DOCSLIB.ORG

Polymorphisms with Late-Onset Alzheimer Disease in Han Chinese

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Polymorphisms with Late-Onset Alzheimer Disease in Han Chinese 172 Original Article on Translational Neurodegeneration Page 1 of 8 Association of lectin-like oxidized low density lipoprotein receptor 1 (OLR1) polymorphisms with late-onset Alzheimer disease in Han Chinese Zuo-Teng Wang1#, Xiao-Ling Zhong2#, Meng-Shan Tan1, Hui-Fu Wang1, Chen-Chen Tan1, Wei Zhang1, Zhan-Jie Zheng3, Ling-Li Kong3, Lan Tan1, Li Sun2 1Department of Neurology, Qingdao Municipal Hospital, Qingdao University, Qingdao 266071, China; 2Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China; 3Department of Geriatric, Qingdao Mental Health Center, Qingdao 266034, China Contributions: (I) Conception and design: All authors; (II) Administrative support: All authors; (III) Provision of study materials or patients: All authors; (VI) Collection and assembly of data: All authors; (V) Data analysis and interpretation: All authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors should be regarded as co-first authors. Correspondence to: Dr. Lan Tan, MD, PhD. Department of Neurology, Qingdao Municipal Hospital, Qingdao University, No. 5 Donghai Middle Road, Qingdao 266071, China. Email: [email protected]; Dr. Li Sun, MD, PhD. Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China. Email: [email protected]. Background: Lectin-like oxidized low density lipoprotein receptor 1 (OLR1) locates within the area of chromosome 12p, which has been identified as the AD-susceptible region, and plays a role in lipid metabolism. Therefore, it has been suggested to be a good candidate gene for Alzheimer’s disease (AD). Several SNPs within OLR1 have been reported to have association with AD among Caucasians. Methods: We selected and genotyped three SNPs (rs1050283, rs1050286, rs17808009) in OLR1 to investigate its possible relationship with the onset of late-onset Alzheimer disease(LOAD) in 984 LOAD cases and 1,354 healthy controls among northern Han Chinese. Results: No significant association was found between the OLR1 (rs1050283, rs1050286, rs17808009) polymorphisms and LOAD, even after adjustment for gender and age and stratification for apolipoprotein E (APOE) status. Conclusions: Our study showed that the SNPs (rs1050283, rs1050286, rs17808009) located in the 3’UTR of OLR1 may not involve in the mechanism of LOAD in Han Chinese population. Keywords: Alzheimer’s disease (AD); genetics; oxidized low density lipoprotein receptor 1(OLR1); polymorphism association study Submitted Feb 26, 2018. Accepted for publication Apr 13, 2018. doi: 10.21037/atm.2018.04.31 View this article at: http://dx.doi.org/10.21037/atm.2018.04.31 Introduction was influenced by genetic risk factors (3). Presenilin 1 (PSEN1), presenilin 2 (PSEN2), and amyloid precursor Alzheimer’s disease (AD) is a common cause for dementia protein (APP) gene mutations bear responsibility for most among old people. It could cause progressive cognitive familial AD cases (4). The ε4 allele of apolipoprotein impairment, accumulation of amyloid plaques (AP) and E (APOE) is widely recognized for the more common intracellular neurofibrillary tangles (NFTs), and neuronal sporadic late-onset AD (LOAD). APOE has been identified loss in brain (1,2). The pathogenesis of AD is very complex. as a major transporter of cholesterol both in the blood and A number of studies have suggested that the onset of AD central nervous system (5). Based on the role of APOE © Annals of Translational Medicine. All rights reserved. atm.amegroups.com Ann Transl Med 2018;6(10):172 Page 2 of 8 Wang et al. OLR1 and AD for the pathogenesis of AD and some other findings, three functional SNPs (rs1050283, rs1050286, rs17808009) we hypothesized that imbalanced cholesterol levels may located in 3'UTR of OLR1 with LOAD in Han Chinese influence the risk of AD, and statins and other cholesterol- population. modifying medications may be useful in AD’s treatment and prevention (6-16). Methods Chromosome 12p has been recognized as a region associated with AD by Genome-wide linkage analyses. It Subjects includes lipoprotein receptor-related protein 1 (LRP1), α-2- Totally, 984 sporadic LOAD patients and 1,354 healthy macrogobulin (A2M), as well as OLR1 (17). OLR1, a class controls were enrolled for the study. They were matched E scavenger receptor, is a trans-membrane glycoprotein. for age and sex. The cases came from several hospitals in It could mediate the uptake and internalization of oxidized Shandong Province. All participants were northern Han low-density lipoprotein (oxLDL) (18). In vitro factors such Chinese. The diagnosis of AD was carried out with standard as oxLDL, oxidative stress and inflammatory cytokines, and in vivo proatherogenic stimuli such as diabetes clinical evaluation in accordance with NINCDS-ADRDA mellitus, hyperlipidaemia, as well as hypertension could criteria (46). No patients had severe CNS diseases or a induce its expression (19-21). Increased level of oxLDL family history of dementia. The controls were confirmed induces endothelial cell activation, dysfunction, apoptosis healthy and neurologically normal by medical history, and impaired vasorelaxation, thus contribute causally to general examinations, laboratory examinations and Mini atherosclerosis development and progression (22-28). Mental State Examination MMSE (score ≥28). They were Indeed, epidemiologic and clinical literature has consistently enrolled from the Health Examination Center of the reported an association between atherosclerosis, vascular Qingdao Municipal Hospital. The present study was carried risk factors and AD (29,30). Therefore, it is possible that out with approval by the Institute Ethical Committee of variations in ORL1 could lead to oxLDL being removed less Qingdao Municipal Hospital and with informed consent of efficiently, and this, with increased amyloid beta peptide (Aβ) all the participants or their representatives. The ID number might result in death of neurons (31-33). of informed consent is 2009-05-06-003. MicroRNAs (miRNAs) are 19–24 nt single-stranded RNA molecules. It can down-regulate gene expression SNP selection and genotype through binding to a complementary sequence in the 3'UTR of target genes, thus resulting in translational inhibition or Candidate SNPs meet the following criterion: (I) SNPs mRNA cleavage and subsequent degradation (34). Clinical of miRNA binding sites located in the 3'UTR region of and research evidence showed that a number of miRNAs OLR1; (II) SNPs from the public databases and literatures; are dysregulated in AD patients and AD animal models (III) SNPs with a minor allele frequency (MAF) ≥0.05 in (35-39). The single-nucleotide polymorphism rs1050283 Han Chinese. Finally, three SNPs (rs1050283, rs1050286, (also known as +1073 C/T) located in the 3'UTR of OLR1 rs17808009) were chosen and genotyped. may influence its regulator miRNA binding and subsequent Standard procedures were used for extraction of human protein homeostasis. Several studies have explored the genomic DNA. Genotyping of OLR1 polymorphisms association between OLR1 +1073 C/T and AD. However, (rs1050286and rs17808009) and APOE polymorphisms the results are inconsistent (17,40-43). Recently, a meta- (rs429358 and rs7412) were determined by a custom-by- TM analysis confirmed the association of OLR1+1073 C/T with design 2-×48-Plex SNPscan kit (Genesky Biotechnologies a decreased risk of AD among Caucasians (44). Moreover, Inc., Shanghai, China). Papassotiropoulos et al. investigated a cluster of cholesterol- The sequence of probes in SNP scan reaction and related genes and identified rs1050286 polymorphism in sequence for the PCR reaction are available from the OLR1 conferring significant susceptibility for AD (45). corresponding author. The improved multiplex ligase Given the potential importance of OLR1 in the pathogenesis detection reaction (iMLDR) method was used for and development of AD, we performed a case-control detection of genotyping of rs1050283 in the OLR1 gene study consisting of 984 patients with LOAD as compared (Shanghai Genesky Bio-Tech Co, Ltd; www.geneskies. to 1,354 age-matched healthy subjects among northern com). Primers for rs1050283 are as follows: forward primer: Han Chinese, by analyzing the potentially association of CTTGATTTCGGAATGGCCTCTG; reverse primer: © Annals of Translational Medicine. All rights reserved. atm.amegroups.com Ann Transl Med 2018;6(10):172 Annals of Translational Medicine, Vol 6, No 10 May 2018 Page 3 of 8 Table 1 Characteristics of the study groups Characteristic Patients with AD (n=984) Control subjects (n=1,354) P value OR (95% CI) Age (years; mean ± SD) 0.186* – Age at examination 79.81±6.71 75.50±6.49 Age at onset 75.15±6.08 – Gender, n (%) 0.068 – Male 406 (41.3) 610 (45.1) Female 578 (58.7) 744 (54.9) MMSE score, mean ± SD 11.99±6.20 28.41±1.09 <0.001 – APOEε4 status, n (%) <0.001 2.422 (1.970–2.977) APOEε4 (+) 280 (27.8) 191 (13.6) APOEε4 (−) 704 (72.2) 1,163 (86.4) *, P value was calculated with the age of onset for late-onset AD and age at examination for control subjects. APOEε4 (+) refers to subject carrying at least one APOEε4 allele; APOEε4 (−) refers to subject carrying no APOEε4 allele. Differences in the characteristics of age and MMSE score between the two groups were examined using the Student’s t-test. Differences in gender and APOEε4 status between patients with AD and control subjects were assessed using the χ2 test. AD, Alzheimer disease; APOE, apolipoprotein E; CI, confidence in- terval; MMSE, Mini Mental State Examination; OR, odds ratio; SD, standard deviation. CCTTTGCAGAAACTGGGGTTCC. Data analysis was well-matched with regard to age (P=0.186) and gender performed via an ABI3130XL Sequencer and GeneMapper (P=0.068). LOAD subjects had much lower MMSE scores Software v4.1 (Applied Biosystems, USA). than controls (P<0.001). Bearing of the APOE ε4 allele was related to an elevated risk for LOAD as expected (OR =2.422, 95% CI: 1.970–2.977, P<0.001). Statistical analyses Table 2 summarized the details of the SNPs detected in Differences in the characteristics between two groups our study.
Load more

Recommended publications
  • Genome Wide Analysis of TLR1/2- and TLR4-Activated SZ95 Sebocytes
    RESEARCH ARTICLE Genome wide analysis of TLR1/2- and TLR4- activated SZ95 sebocytes reveals a complex immune-competence and identifies serum amyloid A as a marker for activated sebaceous glands DaÂniel ToÈ rőcsik1,2*, DoÂra KovaÂcs1, SzilaÂrd PoÂliska3, Zita Szentkereszty-KovaÂcs1, a1111111111 Marianna LovaÂszi1, Katalin Hegyi1, Andrea Szegedi1,4, Christos C. Zouboulis5, a1111111111 Mona Ståhle2 a1111111111 a1111111111 1 Department of Dermatology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 2 Unit of Dermatology and Venereology, Department of Medicine, Karolinska Institutet, Karolinska University Hospital, a1111111111 Stockholm, Sweden, 3 Department of Biochemistry and Molecular Biology, Genomic Medicine and Bioinformatics Core Facility, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 4 Division of Dermatological Allergology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 5 Departments of Dermatology, Venereology, Allergology and Immunology, Dessau Medical Center, Brandenburg Medical School Theodore Fontane, Dessau, Germany OPEN ACCESS * [email protected] Citation: ToÈrőcsik D, KovaÂcs D, PoÂliska S, Szentkereszty-KovaÂcs Z, LovaÂszi M, Hegyi K, et al. (2018) Genome wide analysis of TLR1/2- and TLR4-activated SZ95 sebocytes reveals a complex Abstract immune-competence and identifies serum amyloid A as a marker for activated sebaceous glands. Toll-like receptors (TLR) 2 and 4 are active in sebaceous glands and play a central role in PLoS ONE 13(6): e0198323. https://doi.org/ the development of acne. Still, there is only limited knowledge on their effect on sebocytes. 10.1371/journal.pone.0198323 In this work we performed global gene expression profile analysis with functional clustering Editor: Mauro Picardo, San Gallicano Dermatologic of the differentially regulated genes of TLR1/2 (PAM3CSK4)- and TLR4 (lipopolysaccharide Institute, ITALY [LPS])-activated SZ95 sebocytes.
    [Show full text]
  • Basic Science * Drug X Is Used for Ongoing IP/Patent Assessment Heart: First Published As 10.1136/Heartjnl-2021-BCS.199 on 4 June 2021
    Abstracts Basic science * Drug X is used for ongoing IP/patent assessment Heart: first published as 10.1136/heartjnl-2021-BCS.199 on 4 June 2021. Downloaded from Conflict of Interest No BS1 REPROGRAMMING HUMAN MACROPHAGES WITH DRUG X: POTENTIAL MECHANISMS FOR STABILISATION OF ATHEROSCLEROTIC PLAQUES BS2 MECHANOSENSOR PIEZO1 IN SKELETAL MUSCLE PERICYTES 1Klaudia Kocsy, 1Endre Kiss-Toth, 2Jessica Redgrave, 2Arshad Majid, 3Sheila Francis. 1Department of Infection, Immunity & Cardiovascular Disease, The University of Sheffield, 1Yilizila Abudushalamu, 1Hema Viswambharan, 2Romana Mughal, 1Richard Cubbon, Sheffield, UK; 2Department of Neuroscience, The University of Sheffield, Sheffield, UK; 3The 1Mark Kearney, 1David Beech, 1Piruthivi Sukumar. 1Discovery and Translational Science University of Sheffield, Sheffield, UK Department Leeds Institute of Cardiovascular and Metabolic Medic, Leeds, UK; 2Department of Optometry and Vision Sciences School of Applied Sciences University of Huddersfield 10.1136/heartjnl-2021-BCS.199 10.1136/heartjnl-2021-BCS.200 Introduction Ischemic stroke is commonly caused by large artery atherosclerosis. Patients with a high atherosclerotic bur- Introduction Pericytes (PC) are mural cells which are present den (stenosis) and inflamed or ulcerated plaque are at in blood microvessels. They play an important part in the for- increased risk of early recurrent ischaemic events. Treatment mation and stabilization of new blood vessels. They are essen- with anti-inflammatory agents may therefore reduce stroke tial for vascular development and cardiovascular homeostasis. incidence and recurrence in patients with this condition, but They wrap around the endothelial cells (EC) and endothelial- in vitro human studies of the possible mechanisms are lacking. pericyte communication is both via physical contact and para- 1 We hypothesised that an anti-inflammatory compound crine signalling.
    [Show full text]
  • Evaluating the Effect of TLR4-Overexpressing on The
    Guo et al. J of Biol Res-Thessaloniki (2020) 27:13 https://doi.org/10.1186/s40709-020-00124-3 Journal of Biological Research-Thessaloniki RESEARCH Open Access Evaluating the efect of TLR4-overexpressing on the transcriptome profle in ovine peripheral blood mononuclear cells Xiaofei Guo1†, Jinlong Zhang1,2†, Yao Li2, Jing Yang1, Yihai Li1, Chunxiao Dong1, Guoshi Liu2, Zhengxing Lian2 and Xiaosheng Zhang1* Abstract Background: Toll-like receptor 4 (TLR4) plays an important role in the elimination of Gram-negative bacteria infec- tions and the initiation of antiinfammatory response. Using the technology of pronuclear microinjection, genetically modifed (GM) sheep with TLR4 overexpression were generated. Previous studies have shown that these GM sheep exhibited a higher infammatory response to Gram-negative bacteria infection than wild type (WT) sheep. In order to evaluate the gene expression of GM sheep and study the co-expressed and downstream genes for TLR4, peripheral blood mononuclear cells (PBMC) from TLR4-overexpressing (Tg) and wild type (WT) sheep were selected to discover the transcriptomic diferences using RNA-Seq. Result: An average of 18,754 and 19,530 known genes were identifed in the Tg and WT libraries, respectively. A total of 338 known genes and 85 novel transcripts were found to be diferentially expressed in the two libraries (p < 0.01). A diferentially expressed genes (DEGs) enrichment analysis showed that the GO terms of infammatory response, cell recognition, etc. were signifcantly (FDR < 0.05) enriched. Furthermore, the above DEGs were signifcantly (FDR < 0.05) enriched in the sole KEGG pathway of the Phagosome. Real-time PCR showed the OLR1, TLR4 and CD14 genes to be diferentially expressed in the two groups, which validated the DEGs data.
    [Show full text]
  • Modulation of Cell-Mediated Immunity by HIV-1 Infection of Macrophages
    Modulation of cell-mediated immunity by HIV-1 infection of macrophages Lucy Caitríona Kiernan Bell Division of Infection and Immunity University College London PhD Supervisor: Dr Mahdad Noursadeghi A thesis submitted for the degree of Doctor of Philosophy University College London August 2014 Declaration I, Lucy Caitríona Kiernan Bell, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Cell-mediated immunity (CMI) is central to the host response to intracellular pathogens such as Mycobacterium tuberculosis (Mtb). The function of CMI can be modulated by human immunodeficiency virus (HIV)-1 via its pleiotropic effects on the immune response, including modulation of macrophages, which are parasitized by both HIV-1 and Mtb. HIV-1 infection is associated with increased risk of tuberculosis (TB), and so in this thesis I sought to explore the host/pathogen interactions through which HIV-1 dysregulates CMI, and thus changes the natural history of TB. Using an in vitro model of human monocyte-derived macrophages (MDMs), I characterise a phenotype wherein HIV-1 specifically attenuates production of the immunoregulatory cytokine interleukin (IL)-10 in response to Mtb and other innate immune stimuli. I show that this phenotype requires HIV-1 integration and gene expression, and may result from a function of the HIV-1 accessory proteins. I identify that the phosphoinositide 3-kinase (PI3K) pathway specifically regulates IL-10 production in human MDMs, and thus may be a target for HIV-1 to mediate IL-10 attenuation.
    [Show full text]
  • Critical Role of Oxidized LDL Receptor-1 in Intravascular
    www.nature.com/scientificreports OPEN Critical role of oxidized LDL receptor‑1 in intravascular thrombosis in a severe infuenza mouse model Marumi Ohno1, Akemi Kakino2, Toshiki Sekiya1, Naoki Nomura1, Masashi Shingai1, Tatsuya Sawamura2 & Hiroshi Kida1* Although coagulation abnormalities, including microvascular thrombosis, are thought to contribute to tissue injury and single‑ or multiple‑organ dysfunction in severe infuenza, the detailed mechanisms have yet been clarifed. This study evaluated infuenza‑associated abnormal blood coagulation utilizing a severe infuenza mouse model. After infecting C57BL/6 male mice with intranasal applications of 500 plaque‑forming units of infuenza virus A/Puerto Rico/8/34 (H1N1; PR8), an elevated serum level of prothrombin fragment 1 + 2, an indicator for activated thrombin generation, was observed. Also, an increased gene expression of oxidized low‑density lipoprotein (LDL) receptor‑1 (Olr1), a key molecule in endothelial dysfunction in the progression of atherosclerosis, was detected in the aorta of infected mice. Body weight decrease, serum levels of cytokines and chemokines, viral load, and infammation in the lungs of infected animals were similar between wild‑type and Olr1 knockout (KO) mice. In contrast, the elevation of prothrombin fragment 1 + 2 levels in the sera and intravascular thrombosis in the lungs by PR8 virus infection were not induced in KO mice. Collectively, the results indicated that OLR1 is a critical host factor in intravascular thrombosis as a pathogeny of severe infuenza. Thus, OLR1 is a promising novel therapeutic target for thrombosis during severe infuenza. Infuenza is a respiratory disease and remains a major health concern, causing approximately half a million deaths per year globally1.
    [Show full text]
  • TDP43 Exacerbates Atherosclerosis Progression by Promoting Inflammation and Lipid Uptake of Macrophages
    fcell-09-687169 July 2, 2021 Time: 12:55 # 1 ORIGINAL RESEARCH published: 05 July 2021 doi: 10.3389/fcell.2021.687169 TDP43 Exacerbates Atherosclerosis Progression by Promoting Inflammation and Lipid Uptake of Macrophages Ning Huangfu, Yong Wang, Zhenyu Xu, Wenyuan Zheng, Chunlan Tao, Zhenwei Li, Yewen Hu and Xiaomin Chen* Department of Cardiology, Ningbo First Hospital, Ningbo, China Objective: Atherosclerosis (AS), characterized by cholesterol overloaded-macrophages accumulation and plaque formation in blood vessels, is the major cause of cardiovascular disease. Transactive response DNA-binding protein∼43 kDa (TDP43) has recently been identified as an independent driver of neurodegenerative diseases Edited by: through triggering inflammatory response. This study investigated whether TDP43 is Yuxain Shen, involved in AS development, especially in macrophages-mediated-foam cell formation Anhui Medical University, China and inflammatory responses. Reviewed by: Juntang Shao, Methods: Transactive response DNA-binding protein∼43 kDa expressions in Anhui Medical University, China Heiko Lemcke, oxidized low-density lipoprotein (oxLDL)-treated macrophages and peripheral blood University Medical Center Rostock, mononuclear cells (PBMCs) from patients with coronary artery disease (CAD) were Germany detected by real time-polymerase chain reaction (RT-PCR), Western blot, and *Correspondence: immunofluorescence. Gene gain or loss of function was used to investigate the effects Xiaomin Chen [email protected] of TDP43 on macrophages-mediated lipid untake and inflammation with ELISA, protein immunoprecipitation, RT-PCR, Western blot, and immunofluorescence. Macrophage Specialty section: TDP43 specific knockout mice with ApoE−=− background were fed with western This article was submitted to Signaling, diet for 12 weeks to establish AS model, and used to explore the role of TDP43 a section of the journal on AS progression.
    [Show full text]
  • SARS-Cov-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-Like Receptors in Pathogenesis
    International Journal of Molecular Sciences Article SARS-CoV-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-like Receptors in Pathogenesis Agnese Gugliandolo 1 , Luigi Chiricosta 1 , Valeria Calcaterra 2,3,† , Mara Biasin 4 , Gioia Cappelletti 4 , Stephana Carelli 5 , Gianvincenzo Zuccotti 2,4, Maria Antonietta Avanzini 6 , Placido Bramanti 1, Gloria Pelizzo 4,7 and Emanuela Mazzon 1,*,† 1 IRCCS Centro Neurolesi “Bonino-Pulejo”, Via Provinciale Palermo, Contrada Casazza, 98124 Messina, Italy; [email protected] (A.G.); [email protected] (L.C.); [email protected] (P.B.) 2 Department of Pediatrics, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy; [email protected] (V.C.); [email protected] (G.Z.) 3 Pediatrics and Adolescentology Unit, Department of Internal Medicine, University of Pavia, 27100 Pavia, Italy 4 Department of Biomedical and Clinical Sciences–L. Sacco, University of Milan, 20157 Milan, Italy; [email protected] (M.B.); [email protected] (G.C.); [email protected] (G.P.) 5 Pediatric Clinical Research Center Fondazione Romeo ed Enrica Invernizzi, University of Milan, 20157 Milan, Italy; [email protected] 6 Cell Factory, Pediatric Hematology Oncology Unit, Fondazione IRCCS Policlinico San Matteo, 27100 Pavia, Italy; [email protected] 7 Pediatric Surgery Unit, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy Citation: Gugliandolo, A.; Chiricosta, * Correspondence: [email protected] L.; Calcaterra, V.; Biasin, M.; † These authors contribute equally to the paper as senior author. Cappelletti, G.; Carelli, S.; Zuccotti, G.; Avanzini, M.A.; Bramanti, P.; Abstract: Different mechanisms were proposed as responsible for COVID-19 neurological symptoms Pelizzo, G.; et al.
    [Show full text]
  • Upregulation of OLR1 and IL17A Genes and Their Association with Blood Glucose and Lipid Levels in Femoropopliteal Artery Disease
    1160 EXPERIMENTAL AND THERAPEUTIC MEDICINE 13: 1160-1168, 2017 Upregulation of OLR1 and IL17A genes and their association with blood glucose and lipid levels in femoropopliteal artery disease CANER ARSLAN1*, BURCU BAYOGLU2*, CIGDEM TEL1, MUJGAN CENGIZ2, AHMET DIRICAN3 and KAZIM BESIRLI1 Departments of 1Cardiovascular Surgery and 2Medical Biology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul 34098; 3Department of Biostatistics and Medical Informatics, Istanbul Medical Faculty, Istanbul University, Istanbul 34093, Turkey Received April 4, 2016; Accepted October 28, 2016 DOI: 10.3892/etm.2017.4081 Abstract. Oxidized low-density lipoprotein receptor 1 (OLR1) identify an association between OLR1 and IL17A genes and and interleukin 17A (IL17A) have pro‑inflammatory roles in FP artery disease. OLR1 and IL17A mRNA transcripts may be the development of cardiovascular disorders. The present associated with blood lipid parameters and with the develop- study evaluated the association of OLR1 and IL17A and their ment of FP artery disease. polymorphisms with the development of femoropopliteal (FP) artery disease. The mRNA expression of OLR1 and Introduction IL17A in peripheral blood mononuclear cells as well as the frequency of OLR1 rs11053646 and IL17A rs8193037 and Peripheral artery disease (PAD) is an occlusive disease of rs3819025 polymorphisms were assessed by polymerase the peripheral circulation system. PAD is one of the major chain reaction in 70 patients with FP artery disease and syndromes of atherothrombosis and is found in 15‑20% of 80 age‑matched disease‑free controls. Furthermore, the levels individuals aged >70 years (1). Early diagnosis is important of plasma cytokines were assessed by multiplex immunoassay. to improve patient quality of life and prevent secondary OLR1 and IL17A mRNA expression was significantly higher vascular events, such as stroke or acute myocardial infarc- in patients with FP artery disease compared with that in tion (AMI) (2).
    [Show full text]
  • Recombinant Human LOX-1/OLR1 Catalog Number: 1798-LX
    Recombinant Human LOX-1/OLR1 Catalog Number: 1798-LX DESCRIPTION Source Mouse myeloma cell line, NS0­derived Ser61­Gln273, with an N­terminal 9­His tag Accession # P78380 N­terminal Sequence His Analysis Structure / Form Disulfide­linked homodimer Predicted Molecular 25.5 kDa (monomer) Mass SPECIFICATIONS SDS­PAGE 35­40 kDa, reducing conditions Activity Measured by its binding ability in a functional ELISA. Immobilized rhLOX­1 at 5 µg/mL (100 µL/well) can bind biotinylated advanced glycation endproducts of bovine serum albumin (AGE­BSA) with a linear range of 0.02­1 µg/mL. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by silver stain. Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 100 μg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 3 months, ­20 to ­70 °C under sterile conditions after reconstitution. BACKGROUND Lectin­like oxidized low­density­lipoprotein receptor­1 (LOX­1), also known as oxidized low­density­lipoprotein receptor­1 (OLR­1), is a type II transmembrane receptor belonging to the C­type lectin family (1). It also belongs to the functionally defined scavenger receptor (SR) superfamily, whose members share the common ability to bind and internalize modified forms of Low Density Lipoproteins (LDL) (2 ­ 4).
    [Show full text]
  • Nomenclature Standardizing Scavenger Receptor
    Standardizing Scavenger Receptor Nomenclature Mercy PrabhuDas, Dawn Bowdish, Kurt Drickamer, Maria This information is current as Febbraio, Joachim Herz, Lester Kobzik, Monty Krieger, of April 20, 2014. John Loike, Terry K. Means, Soren K. Moestrup, Steven Post, Tatsuya Sawamura, Samuel Silverstein, Xiang-Yang Wang and Joseph El Khoury Downloaded from J Immunol 2014; 192:1997-2006; ; doi: 10.4049/jimmunol.1490003 http://www.jimmunol.org/content/192/5/1997 http://www.jimmunol.org/ References This article cites 76 articles, 39 of which you can access for free at: http://www.jimmunol.org/content/192/5/1997.full#ref-list-1 Subscriptions Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions Permissions Submit copyright permission requests at: http://www.aai.org/ji/copyright.html at McMaster Univ Hlth Sci Lib on April 20, 2014 Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Standardizing Scavenger Receptor Nomenclature x Mercy PrabhuDas,* Dawn Bowdish,† Kurt Drickamer,‡ Maria Febbraio, { ‖ # †† Joachim Herz, Lester Kobzik, Montyxx Krieger, John Loike,**{{ Terry K. Means,‖‖ Soren K. Moestrup,‡‡ Steven Post, Tatsuya Sawamura, Samuel Silverstein, Xiang-Yang Wang,## and Joseph El Khoury*** Scavenger receptors constitute a large family of proteins at the workshop and to solicit additional feedback that are structurally diverse and participate in a wide from the broader research community.
    [Show full text]
  • OLR1 Promotes Pancreatic Cancer Metastasis Via Increased C-Myc
    Published OnlineFirst February 4, 2020; DOI: 10.1158/1541-7786.MCR-19-0718 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS OLR1 Promotes Pancreatic Cancer Metastasis via Increased c-Myc Expression and Transcription of HMGA2 A C Gang Yang1, Guangbing Xiong1,2, Mengyu Feng1, Fangyu Zhao1, Jiangdong Qiu1, Yueze Liu1, Zhe Cao1, Huanyu Wang1, Jinshou Yang1, Lei You1, Lianfang Zheng3, Taiping Zhang1,4, and Yupei Zhao1 ABSTRACT ◥ Pancreatic cancer is one of the most lethal human malignancies, pancreatic cancer cells in vitro and in vivo. Mechanistically, partly because of its propensity for metastasis. However, the OLR1 increased HMGA2 transcription by upregulating c-Myc mechanisms of metastasis in pancreatic cancer remain unclear. expression to promote the metastasis of pancreatic cancer cells. In Oxidized low-density lipoprotein receptor 1 (OLR1), a lectin-like addition, patients with pancreatic cancer with high expression of scavenger receptor that recognizes several ligands, such as oxidized OLR1–c-Myc–HMGA2 axis showed worse prognosis compared low-density lipoprotein, was previously reported in cardiovascular with patients with low expression of OLR1–c-Myc–HMGA2 axis. and metabolic diseases. The role and mechanism of OLR1 in pancreatic cancer is unclear. In this study, we found that OLR1 Implications: Our findings suggested that the OLR1–c-Myc– expression was significantly higher in pancreatic cancer tissues than HMGA2 axis promotes metastasis of pancreatic cancer cells and that in adjacent normal tissues and closely associated with
    [Show full text]
  • Suppressor Cells in Cancer Patients Polymorphonuclear Myeloid
    SCIENCE IMMUNOLOGY | RESEARCH ARTICLE CANCER 2016 © The Authors, some rights reserved; Lectin-type oxidized LDL receptor-1 distinguishes exclusive licensee American Association population of human polymorphonuclear for the Advancement of Science. myeloid-derived suppressor cells in cancer patients Thomas Condamine,1* George A. Dominguez,1 Je-In Youn,1† Andrew V. Kossenkov,1 Sridevi Mony,1 Kevin Alicea-Torres,1 Evgenii Tcyganov,1 Ayumi Hashimoto,1 Yulia Nefedova,1 Cindy Lin,1 Simona Partlova,1‡ Alfred Garfall,2,3 Dan T. Vogl,2,3 Xiaowei Xu,2 Stella C. Knight,4 George Malietzis,4,5 Gui Han Lee,4,5 Evgeniy Eruslanov,2 Steven M. Albelda,2,3 Xianwei Wang,6 Jawahar L. Mehta,6 Meenakshi Bewtra,3 Anil Rustgi,2,3 Neil Hockstein,7 Robert Witt,7 Gregory Masters,7 Brian Nam,7 Denis Smirnov,8 Manuel A. Sepulveda,8 Dmitry I. Gabrilovich1§ Downloaded from Polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) are important regulators of immune re- sponses in cancer and have been directly implicated in the promotion of tumor progression. However, the heter- ogeneity of these cells and the lack of distinct markers hamper the progress in understanding the biology and clinical importance of these cells. Using partial enrichment of PMN-MDSC with gradient centrifugation, we determined that low-density PMN-MDSC and high-density neutrophils from the same cancer patients had a distinct gene profile. The most prominent changes were observed in the expression of genes associated with endoplasmic http://immunology.sciencemag.org/ reticulum (ER) stress. Unexpectedly, low-density lipoprotein (LDL) was one of the most increased regulators, and its receptor oxidized LDL receptor 1 (OLR1) was one of the most overexpressed genes in PMN-MDSC.
    [Show full text]