotype and M. condensatus that we determined are posi- cpDNA haplotype pattern. The first possibility is tioned near Chiang et al.’s genotype s06 of M. si- that the two species, whose lineages were origi- nensis. nally separated, hybridized on mainland Japan. In fact, complex hybridization patterns among the species in the other sections have already Discussion been suggested (Hirayoshi et al. 1956, 1959, 1960, 1964). The finding that intermediate forms Based on the results of our molecular phylo- between Miscanthus sinensis and M. condensatus genetic analyses, the Japanese species of Miscan- occur in transitional habitats between the coast thus, with the exception of M. sinensis and M. and inland regions (Osada 1989) supports this condensatus, should remain separate. Indeed, it is theory from a morphological point of view. Con- difficult to distinguish M. condensatus from M. versely, M. condensatus may have evolved in par- sinensis based on DNA sequences. One reason allel to M. sinensis, from a separate lineage of the could be that the nuclear ITS region and Adh1 latter, through adaptation to coastal environ- gene sequences specifically of M. sinensis and M. ments. The fact that M. condensatus is widely condensatus from mainland Japan are identical. distributed in coastal habitats supports this theo- In addition, we identified two haplotypes of the ry (Ohwi 1953, 1975, 1982, Makino 1961, Osada cpDNA sequences that are common to both spe- 1989). cies. With respect to the nuclear Adh1 gene se- We can suggest two opposing explanations quences, there was no variation between the five June 2017 Nakamori & al.–Phylogeny of Japanese Miscanthus 89

CO-1 CO-2 CO-3 M.condensatus CO-4 CO-5 76 CO-6 group1 SI-7 M.sinensis SI-8 79 TI-1 M.tinctorius TI-2 A1 A2 89 A3 FL-1 FL-2 M.floridulus FL-3 group2 52 FL-4 A4 C1 B4 B1 62 SI-1 SI-2 SI-3 M.sinensis SI-4 group3 SI-5 SI-6 CO-7 CO-8 M.condensatus CO-9

56 B3 B2

SA-2 90 75 SA-1 M.sacchariflorus 74 SA-3 OL-1 OL-2 M.oligostachyus group4 OL-3 96 IN-1 M.intermedius IN-2

0.0002

Fig.1. Neighbor-joining (NJ) tree obtained from combined data for the trnL(UAA)-trnF(GAA), psbC-trnS(UGA), trnS(GGA)-trnT(UGU), and rpl20-rps12 regions of seven Japanese species of Miscanthus, with nine added haplotypes (A1–4, B1–4, and C1) from Shimono et al. (2013). Numbers above branches indicate bootstrap percentages (> 50%). See Table 1 for sample name abbreviations.

Miscanthus condensatus and four M. sinensis origin from the plants on the Nansei Islands. samples examined, and the genotypes were in- However, our findings suggest that it is difficult cluded within the network of 40 M. sinensis ac- to distinguish the two species based on DNA se- cessions identified by Chianget al. (2003). On the quences, at least on mainland Japan, although we basis of their phylogenetic analysis, Chiang et al. do not refute the recognition of M. condensatus (2003) demonstrated the monophyly of the Adh1 as a species. It will be necessary to examine the gene sequences of each species, although their chloroplast haplotypes of more samples, together study focused on China, Taiwan, and the Nansei with their distribution and/or morphological Islands, Japan, and did not include samples from characters, to accurately assess the taxonomic mainland Japan. It is therefore possible that the status of M. condensatus. M. condensatus of mainland Japan has a different In the meantime, we recommend that Miscan- 90 Acta Phytotax. Geobot. Vol. 68

CO-1

CO-2

CO-3

CO-4

CO-5 M.condensatus

CO-6

CO-7

CO-8

75 CO-9

SI-1

SI-2

SI-3

94 SI-4 M.sinensis SI-5

SI-6

SI-7

SI-8 FL-1

FL-2 M.floridulus FL-3

FL-4 SA-1

SA-2 M.sacchariflorus SA-3

OL-1

99 OL-3 M.oligostachyus OL-2 IN-1

M.intermedius 89 IN-2

88 TI-1 M.tinctorius TI-2

0.002

Fig.2. NJ tree obtained from the combined data for the nuclear ITS regions of seven Japanese species of Miscanthus. Numbers above branches indicate bootstrap percentages (> 50%). See Table 1 for sample name abbreviations. thus condensatus should be treated as an infra- land Japan with samples from the latter islands specific taxon, Miscanthus sinensis var. conden- are thus necessary. satus. We propose this because the evidence from Our results raise another question based on this study suggests that either hybridization be- the cpDNA analysis. Miscanthus tinctorius was tween the two species has proceeded rapidly in grouped with M. condensatus and M. sinensis the regions north of the Nansei Islands, or M. (Fig. 1). In the analysis of ITS sequences, how- condensatus has evolved independently multiple ever, M. tinctorius was close to M. intermedius, times from M. sinensis. However, samples of M. which is in the same section (Fig. 2). These re- condensatus from Taiwan and the Japanese is- sults suggest another complex taxonomic situa- lands of Okinawa and Amami-Oshima were dis- tion analogous to M. sinensis and M. condensat- tinguishable from M. sinensis based on their nu- us, such as inter-sectional hybridization. In fact, clear Adh1 DNA sequences and chloroplast trnL- the possibility of hybridization between M. sinen- trnF sequences (Chiang et al. 2003). Compari- sis and M. tinctorius has previously been men- sons of the M. condensatus samples from main- tioned (Hirayoshi et al. 1959). Recently, Clark et June 2017 Nakamori & al.–Phylogeny of Japanese Miscanthus 91

c04 c08 s08 c09 s09

c01 FL01 FL02 c02 s10 t14

M.floridulus s03

c03 c05 s05 c06 c10 ● s04

c07 s06 t15 M.condensatus t16 f03 g04 t11 t12 s11 f02 t09 s01 s12 t10 f05 f04 s07 t06 t05 t07 s02 s14 t03 t13 t08 t04 t02 s13 t01

g01 g02 g03 f01 M.sinensis

Fig.3. Parsimony network for the nuclear Adh1 genotypes detected for M. condensatus, M. floridulus, and M. sinensis by Chi- ang et al. (2003). Arrow indicates accession no. LC171387 from this study.

al. (2015) conducted a large-scale DNA analysis Chiang, Y. C., B. A. Schaal, C. H. Chou, S. Huang & T. Y. Chiang. 2003. Contrasting selection modes at the that suggested introgression from diploid Mis- Adh1 locus in outcrossing Miscanthus sinensis vs. in- canthus sinensis into tetraploid M. sacchariflorus breeding Miscanthus condensatus (Poaceae). Amer. in Japan. The fact that M. sinensis and M. tincto- J. Bot. 90: 561–570. rius share the same cpDNA haplotype implies Christian, D. G., M. J. Bullard & C. Wilkins. 1997. The that this may be another example of inter-section- agronomy of some herbaceous crops grown for energy in Southern England. Aspects Appl. Biol. 49: 41–51. al introgression in Miscanthus. Another large- Clark, L. V., J. E. Brummer, K. Głowacka, M. C. Hall, K. scale DNA analysis is thus necessary to clarify Heo, J. Peng, T. Yamada, J. H. Yoo, C. Y. Yu, Y. H. the relationship between M. sinensis and M. tinc- Zhao, S. P. Long & E. J. Sacks. 2014. A footprint of torius. past climate change on the diversity and population structure on Miscanthus sinensis. Ann. Bot. 114: 97– We are grateful to the Fukui Botanical Garden and the 107. Takasu Tourism Association for collecting leaf materials Clark, L. V., J. R. Stewart, A. Nishiwaki, Y. Toma, J. B. and to anonymous reviewers for helpful comments on Kjeldsen, U. Jørgensen, H. Zhao, J. Peng, J. H. Yoo, earlier drafts of the manuscript. K. Heo, C. Y. Yu, T. Yamada & E. J. Sacks. 2015. Ge- netic structure of Miscanthus sinensis and Miscan- thus sacchariflorus in Japan indicates a gradient of bidirectional but asymmetric introgression. J. Exp. References Bot. 66: 4213–4225. Clayton, W. D. & S. A. Renvoize. 1986. Genera grami- Adati, S. 1958. Fundamental thremmatology of Miscan- num, Grasses of the world. Her Majesty’s Stationery thus (Poaceae). Bull. Fac. Agric. Mie Univ. 17: 1–112. Office, London. (in Japanese). Clement, M., D. Posada & K. A. Crandall. 2000. TCS: A Bullard, M. J. 1996. The agronomy of Miscanthus. Land- computer program to estimate gene genealogies. wards 51: 12–15. Molec. Ecol. 9: 1657–1659. Bullard, M. J., P. M. Nixon & M. C. Heath. 1997. Quanti- Demesure, B., N. Sodzi & R. J. Petit. 1995. A set of uni- fying the yield of Miscanthus × giganteus in the UK. versal primers for amplification of polymorphic non- Aspects Appl. Biol. 49: 199–206. coding regions of mitochondrial and chloroplast 92 Acta Phytotax. Geobot. Vol. 68

DNA in plants. Molec. Ecol. 4: 129–134. Forestry and Fisheries, Forestry Agency and Minis- Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation try of Land, Infrastructure and Transport, Tokyo. (in procedure for small quantities of fresh leaf tissue. Japanese). Phytochem. Bull. 19: 11–15. Nishiwaki, A. & M. Nadir. 2014. Roll of Hybridization on Hamilton, M. B. 1999. Four primer pairs for the amplifi- Evolutional History of Genus Miscanthus in Japan. cation of chloroplast intergenic regions with intraspe- Jap. Soc. Grassland Sci. 60: 111–117. cific variation. Molec. Ecol. 8: 521–523. Ohwi, J. 1953. Flora of Japan. Shibundo, Tokyo. (in Japa- Hayakawa, H., M. Asaoka, Y. Shimono, S. Kurokawa, T. nese). Nishida, H. Ikeda & T. Wakamatsu. 2014. Phylogeog- Ohwi, J. 1965. Flora of Japan. Smithsonian Institution, raphy based on the nrDNA ITS regions of native Mis- Washington, D.C. canthus sinensis (Poaceae) populations in Japan. Ohwi, J. 1975. Flora of Japan, new edition, revised and Weed Biol. Managem. 14: 251–261. enlarged. Shibundo, Tokyo. (in Japanese). Hirayoshi, I., K. Nishikawa & M. Kubono. 1956. Cyto- Ohwi, J. 1982. Poaceae. In: Satake, Y., J. Ohwi, S. Kita- genetical studies on forage plants (V). Polyploidy and mura, S. Sawatari & T. Tominari (eds.), Wild Flowers distribution in Miscanthus sect. Kariyasua OHWI. of Japan. Heibonsha, Tokyo. (in Japanese). Res. Bull. Fac. Agric. Gifu Univ. 7: 9–14. Osada, T. 1989. Illustrated grasses of Japan. Heibonsha, Hirayoshi, I., K. Nishikawa, M. Kubono & T. Sakaida. Tokyo. (in Japanese). 1959. Cytogenetical studies of forage plants (VII). Quinn, L. D., T. M. Culley & J. R. Stewart. 2012. Genetic Chromosome conjugation and fertility of Miscanthus comparison of introduced and native populations of hybrid including M. sinensis, M. sinensis var. con- Miscanthus sinensis (Poaceae). a potential bioenergy densatus and M. tinctorius. Res. Bull. Fac. Agric. crop. Jap. Soc. Grassland Sci. 58: 101–111. Gifu Univ. 11: 86–91. Shimono, Y., S. Kurokawa, T. Nishida, H. Ikeda & N. Hirayoshi, I., K. Nishikawa & A. Hakura. 1960. Cyto- Futagami. 2013. Phylogeography based on intraspe- genetical studies on forage plants (VIII). 3x- and 4x- cific sequence variation in chloroplast DNA of Mis- hybrid arisen from the cross, Miscanthus sinensis var. canthus sinensis (Poaceae), a native pioneer grass in condensatus×M. sacchariflorus. Res. Bull. Fac. Ag- Japan. Botany 91: 449–456. ric. Gifu Univ. 12: 82–88. Simmons M. P., K. Müller & A. P. Norton. 2007. The rela- Hirayoshi, I., K. Nishikawa & T. Kikuchi. 1964. Cyto- tive performance of indel-coding methods in simula- genetical studies on forage plants. IX Morphological tions. Molec. Phylogenet. Evol. 44: 724–740. analysis and phylogenetical relationship in three spe- Slavov, G., P. Robson, E. Jensen, E. Hodgson, K. Farrar & cies of Miscanthus sect. Kariyasua. Res. Bull. Fac. G. Allison. 2012. Contrasting geographic patterns of Agric. Gifu Univ. 19: 64–69. genetic variation for molecular markers vs. phenotyp- Ibaragi, Y., T. Tanaka, K. Yonekura, C.-S. Kuoh & M. Su- ic traits in the energy grass Miscanthus sinensis. zuki. 2013. Genetic variation in Miscanthus floridu- Global Change Biology Bioenergy 5: 562–571. lus (Labill.) Warb. ex K. Schum. et Lauterb. popula- Stewart, J. R., Y. Toma, F. G. Fernandez, A. Nishiwaki, T. tions in Japan revealed by nuclear DNA markers. J. Yamada & G. Bollero. 2009. The ecology and agron- Phytogeogr. Taxon. 61: 21–29. omy of Miscanthus sinensis, a species important to Iwata H., T. Kamijo & Y. Tsumura. 2005a. Assessment of bioenergy crop development in its native range in Ja- genetic diversity of native species in Izu Islands for a pan: a review. GCB Bioenegy 1: 126–153. discriminate choice of source populations: implica- Tamura, K., G. Stecher, D. Peterson, A. Filipski & S. Ku- tions for revegetation of volcanically devastated sites. mar. 2013. MEGA6: Molecular Evolutionary Genet- Conservation Genet. 7: 399–413. ics Analysis Version 6.0. Molec. Biol. Evol. 30: 2725– Iwata H., T. Kamijo & Y. Tsumura. 2005b. Genetic struc- 2729. ture of Miscanthus sinensis ssp. condensatus (Poa- Tamura, K. 1992. Estimation of the number of nucleotide ceae) on Miyake Island: implications for revegetation substitutions when there are strong transition-trans- of volcanically devastated sites. Ecol. Res. (Tokyo). version and G+C-content biases. Molec. Biol. Evol. 9: 20: 233–238. 678-687. Koyama, T. 1987. Grasses of Japan and its neighboring Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991. Uni- regions, an identification manual. Kodansha, Tokyo. versal primers for amplification of three non-coding Makino, T. 1961. Makino’s New Illustrated Flora of Ja- regions of chloroplast DNA. Pl. Molec. Biol. 17: pan. Hokuryukan, Tokyo. (in Japanese). 1105–1109. Ministry of the Environment, Ministry of Agriculture, White, T. J., T. Bruns, S. Les & J. Taylor. 1990. Amplifi- Forestry and Fisheries, Forestry Agency and Minis- cation and direct sequencing of fungal ribosomal try of Land, Infrastructure and Transport. 2007. Veg- RNA genes for phylogenetics. In: Innis, M. A., D. H. etation Management Ecosystem Conservation. Min- Gelfand, J. J. Sninsky & T. J. White (eds.), PCR Pro- istry of the Environment, Ministry of Agriculture, tocols: a guide to methods and application, pp. 315– 322. Academic Press, San Diego.

Received December 2, 2016; accepted February 21, 2017