DOCSLIB.ORG

TDP43 Exacerbates Atherosclerosis Progression by Promoting Inflammation and Lipid Uptake of Macrophages

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TDP43 Exacerbates Atherosclerosis Progression by Promoting Inflammation and Lipid Uptake of Macrophages fcell-09-687169 July 2, 2021 Time: 12:55 # 1 ORIGINAL RESEARCH published: 05 July 2021 doi: 10.3389/fcell.2021.687169 TDP43 Exacerbates Atherosclerosis Progression by Promoting Inflammation and Lipid Uptake of Macrophages Ning Huangfu, Yong Wang, Zhenyu Xu, Wenyuan Zheng, Chunlan Tao, Zhenwei Li, Yewen Hu and Xiaomin Chen* Department of Cardiology, Ningbo First Hospital, Ningbo, China Objective: Atherosclerosis (AS), characterized by cholesterol overloaded-macrophages accumulation and plaque formation in blood vessels, is the major cause of cardiovascular disease. Transactive response DNA-binding protein∼43 kDa (TDP43) has recently been identified as an independent driver of neurodegenerative diseases Edited by: through triggering inflammatory response. This study investigated whether TDP43 is Yuxain Shen, involved in AS development, especially in macrophages-mediated-foam cell formation Anhui Medical University, China and inflammatory responses. Reviewed by: Juntang Shao, Methods: Transactive response DNA-binding protein∼43 kDa expressions in Anhui Medical University, China Heiko Lemcke, oxidized low-density lipoprotein (oxLDL)-treated macrophages and peripheral blood University Medical Center Rostock, mononuclear cells (PBMCs) from patients with coronary artery disease (CAD) were Germany detected by real time-polymerase chain reaction (RT-PCR), Western blot, and *Correspondence: immunofluorescence. Gene gain or loss of function was used to investigate the effects Xiaomin Chen [email protected] of TDP43 on macrophages-mediated lipid untake and inflammation with ELISA, protein immunoprecipitation, RT-PCR, Western blot, and immunofluorescence. Macrophage Specialty section: TDP43 specific knockout mice with ApoE−=− background were fed with western This article was submitted to Signaling, diet for 12 weeks to establish AS model, and used to explore the role of TDP43 a section of the journal on AS progression. Frontiers in Cell and Developmental Biology Results: Transactive response DNA-binding protein∼43 kDa expression increases Received: 30 March 2021 in oxLDL-treated macrophages and PBMCs from patients with CAD. Furthermore, Accepted: 07 June 2021 Published: 05 July 2021 we find that TDP43 promotes activation of NF-kB to increase inflammatory factor Citation: expression in macrophages through triggering mitochondrial DNA release to activate Huangfu N, Wang Y, Xu Z, cGAS-STING signaling. Moreover, TDP43 strengthens lipid uptake of macrophages Zheng W, Tao C, Li Z, Hu Y and through regulating b-catenin and PPAR-g complex to promote scavenger receptor Chen X (2021) TDP43 Exacerbates Atherosclerosis Progression by gene CD36 transcription. Finally, using macrophage TDP43 specific knockout mice Promoting Inflammation and Lipid with ApoE−=− background fed with western diet for 12 weeks to establish AS model, Uptake of Macrophages. Front. Cell Dev. Biol. 9:687169. we find that specific knockout of TDP43 in macrophages obviously alleviates western doi: 10.3389/fcell.2021.687169 diet-induced AS progression in mice. Frontiers in Cell and Developmental Biology| www.frontiersin.org 1 July 2021| Volume 9| Article 687169 fcell-09-687169 July 2, 2021 Time: 12:55 # 2 Huangfu et al. TDP43 Promotes Atherosclerosis Progression Conclusions: Transactive response DNA-binding protein∼43 kDa exacerbates atherosclerosis progression by promoting inflammation and lipid uptake of macrophages, suggesting TDP43 as a potential target for developing atherosclerotic drug. Keywords: atherosclerosis, macrophage, inflammation, CD36, TDP43 INTRODUCTION strengthens lipid uptake of macrophages through regulating b- catenin and peroxisome proliferator-activated receptor gamma Atherosclerosis (AS), which is a chronic immune-inflammatory (PPAR-g) complex to promote Cluster of Differentiation 36 disease characterized by cholesterol overloaded-macrophages Receptor (CD36) transcription. Moreover, specific knockout of accumulation and plaque formation in blood vessels, is the TDP43 in macrophages obviously alleviates western diet-induced major cause of cardiovascular disease, such as coronary artery AS progression in mice. Our study suggests TDP43 as a potential disease (CAD), and stroke (Go et al., 2013; Writing Group target for developing atherosclerotic drug. Members et al., 2016). Macrophages, as the primary immune cells present in plaque, have been reported to play essential roles in the development of AS through formation of foam cells and MATERIALS AND METHODS production of inflammatory factors (Hansson and Hermansson, 2011; Moore et al., 2013). Nowadays, the therapeutics of Cell Culture and Reagents AS remain undesirable. Thus, illuminating the underlying THP-1 macrophages, purchased from ATCC (United States), mechanism of macrophage-mediated foam cell formation and were cultured in complete RPMI-1640 (Gibco, United States) inflammatory responses in atherosclerosis will deeper our medium containing 10% fetal bovine serum (Gibco, understanding of disease and provide potential targets for United States). The THP-1 cells were stimulated with phorbol developing novel drugs for AS therapy. ester (PMA) (100 nM, Sigma, United States) to differentiate Transactive response DNA-binding protein∼43 kDa macrophage-like sticky cells for later experiments. Peritoneal (TDP43), as a nuclear deoxyribonucleic acid (DNA)/RNA macrophages were obtained 3 days after intraperitoneal injection binding protein, acts multiple roles on RNA metabolism, such of 2 ml of 3% thioglycolate broth, 2 ml of 3% proteose peptone as transport of RNA, transcription, translation (Ling et al., or 25 mg/ml of concanavalin A. Macrophages were isolated 2013; Coyne et al., 2017). Nowadays, mis-localization and by peritoneal lavage with 10 ml ice-cold PBS/EDTA and aggregation of TDP43 in the cytoplasm has been considered as cultured in high glucose (25 mM) DMEM supplemented an independent driver of neurodegenerative diseases, including with 10% LPDS (Sigma-Aldrich, S5394), 1% penicillin- Alzheimer’s disease, frontotemporal lobar degeneration, streptomycin for 2 h to adhere to the non-treated culture amyotrophic lateral sclerosis (Uryu et al., 2008; Yarchoan dish, as previously reported (Schon-Hegrad and Holt, 1981). et al., 2012; Nag et al., 2015; Yu L. et al., 2020). In mechanism, Human oxLDL was purchased from Guangzhou Yiyuan mis-localization of TDP43 in the cytoplasm is found to (China). Cyclosporine A (CsA) (the inhibitor of mitochondrial destroy mitochondria membrane potential, disturb metal ion permeability transition pore, 12.5 mM), XAV939 (b-catenin homeostasis and chromatin remodeling, and induce oxidative signaling inhibitor, 5 nM), Ethidium bromide (EtBr) (50 ng/ml), stress (Wang et al., 2016; Xia et al., 2016; Berson et al., 2017). and pyrrolidine dithiocarbamate (PDTC) (an inhibitor of Moreover, TDP43 is demonstrated to locate to mitochondria and the nuclear factor-kappa B, 10 mM) were purchased from trigger mitochondrial DNA release to activate cyclic GMP-AMP Sigma biotech (United States). SC75741 (another inhibitor synthase (cGAS)/stimulator of type 1 interferon gene (STING) of the nuclear factor-kappa B, 1 mM), sulfo-N-succinimidyl signaling, resulting in induction of inflammatory responses and oleate (SSO) (an inhibitor of CD36, 50 mM), and T0070907 type I IFN production in amyotrophic lateral sclerosis (Yu C.H. (PPAR-g inhibitor, 2 nM) were obtained from Selleck Chemicals et al., 2020; Kumar and Julien, 2021). Recently, TDP43 pathology (United States). has been reported to be associated with brain arteriolosclerosis (Katsumata et al., 2018). However, whether TDP43 is involved Real Time-PCR (RT-PCR) in atherosclerosis development, especially in macrophages- Real Time-polymerase chain reaction (RT-PCR) was performed mediated-foam cell formation and inflammatory responses as previously described (Huangfu et al., 2020). Briefly, after is still unclear. treatment, total RNA was extracted using the RNA elution kit In the present study, we explored the roles of TDP43 on (Tiangen, China). Subsequently, cDNA was generated using macrophage-mediated inflammatory responses and lipid uptake the PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). during AS progression in vitro and in vivo. Our study for The SYBR premix Ex Taq II (Takara, Japan) master mix was the first time demonstrates that TDP43 promotes oxidized used to perform the RT-PCR reactions, and the amplicons low-density lipoprotein (oxLDL)-induced mitochondrial DNA were detected using the ABI PRISM 7500 Detection System release to trigger inflammation in macrophages. Besides, TDP43 (United States). Expression of mRNAs level was normalized to Frontiers in Cell and Developmental Biology| www.frontiersin.org 2 July 2021| Volume 9| Article 687169 fcell-09-687169 July 2, 2021 Time: 12:55 # 3 Huangfu et al. TDP43 Promotes Atherosclerosis Progression GAPDH. Primers used for RT-PCR were as follows: TDP43, F: calculated as the targeted fluorescence intensity relative to the GGGTAACCGAAGATGAGAACG, R: CTGGGCTGTAACCGT DAPI fluorescence intensity. GGAG; IL6, F: ACTCACCTCTTCAGAACGAATTG, R: CCA TCTTTGGAAGGTTCAGGTTG; tumor necrosis factor-alpha Human PBMC Isolation (TNF-a), F: CCTCTCTCTAATCAGCCCTCTG, R: GAGGAC Human peripheral blood sample from health volunteers or CTGGGAGTAGATGAG; MT-ND1 (mitochondrial ND1 gene), patients with CAD were obtained from the Ningbo First Hospital, F: CTCTTCGTCTGATCCGTCCT, R: TGAGGTTGCGGTCT which was allowed by the ethics committee of Ningbo First GTTAGT; 18SSRNA (18S ribosomal RNA), F: GTAACCC Hospital. Human primary macrophages were induced from
Load more

Recommended publications
  • Polymorphisms with Late-Onset Alzheimer Disease in Han Chinese
    172 Original Article on Translational Neurodegeneration Page 1 of 8 Association of lectin-like oxidized low density lipoprotein receptor 1 (OLR1) polymorphisms with late-onset Alzheimer disease in Han Chinese Zuo-Teng Wang1#, Xiao-Ling Zhong2#, Meng-Shan Tan1, Hui-Fu Wang1, Chen-Chen Tan1, Wei Zhang1, Zhan-Jie Zheng3, Ling-Li Kong3, Lan Tan1, Li Sun2 1Department of Neurology, Qingdao Municipal Hospital, Qingdao University, Qingdao 266071, China; 2Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China; 3Department of Geriatric, Qingdao Mental Health Center, Qingdao 266034, China Contributions: (I) Conception and design: All authors; (II) Administrative support: All authors; (III) Provision of study materials or patients: All authors; (VI) Collection and assembly of data: All authors; (V) Data analysis and interpretation: All authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors should be regarded as co-first authors. Correspondence to: Dr. Lan Tan, MD, PhD. Department of Neurology, Qingdao Municipal Hospital, Qingdao University, No. 5 Donghai Middle Road, Qingdao 266071, China. Email: [email protected]; Dr. Li Sun, MD, PhD. Department of Neurology, Qingdao Central Hospital, Qingdao University, Qingdao 266042, China. Email: [email protected]. Background: Lectin-like oxidized low density lipoprotein receptor 1 (OLR1) locates within the area of chromosome 12p, which has been identified as the AD-susceptible region, and plays a role in lipid metabolism. Therefore, it has been suggested to be a good candidate gene for Alzheimer’s disease (AD). Several SNPs within OLR1 have been reported to have association with AD among Caucasians. Methods: We selected and genotyped three SNPs (rs1050283, rs1050286, rs17808009) in OLR1 to investigate its possible relationship with the onset of late-onset Alzheimer disease(LOAD) in 984 LOAD cases and 1,354 healthy controls among northern Han Chinese.
    [Show full text]
  • Genome Wide Analysis of TLR1/2- and TLR4-Activated SZ95 Sebocytes
    RESEARCH ARTICLE Genome wide analysis of TLR1/2- and TLR4- activated SZ95 sebocytes reveals a complex immune-competence and identifies serum amyloid A as a marker for activated sebaceous glands DaÂniel ToÈ rőcsik1,2*, DoÂra KovaÂcs1, SzilaÂrd PoÂliska3, Zita Szentkereszty-KovaÂcs1, a1111111111 Marianna LovaÂszi1, Katalin Hegyi1, Andrea Szegedi1,4, Christos C. Zouboulis5, a1111111111 Mona Ståhle2 a1111111111 a1111111111 1 Department of Dermatology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 2 Unit of Dermatology and Venereology, Department of Medicine, Karolinska Institutet, Karolinska University Hospital, a1111111111 Stockholm, Sweden, 3 Department of Biochemistry and Molecular Biology, Genomic Medicine and Bioinformatics Core Facility, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 4 Division of Dermatological Allergology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary, 5 Departments of Dermatology, Venereology, Allergology and Immunology, Dessau Medical Center, Brandenburg Medical School Theodore Fontane, Dessau, Germany OPEN ACCESS * [email protected] Citation: ToÈrőcsik D, KovaÂcs D, PoÂliska S, Szentkereszty-KovaÂcs Z, LovaÂszi M, Hegyi K, et al. (2018) Genome wide analysis of TLR1/2- and TLR4-activated SZ95 sebocytes reveals a complex Abstract immune-competence and identifies serum amyloid A as a marker for activated sebaceous glands. Toll-like receptors (TLR) 2 and 4 are active in sebaceous glands and play a central role in PLoS ONE 13(6): e0198323. https://doi.org/ the development of acne. Still, there is only limited knowledge on their effect on sebocytes. 10.1371/journal.pone.0198323 In this work we performed global gene expression profile analysis with functional clustering Editor: Mauro Picardo, San Gallicano Dermatologic of the differentially regulated genes of TLR1/2 (PAM3CSK4)- and TLR4 (lipopolysaccharide Institute, ITALY [LPS])-activated SZ95 sebocytes.
    [Show full text]
  • Basic Science * Drug X Is Used for Ongoing IP/Patent Assessment Heart: First Published As 10.1136/Heartjnl-2021-BCS.199 on 4 June 2021
    Abstracts Basic science * Drug X is used for ongoing IP/patent assessment Heart: first published as 10.1136/heartjnl-2021-BCS.199 on 4 June 2021. Downloaded from Conflict of Interest No BS1 REPROGRAMMING HUMAN MACROPHAGES WITH DRUG X: POTENTIAL MECHANISMS FOR STABILISATION OF ATHEROSCLEROTIC PLAQUES BS2 MECHANOSENSOR PIEZO1 IN SKELETAL MUSCLE PERICYTES 1Klaudia Kocsy, 1Endre Kiss-Toth, 2Jessica Redgrave, 2Arshad Majid, 3Sheila Francis. 1Department of Infection, Immunity & Cardiovascular Disease, The University of Sheffield, 1Yilizila Abudushalamu, 1Hema Viswambharan, 2Romana Mughal, 1Richard Cubbon, Sheffield, UK; 2Department of Neuroscience, The University of Sheffield, Sheffield, UK; 3The 1Mark Kearney, 1David Beech, 1Piruthivi Sukumar. 1Discovery and Translational Science University of Sheffield, Sheffield, UK Department Leeds Institute of Cardiovascular and Metabolic Medic, Leeds, UK; 2Department of Optometry and Vision Sciences School of Applied Sciences University of Huddersfield 10.1136/heartjnl-2021-BCS.199 10.1136/heartjnl-2021-BCS.200 Introduction Ischemic stroke is commonly caused by large artery atherosclerosis. Patients with a high atherosclerotic bur- Introduction Pericytes (PC) are mural cells which are present den (stenosis) and inflamed or ulcerated plaque are at in blood microvessels. They play an important part in the for- increased risk of early recurrent ischaemic events. Treatment mation and stabilization of new blood vessels. They are essen- with anti-inflammatory agents may therefore reduce stroke tial for vascular development and cardiovascular homeostasis. incidence and recurrence in patients with this condition, but They wrap around the endothelial cells (EC) and endothelial- in vitro human studies of the possible mechanisms are lacking. pericyte communication is both via physical contact and para- 1 We hypothesised that an anti-inflammatory compound crine signalling.
    [Show full text]
  • Evaluating the Effect of TLR4-Overexpressing on The
    Guo et al. J of Biol Res-Thessaloniki (2020) 27:13 https://doi.org/10.1186/s40709-020-00124-3 Journal of Biological Research-Thessaloniki RESEARCH Open Access Evaluating the efect of TLR4-overexpressing on the transcriptome profle in ovine peripheral blood mononuclear cells Xiaofei Guo1†, Jinlong Zhang1,2†, Yao Li2, Jing Yang1, Yihai Li1, Chunxiao Dong1, Guoshi Liu2, Zhengxing Lian2 and Xiaosheng Zhang1* Abstract Background: Toll-like receptor 4 (TLR4) plays an important role in the elimination of Gram-negative bacteria infec- tions and the initiation of antiinfammatory response. Using the technology of pronuclear microinjection, genetically modifed (GM) sheep with TLR4 overexpression were generated. Previous studies have shown that these GM sheep exhibited a higher infammatory response to Gram-negative bacteria infection than wild type (WT) sheep. In order to evaluate the gene expression of GM sheep and study the co-expressed and downstream genes for TLR4, peripheral blood mononuclear cells (PBMC) from TLR4-overexpressing (Tg) and wild type (WT) sheep were selected to discover the transcriptomic diferences using RNA-Seq. Result: An average of 18,754 and 19,530 known genes were identifed in the Tg and WT libraries, respectively. A total of 338 known genes and 85 novel transcripts were found to be diferentially expressed in the two libraries (p < 0.01). A diferentially expressed genes (DEGs) enrichment analysis showed that the GO terms of infammatory response, cell recognition, etc. were signifcantly (FDR < 0.05) enriched. Furthermore, the above DEGs were signifcantly (FDR < 0.05) enriched in the sole KEGG pathway of the Phagosome. Real-time PCR showed the OLR1, TLR4 and CD14 genes to be diferentially expressed in the two groups, which validated the DEGs data.
    [Show full text]
  • Modulation of Cell-Mediated Immunity by HIV-1 Infection of Macrophages
    Modulation of cell-mediated immunity by HIV-1 infection of macrophages Lucy Caitríona Kiernan Bell Division of Infection and Immunity University College London PhD Supervisor: Dr Mahdad Noursadeghi A thesis submitted for the degree of Doctor of Philosophy University College London August 2014 Declaration I, Lucy Caitríona Kiernan Bell, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Cell-mediated immunity (CMI) is central to the host response to intracellular pathogens such as Mycobacterium tuberculosis (Mtb). The function of CMI can be modulated by human immunodeficiency virus (HIV)-1 via its pleiotropic effects on the immune response, including modulation of macrophages, which are parasitized by both HIV-1 and Mtb. HIV-1 infection is associated with increased risk of tuberculosis (TB), and so in this thesis I sought to explore the host/pathogen interactions through which HIV-1 dysregulates CMI, and thus changes the natural history of TB. Using an in vitro model of human monocyte-derived macrophages (MDMs), I characterise a phenotype wherein HIV-1 specifically attenuates production of the immunoregulatory cytokine interleukin (IL)-10 in response to Mtb and other innate immune stimuli. I show that this phenotype requires HIV-1 integration and gene expression, and may result from a function of the HIV-1 accessory proteins. I identify that the phosphoinositide 3-kinase (PI3K) pathway specifically regulates IL-10 production in human MDMs, and thus may be a target for HIV-1 to mediate IL-10 attenuation.
    [Show full text]
  • Critical Role of Oxidized LDL Receptor-1 in Intravascular
    www.nature.com/scientificreports OPEN Critical role of oxidized LDL receptor‑1 in intravascular thrombosis in a severe infuenza mouse model Marumi Ohno1, Akemi Kakino2, Toshiki Sekiya1, Naoki Nomura1, Masashi Shingai1, Tatsuya Sawamura2 & Hiroshi Kida1* Although coagulation abnormalities, including microvascular thrombosis, are thought to contribute to tissue injury and single‑ or multiple‑organ dysfunction in severe infuenza, the detailed mechanisms have yet been clarifed. This study evaluated infuenza‑associated abnormal blood coagulation utilizing a severe infuenza mouse model. After infecting C57BL/6 male mice with intranasal applications of 500 plaque‑forming units of infuenza virus A/Puerto Rico/8/34 (H1N1; PR8), an elevated serum level of prothrombin fragment 1 + 2, an indicator for activated thrombin generation, was observed. Also, an increased gene expression of oxidized low‑density lipoprotein (LDL) receptor‑1 (Olr1), a key molecule in endothelial dysfunction in the progression of atherosclerosis, was detected in the aorta of infected mice. Body weight decrease, serum levels of cytokines and chemokines, viral load, and infammation in the lungs of infected animals were similar between wild‑type and Olr1 knockout (KO) mice. In contrast, the elevation of prothrombin fragment 1 + 2 levels in the sera and intravascular thrombosis in the lungs by PR8 virus infection were not induced in KO mice. Collectively, the results indicated that OLR1 is a critical host factor in intravascular thrombosis as a pathogeny of severe infuenza. Thus, OLR1 is a promising novel therapeutic target for thrombosis during severe infuenza. Infuenza is a respiratory disease and remains a major health concern, causing approximately half a million deaths per year globally1.
    [Show full text]
  • SARS-Cov-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-Like Receptors in Pathogenesis
    International Journal of Molecular Sciences Article SARS-CoV-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-like Receptors in Pathogenesis Agnese Gugliandolo 1 , Luigi Chiricosta 1 , Valeria Calcaterra 2,3,† , Mara Biasin 4 , Gioia Cappelletti 4 , Stephana Carelli 5 , Gianvincenzo Zuccotti 2,4, Maria Antonietta Avanzini 6 , Placido Bramanti 1, Gloria Pelizzo 4,7 and Emanuela Mazzon 1,*,† 1 IRCCS Centro Neurolesi “Bonino-Pulejo”, Via Provinciale Palermo, Contrada Casazza, 98124 Messina, Italy; [email protected] (A.G.); [email protected] (L.C.); [email protected] (P.B.) 2 Department of Pediatrics, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy; [email protected] (V.C.); [email protected] (G.Z.) 3 Pediatrics and Adolescentology Unit, Department of Internal Medicine, University of Pavia, 27100 Pavia, Italy 4 Department of Biomedical and Clinical Sciences–L. Sacco, University of Milan, 20157 Milan, Italy; [email protected] (M.B.); [email protected] (G.C.); [email protected] (G.P.) 5 Pediatric Clinical Research Center Fondazione Romeo ed Enrica Invernizzi, University of Milan, 20157 Milan, Italy; [email protected] 6 Cell Factory, Pediatric Hematology Oncology Unit, Fondazione IRCCS Policlinico San Matteo, 27100 Pavia, Italy; [email protected] 7 Pediatric Surgery Unit, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy Citation: Gugliandolo, A.; Chiricosta, * Correspondence: [email protected] L.; Calcaterra, V.; Biasin, M.; † These authors contribute equally to the paper as senior author. Cappelletti, G.; Carelli, S.; Zuccotti, G.; Avanzini, M.A.; Bramanti, P.; Abstract: Different mechanisms were proposed as responsible for COVID-19 neurological symptoms Pelizzo, G.; et al.
    [Show full text]
  • Upregulation of OLR1 and IL17A Genes and Their Association with Blood Glucose and Lipid Levels in Femoropopliteal Artery Disease
    1160 EXPERIMENTAL AND THERAPEUTIC MEDICINE 13: 1160-1168, 2017 Upregulation of OLR1 and IL17A genes and their association with blood glucose and lipid levels in femoropopliteal artery disease CANER ARSLAN1*, BURCU BAYOGLU2*, CIGDEM TEL1, MUJGAN CENGIZ2, AHMET DIRICAN3 and KAZIM BESIRLI1 Departments of 1Cardiovascular Surgery and 2Medical Biology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul 34098; 3Department of Biostatistics and Medical Informatics, Istanbul Medical Faculty, Istanbul University, Istanbul 34093, Turkey Received April 4, 2016; Accepted October 28, 2016 DOI: 10.3892/etm.2017.4081 Abstract. Oxidized low-density lipoprotein receptor 1 (OLR1) identify an association between OLR1 and IL17A genes and and interleukin 17A (IL17A) have pro‑inflammatory roles in FP artery disease. OLR1 and IL17A mRNA transcripts may be the development of cardiovascular disorders. The present associated with blood lipid parameters and with the develop- study evaluated the association of OLR1 and IL17A and their ment of FP artery disease. polymorphisms with the development of femoropopliteal (FP) artery disease. The mRNA expression of OLR1 and Introduction IL17A in peripheral blood mononuclear cells as well as the frequency of OLR1 rs11053646 and IL17A rs8193037 and Peripheral artery disease (PAD) is an occlusive disease of rs3819025 polymorphisms were assessed by polymerase the peripheral circulation system. PAD is one of the major chain reaction in 70 patients with FP artery disease and syndromes of atherothrombosis and is found in 15‑20% of 80 age‑matched disease‑free controls. Furthermore, the levels individuals aged >70 years (1). Early diagnosis is important of plasma cytokines were assessed by multiplex immunoassay. to improve patient quality of life and prevent secondary OLR1 and IL17A mRNA expression was significantly higher vascular events, such as stroke or acute myocardial infarc- in patients with FP artery disease compared with that in tion (AMI) (2).
    [Show full text]
  • Recombinant Human LOX-1/OLR1 Catalog Number: 1798-LX
    Recombinant Human LOX-1/OLR1 Catalog Number: 1798-LX DESCRIPTION Source Mouse myeloma cell line, NS0­derived Ser61­Gln273, with an N­terminal 9­His tag Accession # P78380 N­terminal Sequence His Analysis Structure / Form Disulfide­linked homodimer Predicted Molecular 25.5 kDa (monomer) Mass SPECIFICATIONS SDS­PAGE 35­40 kDa, reducing conditions Activity Measured by its binding ability in a functional ELISA. Immobilized rhLOX­1 at 5 µg/mL (100 µL/well) can bind biotinylated advanced glycation endproducts of bovine serum albumin (AGE­BSA) with a linear range of 0.02­1 µg/mL. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by silver stain. Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 100 μg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 3 months, ­20 to ­70 °C under sterile conditions after reconstitution. BACKGROUND Lectin­like oxidized low­density­lipoprotein receptor­1 (LOX­1), also known as oxidized low­density­lipoprotein receptor­1 (OLR­1), is a type II transmembrane receptor belonging to the C­type lectin family (1). It also belongs to the functionally defined scavenger receptor (SR) superfamily, whose members share the common ability to bind and internalize modified forms of Low Density Lipoproteins (LDL) (2 ­ 4).
    [Show full text]
  • Nomenclature Standardizing Scavenger Receptor
    Standardizing Scavenger Receptor Nomenclature Mercy PrabhuDas, Dawn Bowdish, Kurt Drickamer, Maria This information is current as Febbraio, Joachim Herz, Lester Kobzik, Monty Krieger, of April 20, 2014. John Loike, Terry K. Means, Soren K. Moestrup, Steven Post, Tatsuya Sawamura, Samuel Silverstein, Xiang-Yang Wang and Joseph El Khoury Downloaded from J Immunol 2014; 192:1997-2006; ; doi: 10.4049/jimmunol.1490003 http://www.jimmunol.org/content/192/5/1997 http://www.jimmunol.org/ References This article cites 76 articles, 39 of which you can access for free at: http://www.jimmunol.org/content/192/5/1997.full#ref-list-1 Subscriptions Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions Permissions Submit copyright permission requests at: http://www.aai.org/ji/copyright.html at McMaster Univ Hlth Sci Lib on April 20, 2014 Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Standardizing Scavenger Receptor Nomenclature x Mercy PrabhuDas,* Dawn Bowdish,† Kurt Drickamer,‡ Maria Febbraio, { ‖ # †† Joachim Herz, Lester Kobzik, Montyxx Krieger, John Loike,**{{ Terry K. Means,‖‖ Soren K. Moestrup,‡‡ Steven Post, Tatsuya Sawamura, Samuel Silverstein, Xiang-Yang Wang,## and Joseph El Khoury*** Scavenger receptors constitute a large family of proteins at the workshop and to solicit additional feedback that are structurally diverse and participate in a wide from the broader research community.
    [Show full text]
  • OLR1 Promotes Pancreatic Cancer Metastasis Via Increased C-Myc
    Published OnlineFirst February 4, 2020; DOI: 10.1158/1541-7786.MCR-19-0718 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS OLR1 Promotes Pancreatic Cancer Metastasis via Increased c-Myc Expression and Transcription of HMGA2 A C Gang Yang1, Guangbing Xiong1,2, Mengyu Feng1, Fangyu Zhao1, Jiangdong Qiu1, Yueze Liu1, Zhe Cao1, Huanyu Wang1, Jinshou Yang1, Lei You1, Lianfang Zheng3, Taiping Zhang1,4, and Yupei Zhao1 ABSTRACT ◥ Pancreatic cancer is one of the most lethal human malignancies, pancreatic cancer cells in vitro and in vivo. Mechanistically, partly because of its propensity for metastasis. However, the OLR1 increased HMGA2 transcription by upregulating c-Myc mechanisms of metastasis in pancreatic cancer remain unclear. expression to promote the metastasis of pancreatic cancer cells. In Oxidized low-density lipoprotein receptor 1 (OLR1), a lectin-like addition, patients with pancreatic cancer with high expression of scavenger receptor that recognizes several ligands, such as oxidized OLR1–c-Myc–HMGA2 axis showed worse prognosis compared low-density lipoprotein, was previously reported in cardiovascular with patients with low expression of OLR1–c-Myc–HMGA2 axis. and metabolic diseases. The role and mechanism of OLR1 in pancreatic cancer is unclear. In this study, we found that OLR1 Implications: Our findings suggested that the OLR1–c-Myc– expression was significantly higher in pancreatic cancer tissues than HMGA2 axis promotes metastasis of pancreatic cancer cells and that in adjacent normal tissues and closely associated with
    [Show full text]
  • Suppressor Cells in Cancer Patients Polymorphonuclear Myeloid
    SCIENCE IMMUNOLOGY | RESEARCH ARTICLE CANCER 2016 © The Authors, some rights reserved; Lectin-type oxidized LDL receptor-1 distinguishes exclusive licensee American Association population of human polymorphonuclear for the Advancement of Science. myeloid-derived suppressor cells in cancer patients Thomas Condamine,1* George A. Dominguez,1 Je-In Youn,1† Andrew V. Kossenkov,1 Sridevi Mony,1 Kevin Alicea-Torres,1 Evgenii Tcyganov,1 Ayumi Hashimoto,1 Yulia Nefedova,1 Cindy Lin,1 Simona Partlova,1‡ Alfred Garfall,2,3 Dan T. Vogl,2,3 Xiaowei Xu,2 Stella C. Knight,4 George Malietzis,4,5 Gui Han Lee,4,5 Evgeniy Eruslanov,2 Steven M. Albelda,2,3 Xianwei Wang,6 Jawahar L. Mehta,6 Meenakshi Bewtra,3 Anil Rustgi,2,3 Neil Hockstein,7 Robert Witt,7 Gregory Masters,7 Brian Nam,7 Denis Smirnov,8 Manuel A. Sepulveda,8 Dmitry I. Gabrilovich1§ Downloaded from Polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) are important regulators of immune re- sponses in cancer and have been directly implicated in the promotion of tumor progression. However, the heter- ogeneity of these cells and the lack of distinct markers hamper the progress in understanding the biology and clinical importance of these cells. Using partial enrichment of PMN-MDSC with gradient centrifugation, we determined that low-density PMN-MDSC and high-density neutrophils from the same cancer patients had a distinct gene profile. The most prominent changes were observed in the expression of genes associated with endoplasmic http://immunology.sciencemag.org/ reticulum (ER) stress. Unexpectedly, low-density lipoprotein (LDL) was one of the most increased regulators, and its receptor oxidized LDL receptor 1 (OLR1) was one of the most overexpressed genes in PMN-MDSC.
    [Show full text]