172 Original Article on Translational Neurodegeneration Page 1 of 8 Association of lectin-like oxidized low density lipoprotein receptor 1 (OLR1) polymorphisms with late-onset Alzheimer disease in Han Chinese Zuo-Teng Wang1#, Xiao-Ling Zhong2#, Meng-Shan Tan1, Hui-Fu Wang1, Chen-Chen Tan1, Wei Zhang1, Zhan-Jie Zheng3, Ling-Li Kong3, Lan Tan1, Li Sun2 1Department of Neurology, Qingdao Municipal Hospital, Qingdao University, Qingdao 266071, China; 2Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China; 3Department of Geriatric, Qingdao Mental Health Center, Qingdao 266034, China Contributions: (I) Conception and design: All authors; (II) Administrative support: All authors; (III) Provision of study materials or patients: All authors; (VI) Collection and assembly of data: All authors; (V) Data analysis and interpretation: All authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors should be regarded as co-first authors. Correspondence to: Dr. Lan Tan, MD, PhD. Department of Neurology, Qingdao Municipal Hospital, Qingdao University, No. 5 Donghai Middle Road, Qingdao 266071, China. Email: [email protected]; Dr. Li Sun, MD, PhD. Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China. Email: [email protected]. Background: Lectin-like oxidized low density lipoprotein receptor 1 (OLR1) locates within the area of chromosome 12p, which has been identified as the AD-susceptible region, and plays a role in lipid metabolism. Therefore, it has been suggested to be a good candidate gene for Alzheimer’s disease (AD). Several SNPs within OLR1 have been reported to have association with AD among Caucasians. Methods: We selected and genotyped three SNPs (rs1050283, rs1050286, rs17808009) in OLR1 to investigate its possible relationship with the onset of late-onset Alzheimer disease(LOAD) in 984 LOAD cases and 1,354 healthy controls among northern Han Chinese. Results: No significant association was found between the OLR1 (rs1050283, rs1050286, rs17808009) polymorphisms and LOAD, even after adjustment for gender and age and stratification for apolipoprotein E (APOE) status. Conclusions: Our study showed that the SNPs (rs1050283, rs1050286, rs17808009) located in the 3’UTR of OLR1 may not involve in the mechanism of LOAD in Han Chinese population. Keywords: Alzheimer’s disease (AD); genetics; oxidized low density lipoprotein receptor 1(OLR1); polymorphism association study Submitted Feb 26, 2018. Accepted for publication Apr 13, 2018. doi: 10.21037/atm.2018.04.31 View this article at: http://dx.doi.org/10.21037/atm.2018.04.31 Introduction was influenced by genetic risk factors (3). Presenilin 1 (PSEN1), presenilin 2 (PSEN2), and amyloid precursor Alzheimer’s disease (AD) is a common cause for dementia protein (APP) gene mutations bear responsibility for most among old people. It could cause progressive cognitive familial AD cases (4). The ε4 allele of apolipoprotein impairment, accumulation of amyloid plaques (AP) and E (APOE) is widely recognized for the more common intracellular neurofibrillary tangles (NFTs), and neuronal sporadic late-onset AD (LOAD). APOE has been identified loss in brain (1,2). The pathogenesis of AD is very complex. as a major transporter of cholesterol both in the blood and A number of studies have suggested that the onset of AD central nervous system (5). Based on the role of APOE © Annals of Translational Medicine. All rights reserved. atm.amegroups.com Ann Transl Med 2018;6(10):172 Page 2 of 8 Wang et al. OLR1 and AD for the pathogenesis of AD and some other findings, three functional SNPs (rs1050283, rs1050286, rs17808009) we hypothesized that imbalanced cholesterol levels may located in 3'UTR of OLR1 with LOAD in Han Chinese influence the risk of AD, and statins and other cholesterol- population. modifying medications may be useful in AD’s treatment and prevention (6-16). Methods Chromosome 12p has been recognized as a region associated with AD by Genome-wide linkage analyses. It Subjects includes lipoprotein receptor-related protein 1 (LRP1), α-2- Totally, 984 sporadic LOAD patients and 1,354 healthy macrogobulin (A2M), as well as OLR1 (17). OLR1, a class controls were enrolled for the study. They were matched E scavenger receptor, is a trans-membrane glycoprotein. for age and sex. The cases came from several hospitals in It could mediate the uptake and internalization of oxidized Shandong Province. All participants were northern Han low-density lipoprotein (oxLDL) (18). In vitro factors such Chinese. The diagnosis of AD was carried out with standard as oxLDL, oxidative stress and inflammatory cytokines, and in vivo proatherogenic stimuli such as diabetes clinical evaluation in accordance with NINCDS-ADRDA mellitus, hyperlipidaemia, as well as hypertension could criteria (46). No patients had severe CNS diseases or a induce its expression (19-21). Increased level of oxLDL family history of dementia. The controls were confirmed induces endothelial cell activation, dysfunction, apoptosis healthy and neurologically normal by medical history, and impaired vasorelaxation, thus contribute causally to general examinations, laboratory examinations and Mini atherosclerosis development and progression (22-28). Mental State Examination MMSE (score ≥28). They were Indeed, epidemiologic and clinical literature has consistently enrolled from the Health Examination Center of the reported an association between atherosclerosis, vascular Qingdao Municipal Hospital. The present study was carried risk factors and AD (29,30). Therefore, it is possible that out with approval by the Institute Ethical Committee of variations in ORL1 could lead to oxLDL being removed less Qingdao Municipal Hospital and with informed consent of efficiently, and this, with increased amyloid beta peptide (Aβ) all the participants or their representatives. The ID number might result in death of neurons (31-33). of informed consent is 2009-05-06-003. MicroRNAs (miRNAs) are 19–24 nt single-stranded RNA molecules. It can down-regulate gene expression SNP selection and genotype through binding to a complementary sequence in the 3'UTR of target genes, thus resulting in translational inhibition or Candidate SNPs meet the following criterion: (I) SNPs mRNA cleavage and subsequent degradation (34). Clinical of miRNA binding sites located in the 3'UTR region of and research evidence showed that a number of miRNAs OLR1; (II) SNPs from the public databases and literatures; are dysregulated in AD patients and AD animal models (III) SNPs with a minor allele frequency (MAF) ≥0.05 in (35-39). The single-nucleotide polymorphism rs1050283 Han Chinese. Finally, three SNPs (rs1050283, rs1050286, (also known as +1073 C/T) located in the 3'UTR of OLR1 rs17808009) were chosen and genotyped. may influence its regulator miRNA binding and subsequent Standard procedures were used for extraction of human protein homeostasis. Several studies have explored the genomic DNA. Genotyping of OLR1 polymorphisms association between OLR1 +1073 C/T and AD. However, (rs1050286and rs17808009) and APOE polymorphisms the results are inconsistent (17,40-43). Recently, a meta- (rs429358 and rs7412) were determined by a custom-by- TM analysis confirmed the association of OLR1+1073 C/T with design 2-×48-Plex SNPscan kit (Genesky Biotechnologies a decreased risk of AD among Caucasians (44). Moreover, Inc., Shanghai, China). Papassotiropoulos et al. investigated a cluster of cholesterol- The sequence of probes in SNP scan reaction and related genes and identified rs1050286 polymorphism in sequence for the PCR reaction are available from the OLR1 conferring significant susceptibility for AD (45). corresponding author. The improved multiplex ligase Given the potential importance of OLR1 in the pathogenesis detection reaction (iMLDR) method was used for and development of AD, we performed a case-control detection of genotyping of rs1050283 in the OLR1 gene study consisting of 984 patients with LOAD as compared (Shanghai Genesky Bio-Tech Co, Ltd; www.geneskies. to 1,354 age-matched healthy subjects among northern com). Primers for rs1050283 are as follows: forward primer: Han Chinese, by analyzing the potentially association of CTTGATTTCGGAATGGCCTCTG; reverse primer: © Annals of Translational Medicine. All rights reserved. atm.amegroups.com Ann Transl Med 2018;6(10):172 Annals of Translational Medicine, Vol 6, No 10 May 2018 Page 3 of 8 Table 1 Characteristics of the study groups Characteristic Patients with AD (n=984) Control subjects (n=1,354) P value OR (95% CI) Age (years; mean ± SD) 0.186* – Age at examination 79.81±6.71 75.50±6.49 Age at onset 75.15±6.08 – Gender, n (%) 0.068 – Male 406 (41.3) 610 (45.1) Female 578 (58.7) 744 (54.9) MMSE score, mean ± SD 11.99±6.20 28.41±1.09 <0.001 – APOEε4 status, n (%) <0.001 2.422 (1.970–2.977) APOEε4 (+) 280 (27.8) 191 (13.6) APOEε4 (−) 704 (72.2) 1,163 (86.4) *, P value was calculated with the age of onset for late-onset AD and age at examination for control subjects. APOEε4 (+) refers to subject carrying at least one APOEε4 allele; APOEε4 (−) refers to subject carrying no APOEε4 allele. Differences in the characteristics of age and MMSE score between the two groups were examined using the Student’s t-test. Differences in gender and APOEε4 status between patients with AD and control subjects were assessed using the χ2 test. AD, Alzheimer disease; APOE, apolipoprotein E; CI, confidence in- terval; MMSE, Mini Mental State Examination; OR, odds ratio; SD, standard deviation. CCTTTGCAGAAACTGGGGTTCC. Data analysis was well-matched with regard to age (P=0.186) and gender performed via an ABI3130XL Sequencer and GeneMapper (P=0.068). LOAD subjects had much lower MMSE scores Software v4.1 (Applied Biosystems, USA). than controls (P<0.001). Bearing of the APOE ε4 allele was related to an elevated risk for LOAD as expected (OR =2.422, 95% CI: 1.970–2.977, P<0.001). Statistical analyses Table 2 summarized the details of the SNPs detected in Differences in the characteristics between two groups our study.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages8 Page
-
File Size-