b"ç'aB
r:
The UniversitY of Adelaide Faculty of Agricultural and Natural Resource Sciences
"The mode of action of Bacillus thuringiensis (Berliner)
against the sheep lous e, Bovicolø ovis (Schrank)."
by
CATITERINE ALEXANDRA HILL
Department of Crop Protection WAITE CAMPUS Glen Osmond, South Australia
Thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy.
January, 1998. Frontispiece. Adult sheep biting lice, Bovicola ovis (Schrank) in the sheep fleece. SUMMARY
Bacillus thuringiensrs, (Bt) produces a heterogeneous range of insecticidal toxins, the most notable being the ð-endotoxin crystal proteins effective against lepidopteran, dipteran and coleopteran larvae. Dulmage (1981) reported that certain strains of Bt produced an uncharacterised "louse factor" effective against phthirapteran species. Bt strain WB3S16, isolated from sheep fleece at the University of Adelaide, Waite Campus, causes very high mortality when ingested by the sheep biting louse B. ovis. This strain is currently being developed as a microbial insecticide for control of B. ovis. The objective of this study was to determine the nature and mode of action of the Bt strain \ryB3sl6 louse toxin effective against B. ovis.
Bt fed B. ovis exhibit midgut disruption and histopathological effects which are similar to those of the ð-endotoxin crystal proteins in susceptible lepidopteran and coleopteran larvae (Hill and Pinnock, 1997). Investigations were made in this study to determine whether the Bt strain WB3S16 louse toxin is related or identical to the ð-endotoxin crystal proteins produced by this bacterium.
A louse toxic factor was found in association with the Bt strain WB3S16 membranes and the culture supernatant following growth of the bacterium. The ð-endotoxin crystals were not toxic to B. ovis possibly because lice lack a midgut environment (Hill, 1992) essential for dissolution and activation of the â-endotoxin crystal into toxic peptides. However, WB3S16 â-endotoxin crystal proteins generated by in vitro dissolution of the crystal were highly toxic to B. ovis and caused a general paralysis, followed by death of the insect. Bt spores were not toxic per se to B. ovis, but caused septicaemia after they germinated in the gut of the insect.
The toxicity of strain WB3S16 preparations was significantly reduced by treatment with proteases, suggesting that the WB3S16 louse toxin is proteinaceous. The louse toxin was produced from the vegetative cell stage through to sporulation. WB3S16 preparations became progressively more toxic to B. ovis as the culture matured and the toxicity of the Bt preparation correlated directly with an increase in the amount of crystal protein in the preparation.
Strain WB3S16 produced 140kDa CrylA and 70kDa CryZA crystal proteins both of which were highly toxic to B. ovis and the CrylA was significantly more toxic to B. ovis than the Cry2A. Immunogold studies demonstrated specific binding of CrylA and Cry2A proteins to the midgut membrane of B. ovis. This result, together with the observed histopathological
I effects, suggests that these proteins may bind to and form pores in B. ovis midgut cell membranes.
The primary and secondary stmctures of the CrylA and Cry2A proteins deduced from sequences of cloned WB3S16 cryIA and cry2A genes were similar to those of other CrylA and Cry2A proteins. The novel host range of these proteins could not be attributed to major amino acid substitutions.
The WB3S16 CrylA protein was highly susceptible to proteolytic degradation and degraded to a 70kDa protein over time. This characteristic may be a key to the lousicdal toxicity of strain WB3SI6. A 70kDa protein, immunologically related to the crystal proteins of strain V/B3S16 was found in association with the louse toxic membrane and supernatant fractions and was produced by louse toxic, crystal- Bt mutant strains generated by heat curing strain WB3S16 of plasmids bearing cry genes.
The louse toxic strain WB3SI6 and crystal- mutant strains appeared to be producing a solubilised 70kDa crystal protein which for reasons unknown, was not incorporated into a crystal at time of formation. This protein which may be a Cry2A, a degraded form of the CrylA or a combination of both, was associated with the bacterial membranes and may be released to the supernatant when the cell lyses. Although lice do not dissolve and activate the crystal to toxic peptides, this solubilised or loosely adsorbed protein may act as a toxin against B. ovis following ingestion of the Bt preparation, by causing colloid osmolysis of midgut cells.
This is the first study to report Bt crystal protein toxicity to a phthirapteran species. Although Bt strain WB3S16 may produce other unidentified toxins effective against B. ovis, these results summarised above have provided strong evidence that the ð-endotoxin crystal proteins of strain WB3S16 significantly contribute to the lousicidal toxicity of this strain.
ll DECLARATION
This work contains no material which has been accepted for the award of any other degree or diploma in any University or other tertiary institution and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text.
I give consent to this copy of the thesis, when deposited in the University Library, being available for loan and photocopying.
Catherine A. Hill
lll ACKNOWLEDGMENTS
I wish to thank my supervisors, Professors Dudley Pinnock, Otto Schmidt and Paul Manning for their input and continued guidance throughout this period of my scientific training.
I am grateful to Professor Rick Roush and Dr Marianne Hellers who in conjunction with Professor Manning, supervised the cloning and sequencing studies.
I would also like to thank the following people who provided assistance with various aspects of this project:
Dr Chris Preston and Stephen Hole for HPLC analysis;
Dr Ian Dundas for iso-electric focusing gels;
Dr Marilyn Henderson for electron microscopy studies;
and Juan Juttner for help with the southern blot analysis.
To the former members of the Insect Pathology Laboratory and current members of the Department of Crop Protection, my thanks for fostering an environment which was conducive not only to study, but also to having fun.
I express my appreciation to many close friends, in particular, Mandy Pace, Markus Beck and Leonie Simmons, who have helped me to maintain my sanity over the last four years.
Finally, my gratitude to my family and to Matt McCallum, for their support and encouragement throughout my studies.
1V LIST OF ABBREVIATIONS
ADP Adenosine diphosphate Ap Ampicillin AP Alkaline phosphatase ATP Adenosine triphosphate BBMV Brush border membrane vesicles ß-ME ß-mercaptoethanol BHIGYE Brain heart infu sion/glycine/yeast extract BLAST Basic local alignment search tool bp Base pair BSA Bovine serum albumin Bsp Bacillus sphaericus Bt B ac illus thur in g iens i s CP Crystal protein cps Counts per second Cry ð-endotoxin crystal protein cry â-endotoxin crystal protein gene crystal- Acrystalliferous Bt mutant strain cyt Cytolytic ð-endotoxin crystal protein cyt Cytolytic ð-endotoxin crystal protein gene ddH2O Distilled water doz Dissolved oxygen DNA Deoxyribonucleic acid dNTP adenine/cytosine/guanine/thymine nucleoside triphosphate DTT Dithiothreitol EDTA Disodium ethylenediaminetetraacetate ELISA Enzyme linked immuno-sorbent assay EMBL European Molecular Biology Laboratory EMP Embden-Meyerhoff-Parnas pathw ay FITC Fluoroscene iso-thio-cyanate GYS Glycine/yeast/salts medium HEPES N-[2-hydroxyethyl] piperazine-N' HPLC High perfonnance liquid chromatography HSB IIEPES salt buffer ICP Insecticidal crystal Protein IgG Gamma immunoglobulin IPTG Isopropylthio-ß-o- galactoside v kb Kilo base kDa Kilo dalton KSCN Potassium isothiocyanate LA Luria-Bertani agar LB Luria-Bertani medium LCso Lethal concentration value determined by probit analysis LV Lecitho-vitellin MDa Mega dalton MLP Modified lowry protein determination MOPS 3- [N -morpholino]propanesulphonic acid) buffer MW Molecular weight NA Nutrient agar NB Nutrient Broth NCBI National Centre for Biotechnology o/N Over night ORF Open reading frame PBS Phosphate buffered saline PC-PLC Phosphatidylcholine degrading phospholipase C enzyme PI-PLC Phosphatidylinositol-hydrolysing phospholipase C enzyme PCR Polymerase chain reaction PEGseso Polyethylene glycolssoo PIPES Piperazine-N, N'-bis[2-ethanesulphonic acid] PVP Polyvinyl-pynolidone 360 RAM Rabbit anti-mouse antibody RH Relative humidity RO Reverse osmosis purified water RNA Ribonucleic acid RNase Ribonuclease RT Room temperature sH2O Sterile water (autoclaved at I2I"C and lba¡ pressure for 20min) SDS Sodium dodecyl sulphate SDS-PAGE SDS polyacrylamide gel electrophoresis SSC Sodium citrate buffer subsp. subspecies TAE Tris-acetate electrophoresis buffer TBE Tris-borate electrophoresis buffer TBS Tris buffered saline TCA Tricarboxylic acid cycle TE TrisÆDTA buffer TEMED N, N, N', N'-Trametþlethylenediamine TES TrisÆDTA/Sucrose buffer vi Tris Tris(hydroxymethyl)aminomethane hydrochloride TTBS Tween-Tris buffered saline Tween-20 polyoxyethylene (20) sorbitan mono-oleate Type Itr RO water Triple distilled Millipore water. vlv volume/volume w/v weighUvolume X-gal 5 -Bromo-4-chloro-3 -indolyl-ß-o- galactoside
vll TABLE OF CONTENTS
I Summary
Decla¡ation 111
Acknowledgments iv
List of Abbreviations v
1. Literature Review I l.l Bovicola ovis 1 l. 2 Bacillus thuringiensis 1 n 1.2. I History of Bt and its Commercial Production 1.2.2 Cell Morphology and Historical Classification 3 4 1. 3 ð-endotoxin Crystal Proteins 1. 3. 1 Genetic Aspects of crystal Protein Production in Bt 4 I.3.2 Crystal Protein Nomenclature 4 L.3.3 Composition of ð-endotoxin Crystals 5 I.3.4 Cryl and Cry2 Crystal Proteins 5 1. 3. 5 Structure of Crystal Proteins 6 1. 3. 6 Mode of Action of Crystal Proteins 7 1.3.7 Histopathological Effects of Crystal Proteins 8 1. 3. 8 Sequencing and Expression of cry Genes 9 1.3.9 CYt Toxins 10 l. 3. 10 Bt subsP. kurstaki Strains 10 1. 3. l1 Bt Devetopment and Formation of the ð-endotoxin Crystal 11 1.3. 12 Proteases Associated rWith the Crystal t2 1. 4 Other Bacillus thuringiensis Toxins t2 1.4. t ß-exotoxin and Other Exotoxins t2 L.4.I.1 M-exotoxin t3 1.4. t.2 Labtle Exotoxin l3 l. 4. l. 3 Mouse FactorÆhermosensitive Exotoxin 13 1.4. t.4 Vegetative Insecticidal Proteins t4 1.4.2 Bt Enzymes t4 l. 4.2. 1 Phospholipase C T4 1.4.2.2 Haemolysins 15 L.4.2.3 y-Exotoxin l5 l. 4.3 Water Soluble Toxin 15 L. 4. 4 Nematocidal Toxin 15 1.4.5 Antibiotics 15 1.4.6 Entomocidal Toxins Produced by other Bacillus spp. Strains t6 1.4.7 Louse Toxin I6 1. 4, 8 The Bt Spore t7
2. General Materials and Methods 18 2. 1 Origin of the Louse Toxic Bt subsp. kurstaki Strain WB3S16 18 2.2 Production of Bt Crystal- Mutants 18 2. 3 Production of the Bt Preparation 19 2.3. I Shake flask Culture 19 2.3.2 Fermentation in 20L Chemap Laboratory Fermenter t9 2. 3. 3 Bt Powder PreParation 20 2. 4 Separation of the Bt Preparation into Fractions 20 2.4. I Isopycnic Separation of Bt Membranes 20 2.4.2 Lyophilisation of the Bt Culture Supernatant 2t 2. 4.3 Rate Zonal Separation of Bt Crystals and Spores 2l 2. 5 Determination of Protein Concentration 22 2. 6 Dissolution of Bt Crystals With retention of Toxicity 22 2.7 Prod¡ction of Polyclonal Antisera to the WB3S16 Crystal Proteins 22 2.8 BtBioassaY Against B. ovis 23 2.8.I Skin Diet PreParation 23 2.8.2 Louse Collection 24 2.8.3 BioassaY Design 24 2. 9 SDS Polyacrylamide Gel Electrophoresis 24 2. 10 \Mestern Blots 25 2. 11 Isolation of Plasmid DNA ftom E. coli 26 2.12 Agarose Gel ElectroPhoresis 26 2. 13 Common Solutions 27
3. Toxins Produced by Bacillus thuringiensis 34 3. 1 Introduction 34 3. 1. 1 ß-exotoxin 34 3.I.2 PhospholiPase C 35 3.2 Matenals and Methods 36 3.2.I ß-exotoxin 36 3.2. L. I Lucilia cuprina Bioassay 36 3.2. l.2 IIPLC Analysis for ß-exotoxin 38 3.2.2 Phospholipase C 39 3.2.2.1 Lecitho-vitellin Test for Phospholipase C 39 3.3 Results 40 3.3. I ß-exotoxin 40 3. 3. 1. I Lucilia cuPrina BioassaY 40 3.3. L.2 HPLC Analysis for ß-exotoxin 4l 3.3.2 PhosPholiPase C 4t 3.3.2.1 Lecitho-vitellin Test for Phospholipase C 4l 3.4 Discussion 48 3.4.7 ß-exotoxin 48 3.4.2 PhospholiPase C 49 3. 4.3 General Discussion 49
4. Preliminary Investigations on the Louse Factor 50 4. I Introduction 50 4.I. I Toxicity of Bt Culture Fractions to B' ovis 50 4. 1. 2 Sequential Harvest Experiment 5l 4.2 Matenals and Methods 53 4.2. I Toxicity of Bt Culture Fractions to B. ovis 53 4.2.1.1 Production of Bt Strain WB3S16 Culture 53 4.2. 1.2 Separation of Spores and Crystals 53 4.2.1.3 Separation of Bt Membranes 54 4.2. 1.4 Application of Treatments in Bioassays 54 4. 2. 2 Protease ExPeriment 55 4.2.2. I Production of the Bt Preparation 55 4.2.2.2 Proteinase K Bioassay 55 4.2. 2.3 Proteinase K Degradation Gel 56 4. 2. 3 Sequential Harvest Experiment 56 4. 3 Results 58 4.3. I Toxicity of Bt Culture Fractions to B. ovis 58 4. 3. 2 Protease ExPeriment 59 4. 3. 3 Sequential Harvest Experiment 59 4.4 Discussion 61 4.4. I Toxicity of Bt Culture Fractions to B' ovis 6r 4. 4. 2 Protease Experiment 63 4. 4. 3 Sequential Harvest Experiment & 4. 4. 4 General Discussion 67
5. The Crystal Proteins Produced by Bt Strain WB3S16 68 5. 1 Introduction 68 5. 1. 1 TheWB3S16 CrystalProteins 68 5.1.2 Toxicity of Cryl andCryZ Proteins to B. ovis 68 5. 1. 3 Separation of the WB3S16 Crystal Proteins 69 5. 1. 3. I Iso-electric focusing of WB3S16 Crystal Proteins 69 5. 1. 3. 2 Chromatographic Separation of WB3S16 Crystal Proteins 69 5.2 Materials and Methods 70 5.2. I The WB3S16 Crystal Proteins 70 5.2. L 1 SDS-PAGE of V/B3SI6 Crystal Proteins 70 5.2.1.2 Degradation of WB3S16 Crystal Proteins - Time Course ExPeriment 70 5.2.1.3 N Terminal Sequencing of WB3S16 Crystal Proteins 70 5.2.2 Toxicity of Cryl andCry2 Proteins to B. ovis 7l 5.2.3 Separation of WB3S16 Crystal Proteins 7t 5. 2. 3. 1 Iso-electric Focusing of WB3S 16 Crystal Proteins 7l 5.2.3.2 Chromatographic Separation of WB3S16 Crystal Proteins 72 5. 3 Results 73 5. 3. 1 The WB3S16 Crystal Proteins 73 5. 3. 1. 1 SDS-PAGE of WB3S16 Crystal Proteins 73 5. 3. 1. 2 Degradation of WB3S16 Crystal Proteins - Time Course Experiment 73 5. 3. l. 3 N Terminal Sequencing of WB3S16 Crystal Proteins 73 5.3.2 Toxicity of Cryl andCry2 Proteins to B. ovis 74 5. 3. 3 Separation of WB3Sl6 Crystal Proteins 75 5 . 3. 3. I Iso-electric Focusing of WB 35 16 Crystal Proteins 75 5. 3. 3. 2 Chromatographic Separation of WB3S16 Crystal Proteins 75 5.4 Discussion 75 5.4. I The WB3SI6 Crystal Proteins 75 5. 4. 4 Toxicity of Cryl and Cry2 Proteins to B. ovis 76 5. 4. 3 Separation of WB3S 16 Crystal Proteins 77 5. 4. 3. 1 Iso-electric Focusing of WB3S l6 Crystal Proteins 77 5. 4.3.2 Chromatographic Separation of WB3S16 Crystal Proteins 77 5. 4. 4 General Discussion 78
6. Immunological Investigations Using Anti-Crystal Protein Antibodies 79 6. 1 Introduction 79 6. 1. 1 Investigations Using Anti-Crystal Protein Antibodies 79 6. 1.2 Crystal Proteins Associated With Spore Coat, Membrane and Supernatant Fractions 79 6. l.3 Crystal- Mutant Investigations 80 6.1.4 TEM Immunogold Crystal Protein Binding Studies 80 6.2 Mateials and Methods 81 6.2. I Investigations Using Anti-Crystal Protein Antibodies 81 6.2.2 Crystal Proteins Associated With Spore Coat, Membrane and Supernatant Fractions 82 6. 2. 3 Crystal- Mutant Investigations 82 6.2. 4 TEM Immunogold Crystal Protein Binding Studies 83 6.3 Results 84 6.3. I Investigations Using Anti-Crystal Protein Antibodies 84 6.3.2 Crystal Proteins Associated Spore Coat, Membrane and Supernatant Fractions 84 6. 3. 3 Crystal- Mutant Investigations 85 6.3. 4 TEM Immunogold Crystal Protein Binding Studies 85 6.4 Discussion 87 6. 4. I Investigations Using Anti-Crystal Protein Antibodies 87 6. 4.2 Crystal Proteins Associated Spore Coat, Membrane and Supernatant Fractions 87 6. 4. 3 Crystal- Mutant Investigations 88 6.4.4 TEM Immunogold Crystal Protein Binding Studies 89 6. 4. 5 General Discussion 92
7. Genetic Aspects of Crystal Production in Bacillus thuringiensis Strain WB3S 16 93 7. I Introduction 93 7.l.l The Role of Plasmids and cry Genes in Bt Strain ÌWB3S16 93 7 . l. 2 Sequencing of Bt Strain WB3S 16 cryl/^ and cry2A Genes 94 7.2 Mateials and Methods 95 7.2. L The Role of Plasmids and cry Genes in Bt Strain 1VB3S16 95 7.2. 1.1 Isolation of Plasmid DNA From Bt Strain WB3S16 95 7 .2. 1.2 Southern Blot Analysis of Bt DNA 96 7.2.2 Sequencing of Bt Strain WB3S16 crylAandcry2é^ Genes 97 7. 3 Results 103 7 .3. I The Role of Plasmids and cry Genes in Bt Strain WB3S 16 103 7 . 3. 2 Sequencing of Bt Strain WB3S 16 cryl/^ and cry2A Genes 105 7.4 Discussion 106 7.4. I The Role of Plasmids and cry Genes in Bt Strain WB3S16 106 7.4.2 Sequencing of Bt Strain WB3S16 cryl/^andcry2[Genes 109 7. 4. 3 General Discussio ll3
8. General Discussion It4
References t20
Literature Review
'i,\'[ Y i;;.
CHAPTER 1
Literature Review
1. 1 Bovicola ovß
The sheep body or biting louse, Bovicola ovis (Schrank) (Phthiraptera: Trichodectidae) is a highly contagious, cosmopolitan ectoparasite of sheep which causes significant economic losses to the Australian wool industry (Chapman, 1991). The entire life cycle of B. ovis is spent in the fleece (Calaby and Murray, 1991) and its movement and feeding causes intense irritation to its host. Lousy sheep will rub, scratch and bite their fleece to relieve this irritation (Kettle and Lukies,1982) and consequently produce less wool, which is of an inferior quality (McKenna and Fearn, 1952).
Current control methods for B. ovis rcly heavily on the use of chemical insecticides, principally synthetic pyrethroid aqueous dips and pour-on backline treatments (Drummond er aI., 1992). However, since 1985 reports of B. ovis resistance to synthetic pyrethroids (Levot, 1992) coupled with concern over the levels of chemical residues in wool products and scouring effluent has focused attention on the need to develop alternative, non-chemical control measures for this pest. The potential of the insecticidal bacterium Bacillus thuringiensis (Berliner) (Bt) as a control agent for B. ovis, is under investigation at the 'Waite University of Adelaide, Campus, where it was discovered that at onset of sporulation, certain strains of Bt produce an unidentified toxin, which when ingested, causes very high mortality of lice (Hill and Pinnock, 1997).
l. 2 Bacillus thuringíensís
Bacillus thuringiensis is a rod-shaped, spore forming, gram positive bacterium, characterised by the ability to produce one or more crystalline parasporal inclusion proteins referred to as ð- endotoxins (Hannay and Fitz-James, 1955; Aronson et a1.,1986). The ð-endotoxins have insecticidal activity aganst lepidopteran, dipteran and coleopteran larvae and form the basis of many Bt-based bio-insecticides which have been employed world wide for more than forty years to control pests of crops, forests, livestock and human health. Bt ð-endotoxins are highly host specific and Bt-based bioinsecticides have attracted considerable attention because they are considered to be relatively harrnless to the environment (Rowe and I Literature Review
Margaritis, l9S7). In addition to the ô-endotoxins, Bt strains produce a heterogeneous range of insecticidal, nematocidal and acaricidal toxins (Drummond and Pinnock, 1991). The review of Feitelson et aI. (1992) lists species of protozoa, flatworms, nematodes and mites as susceptible to Bt. An extensive literature is available on Bt; this review is not intended to be an exhaustive monograph on Bt but will focus only those aspects of Bt research pertinant to the present study.
I. 2. I History of Bt and its Commercial Production
Bt was first isolated in Japan from diseased silkworm larvae by Ishiwata in 19O2. Berliner (1915) described a spore forming agent which caused an infectious disease of the Mediterranean flour moth, Anagasta kuehniella. He named this agent Bacillus thuringiensis after the German district of Thuringen where the diseased insects were isolated. Hannay (1953) was the first to suggest that the alkali-soluble parasporal crystal was the toxic agent and this was confirmed by Angus (1954). Hannay and Fitz-James (1955) showed the crystal was proteinaceous and Angus (1956b and 1956c) proved its toxic action by separation and feeding to insects.
I3ieg and Langenbruch (19S1) completed an exhaustive survey of arthropod susceptibility to Bt, which included over 200 insect species, mainly lepidoptera. Bt subsp. israelensis was discovered in1916 and the crystal proteins of this subspecies were reported as toxic to diptera (Goldberg and Margalit, 1977). Bt crystal proteins active against coleopterans have been isolated from Bt subsp. tenebrionis (Iftieg et a1.,1933) and subsp. san diego (Herrnstadt er aI., 1986) Recentþ, Walters and English (1995) gave the first report of ð-endotoxin toxicity to a hemipteran species, Macrosiphum euphorbiae.
Although Bt was first used as a microbial insecticide (Sporeine@) against lepidopteran larvae in France in 1938 (Rowe and Margaritus, 1987), large-scale commercial production did not begin until the 1950's (Cannon, 1993). In the US, the first commercial products became available for field testing in 1958 as unformulated wettable powders and as dusts formulated with celite@ lRowe and Margaritis, 1987). Bt can be grown on a variety of media (Norris, l97l;Rowe and Margaritis, 1987; Morris et al.,1997) using solid, semi-solid fermentation or the more preferred submerged fermentation method which became popular in the 1960's (Dulmage and Rhodes, l97l; Devisetty, 1993). Bt subsp. thuringiensis was used for all commercial production until about L970. A major advance occurred in 1969 when Dulmage isolated the HD-l strain of subsp. kurstaki (Dulmage, l97O). This strain was considerably more effective than the traditional strain in controlling the pest Heliothis virescens, and over several years US producers converted to the use of strain HD-l. Commercial production of Bt subsp. isrealensis for use against diptera began in 1980 (Rowe and Margaritis, 1987).
2 Literature Review
Today, insecticide products based on a mixture of Bt spores and crystals are available from various manufacturers as wettable powders, dusts, granules and more commonly as liquid suspensions formulated for spray-on application which are compatable with conventional agricultural practices (Pendelton, 1969). The major companies producing Bt commercially and their registered products, have been documented by Powles and Rogers (1989); Rowe and Margaritis (1987) and Devisetty (1993).
Despite their advantages, Bt-based commercial insecticides coÍlmand a relatively low share of the total insecticide market (approximately l%o), although some industry observers speculate that this figure could rise substantially by the year 2000 (Priest et aI-, 1994). Modern molecular techniques have revolutionised Bt research. Recently, crop plants including potato, tomato, tobacco and cotton, have been genetically engineered to express Bt â-endotoxins, in theory providing the plant with the ability to protect itself against insect attack (EIy,1992). In addition, the Mycogen Corporation's CellCap@ technology has enabled bio-encapsulation of single â-endotoxin gene products in killed pseudomonad cells (Cannon, 1993). These advances, coupled with the emergence of insect resistance to ð-endotoxins (McGaughey, 1985) have resulted in an increased research effort to isolate bacteria with novel or enhanced toxicities (Feitelson et a1.,1992).
l. 2. 2 Cell Morphology and Historical Classification
The cell morphology and physiology of Bt has been reviewed by Bulla et al. (1980) and Rowe and Margaritus (1937). Bt is a member of Group I of the genus Bacillus. Taxonomically, Bt is closely related to B. cereøs and is distinguishable from it by the presence of the parasporal crystal (Heimpel, 1967). Bt strains are essentially B. cereus strains which harbour plasmids bearing crystal protein genes (Somerville and Jones, 1972; Go¡zâlez et a1.,1982; Aquino de Muro et a1.,1992).
Traditionally, the identification of Bt subspecies has been based on serology and phenotypic characterisation, including H serotypes, esterase types, toxin production other than the crystal and on biochemical characteristics. Many Bt subspecies have been grouped according to flagellar (H) serotypes (de Barjac and Bonnefor,1973; Krywienczyk et aL, 1978; de Barjac, 1981; Krywienczyk et aI., l98I). Krywienczyk and Fast, (1980) extended this typing to include ð-endotoxin crystal antigens and established relationships between crystal and flagellar serotypes. However, serology is not a satisfactory technique for classification of a Bt species because more than one crystal type can occur in each serological group and serologically identical crystals can sometimes occur in different H serotypes. Techniques such as double-immunodiffusion, enzyme-linked immunosorbant assay (ELISA) and western blots have been used to study crystal homology, but are unable to differentiate between Bt
3 Literature Review
strains (Smith, 1937). Modern molecular techniques and the sequencing of crystal protein genes has enabled reliable and rapid classification of Bt species as discussed in Sections 1. 3. 2andI. 3. 4.
1. 3. ð-endotoxin Crystal Proteins
1. 3. 1 Genetic Apects of Crystal Protein Production in Bt
Stahly et at. (1978) first recognised that Bt harboured plasmids and suggested that these plasmids might be associated with expression of crystal protein. Bt strains contain a substantial proportion of their genetic information on plasmids (Aronson et a1.,1986). The number and size of plasmids vary considerably between Bt strains, and range from 1.5MDa to 150MDa (Baum and Malavar, 1995). Gonzalez et al. (1981) isolated acrystalliferous mutants and correlated loss of crystal production with the absence of specific plasmids. The cloning and expression of Bt crystal protein genes in E. coli has provided direct evidence that crystal protein is encoded on plasmids (Schnepf and Whiteley, 1981; Held et aI., 1982; Ferre et al., 1991). Crystal protein genes may occur on large conjugative plasmids (Carlton and Gonzalez, 1985), providing a mechanism for transfer of genes between and within subspecies (Cooper, 1994). Depending on the subspecies, one or more crystal protein genes may be located on large plasmids (Gonzalez et aI., 1982; Kronstad et al., 1983) and/or on the chromosome (Schnepf and Whiteley, 1981; Held et a1.,1982). The copy numbers of these plasmids have not been determined and are presumed to be low, possibly several copies per cell (Baum and Malvar, 1995). Consequently, the host range of a Bt strain may be due to the composition of the â-endotoxin crystal resulting from the expression of a combination of crystal protein genes present in the Bt strain.
I. 3. 2 Crystal Protein Nomenclature
The crystal proteins (Cry or Cyt) are encoded by crystal (cry or cyf) genes and twenty one different classes of Bt crystal protein genes (cry I-22; cyt I-2) have been identified to date. Crystal proteins are identified solely on their amino acid sequence. Generally, Cry proteins exist in two size ranges, 125-138kDa and 65-75kDa whereas Cyt proteins are approximately 25-28kDa in size. Traditionally, the toxin genes were classified into primary classes depending on the host range specificity and the sequence similarities of the encoded proteins. The four major classes of Cry proteins are Lepidoptera specific (Cryl), Lepidoptera and Diptera specific (Cry2), Coleoptera specific (Cry3) and Diptera specific (Cry4) (Höfte and Whiteley, 1989). The crystals often contain more than one class of protein. The Cyt proteins discussed in Section 1. 3. 9, have cytolytic effects against vertebrate and invertebrate cells and consequently have been separately classified from the Cry proteins. The current
4 Literature Review classification system of Bt crystal proteins and their corresponding genes approved by the Society for Invertebrate Pathology Bt cry Gene Nomenclature Committee, uses a basic \ü/orld naming strategy similar to that proposed by Höfte and V/hitely (1989). A Wide V/eb site is maintained at the Bacillus Genetic Stock Centre, Ohio State University and is currently found at: http : //www. sus sex. ac.uk/Users/bafnf6/bt' l. 3. 3 Composition of ð-endotoxin Crystals
Cystal protein may comprise between20-307o of the dry cell mass of a Bt cell (Baum and Malvar, 1995). Bulla et al. (1977) reported that the crystal was composed of repeating glycoprotein subunits. Chemical analysis of crystals has also demonstrated the absence of lipids, carbohydrates and phosphorous (Hannay and Fitz-James, 1955; Angus, 1956c). The amino acid composition of crystals from a number of different strains has been determined (Somerville et a1.,1968; Angus, 1956c; Spencer, 1968; Cooksey, l97I) and aspartic and glutamic acid are common. Elemental analysis reveals that â-endotoxin crystals contain significant amounts of calcium, iron, magnesium and silicon (Faust et aI., 1973).
Cry proteins contain between 13 and 19 cysteine residues, all of which are located in the C- terminus (Brousseau and Masson, 1988; Choma and Kaplan,1992). All cysteine and most lysine residues are removed during activation (Bietlot et al., 1989). Nickerson (1980) proposed that interchain disulphide bridges may play a role in crystal formation and may be an important factor in determining the stucture and unusual solubility properties of the crystal.
l. 3. 4 Cryl and Cry2 Crystal Proteins
Cryl genes encode 130-l40kDa proteins which accumulate as a bi-pyramidal crystal in the Bt cell during sporulation. These proteins are protoxins which dissolve in the alkaline insect midgut and are proteolytically converted by crystal-associated or larval midgut proteases to an activated or toxic core fragment of 60-70kDa (Höfte and Whiteley, 1989). The activation can be caried out iz vdrro using a number of proteases (Whiteley and Schnepf, 1986). The toxin is derived from the N-terminal half of the protoxin molecule. The C-terminal structural fragment of these protoxins is removed by proteolytic processing (Bietlot et al., 1989; Choma et aI., 1990) and is not required for toxic activity. Degradation of CrylAc occurs in an ordered sequence of seven specific cleavages which start at the C-terminus of the protoxin and proceed towards the N-terminus (Choma et a1.,1990). Only limited proteolysis occurs at the N-terminus (Höfte and \Vhiteley, 1989).
5 Literature Review
Cryl genes and their encoded proteins are distinguished from other cry genes by a greater than 507o amino acid homology of their encoded proteins and have been fuither divided into subclasses. CrylAa, CrylAb and CrylAc proteins share 80% amino acid identity and differ greatly from CrylB, CrylC and CrylD gene products (Höfte and Whiteley, 1989). CrytAa, cryIAb and crylAc were previously designated as the 4.5,5.3 and 6.6kb genes respectively, on the basis of the size of the Hindnl restriction fragment containing the 5' end of the genes (Kronstad and Whiteley, 1986).
The cry2 genes encode 65-70 kDa proteins which form cuboidal or rhomboidal parasporal inclusions in several subspecies of Bt. Cry2 crystals are often evident as inclusions embedded in the side of the bipyramidal â-endotoxin crystals, particularly in subsp. kurstaki strains. They are approximately half the size of the ô-endotoxin crystals and do not have surface striations (Sharpe and Baker, 1979). These crystal proteins were formerly designated P2 proteins to distinguish them from the 130kDa Pl crystals composed of Cryl proteins which are present in the same strain (Yamamoto and Mclaughlin, 1981). In contrast to Cryl proteins, Cry2 proteins undergo minimal proteolytic degradation. They do not possess the conserved C-terminal domain and may require assistance in crystal formation (Baum and Malvar, 1995). These proteins appear to be naturally truncated and the loss of several amino acids from the C-terminus can result in loss of insecticidal activity (Widner and Whiteley, 1989). The Cry2Aa and Cry2ltb proteins share 897o amino acid homology (Dankocsik et al., 1990). The Cry2Aa subclass is toxic to both lepidopteran and dipteran larvae, whilst the Cry2Ab subclass is toxic only to lepidopteran larvae (Widner and Whiteley, 1989).
1. 3. 5 Structure of Crystal Proteins
Activated CrylA toxins can be divided into three structural regions. These are the N-terminal region, which contains the toxic domain and several conserved hydrophobic regions; the conserved C-terminal region and a variable region between these two regions which contains most of the amino acid differences. The N and C-terminal regions fold independently and the secondary structure of Cry proteins is highly conserved between classes, suggesting that these regions are essential for folding, stability or toxicity (Convents et a1.,1990). It is generally accepted that protease-sensitive sites are located in flexible regions connecting structural domains (Convents et a\.,1990).
The first putative three dimensional structure of a Cry protein was determined by Li et al. (1991) using high resolution X-ray crystallography of aCry3 protein. This protein comprised three domains which were, from the N to C-termini, a seven-helix bundle, a three sheet domain and a ß-sheet sandwich. The N-terminus of activated Cry toxins is thought to be involved in pore formation in host cell membranes (Yool and Schwa¡z,l99l), whilst the C-
6 Literature Review
terminus of the activated toxin may be involved in receptor binding (Convents et al., 1990; GiLl et at., 1992). The three dimensional structure of the Cry2 proteins and their mode of action is not well understood although these toxins are thought to interact with the midgut epithelium of susceptible insects through a mechanism similar to that of Cryl proteins (Widner and Whiteley, 1989).
Most Cry toxins of various Bt subspecies contain five highly conserved sequence blocks or domains (1 - 5) (Li et at., I99l). Domains I and 2 in the N-terminus of the protoxin, are conserved between Cryl, Cry2A and Cry4 protoxins. The nonconserved regions of the toxins are virtually identical among the CrylAa, CrylAb and CrylAc subclasses and differ from other Cryl proteins andCry2 and Cry3 toxins. Domains 3 - 5 occur in the C-terminus of the protoxin and may be indirectly involved in specificity, whilst domains 1 and 2 may participate directly in toxicity. Thus, heterogeneity in the amino acid sequence between classes of crystal proteins may not significantly affect their insecticidal toxicity provided key regions of the proteins are preserved in the correct three-dimensional conformation (Wu and Atonson, 1ee0).
l. 3. 6 Mode of Action of Crystal Proteins
The primary target of Bt Cry toxins is the insect midgut epithelium (Heipel and Angus, 1959). Three hypotheses have been proposed for the mode of action of Bt toxins in the midgut of lepidoptera (Reisner et a1.,1989). It has been suggested that Bt toxins directly inhibit plasma membrane ATPases (English and Cantley, 1985), increase K+ permeability selectively (Ramakrishnan and Tiwari, 1968; Narayanan and Jayaraj , 1974; Van Rie et al., 1990a) or form non-specific cation pores resulting in colloid osmotic lysis (Knowles and Ellar, 1987).
The "colloid osmotic lysis" mechanism suggested by Knowles and Ellar (1987) is represented diagramatically in the review of Gill et aL (1992). Following solubilisation and activation of the ð-endotoxin crystals in the midgut of susceptible lepidopteran and coleopteran larvae, Cry toxins are thought to bind to high affinity glycoprotein receptors or "binding sites" on the midgut epithelial membrane. The carbohydrate moiety may or may not be involved in receptor binding. The N-terminal toxic domain is thought to insert into the membrane following a change in toxin conformation (Convents ¿f aL, l99O). Oligomerisation of six toxin molecules is thought to lead to formation of a pore in the membrane (Knowles et aI., 1990), the radius of which is approximately 0.6-1.0nm (Knowles and Ellar, 1987). Consequently, the osmotic balance of the cell is disrupted through the influx of water, cations and other small molecules (Gill et a1.,1992). The integrity of the midgut is destroyed and the insect dies of starvation and/or septicaemia (Knowles and Dow, 1993).
7 Literature Review
Putative receptors for a range of Cryl proteins have been reported from studies using preparations from lepidopteran midgut tissue. In Manduca sexta, the CrylAb binding protein is a 210kDa cadherin-like gtycoprotein (Vadlamudi et aI., 1995) and the CrylAc binding protein is a 120kDa metalloprotease aminopeptidase N (Knight et aI., I994b). The gene coding for the aminopeptidase N receptor was identified by Ifuight et aL (1994a).
l. 3. 7 Histopathological Effects of Crystal Proteins
Previous research has concentrated on the effects of Bt against lepidopteran, dipteran and coleopteran larvae. Ultrastructural effects have been studied by light microscopy (Heipel and y Angus, 1959; Davidson and Titus, lg87),or by scanning (Griego et a1.,1980) or transmission electron microscope examination of midgut tissue specimens from Bt fed insects (Sutter and. Raun, 1967). The Bt-induced ultrastructural changes of lepidopteran midgut epithelial cells have been studied in detail using a variety of methods in situ, using tissue cultures derived from susceptible insects (Murphy et a1.,1976; Lüthy and Ebersold, 1981; Thomas and Ellar, 1983; Knowles and Ellar, 1986; Baines et al., 1994) and more recently using brush border membrane vesicles (BBMVs) which consist primarily of the apical brush border membrane prepared from insect midgut columnar cells (see Wolfersberger (1990) for review). Recently, Braun and Keddie (1997) developed a technique using an isolated midgut epithelial cell layer whole mount to identify cells affected by Bt toxins. The histopathological effects of Bt against lepidopteran larvae have been summarised by Gill et al. (1992) and include swelling of the apical microvilli, vesiculation of the endoplasmic reticulum, loss of ribosomes, swelling of mitochondria, rupture of nuclear, organelle and plasma membranes, and finally cell lysis and sloughing of cells into the gut lumen.
There is a positive correlation between the biological activity of the Cry proteins and their ability to bind to the BBMV or midgut epithelial membrane of susceptible larvae (Bravo er aI., I992a). Cry proteins are thought to require specific plasma membrane receptors on midgut epithelial cells and specific high affinity binding sites have been demonstrated for a number of Bt Cry toxins (Knowles and Ellar, 1986; Hofmann et al.,l988a and 1988b; Knight et aI., 1994a; Vadlamudi et aI., 1995; Luo et al., L996). To date, no Cry protein has been found to be toxic without binding to the midgut epithelium and binding appears to be essential for toxicity, except possibly with CrylC against Heliothis virescens (Van Rie et al., 1990a) and Plodia interpunctel/ø (Johnson,1994). Toxicity of Cry proteins appears to be correlated with receptor concentration rather than receptor affinity (Hofmann et al., 1988b; Van Rie øf aI.,1989; Van Rie et al.,l99}a and b). However, a non quantitative correlation between the toxicity and binding characteristics of CrylAb and 1Ac in Lymantria dispar was reported by Wolfersberger (1990) and Ferre et aI. (1991).
8 Literature Review
Immunocytochemical localisation has been used to study the binding of crystal proteins to the brush border membrane in lepidopteran larvae (Bravo et al., 1992a and I992b and Aranda ør al., 1996). Crystal protein binding was localised in wax embedded tissue sections using a variety of anti-crystal protein antibodies. Prior to pore formation, there was a specific interaction between the activated crystal protein and the brush border membrane of the midgut cells. 1251-1¿5s¡ed crystal protein antibodies have been used in histopathological studies to demonstrate the binding of Bt crystal protein to the midgut epithelium (Hofmann et aL.,1988a and b), cell lines (Knowles arid Ellar, 1986; Johnson, 1994) or BBMVs of susceptible insects (Garczynski et al., l99l; Knight et aI., 1994; Vadlamudi et al., 1995). The immunoblot technique such as that described by Pang (1993) and others has been commonly used to demonstrate binding of Cryl proteins to brush border membrane vesicles prepared from a variety of lepidopteran la¡vae.
1. 3. 8 Sequencing and Expression of cry Genes
The first crystal protein gene to be cloned and characterised was crylAa (Schnepf and Whiteley, 1981). A survey of the EMBL and GenBank databases revealed that at time of publication (November,1997), over 128 Cry and Cyt genes had been cloned and sequenced, using a variety of methods. Considerable effort has been directed at sequencing of cryl genes (Adang et a|.,1985; Schnepf et a1.,1985; Shibano et al., 1985; Geiser et a1.,1986; Höfte ¿r a1.,1986; Thorne et a\.,1986; Wabiko et a\.,1986; Kondo et aI.,1987; Hefford et al., t987; Oeda et al., L987;Brizzard and V/hiteley 1988). The cry2Aa gene has been cloned and sequenced by Donovan et al. (1989); Widner and V/hiteley, 1989 and V/u et aI. (1991) and the cry2\b gene by Widner and Whiteley (1939) and Dankocsik ¿f aI. (199O). â-endotoxin expression has been achieved in E. coli (Ward et al., 1984), B. subtiliis (Klier et aI., 1982), B. cereus and several acrystalliferous strains of Bt (Minnich and Aronson, 1984).
Many of the cryl genes appear to be arranged on plasmids as monocistronic units with transcriptional sta¡t sites upstream of the gene and a transcription terminator downstream of the coding region (Baum and Malvar, 1995). The cry2{ is expressed as part of an operon containing two upstream reading frames (ORFs) (Widner and Vlhiteley, 1989; Wu et aI., 1991). The role of the orf2 protein is not clear and may include protection from proteolysis, assisting in folding of the protein to permit its deposition or serving as a scaffolding for protein formation (Baum and Malvar, 1995). In most cases, the temporal and spatial regulation of cry gene expression is determined at the transcriptional level by mother cell specific sigma factors (Baum and Malvar, 1995) and cry genes are actively transcribed by a sporulation specific form of RNA polymerase (Wong et a1.,1960).
9 Literature Review
1. 3. 9 Cyt Toxins
The Cyt toxins are discussed only briefly in this review as they are not relevant to the present study. Bt subsp. israelensis and several other Bt subspecies produce proteins of approximately 27-2\trDa which have specific cytolytic activity against dipteran larvae in vivo and which lyse a wide range of insect and mammalian cells in vitro (Thomas and Ella¡, 1983; Knowles et a1.,1990). These proteins lack sequence homology to Cry proteins and Höfte and V/hiteley (1989) suggested a unique designation (Cyt toxins) for these toxins. Like Cry proteins, Cyt proteins are synthesised as water insoluble crystals which require high pH for solubilisation in vitro. Cyt proteins are also thought to be protoxins and the 23kDa proteolytic product of CytlB is highly cytolytic (Knowles et aI., 1990). Knowles and Ellar (1987) and Drobniewski and Ellar (1988) proposed that like the Cry toxins, the Cyt toxins act by a coÍrmon mechanism of colloid osmotic lysis. However, Cyt toxins can bind and insert into membranes containing a range of unsaturated phospholipids, thus explaining their broad cytolytic spectrum (Thomas and Ellar, 1983). In Diptera, it is possible that Cyt toxins also bind to high affinity dipteran specific receptors (Knowles et a1.,1990). As with Cry toxins, the pore formed by Cyt toxins is approximately l-2nm in radius (Drobniewski and Ellar, 1988) and there is kinetic evidence that this pore may be composed of more than one toxin molecule (Maddrell et a1.,1988; Chow et a1.,1989). Experiments with lipid bilayers sugggest that the CytlA and CytlB toxins form monovalent cation-selective channels (Knowles et al., 1989; Knowles et al.,1992). The gene encoding the 27kDa CytlA protein has been cloned in E. coli (V/ard et al., 1984; Waalwijk et a1.,1985) and B. subtilus (Ward et al., 1986) and sequenced by V/aalwijk et al., (1985). The CytlB toxin has been cloned and sequenced by Koni and Ellar (1993).
1. 3. 10 Bt subsp. kurstaki Strains
The Bt strain ïYB3S16 investigated in this study is a strain of subsp. kurstaki serotype 3a3b, thought to be closely related to the most commonly studied Bt subsp. kurstaki strain HD-l, used in many commercial formulations such as Dipel (Drummond, pers comm.). Between 8- 12 plasmids have been isolated from Bt subsp. kurstaki strain HD-l (Aronson et aI., 1986). Gonzílez and Carlton (1980) reported that Bt subpp. kurstaki strain HD-1 produced plasmids of 1.4, 4.9, 5.4,9.3, 10, 29, 44, 52, IIO and 120MDa. Strain HD-l produces CrylAa, CrylAb, CrylAc, Cry2Ña and Cry2Ab proteins (Adang et a1.,1985; Schnepf et a1.,1985; Geiser et al., 1986; Thorne et a1.,1986; Kondo et a1.,1987; rWidner and Whiteley, 1989) and possibly a Cry5 (Shin et aI., 1995). Cloning and expression of crystal protein genes in E. coli has provided direct evidence that Bt subsp. kurstaki HD-l crystal proteins genes a¡e carried on large plasmids (Schnepf and White1ey, 1981; }Ield et a1.,1982; Ferre et a1.,1991). Strain HD-l contains crylfua,crylfuc,cry2&aandasilent cry2Ab onaplasmidof approximately
1C Literature Review
1lgMDa, with a crylAb on a self transmissible 44MDa plasmid (Baum and Malvar, 1995).
1. 3. 11 Bt Development and Formation of the ð-endotoxin Crystal
Bt cell growth occurs in three distinct phases; a logarithmic vegetative stage, a transition phase and sporulation. The metabolism of Bt was reviewed by Rowe and Margaritis (1987). Bt is a chemoheterotroph and aerobically oxidises carbohydrates to organic acids, which are then in turn, further oxidised in conjunction with amino acids to carbon dioxide. Bt initially employs the Embden-Meyerhoff-Parnas (EMP) pathway and converts to a modified tricarboxylic acid (TCA) cycle as sporulation coûtmences. Media for Bt growth have been reviewed by Rowe and Margaritis (1987) and discussed by Norris (1971), Dulmage (1981), Lüthy and Ebersold, (1981) and Sakharova et aI. (1984). Bt will grow in a wide variety of solid or liquid media provided that the media contains a balance of carbon, nitrogen, phosphorus, vitamins and minerals and can be cultured at temperatures between 26"C and 34'C within a pH range of 5.5 to 8. 5 (Devisetty, 1993). Nutritional depletion reduces vegetative proliferation of Bt and induces sporulation (Lüthy and Ebersold, 1981).
The formation of the ð-endotoxin crystal is linked to the growth of the bacterium. The stages of Bt growth have been reported by Norris, (I971), Lecadet and Dedonder (1971), Bechtel and Bulla (1976) and Fast, (1931). V/hen Bt is grown on artificial media, a period of rapid vegetative (exponential or logarithmic) growth is followed by commitment of the cell to sporulation (shiftdown) and formation of an environmentally resistant endospore (Lecadet and Dedonder, l97l). Bechtel and Bulla (1976) reported the sequence of spore (stages I to VII) and parasporal crystal development in Bt subsp. kurstaki strain HD-l grown in GYS (glycine/yeast/salts) media.
The crystal is thought to be synthesised from amino acids formed by protein turnover within the sporangium (Monro, 1961a). The crystal first appeats as a minute granule near the forespore, enlarges as the spore develops and reaches its full size as the spore becomes mature (Young and Fitz-James, 1959). The initiation of crystal formation has been observed microscopically during the later pa"rt of stage II ( Lecadet and Dedonder, 197L; Somerville, t97l) and also during stage III engulfment (Bechtel and Bulla, 1976) and formation continues until the end of stage fV (Lecadet and Dedonder, 1971). Somerville and James (1970) and Somerville (197I) suggested that the exosporium forms a template for crystal assembly. However, Bechtel and Bulla (1976) surmised that the ô-endotoxin crystal is progressively formed within the cytoplasm from protein subunits, without involvement of mesosomes, forespore septa, forespore membrane or exosporium. ð-endotoxin crystal protein production may be fortuitously coincident with sporulation or may accumulate as a result of unregulated spore protein synthesis (Delafield et a1.,1968; Somerville et a1.,1968). Monro, (196lb)
11 Literature Review
reported crystal antigen is not found in the cell prior to sporulation. In contrast, Luthy et aI' (1970) reported that vegetative cells were atoxic although a small amount of toxic protein antigenically related to the crystal could be detected in the particulate fraction of a vegetative cell homogenate.
l. 3. L2 Proteases Associated \Vith the Crystal
Bulla et aI. (1977); Chestukhina et aI. (1973) and Chestukhina et al. (1979) reported proteases found in association with the Bt crystal. Yamamoto (1983) reported that Cryl protein was quickly degraded by these crystal associated proteinases. Haider et aI. (1986) showed that hydrolysis of a Cryl protein by endogenous proteases occurred slowly compared to that caused by gut enzymes and proceeded only as far as a 55kDa peptide. These crystal associated proteases may be contaminants from the bacterial cell which adhere to the crystal surface. Alternatively, Bulla et al. (1977) suggested that these enzymes were prepacked within the crystal and functioned to degrade and activate the crystal.
L. 4. Other Bacillus thuringíensis Toxins
In addition to the â-endotoxin insecticidal crystal proteins effective against lepidopteran, dipteran and coleopteran larvae (Drummond and Pinnock, 1991), some strains of Bt produce a variety of other insecticidal toxins. Of these, both the ß-exotoxin and phospholipase C are broad spectrum toxins known to have activity against certain insects species. In addition, Bt produces a gamut of compounds which are effective against insects, many of which cannot be defined as toxins. To date, there is inadequate knowledge of their chemical structure and role in insect pathogenesis (Lysenko and Kucera, 197l). The range of insecticidal toxins produced by Bt subsp. kurstaki (serotype 3a3b) have been reviewed by Faust (1971), Luthy and Ebersold (1981) and Rowe and Margaritis (1987).
l. 4. I ß-exotoxin and Other Exotoxins
The ß-exotoxin (Heimpel,1967) is a water soluble, heat stable, low molecular weight adenine nucleotide which is found in the supernatant following growth of some Bt strains (Lysenko and Kucera , !97I; Dulmagê, 1981). The elemental composition of ß-exotoxin corresponds to the formula CZZHZ2NSO1gP.3H2O and dephosphorylated ß-exotoxin to C22H3¡NSO10 (Pais and de Barjac, 1974). Dephosphorylated ß-exotoxin and ß-exotoxin have been ascribed molecular weights of 62I and 701, respectively (Farkas et al., L977). ß-exotoxin toxicity results from inhibition of RNA and thus protein synthesis through competition with ATP for binding sites on both eukaryotic and prokaryotic DNA dependant RNA polymerase (Sebesta
12 Literature Review
and Horská, 1968; Sebesta et a1.,1981). A comprehensive summary of invertebrate species susceptible to ß-exotoxin includes a number of insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera,Isoptera and Orthoptera), acarina and nematode species (Sebesta et aI., 19gl). Hoffman and Gingrich (1963) reported that Phthirapteran species were also susceptible to ß-exotoxin. Sub-lethal doses of ß-exotoxin may produce anomalies, deformaties and teratological changes in insects and toxicity is often most pronounced during physiologically critical developmental stages such as moulting or pupation (Bond et aI., lgTl). Various studies reviewed by Sebesta et aI. (198t) indicate that the ß-exotoxin is also toxic to higher animals when administered parenterally, causing some pathological effects in mice and human cell lines.
l. 4. l. 1 M-exotoxin
preliminary studies by V/eiser et aI. (L992) described a water soluble metabolite of Bt subsp. israelensis which was toxic for aquatic snails including Biomphalaria glabrata and cercariae of the fluke, Trichobitharzia szidati. The toxin was a dephosphorylated molecule which appeared at the same elution time as the dephosphorylated ß-exotoxin in HPLC analysis (V/eiser et. al., Igg2) and was named the M-exotoxin due to its primary toxicity to molluscs. Untike the ß-exotoxin, this metabolite did not inhibit DNA dependent RNA polymerase (Horak et a1.,1996).
l. 4. L. 2 Labile Exotoxin
In 1966, Smirnoff and Berlinguet reported a new and undescribed toxin in commercial preparations of Bt subsp. thuringiensis, toxic to larvae of Tenthrendinidae (sawflies). The toxic substance was sensitive to air, sunlight, oxygen and temperatures above 60'C. Preliminary biochemical analysis revealed it was composed of seventeen amino acids which were not identical to the â-endotoxin, in addition to one or more peptides of low molecular weight (200Da-2kDa). The mode of action of this toxin has not been determined and the toxin may be an artifact of the fermentation process rather than a toxin produced by Bt (Lysenko and Kucera, L97l).
l. 4. t. 3 Mouse FactorÆhermosensitive Exotoxin
The mouse factor exotoxin was described by Krieg (1971) as a thermo-sensitive exotoxin of proteinaceous character produced during log phase growth by strains of Bt and B. cereus. This toxin was highly effective against mice per os and several lepidopteran insects and was present in the supernatant of Bt beers. In sublethal doses, the mouse factor caused reduction of growth and prolonged development in lepidopteran larvae. This toxic factor has been t3 Literature Review
related to Heimpel's ü,-exotoxin and was not identical to lecithinase C (Krieg, I97l). Its importance in the pathogenicity of Bt against insect pests is not known (Faust, I97I) and its insectcidal mode of action has not been reported to date. l. 4. l. 4 Vegetative Insecticidal Proteins
Estruch et aI. (1996) reported the isolation of an 88.5kDa protein termed Vip3A, from Bt culture supernatant which was not homologous to any known proteins and which showed activity against a range of lepidopteran insect larvae. Expression of Vip3A commenced during midJog phase of Bt growth and continued through to Bt sporulation. The protein was secreted without N-teminal processing and was detected in about l57o of Bacillus straihs analysed. l. 4. 2 Bt Enzymes
Vegetative and sporulating Bt cells produce enzymes such as haemolysins, chitinases, hyaluronidases, phosphatases, esterases and proteases which may support the proliferation of Bt in its insect host and contribute to lethal septicaemia (Lüthy and Ebersold, 1981). In general, the precise role of such enzymes in pathogenesis is unknown (Lysenko and Kucera, lg7t). Iî 1974, Smirnoff showed that chitinase enhanced the activity of Bt, possibly through destruction of the peritrophic membrane, thus facilitating contact between the ð-endotoxin and the insect gut epithelium (Lüthy and Ebersold, 1981).
L. 4. 2. I Phospholipase C
The phospholipases C are a group of bacterial single polypeptide enzymes which hydrolyse membrane phospholipids (Titball, 1993). The terminology for bacterial phospholipases is confused in the literature. In 1953, Toumanoff identified a water soluble, heat labile Bt "ct- toxin", which was toxic to insects, as lecithinase C. This toxin accumulated during exponential growth and was capable of tysing many types of cells. It was toxic to Galleria melonella and some sawfly species (Taguchi et a1.,1980; Ikezawa et a1.,1983). The work of Krieg and Lysenko in 1979 showed that this toxin was produced only under certain culture conditions (Lüthy and Ebersold, 1981). Recent research has shown that Bt produces both phosphatidylcholine degrading phospholipase C (PC-PLC or lecithinase) and phosphatidylinositol-hydrolysing phospholipase C enzyme (PI-PLC) (Faust, 1977; Henner et aI., 1988; Johansen et al., 1988; Titball, 1993). PC-PLC is similar to Bacillus cereus lecithinase and Clostridium perfringens o-toxin (Zhang,1994). Bt phospholipases are toxic to a number of insect species (Toumanoff, 1953; Krieg, l97I; Lysenko and Kucera, L97li Zhang,1994). l4 Literature Review l. 4. 2. 2 Haemolysins
Two distinct haemolytic toxins produced by Bt subspecies have been purified which were biologically, physiochemically and immunologically identical (Honda et aI.,l99I; Pendelton et aI., 1973). These were thuringiolysin, a 47Y,Da cerolysin like protein and an unidentified secondary haemolysin protein of 29kDa (Pendelton et al., 1973). l. 4. 2. 3 1-exotoxin
The y-exotoxin is an unidentified enzyme responsible for clearing egg yolk agar (Heimpel, 1967). No proof of its insecticidal toxicity has been obtained and the precise nature of this toxin has not been determined (Krieg, l97l), although it appears to be a protease. It has been reported that Bt subsp. kurstaki produces an extracellular, metal chelator sensitive, 37.5kDa protease during the early stages of sporulation which is found in the supernatant (Li and Yousten, 1975). However, no connection has been made between this enzyme and the 1- exotoxin. l. 4. 3 'Water Soluble Toxin
Fast (1971) isolated a water soluble toxin of greater than 30kDa from a commercial preparation of Bt subsp. alesti, which produced symptoms in Bombyx mori similar to those of the parasporal crystal. These included cessation of feeding, absence of response to external stimuli and flaccid paralysis. This toxin was not serologically related to the ð endotoxin. t. 4. 4 Nematocidal Toxin
Some Bt strains kill the eggs and embryonic stages of strongylid nematode species (Cooperia spp and Ostertagia osteragi ) (Ciordia andBizzell, 1961). Studies by Bone et al. (1985) and Bottjer et aI. (1985) showed that a fraction of the crystalline ð-endotoxin of different Bt serotypes killed eggs of Trichostrongylus colubriformis and Nippostrongylus brasiliensis.
1.4.5 Antibiotics
The 1994 patent application of Manker et al. (WO 94109630) reported that Bt subsp. kurstaki strain HDl produces zwittermicin A. Zwittermicin A is an antibiotic which is indistinguishable from fungistatin and reportedly potentiates the entomocidal activity of Bt endotoxins (Stabb et a1.,1994).
15 Literature Review
L 4. 6 Entomocidal Toxins Produced by other Bacillus subsp. Strains
Other Bacillus species such as Bacillus sphaericus (Bsp), produce entomocidal toxins which have similar properties to the louse toxin described by Dulmage (1981). The mosquitocidal toxins produced by some Bsp strains include an mtx gene encoded ADP-ribosylating toxin (Thanabalu et aI.,l99l); a parasporal body produced at sporulation, comprising a binary toxin consisting of equimolar amounts of 41.9kDa and 51.2kDa proteins (Baumann et aI., 1991) and a 31.8kDa mtx2 gene product (Thanabalu and Porter,1996). The Mtx2 protein is produced during the vegetative phase of growth prior to onset of sporulation and is relatively unstable (Thanabalu and Porter, 1996). Both the parasporal toxins and the Mtx2 protein are believed to form pores in susceptible target cells leading to disruption of osmotic balance (McDonel, 1986; Lutz et a1.,1987; Thanabalu and Porter, 1996)'
Bt and Bacillus cereus have many characteristics in common and there is an increasing body of genetic and other evidence which suggests that Bt is a variant of. B. cereus (Pinnock et aI., 1993). Strains of Bt have been shown to produce the human enterotoxin produced by B. cereus (Kolsto and Carlson, 1993)
I. 4.7 Louse Toxin
Hoffman and Gingrich (1968) first reported the potential of Bt to control phthirapteran species, and used dusts containing commercial preparations of Bt against chicken body, shaft and wing lice. Gingnch et aI. (1974) reported that four species of biting lice (Bovicola bovis, B. crassipes, B. Iimbata and B. ovis) were susceptible to powders containing the spore/ð- endotoxin complex of Bt subsp. kurstaki strain HD-l. Dulmage, (1981) discussed an uncharacterised toxin in spore/ð-endotoxin complexes of Bt effective against lice which he termed the "louse factor". This louse factor remains unidentified and its mode of action in phthirapteran species has not been investigated to date. Pinnock and Drummond (1992) suggested that the louse factor is a novel, plasmid encoded, insecticidal toxin, which may be membrane bound and bio-activated in the midgut of. B. ovis.
Hill and Pinnock (1993) completed the first study to examine the histopathological effects of Bt against the Phthirapteran species, B. ovis. A lyophilised fermentation preparation of Bt strain V/B3S16 was fed to B. ovis and midgut tissues were removed and examined by transmission electron microscopy at various intervals post feeding. Strain WB3S16 caused disruption of microvilli and cell organelles, cell swelling and eventual lysis of midgut cells. The histopathological effects of Bt against B. ovis were very similar to those caused by the â- endotoxin in susceptible insects and the authors proposed that the louse toxin effective against B. ovis had a similar mode of action to that of the ð-endotoxin in susceptible lepidopteran and
16 Literature Review coleopteran larvae. Hill, (1992) reported that the B. ovis midgut is pH neutral and slightly oxidising. Consequently, it is unlikely that the crystal per se is responsible for these histopathological effects because the louse gut environment is not conducive to crystal dissolution and activation. Preliminary investigations suggested that the louse toxin was produced by Bt strain WB3SI6 at time of sporulation and released when the cells lysed (Drummond, pers comm.).
1. 4. 8 The Bt Spore
Somerville and Pocket, (L975) and Schesser and Bulla, (1978) reported that the Bt spore had insecticidal properties. Considerable evidence indicates a relationship between the Bt crystal protein and the spore material solubilised under conditions necessary to dissolve the crystal (Somerville and Pocket, 1975). Proteins with solubility, antigenic and chromatographic characteristics, molecular weight and amino acid composition similar to that of crystal proteins have been found in association with the Bt spore (Delafield et a1.,1968; Somerville et a1.,1968; Lecadet and Dedonder,l97l; Herbert and Gould, 1973). Using labelled antibody techniques, these proteins have been localised to the inner side of the exosporium and the spore coat (Short et aI.,1974). Tyrell et aI. (1981) reported that the Bt subsp. kurstaki spore coat contained large amounts of the 134 kDa crystal protoxin and the 68 kDa crystal toxin. A major protein of l3kDa was also found in the spore fraction which was not a crystal protein. Garcia-Patrone and Tandecarz, (1995) isolated two glycoproteins of 205kDa and 72kDa from the exosporium and spore coat of Bt. However, in comparison to the results of Bulla et aI. (1977); Tyrell et al. (1981); Muthukvmar et aI. (1987) and Pfannenstiel et aI. (1987), the authors reported that these proteins were not related to the ð-endotoxin crystal proteins.
t7
Materials and Methods
CHAPTER 2
General Materials and Methods
2. 1 Origin of the Louse Toxic Bt subsp. kurstaki Strain WB3S16
Bt subsp. kurstaki strain WB3S16 was obtained as a lyophilised spore/ð-endotoxin crystal powder from ampoules in the Insect Pathology culture collection at the University of Adelaide, Waite Campus. The strain was originally isolated from sheep fleece at the Waite Campus by Professor Dudley Pinnock and Dr David Cooper. The strain was confirmed as serotype 3a3b by Professor Huguette de Barjac of the Institut Pasteur, Paris, France (Drummond et a1.,1992).
Short Term Storage: ampoules of lyophilised spore/ð-endotoxin crystal mixture were used to establish plate cultures on Nutrient Agar (NA) (Oxoid) maintained at 4'C.
Long Term Storage: a glycerol culture was established from ampoules according to the method of Sanrbrook et aI. (1989) and stored at -2O"C.
2. 2 Production of Bt Crystal- Mutants
Bt crystal- mutants were obtained from the University of Adelaide, Waite Campus culture collection and were prepared by Dr Jane Drummond. The crystal- strains were prepared from Bt strain WB3S16 by heat curing the parent strain to delete plasmids carrying the genes for crystal production, by growth at 42"C for 6 hours in 50ml Nutrient Broth (Oxoid) in a 250m1 baffle flask. 100-200p1 seed inoculum was plated out onto NA (Oxoid) plates which were incubated at 42'C f.or 24 hours. Colonies were then assessed microscopically under phase contrast at x1000 magnification for the presence or absence of crystals. Crystal- strains contained spores but no crystals and had a thin cellular wall in comparison to the parent strain. Crystal- strains were selected and separately plated out on NA. The shiny, transparent morphology of mutant colonies made these strains distinguishable from the parent strain. Twelve crystal- mutants identified as; # 5, 6, 8, 9, 12, t3, 18,20, 52,96,97 nd 98 were isolated in total.
18 Materials and Methods
2. 3 Production of the Bt Preparation
2.3. I Shake flask Culture
Experimental powders were prepared following liquid culture in 100m1 Sakharova's 5156 medium (Sakharova et a1.,1984) (Section 2. 13) in 500m1 baffled Erlenmeyer shake flasks incubated at32"C, on an orbital shaker at 200rpm.
The amino acids were dissolved in 100m1RO water and the pH of the solution was adjusted to 7.2 with 2M NaOH before being filter sterilised through a Millex-Gv4 Millipore O.22¡tm filter unit and mixed with a 900m1 autoclaved solution containing the salts, yeast extract and glucose. Once cool, two successive 2ml aliquots of this media were inoculated with a loopful of Bt taken from an NA plate or glycerol culture and grown at32'C and 200rpm on an orbital shaker for 3-6 hours. This culture was inturn used to inoculate 100m1 of medium in baffled Erlenmeyer shake flasks.
2.3.2 Fermentation in 20L Chemap@ Laboratory Fermenter
To achieve optimal production of louse toxin and larger amounts of working material, experimental powders were prepared by liquid culture in l4L of supplemented Nutrient Broth (Section 2. 13), in a2OL Chemap@ laboratory fermenter (Figure 2. 1), under standard growth conditions of 70Vo dO2,32"C, and pH '7 .O, at a turbine speed of 600-700rpm.
To achieve vigorous and synchronised bacterial growth, a culture was established by inoculating 250ml supplemented Nutrient Broth with a loopful of Bt taken from a 24 hour NA plate culture. The culture was incubated at32'C and 200rpm for 18-24 hours in a McCartney bottle and was used to inoculate a 2L baffled seed flask of supplemented Nutrient Broth which was grown to exponential phase for approximately 4-5 hours by incubation at 32"C and 200rpm. The seed flask was used to inoculate t4L of supplemented Nutrient Broth in the fermenter. The fermentation parameters were: 32"C,lOVo dO2 and pH 7.0.
The culture was sampled at regular intervals to monitor cell numbers and check for contamination. Samples were diluted and the number of cells containing endospores and mature free spores were counted using a Petroff-Hauser counting chamber. The culture was harvested when it contained 5OVo free spores and 50Vo endospores (termed 507o lysis).
19 Materials and Methods
Figure 2. 1 Fermentation of Bt strain WB3S 16 in a20L Chemap@ laboratory fermenter a_4
I-
I a
6 Materials and Methods
2. 3. 3 Bt Powder PreParation
Aliquots (200n¡l) of the Bt culture ferment from the shake flask or fermenter were collected by centrifugation at 10, 000xg in a Sorvall RC-58 refrigerated superspeed centrifuge. The pellet obtained from shake flask culture was washed three times with sterile type III RO water. Alternatively,l4L of fermenter culture was harvested using an Alpha-Laval cream sepafator to separate particulate matter from the culfure supernatant.
The slurry or pellet obtained from culture of the Bt was shell frozen in conical flasks using a mixture of solid CO2(s) and ethanol. The pellet was completely lyophilised in a Dynavac freeze dryer at -25"C and l0-3 Torr. Pellets were ground to a fîne powder using either mortar and pestle or a kitchen food processor, and the Bt powder was stored with desiccant at -80"C andOTo RH in vacuum sealed plastic bags.
2. 4 Separation of the Bt Preparation into Fractions
2. 4. I Isopycnic Separation of Bt Membranes
Bt membranes were separated from spores and crystals using Percoll@ (Pharmacia) isopycnic gradients. 0.019 of Bt powder preparation was sonicated for 2 minutes at 3OHz with 35ml Percoll@ in Beckman (#344367) polyallomer centrifuge tubes. The tubes were capped and centrifuged at70,000xg and 4'C for 1.5 hours. The membrane debris separated as a diffuse band at the top of the tube and was removed by aspiration. Contaminating spores were removed by incubating the material at25'C for 24 hours and then disrupting germinated cells by sonication at 30Hz for 5 minutes. The membranes \ryere dialysed in 30, 000 MW cut-off Millipore Ultra-free MC fîlter units (UFC3 LTK 25) against three washes with Type III RO water to remove the Percoll@ solution, and collected by centrifugation at 11,000xg. The resulting pellet was transferred to an eppendorf tube, lyophilised and stored at -80'C.
20 Materials and Methods
2. 4. 2 Lyophilisation of Bt Culture Supernatant
Following fermentation, particulate matter was removed by centrifugation as described in Section 2. 3. 3, and the separated supernatant and particulate matter were lyophilised at -25"C and l0-3 Torr in a Dynavac freezedryer. The supernatant and particulate pellets were ground with a mortar and pestle and stored at -80'C.
2. 4. 3 Rate Zonal Separation of Bt Crystals and Spores
Spores and crystals have very similar densities and are extremely difficult to separate. The density of spores and crystals varies between different strains of Bt and will determine the success of separation. The relative density of crystals and spores is approximately 1.30 and 1.35 respectively (Fast ¿f aI., 1972). The method used in this study to separate spores and crystals is a modified version of that developed by Thomas and Ellar (1983) using discontinuous sucrose density gradients.
5ml volumes of 677o (saturated sucrose), 66Vo, 60Vo, 507o, 45Vo and 30Vo v/v sucrose solutions were prepared and used to generate discontinuous sucrose step gradients in Beckman (#344367) polyallomer centrifuge tubes. 1glml of Bt powder preparation was prepared in sterile Type III RO water and applied to the top of the gradient. Gradients were centrifuged at 200,000xg for 65 minutes in a Beckman L8-70 ultracentrifuge to achieve separation. Crystals formed a band between the 677o and 6OVo v/v sucrose layers (Figure 2. 2) and were removed by aspiration with a pipette. The crystals were dialysed against 2 changes of IxPBS or sterile Type III RO water in 30, 000 MV/ cut-off dialysis tubing (Selby) for a maximum of 5 hours at 4'C to remove the sucrose solution and were collected by centrifugation at 200, 000xg for 30 minutes in a Beckman L8-70 ultracentrifuge. Alternatively, small amounts of crystals were dialysed in 30, 000 MW cut-off Millipore Ultra- free MC filter units against three washes with sterile Type trI RO water and were collected by centrifugation at 11, 000xg. Crystal pellets were transferred to eppendorf tubes, lyophilised immediately to prevent proteolytic degradation by proteases coÍrmonly isolated with Bt crystals (Yamamoto and Mclaughlin, 1981) and stored at -80"C.
2l Materials and Methods
Figure 2. 2 Rate-zonal separation of Bt strain \VB3S16 spores and crystals using a sucrose density gradient. Following centrifugation, the dense spores formed a pellet at the bottom of the tube whilst the less dense crystals separated out and were visible as a band.
Materials and Methods
2. 5 Determination of Protein Concentration
The concentration of whole and dissolved crystal protein, membranes and supernatant fractions was determined using the Modified Lowry Protein Determination (MLP) method for soluble proteins (Sigma Protein Assay Kit #5656) against blanks of sH2O. Protein concentration was determined spectrophotometrically by comparison to a BSA calibration curve by measuring absorbance at a wavelength of 720nm.
2. 6 Dissolution of Bt Crystals \ryith Retention of Toxicity
The Bt strain WB3S16 crystals were dissolved to yield their constituent proteins using a modified version of the method developed by Fast and Milne (1979) reported to successfully dissolve the crystals and to minimise the hydrolysis of peptide bonds, thus maintaining protein structure and toxicity to insects. Crystals were suspended in a â-endotoxin dissolving buffer, the pH of which had been adjusted to 7.8 with lM HCI (Section2. l3).
A ratio of l:1 pl dissolving buffer to pg Modified Lowry Protein of Bt crystals was used. The buffer/crystal suspensions were incubated at 37"C for I hour. For the purpose of bioassays, the dissolving solution was removed from the crystal protein by dialysis against three washes of sterile Type III RO water in 30, 000 MW cut-off Millipore Ultra-free MC filter units. The crystal protein was resuspended in a minimal volume of sterile Type Itr RO water, centrifuged at 11, 000xg in a microcentrifuge to collect the pellet, lyophilised and stored at -80'C.
2. 7 Production of Polyclonal Antisera to the Crystal Proteins
Female New Zealand White/Lop-eared cross rabbits were used to generate polyclonal antibodies to Bt strain WB3S16 whole crystals and dissolved crystal proteins using a method developed from that of Krywienczyk et aI. (1978). Reference serum was collected prior to immunisation. Two rabbits were given four lml injections each containing a 0.5m1 dose of either whole crystals or dissolved crystal protein in sterile IxPBS and 0.5m1 Freund's complete adjuvant (Sigma), at weekly intervals. The injections were sequentially administered subcutaneously, intramuscularly and twice intravenously. The doses were lmg, lmg, 0.5mg and 2mg respectively, of whole crystals and 4mg, 4mg, 2mg and 2mg respectively, of dissolved crystals. Antibody titre checks were conducted by collecting a small amount of serum one week after the first intravenous injection. 20ml blood was collected for antiserum separation two weeks after the final intravenous injection. One month
22 Materials and Methods
after the last injection, rabbits were given a booster injection of 2mg. 4.5mg of whole crystals or l2mg of dissolved crystal protein were administered per rabbit in total. The rabbits were exsanguinated eleven days after the booster injection. Sera were separated from blood cells in Corex@ tubes (siliconised with Sigmacote@(Sigma)) by centrifugation in a Clements GS100 centrifuge at 2, 500xg. Sera were stored in sterile containers at -7O"C without preservatives'
The IgG serum fractions were obtained by ammonium sulphate precipitation according to the method of Harlow and Lane (1938) and purified by absorption with liver tissue preparation as described by (Nairne,1969). 40Vo satwated (NH+)ZSO4 (pH 7.0) equivalent to a two-thirds volume of the original sera, was added dropwise at a rate of I drop/minute to the serum whilst stirring. The solution was left to stand overnight and then centrifuged at 1, 000xg in an Beckman L8-70 Ultracentrifuge and the supernatant was discarded. The pellet was redissolved in a volume of sterile IxPBS equal to half that of the original serum. The globulin fraction was dialysed against two changes of sterile IxPBS (100x the volume of the original sera) for 16 hours using 30, 000 MW cut-off dialysis tubing (Selby). All reactions were carried out at 4"C. 100mg liver powder (Sigma) per ml of serum was added and the mixture was shakenfot 2 hours at room temperature on an end over end shaker at a speed which avoided frothing. The mixture was then centrifuged at 15, 000xg for 15 minutes and the supernatant was removed and stored in 25ml aliquots at -80'C.
Antibody titre was measured by slide agglutination for the dissolved crystals and by dot blot analysis for both the dissolved and whole crystals using the procedure outlined for western blots in Section 2. 10. The optimal working titre for both the dissolved crystals and the whole crystals was determined to be 1:500.
2. 8 Bt Bioassay Against B. ovß
2. 8. I Skin Diet Preparation
Louse skin diet was prepared by the method sf Drummond et aI. (1992). Epidermal scrapings from frozen sheep skin were desiccated in a microwave, ground in liquid N2(l) using a mortar and pestle and seived through a 0.04 inch Greenburn laboratory sieve. The skin preparation was stored with desiccant at 4'C.
23 Materials and Methods
2. 8. 2 Louse Collection
Adult male and female B. ovis were collected by vacuum suction from the fleece of naturally infested Merino sheep.
2. 8. 3 Bioassay Design
Bioassays were conducted in Falcon@ MultiwelledrM Tissue-Culture plates. Ten B. ovis were added to each of six replicate wells containing 10mg sheep skin diet which incoqporated 5Vo by weight of Bt strain WB3S16 lyophilised powder preparation. During the feeding period, the plates were kept at 34'C and 70Vo RH in a humidity controlled Heraeus Cytoperm@ incubator. A control group of 40 B. ovis were fed the skin diet without Bt. Mortality was recorded after set time periods, generally 24 hours,48 hours and72 hours. Bioassays were terminated if B. ovis control mortality exceeded an arbitrary rejection level of 107o. To determine LCSO values (the dose of Bt which kills SOVo of the B. ovrs population), bioassays were performed as above, using five, two-fold dilutions (31.25pg -500pg) of Bt powder preparation incorporated with the skin diet. Results were analysed using the probit analysis method of Finney (1971). Bioassays were terminated when B. ovis mortality exceeded an arbitrary rejection level of 107o.
2. 9 SDS-Polyacrylamide Gel Electrophoresis
The constituent proteins of Bt crystals, Bt fermentation powders, spore coats, and the supernatant and membrane fractions were studied by SDS-PAGE. Proteins were run on Mini- PROTEAN@ U 4-20Vo polyacrylamide gradient Ready gels (Bio-Rad #161-0903) to determine the molecular weight of proteins and analyse protein banding patterns.
Samples were heated at 100'C for 4 minutes in IxSDS gel loading buffer (30pl per sample) (Section 2. 13) to denature proteins and the samples were placed on ice until ready for loading.
SDS-PAGE Molecular IVeight Standards:
The molecular weight of proteins was determined by comparison of their electrophoretic mobility to the following Bio-Rad MV/ standards. Standa¡ds were also diluted 1:20 in IxSDS gel loading buffer (Section 2. L3).
21 Materials and Methods
Broad Range Standard (# 161-0317) Kaleidescope Prestained Standard (# 161-0324)
200,000kDa 203,000kDa 116,250kDa 135,000kDa 97,4OOkDa gl,000kDa 66,200kDa 44,000kDa 45,000kDa 32,000kDa 31,000kDa 17,400kDa 21,500kDa 7,500kDa 14,400kDa 6,500kDa
Gels were run at 200m4 for 45 minutes in Tris-glycine electrophoresis buffer (Section 2. I3). Gels were stained for a minimum of 2 hours on a slowly rotating platform at RT in staining solution (Section 2. 13). Gels were destained in a destaining solution (Section 2. 13) until the background was clear and photographed immediately or stored at 4"C in sterile water containing 20Vo gly cerol.
2. l0 Western Blots
All solutions including transfer buffer, blocking buffer, TBS, TTBS, antibody buffer, colour development buffer and colour reagents A and B were prepared as described in Section 2. 13 using the Bio-Rad Immun-Blot@ Alkaline Phosphatase Assay Kit containing goat anti-rabbit IgG (H+L) AP.
Proteins were run on SDS-PAGE gels against a Bio-Rad Kaleidoscope Prestained Standard (Section 2. 9) and then transferred from to nitrocellulose membranes in transfer buffer at 200m4 for 2 hours. The membranes were immersed in 10ml blocking buffer containing 37o w/v gelatine in Tris Buffered Saline (TBS), and gently agitated for t hour. The membranes were washed twice in 10ml Tween Tris Buffered Saline (TTBS; TBS buffer containing0.OíVo v/v Tween-20) for 5-10 minutes with gentle agitation. The primary antibody was dissolved to titre ( 1:500) in an antibody buffer containing l7o wlv gelatine in TTBS. The membranes were gently agitated in 5ml of the primary antibody for 2 hours. The unbound primary antibody was removed with a pipette and the membranes were washed with 5ml of the secondary antibody (33Vo v/v Goat anti-rabbit antibody with alkaline phosphatase label in antibody buffer) for l-2 hours. The membranes were washed twice in 10ml of TTBS for 5 minutes and once in lOml TBS for 5 minutes. The membranes were immersed in lOml colour
25 Materials and Methods
development buffer containing IVo vlv alkaline phosphatase (AP) colour reagent A and lVo v/v Ap colour development reagent B. Colour development was stopped by immersion of the membranes in sterile RO water and membranes were photographed immediately.
2. lI Isolation of Plasmid DNA lrom E. coli
Bacteria were grown in 4ml of Luria-Bertani media (LB) containing 2Opglml ampicillin (Ap) for 18 hours at37"C and 200rpm. Bacteria were harvested by centrifugation twice in 1.5m1 eppendorf tubes at 6, 000x g for 2-5 minutes. The pellet was re-suspended in 500p1 of Solution I (Section 2. 13) and centrifuged at 6, 000xg for 2-5 minutes to remove media. The pellet was then re-suspended in 300p1 of Solution I and incubated for 5 minutes at RT. 300p1 of freshly prepared solution tr (Section 2. 13) was added and the mixture was incubated for 5 minutes at 4'C. 300p1 of Solution III (Section 2. 13) was added and the mixture was incubated for 5 minutes at 4'C. Precipitated protein, cellular debris, SDS and chromosomal DNA was removed by centrifugation at 10, 000xg for 10 minutes. RNaseA was added to the supernatant to a final concentration of 2}¡tglml and the mixture was incubated at37"C for 2O minutes. The supernatant was extracted with an equal volume of 1:1 phenoVchloroform and the mixture was centrifuged at 10, 000xg for 2 minutes. An equal volume of chlorofonn was added to the supernatant which was centrifuged at 10, 000xg for 2 minutes to separate the phases. Two volumes of 1007o ethanol were added to the supernatant, which was incubated for 2 minutes at RT and centrifuged for 10 minutes at 10, 000xg, to collect the precipitated nucleic acid. The pellet was washed with TOVo ethanol and air-dried at37"C. To improve the purity of the DNA for sequencing, the pellet was re-suspended in water containing 0.4M NaCl and 6.57o v/v PEGse¡s (polyethylene glycol). The sample was incubated at 4"C for 20 minutes and the plasmid DNA was pelleted by centrifugation for 15 minutes at 4"C in a fixed angle rotor at 10, 0000xg. The pellet was washed with TOVo ethanol and dried before re-suspension in water. The concentration and purity of the DNA was assessed spectrophotometrically by measuring absorbance of an aliquot at 260nm and 280nm.
2. 12 Agarose Gel ElectroPhoresis
DNA samples in 6x Ficoll Dye loading buffer containing 2}¡tglml RNAaseA were run on l7o agafose Tris borate electrophoresis (TBE) gels containing 5Vo ethidittm bromide with TBE buffer at 70m4. DNA bands were visualised on a UV transilluminator and photographed using a Landpack Polaroid camera (aperture f=8, shutter time=Z seconds) fitted with a red filter and Polaroid 667 fùm.
26 Materials and Methods
2, 13 Common Solutions
Antibod]¡ Buffer
TTBS solution containing IVo wlv gelatin'
The solution was heated to 50"C whilst stirring to dissolve the gelatin.
Blocking Buffer
TBS solution containing3Vo w/v gelatin.
The solution was heated to 50"C whilst stirring to dissolve the gelatin.
Colour Development Solution
AP colour reagent A 0.5ml AP colour reagent B 0.5mI Colour Development Buffer 5Oml
ð-endotoxin Crystal Dissolving Buffer (pH 7,8)
MOPS 0.1M DTT 0.05M KSCN 1M
Denaturins Solution
NaCl 1.5M NaOH 0.5M
Denhardt's III
BSA (Sigma Fraction V) 2Vo wlv Ficoll400 2Vo wlv PVP ZVo wlv
n Materials and Methods
Destaining Solution methanol:H2O 1:1vlv Glacial acetic acid lïVo vlv
6x Ficoll Dye Loading Buffer
Bromophenol blue O.25Vo wlv Ficoll type 400 l5%o wlv Xylene cyanol FF 0.25Vo wlv
5x HSB
NaCl 3M Na2EDTA 25mM NaOH (pH 6.8) 4M PIPES 100mM
H)¡bridisation Solution 10ml
Denatured salmon sperm DNA (spg/rnl) 500p1 Denhardt's III 3ml 25ToDextran sulphate 3ml 5xHSB 3rnt Sterile ddHZO 500p1
The solution was mixed well and incubated at 65'C for 5 minutes.
Lå
Bacto-tryptone l%o wlv Bacto-yeast extract O.SVo wlv NaCl l%o wlv
The pH of the solution was adjusted to 7.0 with 5N NaOH and autoclaved for 20 minutes at l2l"c.
28 Materials and Methods
LB Plates with X-gal and IPTG l5g (1.57o w/v) bacto-agar was added to the above medium which was autoclaved as above. Molten agar was poured into 35mm plastic petri dishes. Once set, 100p1IPTG and 20pl X- gal were pipetted onto the surface of the agar and spread with a sterile glass spreader.
Neutralising Solution
NaCl 1.5M Na2EDTA 1mM Tris-HCl 0.5M
pH to 7 .2 with lM HCl.
Nutrient Agar
Nutrient agar (Oxoid) 23Vo wlv
The solution was autoclaved at l2l'Cfot 20 minutes.
Nutrient Broth
Nutrient broth (Difco) \Vo wlv
The solution was autoclaved at t2l"C for 20 minutes'
Oligolabelling Mix
BSA 3OOpg/ml dATP/dTTP/dGTP 60pM each Iv.fgCl2 3OmM NaCl 150mM Primers: 0.3¡tgl12.5¡tI Tris-HCl pH7.6 150mM
29 Materials and Methods
Phosphate Buffered Saline ßBS)
NaCl 0.15mM NaZHPO+ 0.0lmM NaHZPO4.2HZO 3.3pM
Sakharova's 5156 Medium (Sakharova ¿l a/.. 19841
Salts (NH¿)zSo+ 11.4mM KZHPO+ 1.8mM MgSO¿.7HZO 1.2mM MnSO¿.5HZO 0.2mM FeCL3.6HZO 3.6pM ZnSO+.7HZO 17.3pM CUSO+.SHZO 2.O¡rM H¡BO¡ 0.9pM CaCLZ.2HZO 0.5mM Na2Mo04 0.lpM
Amino Acids L-alanine 3.4mM L-aspartic acid 0.6mM L-glutamic acid 1.OmM L-histidine 1.OmM L-threonine 1.3mM nicotinic acid 81.OpM
Yeast Extract 0.I Vo wlv
D-glucose 5.6mM
30 Materials and Methods
lx SDS Gel Loading Buffer
Tris.Cl (pH 6.8) 5OmM DTT 100mM SDS 2Vo wlv Bromophenol blue O.IVI wlv glycerol IÙVo wlv
SOC Media
Bacto-tryptone 2Vo wlv Bacto-yeast extract O.57o wlv Glucose 2OmM NaCl 0.O5Vo wlv
Solution I
Glucose 5OmM Tris.Cl pH 8.0 25mM EDTA pH 8.0 lOmM
Solution II
NaOH 0.2N SDS l%o vlv
Solution trI
Potassium acetate 3M Glacial acetic acid 5M
20x SSC
NaCl 3M Tri-sodium citrate 0.3M
31 Materials and Methods
Stainins Solution
Methanol:H2O 1:l v/v Glacial acetic acid lOVo vlv Coomassie Brilliant Blue R250 O.I32 7o wlv
Supplemented Nutrient Broth
Besan Pea Flour O.5Vo wlv MnS04 0.OO24 Vo wlv Nutrient Broth (Oxoid) 0.8Vo wlv Potato Starch (Sigma) l.O7o wlv
TES Buffer
EDTA pH 8.0 1OnM Tris. HCI pH 8.0 25mM Sucrose (filter sterilised) 5OmM
Towbin Running Buffer
Glycine 192mM Methanol 1Ov/v Tris 25mM
Tris Acetate Electrophoresis Buffer (TAE)
Glacial acetic acid 0.02mM EDTA 1.OmM Tris base 0.04mM
Tris Borate Electrophoresis Buffer (TBE)
Boric acid 0.09mM EDTA (pH8.0) 2mM Tris base 0.09mM
32 Materials and Methods
Tris Borate Saline (TBS)
KCI 2.7¡t},f NaCl 0.14mM Tris base 25pM
The solution was adjusted to pH 7.4 with HCI and autoclaved at l2I'C for 2O minutes.
TrisÆDTA Buffer (TE)
EDTA 1mM Tris.HCl (pH8.a) 1OmM
Tris-glycine Electrophoresis Buffer
Tris 25mM Glycine (pH 8.3) 25OmM SDS O.lVo wlv
Tween-2O Tris Borate Saline (TTBS)
TBS containingO.05Vo v/v Tween-20
Western Blot Transfer Buffer
Glycine 39mM Methanol 2OVo vlv Tris 48mM SDS O.O37VI wlv
33
Bt Strain WB3S16 Toxins
CHAPTER 3
Toxins Produced by Bacillus thurtngiensis
3. 1 INTRODUCTION:
In addition to the ð-endotoxin insecticidal crystal proteins effective against lepidopteran, dipteran and coleopteran larvae (Drummond and Pinnock, 1991), some strains of Bt produce a variety of other insecticidal toxins. Of these, both the ß-exotoxin and phospholipase C are broad spectrum toxins known to be toxic to certain insects, which have potential toxicity to phthirapteran species. These Bt toxins were examined in an attempt to elucidate the nature of the louse toxicity produced by Bt strain WB3S16 against B. ovis.
3. 1. 1 ß-exotoxin The biochemical nature of the ß-exotoxin was reviewed in detail in Section 1. 4. 1. The ß- exotoxin (Heimpel, 1967) is a water soluble, heat stable, low molecular weight adenine nucleotide which is found in the supernatant following growth of some Bt strains (Lysenko and Kucera, !97!; Dulmage, 1981). ß-exotoxin toxicity results from the inhibition of RNA and thus protein synthesis by competition with ATP for binding sites on RNA polymerase. The ß-exotoxin is toxic to a number of insect orders including Lepidoptera, Coleoptera, Diptera, Hymenoptera, Isoptera and Orthoptera (Sebesta et al., 1981) and Phthiraptera (Hoffman and Gingrich, 1968). SubJethal doses of ß-exotoxin may produce anomalies, deformities and teratological changes in insects and toxicity is often most pronounced during physiologically critical developmental stages such as moulting or pupation (Bond et al., t97t).
Fly bioassays (Ignoffo and Gard, 1970) have commonly been used to detect the presence of ß- exotoxin in cultures. Bioassays monitor the ability of ß-exotoxin to prevent the larvae or pupae of an insect species from developing into adults. Ignoffo and Gard (1970) developed an agar based diet for assaying ß-exotoxin activity against larvae of Musca domestica, and obtained characteristic dose-response curves. This method and that of Singh and Jerram, (1976) was refined for use with larvae of the Australian Sheep Blowfly, Lucilia cuprinaby Cooper et al. (L985). Many researchers report that whilst bioassays are useful for determining the susceptibility of an insect species to an exotoxin (Bond et aI., l97l; Ignoffo
34 Bt Strain \ry83s16 Toxins and Gregory,1972; Burges, t975; ), they are often variable (Mohd-Salleh and Lewis, 1982; Herbert and Harper, 1985) and may take several days to complete.
Oehler et at. (1982), Bubenschikova et al. (1983) investigated the potential of using High Performance Liquid Chromatography (HPLC) as a more rapid and sensitive method of assaying for ß-exotoxin. Liquid chromatography is well suited to the study of ß-exotoxin because the culture supernatant can be analysed directly. Campbell et al. (1987) refined the HPLC technique to enable ß-exotoxin to be assayed within 20-30 minutes against an external ß-exotoxin standard. The same authors reported that HPLC results correlate well with fly bioassay data for a variety of exotoxin samples and demonstrated that HPLC is a reliable alternative to insect bioassay. In addition, the concentration of exotoxin in a sample and consequently the exotoxin producing capabilities of various Bt strains can be determined using HPLC. HPLC is capable of distinguishing between phosphorylated and dephosphorylated forms of the exotoxin (Campbell et al., 1987) and between other structural derivatives of the toxin such as the uracil analogue reported by Levinson et al. (1990) and the type II or T-exotoxin described by Argauer et al. (1991).
Salts of certain metals (barium, calcium and magnesium) can precipitate ß-exotoxin directly from the bacterial supernatant (Bond et aI., I97t). A rapid method for extraction of ß- exotoxin from small supernatant samples was developed by Arellano and Juttner (Juttner, pers comm.). These extracts were used in HPLC analysis of the Bt strain WB3SI6 supernatant for the presence of ß-exotoxin. In addition, the supernatant of Bt strain WB3S 16 was tested for ß-exotoxin activity against larvae of the Australian sheep blowfly, Lucilia cuprina.
3. l. 2 Phospholipase C Bt phospholipases were reviewed in Section l. 4. 2. The phospholipases C are a group of bacterial single polypeptide enzymes which hydrolyse membrane phospholipids (Titball, 1993). The terminology for bacterial phospholipases is confused in the literature. Recent research has shown that Bt produces both phosphatidylcholine degrading phospholipase C (PC-PLC or lecithinase) and phosphatidylinositol-hydrolysing phospholipase C enzyme (PI- PLC) (Faust, 1977; Henner et a1.,1988; Johansen et al., 1988; Titball, 1993). PC-PLC is similar to Bacillus cereus lecithinase and Clostridium perfringens ü-toxin (Zhang,1994). Bt phospholipases are toxic to a number of insect species (Toumanoff, 1953; Krieg, I97l; Lysenko and Kucera, l97l Zhang, t994). The toxicity spectrum of Bt phospholipases has not been extensively explored and their activity against lice is unknown.
35 Bt Strain WB3S16 Toxins
The lecitho-vitellin or egg yolk agar test is a standard test for phospholipase C (Cowan, Ig74). Lecitho-vitellin (LV) is the lipoprotein component of egg-yolk and can be obtained as a clear yellow suspension by mixing egg-yolk with saline. V/hen lecithinase-forming organisms are grown on agar containing LV, the lecithinase diffuses into the agar and produces zones ofclearing and opalescence around individual colonies. This reaction can be inhibited by adding certain antitoxic or anti-lecithinase sera to the surface of the medium prior to inoculation. Lipolytic organisms also produce an opalescence on LV agar which is often accompanied by a distinctive 'pearly layer' or iridescent film (Cowan, L974). The presence of free fatty acid can be demonstrated by a blue copper zone around the edge of colonies following incubation with copper sulphate solution (Willis, 1960). Opalescence or pearly layer is regarded as a positive result for lecithinase. However, the LV reaction is not due solely to lecithinase and the separation of insoluble protein, splitting of fats from lipoprotein complexes and the coalescence of particles of free fat may be involved (rWillis and Gowland, 1962). The lecitho-vitellin test was used to determine whether Bt strain WB3S16 produced detectable levels of phospholipase C enzyme'
Hoffman and Gingrich (1968) first reported the potential of Bt to control phthirapteran species, using dusts containing commercial preparations of Bt against chicken body, shaft and wing lice. Gingrich et aI. (1974) reported four species of biting lice (Bovicola bovis, B. crassipes, B. Iimbata and B. ovis) were susceptible to powders containing the spore-endotoxin complex of Bt subsp. kurstaki strain HD-1. Dulmage, (19S1) discussed an uncharacterised toxin in spore-endotoxin complexes of Bt effective against lice which he termed the "louse factor". This louse factor remains unidentified and its mode of action in phthirapteran species has not been investigated prior to this study.
An objective of this part of the study was to determine whether Bt strain WB3S16 produced the ß-exotoxin or phospholipase C toxins and to establish whether these could be the "louse factor" produced by Bt strain WB3SI6.
3. 2 MATERIALS AND METHODS:
3. 2. t ß-exotoxin
3. 2. l. I Lucilia cuprina BioassaY
The Lucilia cuprina bioassay was conducted using the method of Cooper et aI. (1985).
36 Bt Strain WB3S16 Toxins
Production of SuPernatant The Bt subsp. thuringiensis strain HD-2, a serotype I isolate, known to produce high levels of ß-exotoxin, was used in this study as a positive control. Bt strains WB3S16 and HD-z were grown for 40 hours in 100m1 of 3.7Vo w/v Brain Heart Infusion (Oxoid) incorporating l60pM MnSO4 in 400m1baffled Erlenmeyer flasks at32'C and 200rpm on an orbital shaker. The culture was centrifuged at 15, 000xg for 20 minutes in a Sorvall RC-58 Refrigerated Superspeed centrifuge to collect the supernatant.
Bioassay Procedure 65mm Petri dishes were ventilated by punching holes in the lids using a 20 tine heated wire punch. To ensure sterility, the holes were covered by gluing a'Whatman No. I filter paper to the inside of the lid, after which the plates were sterilised under ultraviolet light for a minimum of 3 hours.
Larval Diet Medium
Bacteriological agar (Difco) 2.4Og Sungrain@ Brewers Yeast 1.95g
The mixture was dissolved in 21.5m1 of RO water by heating to 50"C with shaking and then autoclaved. 50ml of Devondale@ full-cream UHT milk was autoclaved separately and added to the above mixture, and then 18ml of the bacterial supernatant was sterilised by passing the supernatant through a}.Z2¡tmMillex-GV4 Millipore filter unit and then added to the mixture. The resulting medium was poured into the sterilised 65mm plates and allowed to set.
Lucilia cuprina eggs Lucilia cuprina eggs were kindly supplied by Dr David Cooper of Microbial Technologies Pty. Ltd., South Australia. Freshly laid eggs were dis-aggregated by gentle agitation in l0ml O.OSVo Tween 80 (Ajax Chemicals) for 20 minutes. The Tween 80 was decanted and the eggs were surface sterilised for 10 minutes in 10ml freshly prepared SVo formaldehyde and rinsed three times in sterile RO water. Fifty eggs were dispensed to each plate and plates were incubated at32'C for 40 hours.
Control plates were set up as above, but without the addition of the supernatant. The numbers of larvae which emerged on the diet were recorded, and the percent larval mortality of each treatment was assessed at 30 hours.
37 Bt Strain WB3S16 Toxins
3. 2. I. 2 HPLC Analysis for ß-exotoxin
Isolation of ß-exotoxin 1. 5ml of supernatant produced by the above procedure was centrifuged in a microcentrifuge at 11, 000xg for 15 minutes. lml of the supernatant was filter sterilised through a 0.22¡tm Millex-GV4 Millipore filter unit and the supernatant was cooled to 4'C. Under gentle agitation with a nitrogen stream, barium was slowly added to a final concentration of ^cetate 0.08pM over a period of 5 minutes. Under anaerobic conditions, a white ß-exotoxin precipitate formed at 4'C over 3-4 hours and was collected by centrifugation in a microcentrifuge at 11,000xg for 10 minutes. The pellet was washed three times with sterile RO water and once with cold acetone. The acetone was drained and the ß-exotoxin pellet was dried in a vacuum desiccator. The powder was stored at -2O"C and 07o RH.
Preparation of ß-exotoxin Sample for HPLC The ß-exotoxin pellet was dissolved in 0.5m1 of 0.5M HZSO¿ and the solution was agitated at 4"C for 60 minutes on an end-over-end shaker. The solution was centrifuged in a microcentrifuge at 11, 000xg for 5 minutes. The supernatant was removed and adjusted to pH 3.0 with the addition of 0.75m1 of 0.7M NaOH and then filter sterilised through a Millipore Millex-GV4 0.22¡tm filter unit.
Preparation of the ß-exotoxin Standard A ß-exotoxin standard powder, originally obtained from Professor Huguette de Barjac of the Institute Pasteur, Paris, France, was used as a ß-exotoxin standard for comparative purposes. The powder was dissolved and adjusted to pH 3.0 with lM phosphoric acid to achieve a final concentration of O.lmg/ml. The preparation was filter sterilised through a Millex-GV4 0.22¡tm Millipore filter unit.
HPLC Test HPLC assays were performed on a'Waters-p-Bondapak C13 column (300mm x 3.9mm i.d.) isocratic system maintained within a temperature range of 2O-25"C. A 50mM KH2PO4 þH 3.0) mobile phase and a flow rate of lmUminute were used. The buffer was filtered through a Gelman 0.45pm membrane filter disc prior to use. 100p1 sample aliquots were injected for analysis. Instrumentation included a ICI pump, integrator and variable wavelength UV detector set at 260nm.
38 Bt Strain WB3S1ó Toxins
The samples analysed were:-
1) ß-exotoxin standard blank lM phosphoric acid solution pH 3.0 2) ß-exotoxin standard in lM phosphoric acid solution pH 3.0 3) 0.5M HZSOq|}.TM NaOH sample dissolving solution 4) Bt subsp. thuringiensis strain HD-2 supernatant 5) Bt subsp. kurstaki strain WB3S16 supernatant
The data collected were graphed and analysed.
3. 2. 2 PhospholiPase C
3. 2. 2. 1 Lecitho-vitellin Test for Phospholipase C
Bt strain WB3S16 was tested for production of phospholipase C using the standard lecitho- vitellin test for lecithinase enzymes of MacFarlane et al. (1941) described by Cowan (1974).
Lecitho-vitellin agar ILV agar) lL (MacFarlane et al.' l94I)
Lecitho-vitellin solution (egg-yolk saline):
Hen egg yolk 57o wlv (McGaughey and Chu, 1948) NaCl0.857o 1000m1 Keiselguhr (diatomite) -"ê)4a
The egg yolks were beaten and added to the saline solution to produce a homogeneous LV mixture. The solution was allowed to settle for I hour, centrifuged at 6, 000xg for 30 minutes in a Sorval RC-5B Refrigerated Superspeed Centrifuge and the supernatant was collected and clarified twice by filtration through a Whatman No. 1 filter paper. The filtrate was then filter sterilised using a Millex-GV4 0.45¡tm Millipore filter unit.
Lecitho-vitellin agar:
Lecitho-vitellin solution 100m1 Nutrient agar (Oxoid) solution 900m1
39 Bt Strain WB3S16 Toxins
The lecitho-vitellin solution was added aseptically 1:5 to an autoclaved and cooled nutrient agar solution and 90mm plates were poured and allowed to set. The plates were inoculated with Staphylococcus aureus (positive control); Clostridium perfringens (positive control); S. epidermidis (negative control); Bt subsp. kurstaki strain WB3S16; Bt subsp. kurstaki strain HD-1; Bt subsp. thuringiensis strain HD-z and Bt subsp. kurstaki strain WB3S16 crystal- strains#5,#8, #9,#97,#18and#20(preparedasdescribedinSection2. 2). Plateswere incubated at 32"C f.or 24 hours, then flooded with saturated CuSO4 solution, drained and allowed to air dry. An insoluble blue-green copper soap around the edges of colonies was regarded as a positive result for phospholipase C. The presence of opalescence or a pearly layer around colony edges suggested the production of enzymes capable of hydrolysing fatty acids by the bacteria. Three replicate plates of each bacterial strain were tested.
S. aureus, S. epid,ermidis and C. perfringens weÍe kindly supplied by Dr Kathy Daly of the Institute of Medical and Veterinary Sciences, Adelaide, South Australia.
3. 3 REST]LTS:
3. 3. I ß-exotoxin
3. 3. 1. I Lucilia cuprina BioassaY
Table 3. 1 Percent Lucilia cuprina larval emergence on the bioassay diet.
Treatment 7o Larval Emergence Control (no supernatanQ 86.47o Bt subsp. kurstaki strainWB3S16 I007o Bt subsp. thuringiensis strain HD-2 74.8Vo
Table 3. 1 shows that86.47o,l}O.IVo,74.8Vo L. cuprina larval emergence was recorded on the control, Bt strain WB3SI6 and Bt strain HD-z diets respectively. Infertile eggs and/or handling damage may have reduced the percent larval emergence.
40 Bt Strain WB3S16 Toxins
The results summarised in Table 3. 2 revealed that over a 30 hour incubation period, supernatant from Bt strain HD-z, a strain known to produce high levels of ß-exotoxin, killed 9l.l7o of emerged L. cuprina fly larvae. Larvae on the Bt strain WB3S16 supernatant treatment exhibited OVo mortality over the same time period. Supernatant from the negative control (diet without supernatant) killed I.IVo of larvae. The t-test showed that the supernatant from strain HD-z caused significant larval mortality in comparison to the control (p<0.05). The supernatant of strain WB3S16 did not cause B. ovis mortality which was significantly different from that of the control (p>0.05).
3. 3. l. 2 HPLC Analysis for ß-exotoxin
The HPLC elution chromatograms are shown in Figures 3. I - 3. 5. The injection peak was evident between 2-4 minutes. Phosphoric acid standard dissolving solution did not produce an absorption peak (Figure 3. 1). The ß-exotoxin standard powder produced a ß-exotoxin peak at 7.22 minutes and a dephosphorylated peak at 11.82 minutes (Figure 3. 2). The sample dissolving solution produced a small peak at 2.91 minutes (Figure 3. 3). A similar peak was evident after the same time period in samples of Bt strain WB3S16 and Bt strain HD-z. Bt subsp. thuringiensis strain HD-z produced a ß-exotoxin peak at7.2O minutes and a dephosphorylated peak at 11.75 (Figure 3. 4), both of which were of greater concentration than the corresponding standard powder peaks. The supernatant of strain WB3SI6 did not produce a detectable ß-exotoxin peak (Figure 3. 5) compared to the the ß-exotoxin standa¡d and HD-2 positive control.
3. 3. 2 Phospholipase C
3. 3. 2. I Lecitho-vitellin Test for Phospholipase C
Results of the lecitho-vitellin test are shown in Figure 3. 6 and are summarised in Table 3. 3. All strains produced proteolytic clearing zones around the edges of bacterial colonies. S. aureus positive controls produced opalescence in the media and a blue-green salt following flooding with saturated CuSO4 solution. The C. perfringens positive controls produced a pearly layer around the edges of the colonies but no blue-green salt with saturated CuSO4. Bt strains WB3S16, HD-l, HD-2, the Bt crystal- strains #8, #9, #5, #97, #18 and #20 and the negative control S. epidermidis, did not produce detectable opalescence, pearly layer or blue- green salt when flooded with CuSO4.
4l Table 3. 2 The percentage mortality of Lucilia cuprina larvae exposed to supernatant from culture of Bt strains over a 30 hour incubation period.
Treatment Average Mean S. D. t-test value Vo Ìs'Iortality wB3516 l.l0 r.10 2.41 1.00
HD.2 91.10 91.08 59.38 22.42*
Control 0.00 0.00
t0.95(8) =1.86 (pS0.05 *) Bt Strain WB3S16 Toxins
ß-exotoxin Standard Dissolving Solution Blank
500
400
(a 300 ¡
X
E 200
100
0 0 10 20 30 40 50
time (min)
Figure 3. 1 HPLC chromatogram of ß-exotoxin standard dissolving solution (lM phosphoric acid pH 3.0).
42 Bt Strain WB3S16 Toxins
Beta-exotoxin Standard Powder
500
400
300 dl ca X
E 200
100
0 0 10 20 30 40 50
Time (min)
Figure 3. 2 HPLC chromatogram of ß-exotoxin standard powder (O.lmg/ml in lM phosphoric acid pH 3.0).
43 Bt Strain WB3S16 Toxins
Sample Dissolving Solution Blank
500
400
300 (a a
X
200 É
100
0 0 10 20 30 40 50
Time (min)
Figure 3. 3 HPLC chromatogram of sample dissolving solution (0.5M HZSO¿10.7M NaOH)
4 Bt Strain WB3S16 Toxins
Bt strain HD-2 - Positive Control
500
400
300 (a cI x
200 E
100
0 0 10 20 30 40 50
Time (min)
Figure 3. 4 HPLC chromatogram of the positive control ß-exotoxin producing Bt strain HD -2 supernatant.
45 Bt Strain WB3S16 Toxins
Bt strain \ry83s16
500
400
300 (a a
X
E 200
100
0 0 10 20 30 40 50
Time (min)
Figure 3. 5 HPLC chromatogram of Bt strain ÌWB3S16 supernatant.
46 Bt Strain WB3S16 Toxins
Figure 3. 6 Lecitho-vitellin test for production of phospholipase C showing bacterial colonies grown on lecitho-vitellin agar and flooded with saturated CuSO4 solution: a) Staphylococcus aureus positive control; b) Staphylococcus epidermidis negative control; c) Bt strain WB3S16. The presence of a blue-green soap around the edges of the S. aureus colony indicates a positive result (anow). a) Støphylococcus &ureus b) Staphylococcus epidermidis c) Bøcillus thuringiensis Positive control Negative control strain WB3S16 Bt Strain WB3SL6 Toxins
Tabte 3. 3 Lecitho-vitellin test of bacterial strains for production of phospholipase C.
BACTERIAL PROTEOLYTIC OPALESCENCE PEARLY BLUE.GREEN COLONY CLEARING INMEDIA LAYER SOAP WITH ZONE CuSO4
Staphylococcus oureus .H ++ +H
Staphybcoccus #+ epidermidis
C I o s t ri dium p e rfrin g e n s # +#
Bt subsp. kurstaki strain # wB3516
Bt subsp. kurstaki sÍ:un +# HD.1
Bt subsp. thuringiensis # strain HD-2
Bt strain 1WB3S16 crystal- mutant #8 +++ #9 +++ #5 +# #97 +++ #18 # #19 +++
Three replicate results a¡e shown for each characteristic assessed. + indicates a single positive result for a particular characteristic. - indicates a single negative result for a particular characteristic.
47 Bt Strain WB3S16 Toxins
3.4 DISCUSSION:
3. 4. I ß-exotoxin
The supernatant from the culture of Bt strain HD-z, a strain known to produce high levels of ß-exotoxin, was extremely toxic to larvae of L. cuprina. In contrast, the supernatant of Bt strain WB3S|6 was not toxic to larvae of L. cuprina. The control diet (no addition of bacterial culture supernatanÐ did not cause significant mortality of L. cuprina lawae. The results indicated that V/83S16 did not produce levels of ß-exotoxin sufficient to cause mortality of. L. cuprinalarvae under standard bioassay conditions.
Larvae reared on the Bt strain HD-z supernatant exhibited stunted growth typical of ß- exotoxin teratologies. The ß-exotoxin is known to interfere with the moulting process in dipteran la¡vae (Sebesta et a1.,1981) and is the likely cause of L. cuprina death which was observed only during pupal moulting. In contrast, larvae fed the Bt strain V/B3S16 supernatant diet were large and healtþ. These larvae may have benefited from nutrients in the bacterial supernatant as they exhibited less mortality than larvae fed the control diet.
The HPLC results complemented the findings of the L. cuprina larval bioassay. The Bt strain HD-z supernatant produced a large ß-exotoxin peak at 7.20 minutes which was comparable to that of the ß-exotoxin standard peak evident at 7.22 minutes. In addition, strain HD-2 produced a smaller peak at 11.41 minutes, conesponding to the dephosphorylated form of the ß-exotoxin. Dephosphorylated ß-exotoxin is not biologically active (Sebesta et al., 1981) and therefor thought not to be involved in insect mortality. Similar peaks atl or 11 minutes were not evident in the chromatogram of the WB3S16 supernatant. There was no evidence that strain WB3S16 produced amounts of ß-exotoxin or dephosphorylated ß-exotoxin detectable at the level of sensitivity used in this HPLC experiment.
In contrast to the results reported above, Campbell et al. (1987) observed a ß-exotoxin peak and a dephosphorylated peak at approximately 9 and 17.5 minutes respectively, with a column and mobile phase identical to those used in this experiment and Oehler et aI. (1982) observed a ß-exotoxin peak at 4 minutes using an identical column, 0.I7o tnfTuoroacetic acid as the mobile phase, a flow rate of 2mllminute and a 20¡tl sample loop. Discrepancies between peak retention times of the ß-exotoxin standard, the HD-2 strain ß-exotoxin and dephosphorylated exotoxin reported in this study and those reported by other researchers may be due to variables such as pH, flow rate, column dimensions and solvent concentration. Campbell et aI. (1987) reported that the ionic form of the ß-exotoxin was very sensitive to pH changes and variation of solvent pH by +/- I unit significantly effected ß-exotoxin peak
48 Bt Strain WB3SL6 Toxins retention time. However, these authors showed that peak retention time was unaffected by solvent concentration and temperature variations in a range between 2O-25'C.
3. 4. 2 Phospholipase C
The blue-green soap, evident around the edges of the S. aureus colony, was a positive result for phospholipase. Similar colouration was not evident around the colony edges of the ^S. epidermidi.s negative control or any of the Bt strains. There was no evidence that WB3S 16 and its crystal- derivatives produced detectable levels of phospholipase C. Oligonucleotide probes designed to amplify putative PC-PLC (Johansen et al., 1988; Gilmore et al., 1989) and PI-PLC (Henner et aI., 1988; Lechner et aI., 1989) genes could be used to confirm the IWB3S16 presence or absence of these genes in the genome of strain and the crystal- strains in future experiments
The C. perfringens used in this experiment was the only strain of bacteria which produced a pearly layer. As shown by these results, the ability of a bacterium to produce opacity on LV agar is useful in the division of the genera of. Bacillus from Clostridium species. The proteolytic clearing zone evident at the edges of all the Bt colonies was not regarded as a positive result for phospholipase C and suggested that the bacterial strains produced aggressive proteases. A Bt 1-exotoxin reported by Heimpel (1967), which cleared egg-yolk agar, may be produced by Bt strain WB3S16 and the corresponding crystal- strains derived from this strain. Very little is known about the nature of the 1-exotoxin and further investigations are necessary to confirm the involvement of this toxin in lousicidal toxicity.
3. 4. 3 General Discussion
The above results showed that the louse toxic Bt strain WB3S16 did not produce detectable levels of ß-exotoxin or phospholipase C. Thus, mortality of B. ovis fed Bt strain WB3S16 is not due to these toxins and may be attributed to an unidentified louse-active toxin, which may or may not be the "louse factor" described by Dulmage (1981). A number of other insecticidal Bt toxins have been reported, including the y-exotoxin, labile toxin, mouse factor, haemolysins and a variety of antibiotics and other enzymes (Section 1. 4). The effect of these toxic factors on a wide number of insect species, including the phthiraptera, has not been studied to date. The possibitity that these toxins contribute to the toxicity of Bt strain IWB3S16 to B. ovis requires further investigation. Further studies on the nature of the strain WB3SI6louse toxin are described in subsequent chapters.
49
Louse Toxin Investigations
CHAPTER 4
Preliminary Investigations on the Louse Factor
4. I INTRODUCTION:
The louse toxic factor produced by Bt strain 1VB3SI6 which is effective against B. ovis, has not been identified and its mode of action against phthirapteran species has not been investigated. The results of Chapter 3 revealed that toxicity of this strain to B. ovis was not due to the ß-exotoxin nor phosphoplipase C. Prior to the present study, it was not known with which cell fractions the toxin associates, nor whether the mode of action against B. ovis involved multiple toxins or synergism between several toxic factors. Repeatable production of toxic Bt preparations is difficult to achieve as synthesis of the louse toxin by the Bt cell is poorly understood.
4. l. I Toxicity of Bt Culture Fractions to B. ovis
pinnock and Drummond (1992) suggested that the louse factor is a novel toxin which may be membrane bound and bio-activated in the midgut of B. ovis. V/hen fed to B. ovis, Bt strain WB3S16 induced effects which were similar to those caused by the ð-endotoxin in susceptible lepidopteran and coleopteran insects and Hill and Pinnock (1998) suggested that the toxin may have a mode of action similar to that of the â-endotoxin crystals in susceptible larvae' However, it is unlikely that the crystal is responsible for these effects as the louse gut environment is not conducive to crystal dissolution and activation (Hill, L992). The experiments of Hoffman and Gingrich (1968) also showed that the â-endotoxin crystal was not responsible for the toxicity of Bt to f.ottr Bovicolø species.
Luthy et al. (1970) separated homogenised Bt cells into a variety of fractions by fractional centrifugation. The authors found ð-endotoxin protein in vegetative Bt cell extracts and possibly in association with the cell membranes and concluded that Bt produces ð-endotoxin protein not only during sporulation, but also during the vegetative growth phase.
A variety of procedures have been reported for the separation and purification of spores and crystals from Bt and have been summarised by Cooksey (1971). These methods exploited differences in the surface properties and solubility benveen spores and crystals in addition to
50 Louse Toxin Investigations
the germination and lysis of spores (Sharpe et al., 1975). Foam flotation procedures (Sharpe et aI., 1979) and diphasic systems using organic solvents or high molecular weight polymers (Goodman et aI., 1967) are unpopular as multiple separations may be required to achieve purity of the separated fraction and crystals may be affected by the solvents used.
Slight differences between the buoyant densities of spores and crystals can be exploited to separate spores and crystals by centrifugation. The density of spores and crystals depends on the subspecies of Bt (Milne et al., 1977) and can be affected by the material used to generate centrifugation gradients (Milne et al., 1977 Ang and Nickerson, 1978). Fast (1972) reported the buoyant density of spores and crystals from a coÍImercial preparation of Bt were 1.35 and 1.30 respectively in cesium chloride gradients and 1.40 and l.l2 in potassium tartrate gradients. Spores and crystals have been separated ispycnically using CsCl (Fast, 1972), sodium bromide (Ang and Nickerson,1978); Renograffin (Sharpe et aI., I975; Milne et aI., lg77) and ludox density gradients (Zhu et aI., 1989) to isolate pure â-endotoxin fractions. More recently, Thomas and Ellar (1933) and Knowles and Ella¡ (1986) purified ð-endotoxin crystals by ultracentrifugation on discontinuous sucrose gradients and reported that crystals formed a major band at the interface of the 67 Vo and 87 Vo (w lv) sucrose.
Dissolution of the crystal and release of soluble protoxin has been achieved using alkaline solutions (pH>10.5) with or without reducing agents such as thiol (Fast, 1981; Bietlot et al., 1990) and gut juice enzymes (Ogiwara et aI., 1992) or exogenous proteases, one of the most widely used being trypsin (Bietlot et al., 1989). The effects of dissolution vary depending on the nature of the ð-endotoxin crystal and the method of dissolution. The challenge is to generate toxic peptides from the protoxin without affecting their biological activity. The proteolysis of Bt crystal proteins has been reviewed by Fast (1981). The method of Fast and Milne (1979) permits crystal dissolution with retention of toxicity as it minimises the hydrolysis of crystal protein peptide bonds. Using this method the ð-endotoxin crystals are incubated at37'C for t hr in a 0.lM MOPS (morpholinopropanesulfonic acid) buffer; 0.05M DTT (dithiothreitol); lM KSCN (potassium thiocyanate) solution at pH 7.8.
4. 2. 2 Sequential Harvest Experiment
Preliminary studies indicated that the Bt strain WB3S16 louse toxin is produced at time of sporulation and is released when the cell lyses (Drummond, pers comm.). The toxic activity of Bt strain WB3S16 to B. ovis is relatively low in shake flask cultures, but can be increased by culture i¡ a20L laboratory fermenter under optimal growth conditions. The limited levels
51 Louse Toxin Investigations of dissolved oxygen and high pH achieved in shake flask cultures may suppress louse toxin production under those growth conditions.
Synchronised Bt cultures are commonly harvested at 907o lysis (García-Patrone and Tandecarz, 1995; Cooper, pers comm.) to obtain maximum spore and crystal numbers' preliminary investigations revealed that the Bt strain WB3S16 louse toxin was rapidly degraded in the bacterial culture following fermentation and this finding lead to the initial speculation that the louse toxin was proteinaceous. Consequently, the Bt culture was harvested at5OVo lysis to achieve manimum toxin production and minimum toxin degradation (Drummond, pers comm.).
The stages of Bt growth have been summarised in Section l. 3. 11 and are; a logarithmic phase of rapid vegetative growth, a transition phase involving shiftdown and commitment of the cell to sporulation and sporulation of the cell to release the spore and ð-endotoxin crystal. The formation of the ð-endotoxin is linked to sporulation of the bacterium (Young and Fitz- James, 1959). The crystal first appears as a minute granule near the forespore, enlarges as the spore develops and reaches its full size as the spore becomes mature (Young and Fitz-James, 1959). Bechtel and Bulla (1976) reported the sequence of spore (stages I to VII) and parasporal crystal development in Bt subsp. kurstaki strain HD-l. ð-endotoxin crystal protein production may be fortuitously coincident with sporulation or may accumulate as a result of unregulated spore protein synthesis (Delafield et s1.,1968; Somerville et a\.,1968).
In the present study, the Bt culture was fractionated and fed to B. ovis in bioassays to study association of the louse toxin with components of the fermentation product. The phases of strain WB3S16 growth were monitored during fermentation in a Chemap@ laboratory fermenter to determine whether this strain exhibited unusual metabolism indicative of novel toxin production compared to other Bt strains. Aliquots of the culture were harvested at intervals to investigate association of the louse toxic factor with various stages of cell development. Bt preparation treated with a protease enzyme was tested for toxicity to B. ovis in an experiment to examine the possibility of the louse toxin being proteinaceous in nature.
52 Louse Toxin Investigations
4. 2 MATERIALS AND METHODS:
4. 2. I Toxicity of Bt Culture Fractions to B. ovis
4. 2. L 1 Production of Bt Strain WB3S16 Culture
A "clean" Bt preparation, free of particulate matter and contaminating factors which could give false toxicity results in bioassays, was required for this experiment. For this reason, Bt srrain V/83S16 was cultured in 100m1 5156 media (Sakharova et aI., 1984) in 400m1 Erlenmeyer baffled shake flasks, according to the method detailed in Section 2. 3. 1. 1L of culture was prepared in total and pooled prior to harvest. The phases of growth of the culture were monitored by aseptically removing small aliquots of culture, diluting the culture by I:2O in sterile RO water and recording the percentage of vegetative cells, endospores and free spores using a Petroff Hauser counting chamber. The culture was sampled routinely to check for microbial contamination and harvested at 507o lysis. The culture was centrifuged at 15, 000xg for 2O minutes to separate cellular material from the supernatant. The pellet was washed three times with sterile Type trI RO water and lyophilised at 10-3 Ton and -25'C for 4 hours. 500m1 of the supernatant was shell frozen in glass cylinders using liquid nitrogen and lyophilised under the same conditions. The lyophilised supernatant and pellet were ground separately to a fine powder using a mortar and pestle and then stored at -80'C and 07oRH.
4. 2. l. 2 Separation of Spores and Crystals
Spores and crystals were separated from each other and from cellular debris using sucrose density gradients as described in SectionZ. 4. 3. This procedure was repeated several times to obtain approximately 1-2mg of purified crystals or spores. The purity of the spore and crystal fraction was determined by assessing 7o contanination with either spores or crystals using a Petroff-Hauser counting chamber. The amount of Modified Lowry Protein (MLP) in the crystal or spore fractions was determined using the method described in Section 2. 5.
A solution of purified crystal protein was prepared by dissolving 120¡tg of purified MLP crystals in 120p1 dissolving buffer using the method detailed in Section 2. 6. Dissolving buffer was then removed from the crystal protein solution by dialysis against three washes of 100p1 sterile Type Itr RO water in 30, 000 MW cut-off Millipore Ultra-free MC filter units. The crystal protein pellet was centrifuged in a microcentrifuge at 11,000xg for 2 minutes, lyophilised as described above and stored at -80'C and 07oRH.
53 Louse Toxin Investigations
4. 2. 1. 3 SeParationof BtMembranes
Cell membranes were separated from the cellular debris using Percoll@ isopycnic centrifugation gradients as described in Section 2. 4. 1. The membranes were dialysed against three changes of 100p1 sterile Type III RO water in Millipore filter units and centrifuged in a microcentrifuge at 11,000xg for 2 minutes to collect a pellet which was lyophitised as described above. The concentration of MLP was determined using the method detailed in Section 2. 5.
4. 2. l. 4 Application of Treatments in Bioassays
20pg MLP aliquots of the purified spores, crystals, dissolved crystals, membranes and supernatant fractions and the shake flask powder (equivalent to 30pg crystal protein, shake flask powder or supernatant) were obtained by resuspending lyophilised pellets in sterile Type Itr RO water. These aliquots were diluted to a final volume of 100p1 in sterile Type III RO water and applied to 2.5mg skin diet in wells of Falcon@ MultiwellrM Tissue-Culture plates, using the bioassay method described in Section 2. 8. The treatments were replicated six times and 60 adult B. oyis were exposed in total to each treatment. Negative controls were used to determine the lousicidal toxicity of the Percoll@, sucrose and dissolving buffer residues associated with the respective treatments. 100p1 aliquots of washings collected from the dialysis of the spores, crystals, dissolved crystals and membranes against sterile Type III RO water, were applied to each bioassay well. Four replicates (4O B. ovis in total) were made for each control. The sterile Type III RO water and sheep skin diet negative control was established by applying 100p1 aliquots of sterile Type Itr RO water to skin diet. Following addition of treatments and controls, all bioassay plates were lyophilised for 4 hours at -25'C and 10-3 Torr to ensure that the louse diet was completely dry prior to the addition of B. ovis.
The bioassay plates were incubated for 72 hours atTOToR.ÍI and 34'C (Section 2. 8). Percent B. ovis mortality for each treatment was recorded at24,36,48,60 and 72 hours. The toxicity of the various fractions was statistically analysed by comparison to the respective controls using a t-test at the 957o conftdence level.
54 Louse Toxin Investigations
4. 2. 2 Protease ExPeriment
4. 2. 2. 1 Production ofBtPreparation
Bt strain WB3S16 was cultured on supplemented Nutrient Broth for 15.5 hours in a Chemap@ 20L laboratory fermenter as described in Section 2. 3. 2 to obtain optimal toxin production for use in this experiment (fermenter Run #32t). The LC5O value of the powder was 14.3pg as determined by the probit analysis method of Finney (1971). A normal distribution of B. ovls response to the treatments was assumed and probit analysis gave a satisfactory fit to the data.
Proteinase K Stock Solution
lmg of Proteinase K (Sigma) lyophilised powder was dissolved in 50pl of sterile RO water and stored at -20"C according to the method of Sarnbrook et aI. (1989).
Reaction Buffer (Sambrook et a1.,1989)
SDS 17.3mM EDTA 5mM Tris.Cl (pH 7.8) 1OmM
25¡tl ofproteinase K stock solution (equivalent to 500pg proteinase K powder) was added to lOml reaction buffer to achieve a final concentration of 57o wlv enzyme (2Ulml).
4. 2. 2. 2 Proteinase K BioassaY
The amount of Bt powder applied in this bioassay was reduced to 300pg to achieve maximum dialysis with the Millipore filter units. Pilot studies revealed that optimal dialysis was achieved with 300pg or less of the Bt preparation as the pores in the cellulose membranes of the filter units rapidly became blocked with the particulate Bt preparation during centrifugation. A preliminary bioassay indicated that 300pg of fermenter Run #321 powder equivalent to 80¡rg MLP, caused approximately 50Vo mortality of. B. ovis after 24 hours. The toxicity of the Run #321 Bt powder used in this experiment was lower than that for the same powder tested immediately following its production, due to degradation of the louse toxin over time. 300pg samples of Bt powder suspended in 100p1 of sterile Type III RO water, were incubated either in 88.4p1 of reaction buffer containing proteinase K enzyme (pH 7.5) at a ratio of 2:l protease enzyme to MLP crystal protein or in 88.4¡rl of reaction buffer (pH 7.5)
55 Louse Toxin Investigations
alone for 30 minutes at37"C. The Bt powder suspensions were dialysed against three washes of l00pl sterile Type trI RO water in Millipore filter units by centrifugation at 11, 000xg for 2 minutes, following which, the pellet was resuspended in 100p1 of sterile Type Itr RO water. 88.4 pl of reaction buffer plus proteinase K was heated for 30 minutes at 37"C and dialysed against three l00pl washes of sterile Type trI RO water as above. l00pl aliquots of the third wash from the Millipore filter units were collected as negative controls. Test solutions and controls were applied to 2.5mg of skin diet in wells of Falcon@ MultiwellrM Tissue-Culture plates as described in Section 2. 8. 3.
The bioassay plates were covered with perforated alfoil and lyophilised for 4 hours to ensure the diet was desiccated prior to addition of B. ovis. Each treatment was replicated 6 times and bioassay plates were incubated according to the standard method at 37'C and 707oRH. Mortality was assessed at 14.5 hours and24 hours and the toxicity of both the WB3S16 powder and the proteinase K treated Bt powder were statistically analysed by comparison to respective controls using a t-test at the 95Vo confidence level.
4. 2. 2. 3 Proteinase K Degradation Gel
Aliquots of each of the above treatments were run on an SDS-PAGE gel to verify proteolytic degradation of the Bt proteins by proteinase K. 75¡rg MLP of Bt powder (in 4pl of dissolving buffer; reaction buffer plus proteinase K or reaction buffer alone) was applied to wells of Bio- Rad Mini-PROTEAN@ II4-20Er polyacrylamide gradient Ready gels, according to the method detailed in Section 2. 9. Gels were run against a Kaleidescope Pre-stained MW standard. In each case, 4pl of sample was picked up in 20pl of gel loading buffer and loaded in one gel lane.
4. 2. 3 Sequential Harvest Experiment
The fermentation Run #321 was sampled every hour by removing l0ml aliquots which were diluted 1/20 with sterile RO water. A Petroff-Hauser counting chamber was used to determine the percent of vegetative cells, endospores and free spores of the samples. The opticat density of the culture was also monitored spectrophotometrically by measuring the absorbance of lml of the samples against a blank of supplemented media at 660nm. 200m1 of culture was removed from the fermenter at 4 hours, t hours and 12 hours post inoculation, corresponding to the different stages of the Bt sporogenesis and growth cycle as indicated below in Table 4. 1. The fermentation was terminated at 15.5 hours, when 50Vo of the cells had lysed. Harvests I to 4 were centrifuged separately to collect the cellular particulate matter, which was lyophilised and ground to a powder (Section 2. 3. 3). 200m1 of the
56 Louse Toxin Investigations
supernatant from each harvest was also lyophilised and ground to a powder by the same method.
Tabte 4. 1 Sampling of Bt strain WB3S16 growth stages from fermentation Run #321'
Harvest Sample time Stage of Bt growth Stage of spore post inoculation development* I 4 hours Vegetative cells I-tr II t hours Cells with spore initials m-v III 12 hours Mature cells with VI-Vtr endospores and crystals IV 15 hours 507o cell lysis
* Roman numerals correspond to the stages of spore development described by Lecadet and Dedonder (197L) and Bechtel and Bulla (1976). / 500pg of the cellular particulate powder and 200pg of supernatant powder from each .k ^ut{", harvest (equivalent to l00ug MLP) were incorporated with l0mg skin diet in bioassay plates as described in Section 2. 8. 3. Six replicates were made of each treatment and l0 B. ovis were added to each well so that a total of 60 lice were exposed to each treatment. The plates were incubated at 34'C and TOToF.Lland the percent mortality was recorded after 24 hours and 36 hours. The toxicity of the various particulate matter and supernatant harvests to B. ovis were statistically analysed by comparison to the skin diet control using a t-test at the 95Vo confidence level.
To minimise particulate matter and non-bacterial protein in harvest samples, Bt strain WB3S16 was also cultured under simila¡ conditions in a shake flask as detailed in Section 2. 3. 1. Harvests were collected as described above after 5 hours, 11 hours, 12 hours, 13.5 hours and 35 hours, as indicated in Table 4. 2. The stages of Bt growth sampled were the same as those collected from the fermenter (Table 4. l). An additional sample was taken at 5 hours which represented a pre-logarithmic Bt growth stage. 75pg of MLP shake flask powder protein from each of these stages was run on a Bio-Rad 4-20Vo Mini-PROTEAN@ II polyacrylamide gradient Ready gel against a Kaleidescope Pre-stained MW standard as described in Section 2. 9 to assess protein banding patterns.
57 Louse Toxin Investigations
Table 4. 2 Sampling of Bt strain WB3S16 growth stages from a shake flask culture.
Harvest Sample time Stage of Bt growth Stage of spore post inoculation development* I 5 hours Vegetative cells (pre- I-II logarithmic) II 11 hours Vegetative cells I-II III 12 hours Cells with spore initials ru-v ry 13. 5 hours Mature cells with endospores and VI.VII crystals v 35.5 hours 507o Cell lysis
* Roman numerals correspond to the stages of spore development discussed by Lecadet and Dedonder (1971) and Bechtel and Bulla (1976).
4.3 RESULTS:
4. 3. I Toxicity of Bt Culture Fractions to B. ovis.
Light microscope analysis showed that the spore and crystal fractions separated on sucrose density gradients were greater than 98Vo free of either contaminating crystals or spores, and this method was extremely successful for separating highly purified fractions of Bt strain WB3S16 spores and crystals.
The t-test showed that 20pg MLP of shake flask powder (comprised of spores, crystals and lysed cellular material) was significantly toxic to B. ovis compared to the skin diet control (p<0.05), causing I5Vo mortality after 72 hours (Table 4. 3). The t-test showed that the supernatant and bacterial membrane fractions were significantly toxic to B. ovis after 48.5 hours (P<0.05) and were the most highty louse toxic fractions compared to the Percoll@ and water controls, causing 4O.OVo and33.3Vo mortality of. B. ovis, respectively after 72 hours. The t-test also showed that whole crystals were not significantly toxic but dissolved crystals were significantly toxic to B. ovis compared to the sucrose and dissolving buffer controls (P>0.05) after 60 and 72 hours, and these treatments caused 8.3Vo and 2l.7%o mortality respectively, after 72 hours. Purified Bt spores were not significantly toxic to B. ovis compared to the sucrose control at 72 hours (p>0.05). However, microscopic examination of
58 Table 4. 3 Toxicity of Bt Stain WB3S 16 Culture Fractions to B. ov¿s'
24.5 hours 36 hours 485 hours 60 hours 72 hours
Ãv.% Pop' l¡v.7o Pop. i¡v. Vo Pop. l¡v. Vo Pop' lw. Vo Pop. Mort- sr. t-test Mort- st. þtest Mort- sr. t-test Mort- st. t-test Mort- st. t-test al¡ty I)ev Value ality Dev Value Ðlitv I)ev Vslue d¡tv Dev Velue slitv Dev Value
0.084 1.92r Shakeflask 33 0.075 o.2t6 llJ 0.091 0.99 tt.7 0.091 0.99 tt.7 0.091 0.99 l5 Powder
7S 0.025 Skin 2S 0.043 7S 0.025 7S 0.025 7S 0-025 Control
o.224 o.922 Spores 33 0.04 t.532 5 0.07r 0.832 6.6 0.096 0.469 9.8 o.tt2 0.504 2t
0.304 Crystals 5 0.ür 0.832 t3 o.o97 0.004 83 0.097 0.067 83 o.o97 0.305 t3 0.097
10 0.058 Sucrose a3 0.07 8.7 0.07 7.t 0.07 10 0.058 Control
2.U|7+ 0.1 l7 2.23t+ Dissolved ltl 0.091 1.499 15 0.1u2 0.(X9 15 0.081 2.474+ 16.7 0.095 2ti Crystrls
10 0 Dissolving 5 0.041 5 0.048 5 0.041 7 0.025 Solution Control
0.082 5.2t7' Membrancs 1.7 0.037 2.W2 t3 o.ul4 0.238 133 0.052 2-27+ 233 0.103 3.331r 333
0.058 Percoll 7S 0.025 7S o.m5 61 0.025 7S 0.t25 10 Control
2.758+ Sùp€rnatrnt 13:l 0.056 3.429t 16.4 O.UI2 3.705r 183 0.25 1.9* 30 0.179 f .u7+ 40 o.253
7S o.oit4 Wster ta 0.043 2S 0.043 5 0.041 5 0.041 Control
replicate teatments. The standa¡d deviation is expressed ¿¡s a percentage of the total louse population. Results are an average of six
The t-test results indicate statistically significant differences between the treatments and the respective controls.
t0.95(10)= 1.812. 'p < o.os Louse Toxin Investigations
insect cadavers, showed that Bt spores germinated in the gut of the insect after 72 hours. 20pg MLP doses of dissolved crystals, membranes and supernatant caused higher toxicity levels than the shake flask powder from which they were derived. This bioassay was rejected after 72 hours when the mortality of B. ovis on the Percoll@, ,octot", dissolving buffer and water negative controls exceeded tOVo.
4. 3. 2 Protease ExPeriment
The results of the protease experiment (Tabte 4. 4) were analysed at 24 hours as the skin diet control mortality equaled I07o at this time. The t-test showed that the Bt strain V/B3S16 powder which caused an average of 47.57o mortality after 24 hours, was significantly toxic to B. ovis compared to the skin diet control (p<0.05). The proteinase K enzyme in reaction buffer negative control was highly toxic to B. ovis, causing an average of 45.0Vo mortality and the toxicity of the Bt powder was not significantly different from this control (p>0.05). There was no significant difference between the 53.37o B. ovis mortality caused by the Bt powder in reaction buffer positive control compared to that of the Bt powder alone (p>0.05). Treatment with proteinase K in reaction buffer significantly reduced the mortality caused by the Bt powder to 28.6Vo compared to the corresponding reaction bufferþroteinase K negative control (pS0.05). It was not possible to test the toxicity of the proteinase K enzyme alone because the enzyme was inactive in the absence of reaction buffer.
The SDS-PAGE gel revealed that the Bt strain WB3S16 preparation contained a large number of proteins (Figure 4. 1). Two major bands were evident at 140kDa and 70kDa. These proteins are discussed in Chapters 5, 6 and 7 and may be the constituent proteins of the Bt crystal. When the Bt preparation was dissolved, the majority of the large molecular weight proteins were degraded. However, a strong band was evident at 70kDa which was resistant to further dissolution (Lane l). When the Bt preparation was incubated with reaction buffer containing proteinase K enzyme with and without prior dissolution (Lanes 3 and 4 respectively), the majority of proteins contained within the preparation were degraded. However, in both lanes, two major bands of 70kDa and 37kDa molecular weights, were partially resistant to enzymic degradation. A band of 37kDa was evident in the lane 5 corresponding to the proteinase K in reaction buffer.
4. 3. 3 Sequential Harvest Experiment
SDS PAGE revealed that the protein profile from prelogarithmic Bt cells at 5 hours showed a high concentration of protein bands ranging in size from approximately 110kDa to 7.5kDa and was different to that from all other harvest stages (Figure 4. 2). Some of these proteins
59 proteinase K Tabte 4. 4 Toxicity to B. ovis of Bt strain \ry83s16 fermentation product treated with
14.5 hours 24 hours
Ãv.7o Pop. !tv.7o PoP. Mortality SL Dev Mortality St" Dev
Bt 283 0.214 47.5 0.t4
Bt/Reaction Buffer/ 143 0.095 2E.6 0.175 Proteinase K
BlReaction Buffer 26.7 0.197 s3.3 0.234 Control
Reaction Buffer/ 25 0.103 45 0.138 Proteinase K
Skin Control 5.2 0.084 10 0.095
an average of six replicate treatments' The standa¡d deviation is expressed as a percentage of the total louse population. Results are
t-test values for 24 hour results:
Bt vs skin control=2.490*
Bt vs Bt/reaction buffer=0.996
Bt vs reaction buffer/proteinase K{.128
Bt/reaction buffer/proteinase K vs reaction bufferþroteinase K control=9.106* * (t0.95(10)=1.812, P s 0.05) Louse Toxin Investigations
Figure 4. I SDS-PAGE of Bt strain WB3S16 fermentation Run #321 powder treated with proteinase K to degrade the proteins contained within the preparation. Lane: 1, Bio-Rad Kaleidescope Pre-stained MW standard; 2,3}0¡tg Bt in dissolving buffer; 3, 300pg Bt; 4, 300¡rg Bt dissolved in dissolving buffer and incubated in reaction buffer with proteinase K; 5, 300pg Bt in reaction buffer and proteinase K. kDa I 2 3 4 5
203
135
E1
44
32
t7 Louse Toxin Investigations
Fígure 4. 2 SDS-PAGE of sequentially harvested Bt strain V/B3SI6 shake flask culture. Lane: 1, Bio-Rad Kaleidoscope Pre-stained MW standard. Bt strain WB3S16 culture harvested at:- Lane: 2, 5 hours; 3, 11 hours;4,12 hours; 5, 13.5 hours; 6, 35.5 hours. kDa I 2 3 456 201 t- r3s
81
44
32 t7 Louse Toxin Investigations
were present at lower concentrations in the profiles from the remaining harvests. Several major protein bands, in particular a 110kDa protein and a 50kDa protein, were unique to the 5 hour ha¡vest. 140kDa and 70kDa proteins were evident in all harvest fractions and increased in concentration with maturation of the culture up to 35.5 hours.
Figure 4. 3 showed that the number of vegetative cells increased post inoculation over the duration of the culture, plateaued between 6-8 hours and then decreased. Endospores (mature and immature spores contained within the Bt cell) were not evident in the culture until 8 hours post inoculation. The number of endospores the culture increased between 8 and l1 hours, plateaued at 11 hours and began to decrease after 14 hours. There was a lag time of approximately one hour between the appearance of endospores and that of free spores (mature spores released from lysed Bt cells to the culture medium) at t hours, after which the number of free spores gradually increased, reaching a maximum at 15.5 hours. The culture was harvested after 15.5 hours, corresponding to a stage of 5OVo lysis when the number of endospores and free spores in the culture was approximately equal.
The culture exhibited an exponential increase in optical density from time of inoculation up to 6 hours (Figure 4. 4). The optical density of the culture decreased steeply between 6 and 7 hours and remained relatively constant after this time, fluctuating between 0.1 - 0.15 absorbance units at 660nm until harvest of the culture.
Particulate matter harvest fV was significantly toxic to B. ovis (p<0.05) and caused 60-O7o mortality after 24 hours (Table 4. 5). Over the same time, only the supernatant fraction from harvests II and III were significantly toxic to B. ovis (p<0.05), causing 25.9Vo and I7.5 Vo mortality, respectively. After 36 hours, the particulate matter from all harvests was significantly toxic to B. ovis (pS0.05). As the culture matured, the toxicity of particulate fractions increased and harvest IV was the most louse toxic fraction, causing 90.0Vo mortality. At 36 hours, the supernatant from harvest I was not significantly toxic to B. ovis (p>0.05). However, supernatant from harvests II, Itr and IV were significantly toxic to B. ovis (p<0.05). The t hour supernatant harvest was the most louse toxic and caused St%o moftality of B. ovis. However, lousicidal toxicity of the 12 and 15 hour harvests decreased to 42.IVo and22.47o B. ovis mortality, respectivelY.
60 Louse Toxin Investigations
10
IA (¡) ¡i o È u) (¡) I o) tu, at !) L o u) È Þ Log veg cells o + E Log endospore tr + f¡l -+ Log free spore ,t I(¡) 4 è¡ o)
zd 2 è¡ Fl 0 0 10 20
Time (hours)
Figure 4. 3 Log Bt strain WB3S16 vegetative cell, endospore and free spore count versus time post inoculation of fermenter Run #321. Louse Toxin Investigations
0.500
0.400
E 0.300 \o \o 6l It9 E cl 0.200 ¡L o ¡U2
0.100
0.000 0 10 20
Time post inoculation (hours)
Figure 4. 4 Optical density of Bt strain WB3S16 culture versus time post inoculation of fermenter Run 321. Table 4. 5 Toxicity of fermenter Run # 321 sequentially harvested Bt strain WB3S 16 cellular particulate matter and supernatant fractions to B. ovis.
Particulate Matter Supernatant
Ãv. Vo Pop. t-test v. Vo Pop. t-test St. Dev. Value St. Dev Value
24 hours
HarvestI-5hours 0.084 0 6.8 0.321 1.493
HarvestII-9hours 0.075 0.873 25.9 o.307 3.145'
Harvest III - 12 hours 11.67 0.075 1.746 .5 0.351 2.840'
1.479 Harvest fV - 15 hours 60 0.089 5.305* .2 0.312
Skln control t 0.1 0
36 hours
Harvestl-5hours 0.133 2.060+ 9.3 o.2n 1.04
HarvestII-thours 0.173 6.009* 0.287 2.840'
Harvest III - 12 hours 4lJ 0.098 6.739* o.tn 3.124',
Harvest IV - 15 hours 0.089 17.889* x2.4 0.339 2.750',
Ski¡ Control 0.1 15 4 0.082
teatments. The Søndard Deviation is expressed as a percentage of the total louse population. Results are an average of six replicate
The t-test results indicaæ statistically significant differences between treaEnents and respective controls.
* t0.95(8)= 1.860 P10.05 Louse Toxin Investigations
4. 4 DISCUSSION:
4. 4. I Toxicity of Bt Culture Fractions to B' ovis
Experiments to test the toxicity of Bt supernatant, cell membranes, crystal protein and spore fractions against a phthirapteran species have not been undertaken prior to the present study, and methods to isolate and bioassay these fractions against B. ovis had not been previously established. As discussed below, unavoidable assumptions were made in the fraction toxicity experiment, which served as a pilot study and formed the basis for the design of subsequent fraction bioassaYs.
The amount of material applied in treatments was standardised by measuring the amount of Modified Lowry Protein (Nfl-P) contained within the supernatant, membrane, entire crystal, dissolved crystal and spore fractions. This method allowed comparison between the toxicity of cellula¡ particulate and liquid fractions. However, it did not account for the possibility that the louse toxin is non-proteinaceous nor for the likelihood that the factor(s) responsible for the toxicity of each of the Bt fractions to B. ovis may not be identical. Levels of protein and non- protein louse toxin(s) in the five fractions could be unrelated although this may be unlikely as B. ovis exhibited a graded dose response to MLP supernatant, membrane and dissolved crystal protein treatments (data not shown).
Although the densities of Bt strain WB3S16 spores and crystals were not calculated in this study, differences in the densities of these two fractions were exploited to enable separation of crystals from spores using sucrose density gradients. Following centrifugation, as reported by Knowles and Ellar (1986), the crystals formed a layer between the 66Vo and 677ovlv sucrose solutions and were easily removed. The spores which were of greater denisty than the ð- endotoxin crystals, formed a pellet at the bottom of the tube. The resulting spore and crystal fractions were less than 27o contaminated with crystals or spores. The sucrose density gradient crystal separation technique compared favourably with that of Milne et aI. (1977); Sharpe et at. (1979) and Zhu et aI. (1989) and those summarised by Cooksey (1971), in which the crystal fraction was between 0.0006-77o coîtaninated with spores and those of Pendelton and Morrison, (1966); Milne et al. (1977) and Sharpe et aI. (1979), in which spore fractions were 96-10O7o ftee of contaminating crystals.
Low yields of purified crystals (approximately 2O-4OVo) are generally achieved using traditional spore/ð-endotoxin crystal separation techniques (Cooksey, l97I). The yield of crystals varied between 2O.8Vo and 4I.6Vo in this study. The culture fraction experiment was limited by the yield of crystals which could be obtained using sucrose density gradients.
61 Louse Toxin Investigations
Therefor, for comparative purposes, the bioassay was standardised by the application of 20¡tg of MLP to all treatments
Between 3l.25¡tg and 500pg of Bt shake flask or fermentation powder was commonly applied to B. ovis bioassays to determine the LC5g value of the preparation (Drummond, pers comm.). Assuming crystal protein accounts for approximately 3O7o of the dry weight of the Bt cell (Norris, IgTl) and disregarding the contribution of culture ingredients to the final weight of the lyophilised preparation, crystal protein could represent a maximum of between 9.4¡tg to l50pg of the total weight of the Bt preparation applied to a bioassay. Spectrophotometric analysis revealed that MLP represented approximately two-thirds of the total weight of the WB3S16 crystal proteins (data not shown). 20¡tg of MLP would therefor represent approximately 30pg of WB3S16 crystal proteins, which equates to 100pg of shake flask powder. Therefor, the amount of crystals applied in the culture fraction bioassay was within the range of the amount of crystal protein applied in (in [tg) to a standard bioassay' However, 20pg MLP shake flask powder was equivalent to 30pg of shake flask powder and consequently, the amount of shake flask powder applied in this bioassay was less than that applied in a standard Bt bioassay. In addition, sub-optimal shake flask fermentation conditions result in lower levels of louse toxin production in shake flask culture compared to that in a laboratory fermenter. A combination of these factors may explain the low level of shake flask powder toxicity to B. ovis (l5flo mortality after 72 hours).
The fraction experiment (Table 4. 3) confirmed that entire crystals were not responsible for mortality of B. ovis fed Bt strain V/83S16. This result complemented pH and redox investigations made by Hill (1992) which revealed that the B. ovis midgut is neutral and slightly oxidising, an environment which is not conducive to dissolution of the Bt ð- endotoxins and was in agreement with the findings of Hoffman and Gingrich (1968). In comparison, the dissolved crystal preparation was significantly toxic to B. ovis after 72 hours. This result indicated that dissolved crystal protein can act as a toxin against B. ovis even though lice a¡e apparently unable to process the intact Bt crystal to a toxic peptide. In support of this theory, it was found that increasing the amount of dissolved crystal protein applied per bioassay dose to 100pg (Section 5. 3. 2),resulted in an increase in the average percent louse mortality over the same time period.
The Bt membrane and supernatant fractions were the most louse toxic fractions after 72 hours feeding, causing 33.3Vo and 40.OVo mortality to B. ovis, respectively. This result suggests that a louse toxic factor is associated with Bt supernatant and bacterial membranes and supports the finding of Luthy et al. (1970). This factor may be membrane bound as suggested by Pinnock and Drummond (1992). The results of Chapter 3 revealed that Bt strain 1VB3S16
62 Louse Toxin Investigations
does not produce detectable levels of ß-exotoxin or phospholipase C and the supernatant toxicity can not therefor be attributed to either of these toxins. Further experiments described in Chapter 6, were undertaken to investigate factors causing lousicidal toxicity of the \VB3S16 supernatant and membrane fractions.
4. 4. 3 Protease ExPeriment proteinase K was selected for use in this experiment because it is a coûlmon, commercially available, highly active protease. Following the supplier's recommendations, a ratio of 2:l protease enzyme to crystal protein was used to completely hydrolyse proteins contained within the Bt preparation. The supplier's information stated that one unit of proteinase K would hydrolyse casein to 181¡rg of tyrosine per minute at 37"C and pH 7.5. The amount of enzyme needed to degrade 300pg of Bt preparation under these conditions was calculated based on two assumptions; firstly, that Bt crystals comprise 30Vo of. the total dry weight of the Bt cell (Norris, l97l) and secondly, based on an average calculated from the summary of Cooksey, (lg7I), that Bt subsp. kurstaki crystals contain approximately 5-7g of tyrosine per 1009 of crystal protein. The amount of crystal protein as a percentage of the total dry weight IWB3S16 of Bt strain WB3S16 and the amount of tyrosine contained within the Bt strain crystal have not been previously determined. Therefor, the amount of proteinase K enzyme used in this experiment may have been more or less than was necessary. The proteinase Ilreaction buffer combination was significantly toxic to B. ovis and necessitates accurately adjusting the levels of proteinase K used in future B. ovis bioassays.
The degradation of the majority of the proteins contained within the Bt preparation by proteinase K was confirmed by SDS-PAGE (Figure 4. l). The nature of the 70kDa and 37kDa proteins resistant to further degradation is unknown. An increase in the ratio of enzyme to protein or an increase in incubation time of enzyme with the preparation may have completely degraded all proteins contained within the preparation. The 70kDa protein evident in untreated Bt preparations and the 70kDa protein in Lanes 3 and 4 may be Bt crystal proteins are discussed further in Chapter 5. The 37kDa protein was evident when the reaction bufferþroteinase K solution was analysed by SDS-PAGE and was not present in untreated Bt preparations. Therefor, it is unlikely that this protein is the 18, 500Da Tritirachium album (Limber) proteinase K described by Ebeling et al. (1974) or the 37, 40ODa metalloprotease reportedly produced by Bt subsp. kurstaki (Li and Yousten, t975). Identification of this protein and determination of its role in toxicity, if any, is necessary. Additional experiments to study the effects of varying incubation times and concentration of protease on lousicidal toxicity would be valuable. Different classes of proteases could also be used to provide
63 Louse Toxin Investigations information on the biochemical nature of the louse toxic factor. Unfortunately, it was not possible to undertake these experiments within the time frame of this project.
The reaction buffer contained SDS, Tris and EDTA and was significantly toxic to B. ovis. When used in combination with the Bt powder, this mixture significantly increased the toxicity of the treatment to B. ovis. Despite this, the toxicity of the Bt preparation incubated with proteinase K in reaction buffer was reduced to approximately half that of the untreated Bt preparation (Table 4. 4) when the proteins it contained were degraded by proteinase K, providing evidence that the WB3S16 louse toxin is proteinaceous. This treatment contained a 70kDa protein which was resistant to degradation by proteinase K. Based on its molecular weight, this protein may be a crystal protein and could contribute to the toxicity of the treatment to B. ovis. In addition, insufficient dialysis may have failed to remove all traces of the reaction buffer from treatments and the toxicity of the Bt preparation incubated with enzyme in reaction buffer may have been non significant had all traces of buffer been removed. Unfortunately, the use of reaction buffer was unavoidable in this experiment as the proteinase K was inactive in the absence of reaction buffer. An alternative buffer, less toxic to B. ovis, yet capable of supporting proteinase K activity, should be developed for future experiments.
4. 4. 3 Sequential Harvest Experiment
The time taken for the Bt culture to reach maturity was greater in the shake flask than in the fermenter (35.5 hours compared to 15 hours) due to the sub-optimal growth conditions encountered in the shake flask culture. In a shake flask culture, dO2 is limited by the surface area of the liquid culture exposed for gas exchange and the amount of aeration which can be achieved by simple agitation of the flask. The culture pH can not be controlled in a shake flask and will decrease during the initial stages of log phase as the bacteria release organic acids and will increase towa¡ds the end of log phase as acetate is consumed by the bacteria (Rowe and Margaritis, 1987). In addition, a proteinaceous louse toxin would be subject to proteolytic degradation during prolonged culture incubation and this would result in low levels or activity of the toxin in the end product.
The growth pattern of Bt strain IWB3S 16 (Figures 4. 3 and 4. 4) was similar to that reported for Bt subsp. kurstaki by Rowe and Margaritus, (1987) and no unusual growth cha¡acteristics were observed for strain WB3S16 which would indicate novel toxin production. During log phase, the Bt cells reproduced vegetatively and increased in number exponentially. This is reflected in the exponential increase in the optical density of the culture. The majority of cells in the culture condensed and committed to sporulation between 6-8 hours, as the available & Louse Toxin Investigations
nutrients in the culture became limiting, after which time, endospores became evident in cells. Concomitantly, the optical density of the culture decreased as the Bt cells were smaller. The number of vegetative cells also decreased following sporulation, as vegetative growth became limited by lack of available nutrients. The number of endospores increased rapidly between 8 hours and t hours. After a lag time of one hour, the number of free spores also increased rapidly between 9 and l0 hours as the majority of cells in the culture lysed and released spores. The number of endospores plateaued between 11 hours and 14 hours when the number of cells which were committing to sporulation approximately equalled the number of cells undergoing lysis. During this time, the optical density of the culture fluctuated in a range between 0.1 and 0.15 absorbance units as there was minimal net increase or decrease in the total number of vegetative cells, endospores or spores. After 14 hours, limited by the total number of cells committing to sporulation, the total number of endospores decreased and the net number of free spores increased. Spores were smaller than vegetative cells or cells containing endospores and this may be the reason why the optical density of the culture decreased.
Bt metabolism changes from the EMP pathway to a modified TCA cycle as sporulation commences (Rowe and Margaritis, 1987) and this change was reflected in differences between the SDS-PAGE protein profiles of the 5 hour pre-logarithmic vegetative cell harvest and the remaining harvests (Figure 4. 2). A number of proteins ranging in size from approximately 110kDa to 7.5kDa were common to all harvests. All the strain WB3S16 growth stages tested were toxic to B. ovis and major proteins in this size range could be extracted and their role in lousicidal toxicity could be determined in future experiments.
The sequential harvest gel (Figure 4. 2) showed an increase in number and concentration of bacterial proteins as the culture matured. The 140kDa and 70kDa proteins were evident in each harvest and increased dramatically in concentration as the culture aged. These proteins may be ð-endotoxin crystal proteins and are investigated further in Chapter 5. If so, minor amounts of crystal protein were produced in WB3S16 vegetative cells as early as five hours post inoculation. This result is in agreement with that of Luthy et al. (L970) but contradicts the reports of Lecadet and Dedonder (1971) and Somerville (1971) which indicate that crystal protein appears in the cell coincident with commitment of Bt to sporulation. This suggests either that in Bt strain WB3S16, crystal protein production coÍrmences prior to sporulation or that the early stages of sporulation and crystal production in this strain are difficult to detect by light microscope analysis. Early commitment to crystal protein production in Bt strain WB3S16 may lead to over production of crystal protein and could be a reason for the lousicidal toxicity of this strain. A number of other proteins present in the gel may be
65 Louse Toxin Investigations
intermediate or degraded forms of crystal protein and the role of these proteins in lousicidal toxicity requires further analysis.
The majority of paficulate matter and supernatant fractions were not significantly toxic to B. oyjs when assessed at 24 hours. This result indicated that greater than 24 hours exposure to Bt fractions was required for the lousicidal toxicity of these fractions to manifest in B. ovis. The 24 hour results have not been discussed further as they do not contribute significant information to the exPeriment.
Analysis of the 36 hour sequential ha¡vest experiment showed that the particulate matter (spores, crystals and lysed cellular components) fraction had lousicidal toxicity from the vegetative cell stage onwards (Table 4. 5). Lousicidal toxicity was highest in the 507o lysis fraction. This result suggests that a louse toxic factor was produced from the vegetative cell stage onwards and accumulated as the culture matured. Toxicity levels in fractions harvested at greater thal 50Vo lysis were not studied and require further investigation. Several proteins were unique to the pre-logarithmic vegetative cell culture (Figure 4. 2) and it is unlikely that these proteins would play a major role in the toxicity of V/B3SI6 to B. ovis as all culture harvest fractions were toxic to B. ovis including those that did not contain these proteins'
The t hour supernatant fraction which coincided with Bt culture sporulation and the production of a visible â-endotoxin crystal, was the most lousicidally toxic fraction to B. ovis after 36 hours (Tabte 4. 5). Average mortality decreased when B. ovis were fed the 12 and 15 hour harvests. This result suggests that the Bt cell produces a louse toxin which is present in the supernatant from the vegetative cell stage onwards. This factor may be ð-endotoxin crystal proteins, an enzyme or a metabolic by-product which is exported from the cell and which may be degraded in the culture medium by Bt proteases (Li and Yousten, 1975) and other enzymes.
Both supernatant and particulate matter fractions became toxic early in the growth cycle of the cel| and the toxic factors present in these fractions may be related or identical. The 6 hour delay in appearance of toxicity in the supernatant fraction compared to that of the particulate matter fraction, may reflect the lag time from production of the toxin in the cell to its release to the external growth medium. However, the particulate matter had greatest lousicidal toxicity at, 50Vo lysis whilst the supernatant became less toxic to B. ovis following cell lysis and it is possible that the toxic factors associated with these fractions may be unrelated. However, Bt subsp. kurstaki is known to produce a metalloprotease enzyme (Li and Yousten, lg75) at shiftdown (Egorov et a1.,1984) which is exported into the external growth medium and it is also probable that protease enzymes may degrade a proteinaceous louse toxin present
66 Louse Toxin Investigations in the supernatant. Proteolytic degradation of the louse toxin may explain the decrease in lousicidal toxicity of the supernatant fractions harvested post shiftdown.
4.4.4 General Discussion
The results of these experiments revealed that a louse toxic factor was associated with the bacterial membranes and the supernatant of the Bt strain \VB3S16 culture and support the findings of the fraction bioassay (Chapter 4). Whole crystals were not toxic to B. ovis possibly because lice lack the ability to generate toxic peptides from the ð-endotoxin crystals. However, B. ovis were susceptible to ð-endotoxin crystal proteins solubilised in vitro. The reasons for the toxicity of dissolved crystals were investigated fuither in Chapters 5, 6 and 7. This study provides strong evidence that the louse toxin is proteinaceous in nature because the toxicity of the Bt preparation was significantly reduced by treatment with proteinase K.
The early stages of Bt growth are toxic to B. ovis and the lousicidal toxicity of the particulate matter increased as the Bt culture matured. These results correlate strongly with the electrophoresis results, in which possible â-endotoxin crystal proteins of 70kDa and 140kDa, increased in concentration as the Bt culture matured. The supernatant fractions harvested after shiftdown, became progressively less toxic, coinciding with the production of protease enzymes by the bacteria, which may have degraded a proteinaceous louse toxic factor present in the supernatant. These experiments suggest that the Bt strain WB3S16 louse toxin is a protein associated with the membrane and supernatant fractions and provide strong evidence that dissolved crystal proteins of this strain may act as a toxin against B. ovis.
67
Bt Strain WB3S16 Crystal Proteins
CHAPTER 5
The Crystal Proteins Produced by Bt Strain WB3S16
5. 1 INTRODUCTION:
5. 1. 1 The IWB3S16 Crystal Proteins
As reviewed in Section l. 3. 10, Bt subsp. kurstaki strains are known to produce both Cryl andCry2 proteins. ð-endotoxin crystal protein nomenclature and the nature of Cryl andCry2 genes have been discussed in Sections I. 3. 2 and 1. 3. 4. Cryl genes encode 130-140kDa proteins which accumulate as a bi-pyramidal crystal in the Bt cell during sporulation and a¡e toxic to lepidopteran, coleopteran and dipteran larvae. These proteins are protoxins which dissolve in the alkaline insect midgut and a¡e proteolytically converted by crystal-associated or larval midgut proteases to.a toxic core fragment of 60-70kDa (Höfte and Whiteley, 1989). Cryl genes are distinguished from other cry genes by a greater than SOVo amino acid homology (Höfte and Whiteley, 1989).
The cry2 genes encode 65-70kDa proteins which form cuboidal or rhomboidal parasporal inclusions in several Bt subspecies (Yamamoto and Mclaughlin, 1981) and are toxic to lepidopteran and dipteran larvae. In contrast to Cryl proteins, Cry2 proteins undergo minimal proteolytic degradation and appeil to be naturally truncated (Widner and Whiteley, 1989). Bt subsp. kurstaki strains are known to produce both Cryl and Cry2 proteins (Schnepf et aI., 1985; Widner and Whiteley, 1989).
5. l. 2 Toxicity of Cryl andCry2 Proteins to B. ovis
The toxicity of a range of ð-endotoxin crystal proteins to various lepidopteran, coleopteran and dipteran species was reviewed by Chilcott and Wigley (1993). The results of Chapter 4 indicate that dissolved WB3S16 crystals are also significantly toxic to the phthirapteran, B. ovis and the effect of the Bt preparation against this insect is similar to that of the ð- endotoxins in lepidopteran and coleopteran larvae. The toxicity of different classes of crystal proteins to the Phthiraptera have not been previously investigated and the ð-endotoxin crystal protein classes which comprise the WB3S16 crystal have not been determined.
68 Bt Strain WB3S16 Crystal Proteins
5. 1. 3 Separation of the WB3S16 Crystal Proteins
An attempt was made to separate the constituent proteins of the strain WB3S16 â-endotoxin crystals using standard biochemical techniques.
5. l. 3. I Iso-electric Focusing of WB3S16 Crystal Proteins yamamoto and Mclaughlin, (1931) separated and determined the iso-electric points (pI) of the Cry1 andCry2 proteins of Bt subsp. kurstaki HD-l as 4.4 and 10.7, respectively, by iso- electric focusing of dissolved crystals on IO-4|Vo sucrose density gradients containing 2Vo carrier ampholytes (LKB Ampholine pH 3.5-10) and O.lVo Triton X-100. l00pg of sample was loaded on a micro iso-electric focusing column (5ml capacity) and the gel was focused for 8 hours at 1, 000V. The column solution was pumped through a flow cell to measure pH and the column eluate was fractionated and analysed for crystal proteins using fused-rocket immuno-electrophoresis.
5. I. 3. 2 Chromatographic separation of wB3S16 Crystal Proteins
Yamamoto and Mclaughlin (1981) isolated the Cryl andCry2 proteins of Bt subsp. kurstaki HD-l from a preparation of the parasporal crystal proteins. Crystals (50mg) were dissolved in 3ml of 2Vo ß-mercaptoethanol/water solution adjusted to pH 10 with 2N NaOH, and the solution was chromatographed on a 2.5cm x l00cm column of Sephacryl 5-300 (Pharmacia). The eluate was monitored by absorbance at 280nm and by fused rocket immuno- electrophoresis using anti-solubilised crystal serum. Yamamoto and Iizuka (1983) selectively liberated Cry2 proteins from crystals with the use of NaOH at pH 10-12 and purified the proteins by chromatography on a Sephacryl 5-300 column. The Cryl protein was collected by acid precipitation at pH 4.4 and was solubilised at a pH of less than 12 only in the presence of ß-mercaptoethanol. The authors reported the Cryl appeared as a large peak at an elution volume of 22}ml and the Cry2 was seen as a small peak at 350m1. The Cryl accounted for 95Vo of protein chromatographed (Yamamoto, 1983).
The aim of this study was to evaluate the biochemical nature of Bt strain V/B3SI6 crystal proteins and their contribution to the lousicidal toxicity of this strain. The constituent proteins of the Bt WB3S16 crystal were studied by SDS-PAGE. The susceptibility of the WB3S16 crystal proteins to degradation was studied in a time course dissolution experiment. The N- terminal sequence of proteins contained within the WB3S16 crystal were determined and these proteins were categorised by comparison to published crystal protein sequences on the
69 Bt Strain WB3S16 Crystal Proteins
SV/ISS-pROT protein sequence database. The toxicity of Cry14, Cry2A and Bt strain WB3Sl6 dissolved crystals to B. ovis was determined by bioassay. Iso-electric focusing and column chromatography methods were trialed to separate and purify WB3S16 constituent proteins for further analysis and toxicity testing. However, these were largely unsuccessful due to rapid proteolytic degradation of crystal proteins.
5, 2 MATERIALS AND METHODS:
5. 2. I The WB3S16 Crystal Proteins
5. 2. l. 1 SDS-PAGE of WB3S16 Crystal Proteins An amount equivalent to 75pg MLP whole crystal protein from Bt strain V/B3S16 was dissolved and run on a Bio-Rad Mini-PROTEAN@ II4-20Vo polyacrylamide gradient Ready gel as described in Section 2. 9. The size of the proteins contained within the crystal were estimated by comparison to a Bio-Rad Broad Range MV/ standard run on the same gel.
5. 2. I. 2 Degradation of WB3S16 Crystal Proteins - Time Course Experiment
75pg MLP aliquots of WB3Sl6 crystal protein were separately incubated in dissolving buffer (Section 2. 6) for 30 minutes, t hour, 2 hours and 4 hours respectively. Crystal proteins were n p-urified by dialysis and run on a Bio-Rad Mini-PROTEAN@ ll 4-2OVo polyacrylamide (1 gradient Ready gel against a Kaleidescope Pre-stained MW standard as described in Section 2. 9. The banding patterns of the crystal proteins were examined to determine the effect of dissolution time on crystal proteins.
5. 2. t. 3 N-terminal Sequencing of WB3S16 Crystal Proteins
75pg of MLP Bt strain WB3S16 crystal protein was dissolved in dissolving buffer and run on a Bio-Rad Mini-PROTEAN@ II 4-207o polyacrylamide gradient Ready gel. The proteins were transferred to a Millipore PVDF Imobilon P Transfer Membrane in Towbin Running Buffer (Section 2. 13). The membrane was stained with sequencing staining solution containing 0.O25Vo Coomassie Brilliant Blue R250 and 4OVo v/v methanol and destained in a sequencing destaining solution containing 50Vo vlv methanol in RO water. The proteins of interest were directly sequenced (12 amino acids) from the membrane by Dr Andrew Gooley of the School of Biological Sciences, MacQuarie University, NSW. The N-terminal sequences obtained were compared to those of published crystal proteins documented on the SWISS-PROT protein sequence database at GenomeNet (Tokyo centre).
70 Bt Strain WB3S16 Crystal Proteins
5. 2. 2 Toxicity of Cryl andCryZ Proteins to B' ovis
CrylAa and Cry2A crystals were obtained from Dr Uli Theopold of the University of Adelaide, Waite Campus. The crystals were originally supplied by Dr William Moar, of Auburn University, Alabama. The CrylA was produced by Bt subsp. kurstaki strain HD-73 and was supplied as a lyophilised powder. The Cry2A crystals were a Bt subsp. kurstaki strain NRD-12 gene product expressed in E. coli and supplied in a 0.I7o sodium azide solution.
CrylAa, Cry2A and WB3S16 crystals were dissolved in dissolving buffer (Section 2. 6). The dissolving buffer was removed by dialysis and the amount of dissolved crystal MLP was determined for each type of crystal protein. 100¡rg MLP of each protein was applied to 5mg skin diet in bioassay plates (Section 2. 8. 3). Six replicates of each treatment were made. The bioassay diet was freeze-dried prior to application of B. ovis. The lice were incubated on respective diets under standard conditions and percent louse mortality was assessed after 16 hours, 24 hours, 39 hours and 48 hours.
75pg MLP of dissolved Cry14, CryZA and WB3S16 crystal proteins were run on a Bio-Rad Mini-PROTEAN@ II4-2OVo polyacrylamide gradient Ready gel against a Kaleidescope Pre- stained MW standard to assess the size and purity of the constituent proteins of the respective crystals.
5. 2. 3 Separation of the WB3S16 Crystal Proteins
5. 2. 3. 1 Iso-electric Focusing of rWB3Sl6 Crystal Proteins
'Waite V/ith the assistance of Dr Ian Dundas, of the University of Adelaide, Campus, an ÌWB3S16 attempt was made to separate the constituent proteins of the Bt strain crystals using the isolelectric focusing method described by Yamamoto and Mclaughlin, (1981).
Iso-electric Focusing Gel
Acrylamide :bis-acrylamide 3OVo wlv Glycerol lL.4 Vo vlv Ampholine pH 3.5-10 (Pharmacia #80-l125-87) 4.O Vo vlv TEMED 0.18 7o vlv Ammonium persulphate 0.2I7owlv
7l Bt Strain WB3S16 Crystal Proteins
A horizontal slab gel of 27}mmx 125mm x 2mm dimensions was prepared with the above mixture. Glass plates were pretreated with Repel Silane (Pharmacia #80-1129-42) and Bind- Silane (Pharmacia #80-1129-41, diluted O.OlVo in chloroform) prior to addition of the gel solution. The gel was polymerised for 10 minutes at 60'C prior to loading of samples. The negative electrode buffer was lM NaOH and the positive electrode buffer was lM H3PO4. Electrode wicks (Pharmacia #18-1004-40) were applied to gels which were pre-focused for 30 minutes. 5-6pl crystal protein sample containing 75pg MLP dissolved crystal protein was applied to two 10mm x 3mm wicks (rWhatman No. 3, cut to size). The gel was electrophoresed at RT for 2 hours at 2000V at a maximum of 50mA and 20V/. The gel was stained with Coomassie Brilliant Blue R250, destained and analysed.
5. 2. 3. 2 Chromatographic Separation of WB3S16 Crystal Proteins
Gel filtration column chromatography was used in an attempt to separate the constituent proteins of the Bt strain WB3S16 crystal using the method of Yamamoto and Mclaughlin, (1981); Yamamoto, (1983) and Yamamoto and Iizuka (1983).
Column dimensions: Length 60 cm Diameter 2cm Bed volume 188.5 cm3
Sephacryl@ 5-300 High Resolution gel and an eluent buffer containing 50mM Tris. HCI pH 8.0, O.lVo ß-mercaptoethanol and lmM EDTA were degassed in a sidearm flask under vacuum for 30 minutes. 282.8Í1, of gel slurry (1.5 times the bed volume) was diluted with eluent buffer to twice the desired bed volume and stirred with a glass rod to make a homogeneous mixture. The column was packed in two stages with eluent buffer using a peristaltic pump (60 minutes at lO0ml/hour followed by 60 minutes at 200mllhour, respectively). Excess gel was removed and the column was inverted and mounted vertically on a stand. The column was equilibrated with two bed volumes of eluent buffer.
2mg Bt strain WB3Sl6 crystals were washed three times in lM NaCl and heat treated at 70'C for I hour to destroy contaminating bacterial proteinases as suggested by Yamamoto and Iizuka (1983). The crystals were then dissolved in 3ml of 2Vo ß-mercaptoethanol/water solution adjusted to pH 10 with 2N NaOH. After centrifugation at 100, 000xg for 30 minutes, the supernatant was chromatographed at a flow rate of O.25mIlminute. Absorbance was monitored using an ISCO Model UA-5 monitor at 280-310nm. Fractions were collected manually in polyallomer centrifuge tubes @eckman #3M367) and centrifuged at 200, 000xg for 35 minutes. The pellet was resuspended in 100p1 sterile Type trI RO water and 5pl of
72 Bt Strain WB3S16 Crystal Proteins
each fraction was run on a Bio-Rad Mini-PROTEAN@ Il 4-2O7o polyacrylamide gradient Ready gel against a Kaleidescope Prestained MW standard and stained with Coomassie Brilliant Blue R250 to determine the molecular weight of the separated protein(s) and assess the purity of each fraction.
5. 3 RESTILTS:
5. 3. 1 The WB3S16 Crystal Proteins
5. 3. l. 1 SDS-PAGE of WB3S16 Crystal Proteins
The dissolved crystal solution produced protein bands ranging in size from approximately 14kDa to 140kDa (Figure 5. l). Two major bands of approximately 70kDa and l40kDa were evident.
5. 3. I. 2 Degradation of WB3S16 Crystal Proteins - Time Course Experiment
Two major bands of approximately 70kDa and 140kDa, were evident after 30 minutes of dissolution (Figure 5. 2). After 1-2 hours dissolution, the 140kDa protein was less concentrated and the 70kDa protein band had become more concentrated. Degradation products of the 70kDa protein were not evident during the dissolution process. After 4 hours dissolution, the 140kDa protein had completely degraded and only the 70kDa protein remained. This 70kDa protein was resistant to further degradation.
73 Bt Strain WB3S16 CrYstal Proteins
Figure 5. 1 SDS-PAGE of Bt strain WB3S16 crystal proteins. Lane: l, Bio-Rad Broad Range MW standard;2, dissolved Bt strain \VB3S16 crystals. kDa I t 203 r r35 aÞs
8l Ë
44F
32Ë
t7 ü¡ D Bt Strain WB3S16 CrYstal Proteins
Figure 5. 2 Sequential dissolution of Bt strain WB3S16 crystal proteins in dissolving buffer. Lane: 1, Bio-Rad Broad Range MW standa¡d; Bt strain WB3S16 crystals dissolved for.2,30 minutes; 3, t hour; 4, 2 hours; 5, 4 hours. kDa I 2 3 4 5
203
135
8r
44
32
t7 Bt Strain \ry83s16 Crystal Proteins
5. 3. 1. 3 N-terminal Sequencing of WB3S16 Crystal Proteins
The N-terminal sequencing results are summarised below in Table 5. 1.
Table 5. 1 Comparison of Bt strain V/83S16 l40kDa and 70kDa N-terminal protein sequences to published CrylA andCry2[protein sequences.
140kDa Protein N Terminal Sequence Cry Protein Source MDNNPNINESIP wB3516 this study MDNNPNINECIP Cry lAal Schnepf et aI. (1985) MDNNPNINECIP Cry lAbl rWabiko et al. (1986) MDNNPNINECIP Cry lAc1 Adang et al. (1985) 70kDa Protein N Terminal Sequence Cry Protein Source MNNIVI,NSGRTTI \ry83s16 this study MNNVLNSGRTTI Cry2Aal Donovan et aI (1e8e) MNSVLNSGRTTI Cry21+b2 Dankocsik ¿l ¿/. (19e0)
The 70kDa band was contaminated with a second protein:
contaminating protein sequence: xx E RIE T G YT PI
(x indicates unresolved residue).
Comparison to crystal protein sequences published on the STWISS-PROT database revealed that the WB3S16 140kDa protein N+erminal sequence was homologous to the N-terminus of CrylAa, CrylAb and CrylAc proteins. The 70kDa protein N-terminal sequence was 1007o homologous to the N-terminus of Cry2A proteins. The contaminating protein in the 70kDa band corresponded to the protein sequence of a CrylA protein having an N-terminus beginning at residue 24 of the CrylA proteins sequenced by Schnepf et al. (1985), Wabiko er aI. (1986) and Adang et aI. (1985). However, several amino acids at the N-terminus of this protein could not be resolved and the sequence of this protein was not incomplete.
74 Bt Strain WB3S16 Crystal Proteins
5. 3. 2 Toxicity of Cryl andCry2 Proteins to B. ovis
The SDS-PAGE gel revealed that dissolution of the CrylAa protein produced two major proteins of approximately 65kDa and 135kDa, whilst dissolution of strain V/83S16 A- endotoxin crystals generated proteins of 70kDa and 140kDa (Figure 5. 3). The Cry2A produced a 70kDa protein band.
T-test values showed that dissolved WB3S16 and CrylA ð-endotoxin crystals caused significant mortality of. B. ovis compared to the dissolving buffer control (p<0.05) after 16 and 24 hours respectively (Table 5. 2). The average percent mortality of B. ovis exposed to these treatments increased over the duration of the bioassay and reached a maximum of 5t.6%o and 57.7Vo respectively, after 48 hours. The dissolved Cry2A ð-endotoxin crystals were not significantly toxic to B. ovis (p>0.05) until 48 hours as shown by the t-test values, when this treatment caused 2l.7%o B. ovis mortality. T-test values also showed that the dissolved CrylA crystals were significantly more toxic to B. ovis than the WB3S16 crystals (p<0.05) and that the dissolved Cry2A crystals were significantly less toxic than both the Cry1A and WB3S16 crystals (p<0.05). Dissolved Cry14, Cry2A and WB3S16 crystal proteins caused paralysis of B. ovis and there was no evidence of septicaemia in paralysed or dead insects.
5. 3. 3 Separation of the WB3S16 Crystal Proteins
5. 3. 3. 1 Iso-electric Focusing of WB3SI6 Crystal Proteins
The WB3S16 crystal proteins were insoluble at the pHs used on the iso-electric focusing gel Consequently, the results of this experiment have been included for discussion purposes only.
5. 3. 3. 2 Chromatographic Separation of WB3S16 Crystal Proteins
Spectrophotometric analysis revealed multiple peaks in the eluate from the column and consequently, the Bt strain WB3S16 CrylA and Cry2A proteins were not separable on the column. Numerous protein bands ranging in size from 70kDa tol4OkDa were evident in the SDS-PAGE analysis of the column fractions. The results of the column chromatography experiment have been included for discussion purposes.
75 Bt Strain WB3S16 CrYstal Proteins
Figure 5. 3 Banding pattern of Bt crystal proteins incubated in dissolving buffer. Lane 1: Bio-Rad Broad Range MW standard;2:75pg Bt subsp. kurstaki strain HD-73 CrylA; 3:75¡tg Bt subsp. kurstaki strain NRD-12 CryZA;4:75¡tgBt strain WB3S16 crystal proteins. kDa I 2 3 4
203
135 -
I I -) 1-
44 Table5.2 Toxicity of CrylAa, Cry2A & Bt Strain WB3S16 crystal proteins to B.ovis.
16 hours 24 hours 39 hours 48 hours
Av. Av. Volùflort- Pop t-test 7o Mort- Pop t-test VoMot4- Pop t-test 7ø]ù'fotl- Pop t-test Dev Values Values Dev Values alitv St Dev Values
CrylAa l57o 0.104881 0.23605 Vo 0.150555 2;12266* 707o 0.147196 5.18994* 5I.60Vo 0.098319 9.47467*
Cry2^ 3.30Vo 0.08165 0.91255 Vo 0.083666 0 10.00Vo 0.089443 0.625 2l.70Vo o.t32916 1.96257*
6.34617* 1ryB3Sr6 18,.lÙVo 0.14927 2.70399* 35.007o 0.122474 5.42723* 56.707o 0.175119 6.27772* 57.707o 0.166186
Dissolving 0 Solution Control 07o 0 57o 0.057735 - 7.507o 0.05 l0.00Vo
The standard deviation is represented as a percentage of the total louse population. Results are an average of six replicate treatmen The t-test results indicate statistically significant differences between the crystal protein treatments and the dissolving buffer control (t0.95(8)=1.890; - P < 0.0s)'
Additional t-test values (t0.95(10) =l.El2; P<0.05*)
Cry lAa vs WB3S I 6 ; t=2.206* Cry2A vs WB3S I 6 ; t=12.922* CrylAa vs Cry2A; t=14.055* Bt Strain WB3S16 Crystal Proteins
5. 4 DISCUSSION:
5. 4. I The WB3S16 Crystal Proteins
SDS-PAGE revealed that the V/83S16 crystal was composed of two major proteins of approximately 70kDa and 140kDa. The dissolution study showed that the 70kDa protein was not degraded over time in the presence of dissolving solution. However, the 140kDa protein was completely degraded to a 70kDa protein which was resistant to further degradation. This protein may be the protease resistant peptide reported in the literature (Höfte and V/hiteley, 1989). This finding is supported by the N-terminal sequence analysis data. The N-termini of the 70kDa and the 140kDa proteins were highly homologous to the Cry2A and CrylA classes of crystal proteins, respectively. This experiment showed that strain V/83S16 produces CrylA and Cry2A proteins, both of which are commonly found in Bt subsp. kurstaki strains (Baum and Malavar, 1995). The contaminating sequence found in the 70kDa band and the intermediate proteins which ranged in size from l40kDa to 70kDa, evident in Figure 5. 2, are likely to be proteolytic degradation products of the 140kDa protein and N-terminal sequencing of these peptides is necessary to confirm this theory. Sequencing of the genes encoding these proteins to determine the subclasses of the crystal proteins produced by Bt strain WB3S16 is described in Chapter 7. These results, have enabled a more detailed comparison between the Bt strain WB3S16 CrylA and Cry2A proteins and other published crystal proteins.
5. 4. 2 Toxicity of Cryl andCry2 Proteins to B. ovis
The dissolved CrylAa expression protein obtained from Dr Moar produced a similar banding pattern to the dissolved Bt strain WB3S16 crystals on SDS-PAGE gels. The CrylAa crystal protein produced a major band at 65kDa and 135kDa, compared to the 70kDa and 140kDa crystal proteins of Bt strain WB3Sl6. The Cry2A expression protein obtained from Dr Moat, produced a major band at approximately 70kDa, which was comparable in size to the 70kDa WB3S16 protein. Minor differences in molecular weight and electrophoretic mobility between the CrylAa, Cry2A and WB3S16 crystal proteins may be due to differences in the amino acid sequences and hence biochemical charactersitics of these proteins. However, these results suggested that the Cry1A and Cry2A proteins of Bt strain WB3S16 were similar to the supplied CrylAa and Cry2A proteins and for the purpose of this study, validated the comparisons made between the toxicity of these proteins to B. ovis and those of the WB3S16 crystal proteins.
76 Bt Strain WB3S16 Crystal Proteins
Dissolved CrylAa protein and strain WB3S16 crystals were significantly toxic to B. ovis after 24 and 48 hours. The dissolved Cry2A protein was significantly toxic to B. ovls only after 48 hours and was signifîcantly less toxic to B. ovis in comparison to both the Cry1A and WB3S16 proteins. Both the CrylA and Cry2A proteins of strain WB3S16 may contribute to the lousicidal activity of this strain to B. ovis. Reasons for the delayed effect of the Cry2A t protein in the insect were unclear and may be due to host specificity factors such as receptor concentration and/or affinity for the CryZA toxic peptide know to affect the toxicity of Bt crystal proteins to the target insect (Hofmann et a1.,1988a and b; Van Rie et a1.,1990a and b). Cry1A,Cry2{and WB3S16 crystal proteins all caused paralysis when ingested by B' ovis and septicaemia was not observed in the insects as B. ovis did not ingest spores. This result correlates with the results of Chapter 4, suggesting that the ð-endotoxin crystal proteins are the primary cause of death in B. ovis fed Bt and that Bt spores may contribute to death of B. ovis through septicaemia. This is the first study to report toxicity of â-endotoxin crystal proteins to B. ovis.
5. 4. 3 Separation of WB3S16 Crystal Proteins
5. 4. 3. 1 Iso-electric Focusing of WB3S16 Crystal Proteins
Attempts to separate the Cryl and Cry2 proteins of WB3S16 by iso-electric focusing were unsuccessful as both proteins were insoluble within the pH range of 3.5-10 used in the gel. Dissolved Cryl proteins are known to spontaneously re-aggregate at pHs below their pI point of 4.1 (Fast, 1981). The Cry2 protein is an alkaline protein which is less soluble than Cryl at pH 8.0 and may aggtegate at pHs less than 10 (Yamamoto and Mclaughlin, 1981). These results suggest that the WB3S16 Cryl and Cry2 crystal proteins have similar pI points to other CrylA and CryZLcrystal proteins proteins. This method was not pursued as it did not yield a sufficient amount of purified protein for use in subsequent bioassays.
5. 4. 3. 2 Chromatographic Separation of WB3S16 Crystal Proteins
The chromatographic analysis of WB3S16 crystal proteins was unsuccessful because the Cry1 protein was prone to rapid proteolytic degradation and consequently column fractions were contaminated with a range of Cry1 degradation peptides. Yamamoto and Mclaughlin, (1981) emphasised that successful separation of Cryl andCry2 proteins required prompt processing of the ð-endotoxin crystal sample and use of low temperatures (4'C) during chromatography to minimise proteolytic degradation of the proteins. Yamamoto and Mclaugttlin (1981) and Chestukhina et al. (1930) found traces of Bt proteinase associated with the crystal after extensive washings with NaCl. The protease(s), thought to result in the partial digestion of a
77 Bt Strain WB3S16 Crystal Proteins
l3gkDa Cryl protein, generated a mixture of fragmented proteins of sizes 62kDa, 83kDa, lggkDa and 120kDa. Yamamoto and Mclaughlin (1981) also found that when the Cryl protein was incubated at 37"C for longer than 40 minutes, only the 62Y,Ða protein remained. Similarly, dissolution of Bt strain WB3S16 crystals in dissolving buffer for 4 hours generated a number of peptides ranging in size from 70kDa to l40kDa, which contaminated the fractions collected and resulted in failure of the chromatographic separation experiment. These proteins have not been characterised to date. It is unlikely that the 70kDa Cry2A protein was degraded during the dissolution process as this protein was not degraded in the time course experiment (Figure 5. 2). This finding suggests that either the WB3S16 CrylA protein was unstable and/or that aggressive proteinases are associated with the WB3S16 crystals.
5. 4. 4 General Discussion
Bt strain WB3S16 produces CrylA and Cry2A proteins of 140kDa and 70kDa receptively. rWB3Sl6 Cry1Aa and Cry2A proteins from subsp. kurstaki strains other than were highly toxic to B. ovis and CrylAa was the most louse toxic protein. This is the first report of crystal protein toxicity to a phthirapteran species. The l40kDa WB3S16 crystal protein is prone to proteolytic degradation and is cleaved, possibly by crystal associated proteases, to a protease resistant peptide of 70kDa. Susceptibility of this protein to degradation may be a key to the lousicidal toxicity of Bt strain \VB3S16 and the crystal proteins of this strain. Unfortunately, Cry1A degradation and insolubility of crystal proteins within certain pH ranges prohibited the successful separation of the CrylA and Cry2A proteins of WB3S16 by conventional biochemical techniques. In Chapter 7, the CrylA andCry2Lproteins of strain WB3S16 were cloned to obtain high concentrations of pure proteins to enable verification and quantification of the toxicity of these proteins to B. ovis by bioassay.
78
Immunological Investigations
CHAPTER 6
Immunological Investigations Using Anti-Crystal Protein Antibodies
6. I INTRODUCTION:
6. 1. 1 Investigations using Anti-crystal Protein Antibodies
A number of researchers have raised antibodies to the â-endotoxin crystal proteins produced by Bt. Krywienczyk and Angus (1967) prepared antisera in guinea pigs to pure â-endotoxin inclusions. Krywienczyk et aL (1973) and Krywienczyk and Fast (1980) prepared antisera in rabbits to dissolved â-endotoxin crystals, injecting a total of 9mg and 6mg of dissolved crystal protein, respectively. Bravo et aI. (1992a) prepared polyclonal monospecific antibodies in rabbits to classes of recombinant Cry proteins expressed in E. coli. The antibodies were highly specific for their antigen and reacted only with the toxic fragments against which they were raised. Bravo et at. (I992b) and Aranda et aI. (1996) also reported high specificity of monoclonal antibodies raised to a range of Cryl expression proteins. Similar techniques were employed in the present study to raise antiWB3Sl6 crystal protein antibodies for use in a variety of immunological investigations.
6. I. 2 Crystal Proteins Associated With Spore Coat, Membrane and Supernatant Fractions
The Bt spore has insecticidal properties and considerable evidence indicates a relationship between the Bt spore material and crystal protein solubilised under conditions necessary to dissolve the crystal (Somerville and Pocket, 1975; Schesser and Bulla, 1978). Proteins with solubility, antigenic and chromatographic characteristics and molecula¡ weight and amino acid composition similar to that of crystal proteins have been found in association with the Bt spore (Delafield et aI., 1968; Somerville et aI., 1968; Lecadet and.Dedonder, l97l; Herbert and Gould, t973). The results of Chapter 4 showed that a louse toxic factor is associated with the membrane fraction of Bt strain WB3S16. The factors which cause toxicity of the WB3S16 membrane fraction and culture supernatant to B. ovis are unknown. Asano et al. (1994) found evidence for a ð-endotoxin fraction toxic to lepidopterans in the culture supernatant of Bt subsp. kurstaki strain HD- 1.
79 Immunological Investigations
Chapter 5 showed that certain CrylA and Cry2A and WB3S16 crystal proteins are toxic to B. ovis. The association of WB3S16 crystal proteins with the bacterial membrane, spore and supernatant fractions was assessed in this study to determine whether crystal proteins played a role in the toxicity of these fractions to B. ovis.
6. I. 3 Crystal- Mutant Investigations
Depending on the subspecies of Bt, crystal protein is encoded on one or more crystal protein (cry) genes which may be localised on large, conjugative plasmids (Gonzalez et al., 1982; Kronstad et a|.,1983; Carlton and Gonzalez, 1985) and/or on the chromosome (Schnepf and Whiteley, l98l; Held et at.,1982). Sporulating acrystalliferous mutants (spore+crystal-) are coÍrmon (Somervill e et al., 1963) and have been used by a number of researchers primarily to study relationships between sporulation and crystal protein production (Lecadet and Dedonder, lg/l). Crystal- mutants can be produced by curing the bacterium of plasmids either by using curing agents such as SDS and novobiocin (Bernhard et aI., 1978) or by growth of the bacterium close to its maximum survivable limit (Gonzâlez et aI., 1981; Gonzá,lez et al., 1982). González and Carlton (19S1) reported that colonies of sporulating Bt crystal- strains grown on agar were easily detected as the mutant colonies were less dense than the colonies of the parent strain and confirmed lack of a parasporal inclusion in these strains by phase-contrast microscopy. In this study, crystal- mutants were used as a tool in bioassays and western blot gels to investigate the hypothesis that the Bt strain WB3S16 louse toxin is related or identical to the ð-endotoxin crystal proteins produced by this strain.
6. l. 4 TEM Immunogold Crystal Protein Binding Sn¡dies
A variety of techniques have been used to study the effect of Bt on insect midgut tissue (discussed in Section I. 3. 7). Histopathological investigations using transmission electron micrographs of Bt effected lepidopteran midgut cells have commonly been used to develop models of the mode of action of ð-endotoxin crystal proteins. Following solubilisation and activation of the ð-endotoxin crystals in the midgut of susceptible lepidopteran and coleopteran larvae, Cry toxins are thought to bind to glycoprotein receptors or "binding sites" on the midgut epithelial membrane. The toxins form a pore in the midgut cell plasma membrane, the osmotic balance of the cell is disrupted and eventually the cell lyses (Gill ¿r al.,1992).
Specific, high affinity binding sites have been demonstrated for a number of Bt Cry toxins (Knowles and Ellar, 1986; Hofmann et a1.,1988b; Ifuight et al.,I994a; Vadlamudi et aI.,
80 Immunological Investigations
1995; Luo et aI., 1996). Binding appears to be essential for toxicity and to date, with the exception of CrylC (Van Rie et al.,l99}a; Johnson, 1994), no Cry protein has been found to be toxic without binding to the insect midgut epithelium. Cry protein toxicity appears to be correlated with receptor concentration rather than receptor affînity (Van Rie et a1.,1989; Van Rie ¿/ aI., 1990a and 1990b). Traditionally, in vitro conelation studies have proved problematic because the the susceptibility of cultured insect cells or vesicles to Cry toxins does not always reflect that of midgut cells ir¿ vivo (Davidson, 1989). In addition, there is a lack of suitable midgut epithelial cell lines, the altered expression of receptors in cultured cells and the susceptibility of insect cells to solubilising buffers. Bravo et al. (I992a), Bravo et aI. (I992b) and Aranda et at. (1996) used the alternative technique of immunocytochemical localisation to study binding of crystal proteins to the brush border membrane in lepidopteran larvae. These authors reported that there was a specific interaction between the activated crystal protein and the brush border membrane of the midgut cells prior to pore formation.
The first study to examine the histopathological effects of Bt against the Phthirapteran species, B. ovis, was undertaken by Hill and Pinnock (1993). Bt strain WB3S16 lyophilised fermentation preparation caused disruption of microvilli and cell organelles, cell swelling and eventual lysis of midgut cells following ingestion by B. ovis. This histopathology was very similar to that caused by the â-endotoxin in susceptible insects and the authors proposed that the louse toxin effective against B. ovis shared a mode of action similar to that of the ð- endotoxin in susceptible lepidopteran and coleopteran larvae. In support of this theory, the results of Chapters 4 and 5 showed that solubilised crystal protein is toxic to B. ovis.
IWB3S16 Although crystal proteins have been implicated in mortality of B. ovis fed Bt strain (Hill and Pinnock, I9g7), the interaction of Cry proteins with the B. ovis midgut epithelium has not been investigated. In vitro investigations to determine the effect of Bt on midgut tissue isolated from B. ovis are not possible as B. ovrs BBMVs and cell lines have not been developed. Therefor, labelled antibodies were used to study Cry protein interaction with B. ovis midgut tissue sections.
6. 2 MATERIALS AND METHODS:
6. 2. I Investigations using Anti-crystal Protein Antibodies
Cry1Ac anribody was supplied by Dr Don Dean of Ohio State University. The antibody had been prepared by injecting semi-purified CrylAc inclusion bodies from Bt subsp. kurstaki strain HD-l into rabbits. Cry2|antibody prepared by challenging rabbits with a Cry2A
81 Immunological Investigations
expression product from the recombinant Bt subsp. kurstaki strain HD-73 was supplied by Dr Bill Moar, of Auburn University. Dissolved anti-WB3S16 crystal protein antibody was prepared as described in Section 2. 7. The CrylA and Cry2A antibodies were used at the suggested dilutions of l/1000 and 1/500 respectively, in western blot experiments. Anti- dissolved WB3S16 crystal protein antibodies were used for all experiments at a dilution of 1/500.
6. 2. 2 Crystal Proteins Associated V/ith Spore Coat, Membrane and Supernatant Fractions
75pg MLP of spore, membrane and supernatant fractions were run on a Bio-Rad Mini- PROTEAN@II 4-20Eo polyacrylamide gradient Ready gel against Kaleidescope Pre-stained M'W standard and stained with Coomassie Brilliant Blue R250. Using the method detailed in Section 2. 10, the proteins from a second, identical gel were transferred to a nitrocellulose filter and assessed by western blot. The membrane was probed with anti-WB3S16 crystal protein primary antibody followed by goat anti-rabbit antibody labelled with alkaline phosphatase.
6. 2. 3 Crystal- Mutant Investigations
Bt subsp. kurstaki strain HD-l and subsp. thuringiensds strain HD-2 were supplied by Dr David cooper of Microbial Technologies Pty. Ltd., south Australia.
The crystal- strains #5, #8, #9, #18, #20 and l*97 were obtained as described in Section2. 2. Lyophilised bacterial powder preparations of Bt strains WB3S16, HD-l, HD-z and the six crystal- strains were prepared by culture in 5156 media, following the procedure detailed in Section 2. 3. 75pg MLP of powder preparation from each strain was incubated with dissolving buffer and run on a Bio-Rad MINI-PROTEAN@II4-2O7o polyacrylamide gradient Ready gel against a Kaleidescope Pre-stained MW standard. The gel was stained with Coomassie Brilliant Blue R250. The proteins from a second, identical gel were analysed by western blot, following the method detailed in Section 2. 10. Anti-WB3S16 crystal protein and goat anti-rabbit antibody labelled with alkaline phosphatase were used as primary and secondary antibodies, respectively.
500pg of crystal- strains #5, #8, #9, #18, #20 and #97 and Bt strains WB3SI6, HD-l and HD- 2 prepared as described above, were incorporated with lOmg skin diet into twelve replicate bioassay doses. 120 B. oyis were applied per treatment and the bioassay was incubated at 32'C and 7O7oR\I. The percent louse mortality was assessed after 18 hours, 25 hours and 40
82 Immunological Investigations hours. Toxicity of strains HD-l, HD-2 and all crystal- strains to B. ovis at 40 hours was analysed statistically by comparison to that of strain WB3S16 using a t-test at the 95Vo confidence level. Bt strain HD-l was included in bioassays to enable a comparison between the lousicidal toxicity of two kurstaki strains. Strain HD-z was analysed as this strain is known to produce significant amounts of ß-exotoxin (Chapter 3).
6. 2. 4 TEM Immunogold Crystal Protein Binding Studies
Initially, an attempt was made to study the interaction of Bt strain V/B3S16 CrylA and Cry2{proteins with the B. ovis midgut epithelium using immunofluoresence. Entire midguts and midgut tissue sectioned on a Leica Reichert-Jung Cryocut 1800 were incubated with FITC labelled anti-crystal protein antibodies and examined by light and confocal microscopy. However, this technique was unsuccessful due to the strong autofluoresence of the B. ovis cuticle, crop and midgut tissue.
In an alternative approach, gold labelled anti-crystal protein antibodies were used to study crystal protein binding to the midgut epithelium of B. ovis. Immunogold investigations were undertaken with the assistance of Dr Merilyn Henderson of the University of Adelaide, Centre for Electron Microscopy and Microstructure Analysis (CEMMSA).
Bt strain WB3S16 lyophilised powder (fermenter Run #339) was prepared following culture in a laboratory fermenter (Section 2. 3. 2 - 2. 3. 3). The Run 339 LCSO value was 83.3pg as determined by the probit analysis method of Finney (I97L). A normal distribution of B. ovis response to the Bt preparation was assumed and the probit analysis gave a satisfactory fit to the data.
B. ovís adults were incubated on diets with 500pg of Run #339 Bt powder for t hours and24 hours and on diets with 200pg doses of CrylA, Cry2A and WB3S16 dissolved crystals (Bt powder and crystal protein doses were equivalent to lO0ttg lvtl-P) for t hours. Midguts were removed from paralysed or moribund B. ovis at t hours and 24 hours. Control specimens were midguts isolated from B. ovis which had been incubated on skin diet without Bt or dissolved crystals for t hours and 24 hours. Following dissections, midgut tissue was removedandfixed in0.25%o gluteraldehyde,4Vo paraformaldehyde and4Vo sucrosein IxPBS
pH 7 .2 for 48 hours at 4" C. The midguts were dehydrated 2 x 30 minutes in 70Vo ethanol, 2 x 30minutes ingOVo ethanol,2x3O minutes in9íVo ethanol,2x3O minutes and I x I hourin IOOVo ethanol, 8 hours in l:l 50Vo ethanol:SÙVo LR V/hite (Sigma) and 3 x 8 hours in IOOVo resin at 4"C. The midguts were embedded in resin, polymerised at 50'C, and sectioned on a Reichert Ultracut E microtome. The sections were collected on copper grids, blocked by
83 Immunological Investigations
inversion on the surface of a 20pl drop of 0.2M glycine in lx PBS for 2o minutes and then blotted dry on filter paper. The grids were inverted on a 20pl drop of lx PBS containing 17o w/v ovalbumin for 20 minutes and then blotted dry on filter paper. Each grid was then inverted on a 20¡rl drop of primary antibody solution (anti-Cry 14, 1/500; anti-Cry 2A,11250; anti-WB3S 16,lt50; rabbit anti-mouse,ll2OO) overnight at 4'C. The antibodies were diluted with lx PBS containing IVo w/v ovalbumin. Rabbit anti-mouse antibody was used as a control to monitor the level of non specific anti-body binding. The grids were washed (six times 5 minutes) in lx PBS containing l7o wlv ovalbumin. Each grid was inverted on a 20pl drop of 10nm Protein-A-Gold complex (Amersham Life Science) diluted tl20D with lx PBS for 1.5 hours, and then washed four times in Millipore filtered ddH2O.
The sections were stained with 57o Uranyl acetate for 10 minutes and 5Vo Lead citrate for 5 minutes, washed 4 times in Millipore ddH2O and blotted dry on filter paper. The sections were examined on a Philips CM-100 transmission electron microscope between 2, 500x and 28, 500x magnihcation.
6. 3 REST]LTS:
6. 3. I Investigations Using Anti-Crystal Protein Antibodies
Preliminary western blot experiments (data not shown) revealed that anti-WB3s16, CrylA and Cry2A crystal protein antibodies bound to Bt strain WB3S16 crystal proteins of approximately 140kDa and 70kDa and several proteins of less than 140kDa, assumed to be degradation products of the CrylA crystal protein.
6. 3. Z Crystal Proteins Associated V/ith Spore Coat, Membrane and Supernatant Fractions
SDS-PAGE showed that 70kDa and 140kDa proteins were associated with the WB3S16 membrane and spore fractions and the 140kDa protein was more concentrated in the membrane fraction. A feint protein band indicated that a 70kDa protein was associated with rhe WB3S16 culture supernatant (Figure 6. 1). The 140kDa and 70kDa proteins identified in the spore and membrane fractions and the 70kDa protein associated with the supernatant strongly cross-reacted with anti-WB3S16 crystal protein antibody (Figure 6. 2).
84 Immunological Investigations
Figure 6. 1 (a) SDS-PAGE of Bt strain WB3S16 spore and membrane fractions. Lane: 1, Bio-Rad Kaleidoscope Pre-stained MW standard; 2,75¡tg MLP dissolved spore fraction; 3, 75pg MLP membrane fraction. (b) SDS-PAGE of Bt strain WB3S16 culture supernatant. Lane: 1, Bio-Rad Kaleidoscope Pre-stained MV/ standard; 2,75¡tg MLP dissolved culture supernatant. a) kDa I 2 3 a 203
135
81 rrt
44
32
t7 t
b) kDa t2 203
135
EI
44
32 t7 Immunological Investigations
Figure 6. 2 Western blot of Bt strain \VB3S16 spore, membrane and culture supernatant fractions incubated with anti-WB3S16 crystal protein antibody. (a) Lane: 1, Bio-Rad Kaleidoscope Pre-stained MW standard; 2,75¡tg MLP dissolved spore fraction plus anti- WB3S16 crystal protein antibody; 3,75¡tgMLP membrane fraction plus anti-lVB3S16 crystal protein antibody. (b) Lane: 1, Bio-Rad Kaleidoscope pre-stained MW standard; 2,75¡tg MLP culture supernatant incubated with anti-\VB3S16 crystal protein antibody. €1 T
i
i Immunological Investigations
6. 3. 3 Crystal- Mutant Investigations
Bt strain WB3S16 was significantly toxic B. ovis after 40 hours (p<0.05) when it caused Sl.OVo mortality of B. ovis (Table 6. l) . The t-test showed that the crystal- strains #9, #9'l , #18 and #20 and strain HD-z were also significantly toxic to B. ovis after 40 hours in comparison to the toxicity of the WB3S16 parent strain (p<0.05). These strains caused between 35.97o and 5l.0%o mortality of B. ovis. However, the crystal- strain #5 and Bt strain.., HD-l were not significantly toxic to B. ovis after 40 hours (p>0.05). The bioassay was terminated after 40 hours when control B. ovis mortality exceeded lOVo.
SDS-pAGE analysis showed that Bt parent strain WB3Sl6 produced crystal protein bands of 70kDa and l4QkDa (Figure 6. 3). These proteins were not evident in the protein profiles of the crystal- mutants which did not appear to be producing crystal protein. In addition, crystal- strains produced major protein bands of approximately 20kDa, 30kDa and 40kDa. These proteins were also produced by the parent strain, but were present in lower concentrations. Crystal- strains produced a minor 65kDa protein band which was not evident in the parent strain.
The western blot was used as a positive control to confirm that the 70kDa and 140kDa proteins produced by Bt strain WB3S16 cross reacted with the anti-WB3S16 crystal protein antibody (Figure 6. 4). All crystal- strains produced detectable amounts of 37kDa and 70kDa proteins, both of which cross reacted with the anti-WB3S16 crystal protein antibody. The 25þ,Da,30kDa, 40kDa and 65kDa proteins evident in the SDS-PAGE gel (Figure 6. 3) did not cross react with the anti-WB3Sl6 crystal protein antibody.
6. 3. 4 TEM Immunogold Crystal Protein Binding Studies
Control midgut tissue sections (Figure 6. 5 and 6. 6 (a) - (d)), revealed that the B. ovis midgut was one cell thick. Midgut cells were attached to a muscularised basement membrane. Microvilli were located on the apical surface of the midgut cells and projected into the midgut lumen. Organelles such as mitochondria and nuclei were evident, generally located near the base of the cells. The midgut cells contained numerous irregular shaped vacuoles which also occurred towards the base of the cell. The fibrillar membrane and internal fibres were evident in cross sections of the microvilli.
The immunogold labelling technique was used to indicate the bin{lng of antibodies to crystal protein antigenic sites on the midgut epithelium as shown by electron dense gold colloids which resulted from the complexing of protein-A-gold to the primary antibody (Figures 6. 5 -
85 strains #5, #8, #9,#13,#18,#2O and #97 to Table 6. 1 Toxicity of Bt strains WB3S16, HD-l and HD-2 and WB3S16 acrystalliferous B. ovis.
40 hours
Skin Diet 8 9 5 97 1E 20 HD-1 HD.2 wB3Sr6 Control
5l7o lOTo ìw. Vo 35.90Vo 43.40Vo 427o 45.30Vo 49.2OVo 43.50Vo 48.707o 49'20Vo Mortality
Pop. St. 188 0.154 o.162 0.135 0.136 0.22 0.191 o.173 0.r98
t-test Value 0.039 1.562 2.O34* r.653 0.733 0.164 1.804* o.06'l
The standard deviation is represented as a percentage of the total louse population. Results are an average of twelve replicate treatments. the The t-test results indicate statistically siguificant differences bewteen the toxicity of the nine Bt strains to B. ovis compared to skin diet x). control (t0.95( I 4)= 1.7 6l; p<0.05 Immunological Investigations
Figure 6. 3 SDS-PAGE of Bt strain WB3S16 crystal- mutant strains. Lane: 1, Bio-Rad Kaleidoscope Pre-stained MV/ standard; 2,75¡tgMLP Bt strain WB3S16; 75pg MLP crystal- strains, Lane: 3, #8 ; 4, ll9 ; 5, #5; 6, ll97 ; 7, #L8; 8, #20. kDa 1 2345678 203 135
81
44
3r t7 Immunological Investigations
Figure 6. 4 Western blot of Bt WB3S16 crystal- mutant strains probed with anti-WB3S16 crystal protein antibody. Lane: 1, Bio-Rad Kaleidoscope Pre-stained MW standard; 2,75¡tg MLP Bt strain WB3S16;75pg MLP crystal- strains, Lane: 3, #8; 4,119;5, #5; 6,1197;7,#18; 8, #20. kDa 1234567 203 135
8l
44
32 t7 Immunological Investigations
Figure 6. 5 Transmission electron micrograph of midgut tissue section from control B. ovís fed skin diet for t hours, treated with anti-CrylA crystal protein antibody: B, basement membrane, L,lumen, M, microvilli, V, vacuole. Í:*a> '!rI>
I Immunological Investigations
Figure 6. 6 Transmission electron micrographs of midgut tissue sections from control B. (a) ovis fed skin diet for 9 hours. Sections treated with anti-CrylA crystal protein antibody: M, microvilli. (b) Sections treated with anti-Cry2A crystal protein antibody: M, microvilli; with (c) anti-WB3S16 crystal protein antibody: M, microvilli; and with (d) Rabbit anti-mouse antibody: M, microvilli. I { I I lllt :iì !a '): ar¡ \ I uaoú ¡' I I o ,l t l¡ ,L' ¡ I 5, 1 :.'l r:' a I
'Ð .,ãt Q'*
Þ o _ ..,- ? É.-'Y. ùÇ . ...:fli 'i* lÉ!lr.. æÍÈ;
'T '' " 9úË {'¡ DOI ooú ñf \o :l sltz oà f il rl ?; f¡l / I I b ',1 Immunological Investigations
Figure 6. 7 Transmission electron micrographs of midgut sections from B. ovls fed 500¡tg Bt strain WB3S16 lyophilised preparation for t hours. Sections were treated with anti-Cry14 crystal protein primary antibody and protein-A-gold secondary antibody complex. (a) C, ð- endotoxin crystal, S, spore; (b) B, Bt cell containing endospore and crystal, M, disrupted microvilli, S, spore; (c) Pl, Pl crystal (Cry1A ð-endotoxin crystal), P2,P2 crystal (Cry2A ð- endotoxin crystal), M, disrupted microvilli, S, spore. I { \3 F'
Ð 0 a, /* 'rlS.t ',,n ;ïs;T E; BI o cl !ta Nl úl il "[ i -r-.-..-Àú:,.. A:. ( -rJ ,a F (\' Çry' B t. *-' I .t ! I I I f' t- ¡. ' '1, ! &rù I .rv ... "¡. t L' .t, Ê.f #'t E øi- a I 1 È B P2 o I N' fr P1 t ú 3 ! ,æ Õ t _-.* ,t, a t itI .{Q,¿ , í'!'¡È ;þ *ñì,. lt rrl - .'t. l,' ï, 1 i r*-. ,,0;5 { t ; -:!t c a.a +' j- w -¡ :t" '. ¡ t. -#t i|ù: t ( f t". T ..-: {¡ ( t7 lo t!La a rt¡' t- ct' ,v a ilt (1 ( @, I Immunological Investigations Figure 6. 8 Transmission electron micrographs of midgut sections from B. ovis fed 500pg Bt strain WB3S16 lyophilised preparation for t hours. Sections treated with (a) anti-Cry2A crystal protein primary antibody and protein-A-gold secondary antibody complex: C, A- endotoxin crystal, M, disrupted microvilli; O) anti-WB3S16 crystal protein primary antibody and protein-A-gold secondary antibody complex: M, disrupted microvilli, S, spore; (c) Rabbit anti-mouse primary antibody and protein-A-gold secondary antibody complex: B, bacterial membrane material, M, disrupted microvilli, S, spore. -,- a - ,. { = .ç ø q_ t'l o a.t å-t I t a 'i : û'J' I ¡ I 'rt{ I .. û \ ,a' I ¡ I 4 I , .¡or i '\ , 't 'r -n'd.jt r '' !. .{.- ;' a r¿âL¡bn' :",'- ì ti tt" ' ,*#t a t-tr¡: -- I j ,' :... . I ¡ 5 , a |-l :i r'' 4' { I .ja a' f"x a ^ þ,, 5 þ ,i'"\{ r¡ ''1 6fa -j *\" . ¡: ? / t i i,t' t -.ù J. m ;, ;iil 1,r- a ö I ,^ :Ê ;: i- - - J, 28 eJ2 itz *. a î 9t 9 lrs t t, -rr, n r.æ rAil PcÊ a o t " 'ô.' s I Immunolo gical Investigations Figure 6. 9 Transmission electron micrograph of midgut tissue from B. ovis fed 200pg dissolved CrylA protein for t hours. Sections treated with anti-CrylA crystal protein primary antibody and protein-A-gold secondary antibody complex: (a) B, basement membrane, C, disrupted cell cytoplasm, M, microvilli; (b) M, microvilli. (c) Sections treated with rabbit anti-mouse primary antibody and protein-A-gold secondary antibody complex: M, microvilli. Immunological Investigations Figure 6. 10 Transmission electron micrograph of midgut tissue from B. ovis fed 200pg dissolved Cry2A protein for t hours. Sections treated with (a) anti-Cry2A crystal protein primary antibody and protein-A-gold secondary antibody complex: M, microvilli; (b) anti-Cry2|crystal protein primary antibody and protein-A-gold secondary antibody complex: M, microvilli; (c) Rabbit anti-mouse primary antibody and protein-A-gold secondary antibody complex: M, microvilli. Þ rlJ ,r .'| -rë '#, z:- "& at a S" ¡tà \ t 4 I J*' :Ð ,,t -* f.tr 1: \ l .,.. ->a'. ! ú t I at' :¿È D.ó lD 4r'-' ¡'ra"- +j- É ,.Jî-. ,.:. A 1 --'-t 1¡ 4è t --t .1 o , Í Ì r.t 0'^ r'-ìS o t t' 3 ,# ft V b T ar t e b ,9 ì o ü I ì ì ù c b I lB oç o <ç ¡ .? N ao I N (n \ Figure 6. 11 Transmission electron micrograph of midgut tissue from B. ovis fed 200pg dissolved WB3S16 crystal protein for t hours. Sections treated with (a) antiWB3Sl6 primary antibody and protein-A-gold secondary antibody complex: M, microvilli; (b) Rabbit anti-mouse primary antibody and protein-A-gold secondary antibody complex: M, microvilli. (, o {Ú t Filf t' Immunological Investigations 6. l l). Anti-CrylA, anti-Cry2A and rabbit anti-mouse antibodies did not bind to control tissue sections and there was no evidence of non-specific binding (Figure 6. 5 and 6. 6 (a) - - (d)). The anti-WB3S16 antibody showed minimal levels of non-specific binding to control midgut tissue (Figure 6. 6 (c)). This result may be due to the fact that the antibody is a polyclonal or may be caused by insufficient washing of the tissue sections. However, the levels of non-specific binding were negligible in comparison to the levels of specific binding achieved with this antibody in midgut sections from B. ovis fed Bt or dissolved crystal protein (Figures 6. 8 (b) and 6. I I (a)). B. ovis exhibited significant paralysis and mortality after t hours' feeding on the Bt preparation, which was evident in micrographs of the B. ovis gut lumen. Spores, crystals and mature Bt cells containing an endospore and crystal were evident in close proximity to the disrupted microvilli (Figure 6. 7 (b) and (c) and Figure 6. 8 (a), (b) and (c)). Vegetative cells were not evident at t hours as the ingested Bt spores had not germinated in the gut lumen. Midgut cells and microvilli were difficult to detect in Bt treated B. ovis sections at this time as they had become disrupted and were disintegrating in the midgut lumen. The cell organelles such as nuclei and mitochondria were no longer evident (Figures 6. 7 (b) and (c) and Figure 6. S (a) - (c)). Anti-CrylA, anti-Cry24 and anti-WB3S16 crystal protein antibodies bound strongly to the spores, crystals and bacterial membrane material of the Bt preparation in the B. ouls midgut lumen. The Cry2A crystal was evident as an irregular shaped inclusion, which was adjoined to the CrylA crystal (Figure 6. 8 (a) - (c)). Intact crystals were evident in sections, although some crystals exhibited slight terminal erosion. There was no binding of the rabbit anti-mouse antibody to the microvilli or Bt preparation in the B. ovis gut lumen. The anti-CrylA antibody exhibited the greatest amount of binding to Bt treated B. ovis midgut tissue. B. ovis exhibited significant paralysis and mortality after feeding on purified CrylA, Cry2A and V/B3SI6 crystal protein for t hours and the effects of these protein treatments on the midgut cells of B. ovis after t hours are shown in Figures 6. 9 (a) - (c), 6. 10 (a) - (c) and 6. 11 (a) and (b). Cry14, Cry2A and WB3S16 crystal proteins had a similar effect on the B. ovis midgut cells to that of the entire Bt preparation, causing disruption of midgut cells, disintegration of microvilli and loss of cell organelles. There was no binding of the rabbit anti-mouse antibody to the midgut tissue of. B. ovis fed dissolved Cry14, Cry2A or WB3S16 proteins. Specific binding of anti-CrylA, anti-Cry2A and anti-WB3S16 crystal protein antibodies to the B. ovis microvilli was evident (Figures 6. 9 (a) and (b), 6. 10 (a) and (b) and 6. 11 (a)). The amount of anti-CrylA antibody binding to midgut tissue was greater than that of the anti-Cry2A or anti-WB3S16 crystal protein antibodies. 86 Immunological Investigations B. ovis midguts disintegrated and did not withstand the embedding process after treatment with Bt for 24 hours. Consequently, the 24 hour control and Bt treatment results have not been included in this section. 6. 4 DISCUSSION: 6. 4. I Investigations using Anti-crystal Protein Antibodies Western blots demonstrated that anti-CrylA, anti-Cry2{ and anti-WB3S16 crystal protein antibodies recognised a majority of crystal proteins present in the â-endotoxin crystal of Bt strain WB3S16. All antibodies recognised the Bt strain WB3S16 l40kDa CrylA and the 70kDa CryZA crystal proteins, in addition to a number of other proteins thought to be degradation products of either the 140kDa and/or the 70kDa proteins. The threç antibodies classes crystal protein and possibly d!ùuot ?Ppear to be specific for CrylA or Cry2A of bound to several common epitopes on crystal proteins. This result was anticipated for the anti-WB3S16 crystal protein antibody as this was produced by injecting rabbits with a mixture of Bt strain WB3S16 CrylA and Cry2Aproteins. The specificity of the anti-CrylA and anti-Cry2A crystal protein antibodies in relation to the WB3S16 crystal protein antibodies was unknown prior to the commencement of this study. These antibodies were not specific for classes of WB3S16 crystal proteins, contradicting the findings of Höfte et al. (1988) and Knowles et at. (1986) who reported that Cry1 antisera did not recognise Cry2 proteins and this may be a reflection of the fact that the antibodies were polyclonal. In addition, the peptides generated by degradation of Cryl proteins may present common epitopes, resulting in anti-Cryl{ antibody recognition of a number of related proteins in the CrylA protein profile. 6. 4.2 Crystal Protein Associated With Spore Coat, Membrane and Supernatant Fractions The 70kDa protein associated with the spore coat of Bt strain WB3S 16 (Figure 6. 1) strongly cross reacted with anti-WB3S16 crystal protein antibody (Figure 6. 2), and may be immunologically related to the crystal proteins of Bt strain WB3S16. This spore coat protein may be a Cry2A, a breakdown product of the CrylA or a combination of both proteins. Crystal proteins are thought to be adsorbed or incorporated into the spore coat and exosporium at time of sporulation and this finding is consistent with the results of Delafield ¿r aI. (1968), Somerville et al. (1968), Lecadet and Dedonder (1971) and Herbert and Gould (1973). It is unlikely that an adsorbed or bound 70kDa protein could act as a toxin against 87 Immunological Investigations B. ovis as lice do not possess the enzymes or highly alkaline gut conditions necessary to liberate crystal protein from the spore coat. This idea is supported by the results of Chapter 4 which showed that spores were not toxic to B. ovis and only caused death through septicaemia after they had germinated in the gut of the insect. Dissolution experiments to liberate these two proteins from the spore coat and test their toxicity to B. ovis could bc used to test this theory. The results of this study indicated that proteins of l4OkDa and 70kDa, immunologically related to the CrylA and Cry2A proteins of Bt strain WB3S16, were associated with the Bt strain WB3S16 bacterial membrane fraction. Consistant with the results of Asano et aI. (Igg4),light microscope analysis revealed that some ð-endotoxin crystals co-sedimented with the membrane fraction following separation by isopycnic centrifugation and these crystals may account for a percentage of crystal protein associated with this fraction. Lecadet and Dedonder, (1971) reported that crystal protein represented a large proportion of the insoluble proteins which were preferentially synthesised and bound to membranous structures in Bt serotype I. It is possible that Bt strain WB3S16 may preferentially synthesise a 70kDa protein or produce a protease susceptible CrylA protein which degrades to a protease resistant peptide of 70kDa. The presence of a 70kDa crystal protein in the supernatant following cell lysis (Figure 6. 2) suggests that this protein may be produced in excess and exported from the Bt cell. For reasons not yet understood, the 70kDa protein does not appear to be incorporated into the crystal and may exist free in the cell, thus becoming associated with the bacterial cell membranes and being released from the cell during lysis. Such a protein liberated from the membrane substrate by the action of louse midgut lipases (Sinclair et a1.,1989), may then act as a toxin against B. ovis. Further analysis is required to identify this protein and determine the mechanism by which it becomes associated with the Bt membranes. 6. 4. 3 Crystal- Mutant Investigations Crystal- strains provided a convenient tool to investigate the original hypothesis that the louse toxicity of Bt strain WB3S16 results from ð-endotoxin crystal proteins or proteins homologous to these. After 40 hours, crystal- strains caused levels of B. ovis mortality which were not statistically different to that of the parent strain WB3S16. This finding suggested that the toxicity of crystal- strains was not due to crystal protein. The results reported in Chapter 3 showed that strain WB3S16 and the crystal- strains derived from this strain did not produce detectable levels of phospholipase C. In addition, strain WB3S 16 did not produce ß- exotoxin and it is therefor unlikely that crystal- strains produce this toxin. Consequently, the factors responsible for the lousicidal toxicity of crystal- strains were investigated by SDS- PAGE and western blot in this study. 88 Immunological Investigations SDS-pAGE results (Figure 6. 3) indicated that crystal- strains did not produce detectable amounts of either l40kDa or 70kDa crystal proteins. However, the more sensitive western blot technique (Figure 6. 4) revealed that all crystal- strains did produce significant amounts of 70kDa and 37kDa proteins, both of which cross reacted strongly with anti-WB3S 16 crystal protein antibody. There is a strong possibility that both these proteins are crystal proteins, although their origin and nature are unknown and require further investigation. The 70kDa protein may be aCry2çprotein or a combination of both Cry2A and degraded CrylA protein. The 50kDa protein may consist of one or a combination of CrylA and Cry2A breakdown products. Alternatively, the 70kDa and 37kDa proteins may be unrelated to the crystal proteins of strain \ryB3S16 and may bind to the anti-WB3S16 crystal protein antibody non- specifically. Similar results were reported by Lecadet and Dedonder (1971) who found that an acrystalliferous mutant strain accumulated soluble proteins of approximately 80kDa, having properties of crystal constituents. The toxicity of crystal- strains to B. ovis may be due to the 70kDa and 37kDa proteins of these strains The origin and nature of the 40kDa, 30kDa and 25kDa proteins (Figure 6. 4) found in all crystal- strains and in Bt strain \VB3S16 are unknown. It is unlikely that these proteins are crystal proteins because they did not cross react with anti-V/83S16 crystal protein antibody, although they may contribute to the lousicidal toxicity of Bt strains. The 65kDa protein specific to crystal- strains is also of unknown nature and origin. There is no evidence that this protein is a crystal protein and its role in toxicity has not been studied. This protein may result from mutations of the Bt strain ÌWB3S16 genome caused during heat curing. Cry gene deletion, re-Íurangement or point mutations may have produced novel proteins or protein products resulting from alternative metabolic pathways used by the crystal- strains. The size and number of plasmids in Bt strain WB3S16 and the crystal- strains were investigated further (Chapter 7) to determine the effect of heat curing on Bt cry gene carrying plasmids. The contribution of the 65kDa, 40kDa, 30kDa and 25kDa proteins to lousicidal toxicity of Bt strain WB3S 16 requires further investigation. 6. 4. 4 TEM Immunogold Crystal Protein Binding Studies Immunofluoresence was used to study the interaction of the Bt strain V/83S16 crystal proteins with the B. ovis midgut membrane by light and confocal microscopy. However, this technique was unsuccessful due to the strong autofluoresence of the B. ovis exo-skeleton, crop and midgut. The immunological protein-A-gold technique is compatable with transmission electron microscopy and offered a dual advantage for this study; firstly to determine the ultrastructural effects of Bt strain WB3S16 ð-endotoxin crystal proteins on the 89 Immunological Investigations B. ovis midgut cells, and secondly to locate putative crystal protein binding sites on the B ovrs midgut epithelium. Transmission electron micrographs of control B. ovis midgut tissue indicated that the sample processing procedures did not have a detrimental effect on tlìe tissue as the rnidgut had a similar appearance to that described by Hill (1992). Midgut cells of B. ovis fed the Bt strain WB3S16 lyophilised culture preparation or the dissolved Cry14, Cry2A or WB3S16 crystal proteins for t hours exhibited significant loss of cell integrity. The histopathological effects of these treatments on B. ovrs midgut cells included disruption of microvilli and cell organelles and cell lysis and were consistent with those caused by the ô-endotoxin crystals in susceptible lepidopteran and coleopteran larvae and with those described by Hill and Pinnock (1998). The toxicity of V/83S16 Bt preparations to B. ovds may be due to the presence of crystal proteins in the preparation. As suggested by Hill and Pinnock (1998), Bt strain \V83S16, CrylA and Cry2A proteins may have a similar mode of action in B. ovis to that of the Cry1A andCry2[proteins in susceptible lepidopteran larvae' Electron micrographs confirmed that Bt strain WB3S16 produced both CrylA and Cry2A proteins and supported the protein sequencing results of Chapter 5. The Cry2A crystal, formerly termed theP2 crystal, was evident in micrographs as a separate crystal adjoined to the CrylA containing ð-endotoxin or Pl bi-pyramidal crystal. In contrast to the western blot results (Section 6. 3. 1), the micrographs indicated that the anti-CrylA and anti-Cryz[ antibodies were relatively specific for non-degraded crystal protein because they differentiated between the two types of crystals, the antiCrylA binding specifically to the Pl crystal and the anti-Cry2{binding specifically to the P2 crystal. Intact crystals were evident in the gut of B. ovis after t hours' feeding on Bt. The crystals had not dissolved in the gut of B. ovis even though by this time post feeding the insects were paralysed or dead. This finding supports the results of Hill and Pinnock (1998) and those reported in Chapter 4 which showed that whole crystals of Bt strain WB3S16 were not toxic to B. ovis and suggests that entire crystals are not dissolved and activated in the midgut of B. ovis. Slight terminal erosion of crystals was evident in some micrographs and it was not possible to determine whether this was caused by crystal dissolution in the B. ovis midgut or was an artifact of the Bt preparation procedure. The anti-CrylA crystal protein antibody exhibited the greatest amount of binding to Bt and dissolved Cry14, Cry2A, and \ü83S16 crystal protein treated B. ovis sections, suggesting that B. ovis midgut cells bind more CrylA than Cry2A proteins. B. ovis midgut cells may possess a greater number of CrylA binding sites compared to Cry2A binding sites. The lower levels 90 Immunological Investigations of Cry1A antibody binding observed in sections from B. ovis fed WB3S16 dissolved crystals compared to sections from B. ovis fed dissolved CrylA was expected because strain WB3S16 crystals are comprised of a mixture of Cry1A and Cry2A proteins. Consequently, B. ovis fed dissolved strain WB3S16 crystals received a lower dose of Cry1A protein than those fed pure CrylA protein. It is possible that lower levels of CrylA binding may have resulted from heterologous competition between the CrylA and Cry2A crystal proteins for midgut cell receptors. It was necessary to use the anti-WB3S16 crystal protein antibody w¿s-used-¿t higher concentrations than the CrylA and Cry2A antibodies (l/50 compared to l/500 ot 11250 dilutions, respectively) as low levels of anti-WB3S16 crystal protein antibody binding were observed to tissue sections from B. ovis fed dissolved WB3S16 crystal protein. This may have been due to the low specificity of this polyclonal antibody for its antigen. In addition, the WB3S16 antibody was capable of recognising CrylA and Cry2A antigens as it was prepared by injecting rabbits with a mixture of these two proteins. Therefor, competition between different types of antibodies present in the WB3S16 crystal protein IgG globulin fraction for similar antigenic sites on midgut tissue sections may have occurred. Binding studies indicated that Cry14, Cry2A and WB3S16 ð-endotoxin crystal proteins were associated with the Bt spore coat, supporting the results of Section 6. 3. 2 and the findings of Delafield et aI. (1968); Somerville et aI. (1968) and Lecadet and Dedonder (1971). Khawaled et at. (1992) found thatAedes aegypti larvae digested spores and incorporated digested spore material into their larval tissues. Micrographs showed that V/B3S16 spores remained undigested in the B. ovis midgut after t hours. This finding is supported by the results of Chapter 4 in which spores were not toxic to B. ovis and caused death only through septicaemia. No evidence was found in this project to indicate that the 70kDa and 140kDa proteins associated with the Bt spore coat acted as toxins against B. ovis. Bacterial membrane material present in the lyophilised Bt preparation was evident in close proximity to the B. ovis microvilli in micrographs. This observation is consistent with the results of Chapter 4 in which louse toxicity was associated with the Bt strain WB3S16 bacterial membrane fraction. As discussed in Section 6. 4. 2, the l40kDa and 70kDa proteins, may be liberated from membranes by the action of B. ovis gut enzymes and may act as toxins against the insect. The 70kDa protein associated with crystal- mutants and the WB3S16 spore, membrane and supernatant fractions requires further investigation to determine whether it is a Cry2A protein, a degradation product of the CrylA protein or a combination of both. 9l Immunological Investigations 6.4.5 General Discussion In summary, the results of this study provide strong evidence that the Bt strain WB3S16 crystal proteins act as toxins against B. ovis. Crystal- mutants were significantly toxic to B. ovis and produced detectable arnounts of a 70kDa protein antigenically related to the crystal proteins of Bt strain WB3S16. The l40kDa and 70kDa membrane and spore fraction proteins and the 70kDa supernatant proteins were also immunologically related to crystal proteins of Bt strain WB3S16. A relationship between the proteins of these fractions is unconfirmed. These proteins may exist free in the Bt cell and become adsorbed to the Bt membranes ingested by B. ovis. In this way, crystal proteins may act as a toxin against B. ovis even though lice lack the ability to dissolve and activate entire ð-endotoxin crystals. Thus, incomplete incorporation of crystal protein into the ð-endotoxin crystal or over production of crystal protein may result in louse toxic Bt strains, The histopathological effects of the WB3S16 fermentation preparation and the dissolved CrylA, Cry2A and V/83S16 crystal proteins on the B. ovis midgut were similar and included midgut cell disruption and disintegration of microvilli. These effects paralleled those of the ð-endotoxin proteins in susceptible lepidopteran and coleopteran larvae. The immunogold labelling technique revealed significant binding of Cry1A and Cry2A proteins to the microvillar membrane of B. ovis, suggesting that these proteins may act as a toxin against B. ovis through a mechanism similar to that of the ð-endotoxin crystal proteins in susceptible larvae. The evidence reported above supports the original hypothesis of a relationship between the Bt strain WB3S16 louse toxin and the crystal proteins of this strain. The aim of the sequencing and expression experiments outlined in Chapter 7 was to verify and quantify the toxicity of Bt strain \ry83s16 CrylA and Cry2A proteins to B. ovis. 92 Genetics of Crystal Production in Bt Strain WB3S16 CHAPTER 7 Genetic Aspects of Crystal Production in Bacillus thuringiensis Strain wB3S16 7. I INTRODUCTION: 7. l. I The Role of Plasmids and cry Genes in Bt Strain V/83S16 Cloning and expression studies with Bt cry genes have shown that crystal protein is encoded on plasmids (Schnepf andWhiteley, 1981). Cry genes may be found on more than one plasmid in a given strain (Schnepf and rWhiteley, 1981; Klier et aI., 1982; Kronstad et aI., 1983) and may be conjugative (Carlton and GonzáIez, 1985), providing a mechanism for transfer between and within species (Cooper, t994). Up to 12 plasmids have been isolated from Bt subsp. kurstaki strain HD-l (Aronson et a1.,1986 ), including plasmids of 1.4, 4.9, 5.4,9.3, 10,29, 44, 52, 110 and 120MDa (Gonzâlez and Carlton, 1980) which contains cryl{a, cryl&c, cry2{agenes and a silent cry2!+b gene on a 110MDa plasmid with a cryLl+b gene on a self transmissible 44MDa plasmid (Baum and Malavar, 1995). Gonzá'Iez et al. (1981) isolated plasmids from Bt using a modified Eckhardt lysate electrophoresis method (Eckhardt, 1978) which allowed Bt cells to be lysed without degradation of circular covalently closed plasmids. Small (<10MDa) and large (>10MDa) plasmid molecules were detected and resolved on agarose gels. The authors used this method to compare plasmid profiles from acrystalliferous mutants with the parent strain, the plasmid patterns of which were already characterised (González and Carlton, 1980) and correlated the loss of crystal production with the absence of specific plasmids. Acrystalliferous mutants (crystal-) produced by heat curing Bt strain WB3S16 of cry gene carrying plasmids were described in Chapter 6 and provide an opportunity to investigate the hypothesis that the Bt strain WB3SI6 louse toxin is related or identical to the â-endotoxin crystal proteins produced by this strain. The N-terminal sequencing results of Chapter 5 indicate that Bt strain WB3SI6 produces both CrylA and Cry2A proteins. 'i'41...t from Bt strains WB3S16, HD-l, HD-2 and crystal- détérmine electrophoresis and these strains were assessed for the presence of cryLA and cry2L gene carrying plasmids. The method described by Southern (1975) was used in this study to 93 Genetics of Crystal Production in Bt Strain WB3S16 identify plasmids from Bt strain V/83S16 and crystal- strains which harboured DNA segments homologous to crylA andcry2{ genes. An attempt was made to correlate the presence of cry genes with the toxicity of Bt strain WB3S16 and its crystal- derivatives to B. ovis. genes 7 . l. 2 Sequencing of Bt Strain WB3S 16 cryLA and cry2A Traditional methods based on flagellar (H) serotypes (de Barjac and Bonnefor, 1973; de Barjac, 1981) and phenotypic characterisation (Heimpel and Angus, 1959), reviewed in Section I. 2. 2, are limited in their ability to distinguish between Bt subspecies and strains. Sequencing of cry genes has been adopted by Bt resea¡chers as an alternative and reliable method for classification of a Bt isolate. Comparison of cry sequences with published sequences enables ready classification of a Bt strain according to the class of crystal proteins and may indicate the uniqueness of cry genes and their encoded crystal proteins. A current list of the classes of sequenced cry genes can be obtained from the Bacillus genetic Stock Centre, Ohio State University at http://www.sussex.ac.uk/Users/bafnf6/bt. The biochemistry and structure of Cry1A and Cry2A proteins determined from cry gene sequences have been discussed in Section 1. 3. 4 and are important factors in determining their solubility characteristics and insecticidal properties. Bt subsp. kurstaki. strain HD-l is known to produce CrylAa, CrylAb, CrylAc and Cry2Aa and Cry2Ab proteins (Adang et aI., 1985; Schnepf et aI., 1985; Geiser et aI., 1986; Thorne et al., 1986; Kondo et al., 1987; Widner and Whiteley, 1989). The subclasses of Bt strain \VB3S16 cry genes have not previously been studied and the N-terminal sequencing results of Chapter 5 suggest that this strain possesses both crylA and cryZA genes. Preparations containing single â-endotoxin crystal proteins have been obtained through protein purification (Yamamoto and Mclaughlin, 1981), through the introduction by cloning or conjugation and expression of the correspondiîg cry genes in heterologous hosts, or by the use of Bt strains producing only one protein (Höfte et aI., 1988). Attempts to obtain highly purified samples of WB3S16 CrylA and Cry2A proteins using conventional separation techniques were unsuccessful in this project. In an alternative approach, the crylA and cry2A genes of Bt strain WB3S16 were cloned into the E. coli vectors pGEM@-t ana pCn-Scriptru and sequenced. Expression studies were undertaken in an attempt to obtain pure fractions of CrylA and Cry2A protein for use in bioassays against B. ovis. Sequence data were used to determine the subclass of crylA andcry2[ genes present 94 Genetics of Crystal Production in Bt Strain WB3S16 in this strain. Comparison of the deduced WB3S16 CrylA and Cry2A protein sequences with published Cry protein sequences provided information on the structure and biochemical nature of the \VB3S16 crystal proteins. The implications of these results for the lousicidal toxicity of strain WB3Sl6 crystal proteins are discussed. 7. 2 MATERIALS AND METHODS: 7. 2. I The Role of Plasmids and cry Genes in Bt Strain WB3S16 7. 2. l. I Isolation of Plasmid DNA From Bt Strain WB3S16 Plasmids were isolated from Bt strain WB3S16 and crystal- mutants (#5, #8, #9, #13, #18, #2O and #97) using a modified Eckhardt lysate method (Eckhardt, 1978) as described by Juttner (1993). Bacterial strains were grown in l0ml of Brain Heart Infusior¡/Glycine/Yeast Extract (BHIGYE) at32'C and 250rpm for approximately 12 hours. Brain Heart Infu sion/Gl)¡cine/Yeast Extract Brain Heart Infusion 3.770 wlv Glycine 0.3mM Yeast Extract O.5Vo wlv 200p1 of culture was used to inoculate a further l0ml of BHIGYE. This culture was grown to an optical density between 0.6 and 0.8 as determined by spectrophotometric analysis at 600nm. Four 1.5m1 aliquots of each strain were harvested by centrifugation in an eppendorf tube at 11,000xg for 20 seconds to collect a pellet which was resuspended in 100p1 TES buffer (Section 2. l3). 25pl of fresh lysozyme (Sigma) was added and tubes were incubated at37"C for 30 minutes. 200p1 of freshly made alkaline solution (Section 2. 13) was added and tubes were placed on ice for 10 minutes. L25¡tl of cold 3M NaAc was added, tubes were placed on ice for l0 minutes and then centrifuged at 11, 000xg for 15 minutes at 4"C. 4¡rl of l0mg/ml RNAase was added and the mixture was incubated at 37'C for t hour. Plasmid DNA was deproteinised by the addition of 400¡rl phenoUchloroform/iso-amyl alcohol and the tube was centrifuged at 11,000xg for 2 minutes. DNA was precipitated from the aqueous phase by addition of 150p1 of 3M NaAc and 800p1 ice cold iso-propanol. The precipitate was collected by centrifugation at 11, 000xg for 15 minutes and washed th¡ee times with 400p1 ice cold 807o ethanol. The DNA preparation was dried under vacuum and resuspended in 4pl sH2O. 95 Genetics of Crystal Production in Bt Strain WB3S16 The DNA preparation was diluted 2:5 in sH2O and 6x loading dye (Section 2. 13) was added prior to loading of the sample on a 0.8Vo TBE agarose gel containing O.5pg/ml ethidium bromide. g.5pg/mt ethidium bromide was added to the TBE electrophoresis buffer. Samples were run against a Lambda Hindnl phage standard as a reference at 50mA for 2 hours' The gel was viewed using a UV light source at 302 nm. 7. 2. l. 2 Southern Blot Analysis of Bt DNA With the assistance of Mr Juan Juttner from the University of Adelaide, Special Research Centre for Cereal Biotechnology, southern hybridisation analysis was performed to identify Bt strain WB3S16 and crystal- mutant strains having plasmid DNA with sequence homology to crylA and cry2{ DNA. Bt DNA samples were prepared, run on a O.8Vo TBE agarose gel and stained with ethidium bromide (Section 7. 2. 1. 1). The gel was washed in 200m1 denaturing solution (Section 2. 13) for 20 minutes, followed by 10x SSC (Section 2. 13) for 2 minutes and neutralising solution (Section 2. 13) for 20 minutes. The DNA was transferred from the gel to a Hybond N+ nylon membrane (Amersham) by southern transfer for 4 hours (Southern, 1975). The membrane was washed in 5x SSC for 2 minutes and fixed using 0.4M NaOH for 20 minutes. The membrane was then neutralised for 5 minutes in neutralising solution and washed in 2x SSC for 5 minutes. Purification and Radioactive Labelling of DNA Plasmid Probes Approximately 50ng of the 1900bp and 3550bp Bt crylA and cry2A DNA PCR products (prepared as described in Section7. 2. 3) were purified with Geneclean@ and labelled with 4¡ttþ-3ZpldCTP in 12.5p1 of 2x Oligolabelling Mix (Section 2. 13) and l¡tl(2 units) of Klenow enzyme (Promega) (Section 2. 13) and incubated at37"C for t hour. The labelled probes were separated from unincorporated nucleotides on Sephadex G-100 (Pharmacia) minicolumns prepared with TE buffer (Section 2. 13) in Pasteur pipettes. DNA from both probes was collected at a specific activity between 150-1000cps. Pre-hybridisation and Hybridisation Conditions The membrane was washed in 5x SSC for 1 minute, placed in a bottle and incubated with hybridisation solution (Section 2. 13) and then pre-hybridised for 6 hours at 65"C. The radioactively labelled probe, together with an additional 250mg of heat denatured salmon spenn ca¡rier DNA, was heat denatured by boiling for 5 minutes and then hybridised for 18 hours at 65'C. 96 Genetics of Crystal Production in Bt Strain WB3S16 Washing Conditions and Autoradiography The membranes were washed for 20 minutes each at 65"C in 2x SSC, 0.1% SDS; lx SSC, 0.17o SDS; 0.5x SSC, 0.17o SDS and 0.2x SSC, 0.17o SDS and were exposed on Fuji NIF X- ray hlm for 48 hours at -80"C and developed in a Curix developer. 7 . 2. 2 Sequencing of Bt Strain WB3S 16 cryl/^ and cry2A Genes Degenerate oligonucleotide primers were used to amplify the crylA and cry2A genes of Bt strain WB3S16 by PCR. Using a Promega cloning kit, amplified DNA segments were ligated into an E. coli plasmid vector, which was used to transform E. coli cells. The insert DNA was sequenced from the plasmid vector. The amplified DNA was also introduced into an E. coli expression vector (Ql{express pQE vector - Qiagen Inc.) in an attempt to obtain highly purified fractions of expressed Cry1A and Cry2A protein for use in bioassays against B. ovis. The PCR stategy used to amplify the WB3SL6 crytA andcry2[ genes is summa¡ised in Figure 7. l. Primers were designed to amplify both the N- and C-terminal portions and the entire crylA and cry2A genes of this strain. This cautious approach was selected as it enabled sequencing, comparative analysis and expression of the N- and C-terminal portions of the cryl| and cry2A genes, and in the event of the unsuccessful ligation of the entire crylA and cry2A genes, provided a means to fuse and introduce the DNA segments into an expression vector. Degenerate primers were specific to conserved regions of cryll^ and cry2A genes documented on the EMBL and genebank databases and stacked sequences detailed by Höfte and Whiteley, (1989). Primers were synthesised on an Applied Biosystems (ABI) Model392 at a scale of 200nmol and purified by gradient ion-exchange chromatography on an ICI HPLC system by Dr Neil Shirley of the University of Adelaide, Nucleic Acid and Protein Chemistry Unit. 97 -->]'3S F4 F1 F2 F3 + +> 3' cry 1A 5' -.> 3' cry2A 5' -> +- -{l- <- a- R4 RI R2 H3<- R3bS PCR PCR 800bp 1800bp Products Products 1700bp 1100bp 1950bp 1900bp 3500bp Figure 7. 1 PCR straregy used to amplify Bt strain wB3s16 crylA and cry2A genes. Genetics of Crystal Production in Bt Strain \ryB3S16 Table 7. 1 Forward and reverse oligonucleotide primer pairs used to amplify Bt strain WB3S 16 cryI A and cry2A genes. NAME PRIMER SEQUENCE NUCELOTIDE POSITION* Forward Oligonucleotide Primers F1 5' - ATA GTG TAT TGA ATA CCG GAA G - 3' 5 -26 AAT C F2 5' - ATT TAT ATG CAA GTG GTA GTG G - 3' -2-20 T G F3 5' - AAG AGA TGG AGG TAA CTT ATG G - 3' -18-4 F4 5'- TAG ATC GAA TTG AAT T'TG TTC C - 3 -5-r7 CATA F3S 5' - AAG AGA TGG AGG TAA CTT ATG G - 3' -18-4 Reverse Oligonucleotide Primers R1 5' - TAC CAC TTG CAT ATA AAT TAG C . 3' 8r7-837 AG c R2 5' - AGT GGT GGA AGA TTA GTT GG - 3' l06l-1080 R3 5' - T GTG CTC TTT CTA AAT CAT ATT C - 3' 1866-1889 C CG T R4 5'- CTG TCC ACG ATA AAT CTT CC - 3' 1690-1710 AG R3bS 5' - ACG TAA CTA AAT TGG ACA CTT G - 3' 1965-1987 * Nucleotides are labelled consecutively from the first base of the sequenced gene (Figures 7. 8 - 7. 1l). Negative numbers refer to bases upstream from the first base of the initiation codon of the sequenced gene. 98 Genetics of Crystal Production in Bt Strain WB3S16 PCR Reaction Plasmid DNA was extracted from Bt strain WB3S16 using the modified Eckhardt lysate method (Section 7. 2. l). TableT. 2 PCR reaction reciPe. 800bp 1100bp 1700bp 1800bp 1950bp 1900bp 3550bp 10x PCR buffer 9.5%ovlv 9.S%ovlv 9.S%ovlv 9.S%ovlv 9.SVovlv 9.S%ovlv 9.S%ovlv 25mMMgCl2 2.5mM 2.OmM 2.5mM 2.5mM 2.5mM 2.5mM 2.5mM 15mM dNTP 0.6mM 0.6mM 0.6mM 0.6mM 0.6mM 0.6mM 0.6mM pM Forward Primer 0.9pM 0.4pM 0.07pM 1.0pM 1.OpM 0.9pM 0.7pM pM Reverse Primer 0.45pM 0.06pM 1.lpM 0.3pM 0.3pM 0.6pM 0.3pM 0.5U/pl Taq pol 0.25U{¡lJ 0.25U1¡ll 0.25U1¡ú O.25Ulpl 0.25U1¡ú 0.25U|¡il 0.25Ulpl DNA(100ng) 2.5ngl¡t 2.5ngl¡il 2.5ngl¡ù 2.5ngl¡ld 2.Sngl¡il 2.5nglú, 2.SnelpJ TOTAL VOLUME 40pl 40pl 40pl 40pl 40pl 40pl 40rrl Amplification was conducted using an M. J. Research Inc. PCR PTC-100 Programmable Thermal Controller, with peltier-effect cycling. The reaction mixture was covered with 40pl mineral oil and pre-heated at 95'C for 5 minutes. Details of the PCR reaction used to amplify DNA fragments are provided below. The 800bpt, t tO0bpt, 1700bpf and 1800bpf fragments were extended for 4 minutes and the 1900bp$' 1950$bp and 3550bp$ fragments were extended for 5 minutes. Table 7. 3 PCR reaction conditions Pre-heat 95'C 5 mins Addition of Taq polymerase 75'C Denature cycle ) 95'C I min Anneal ) x 40 53'C l min Extend ) 72'C + mintlsmin$ Extension 72'C 20 min 99 Genetics of Crystat Production in Bt Strain WB3S16 PCR products were purified on a'WizardrM PCR Preps DNA Purification System column (Promega). Aliquots of the reaction mixture were analysed by LVo TBE agarose gel electrophoresis and the products were stained with ethidium bromide and visualised under UV light (Section2. l2). Ligation and Transformation The concentration of amplified fragments was determined by comparsion against a known concentration of Boehringer-Mannheim MW size standards IV and VI. The 800bp, 1100bp and 1700bp fragments were ligated into a pGEM@-T (Pharmacia) vector and the 1950bp into a pCR-ScriptrM (Stratagene) vector. Repeated attempts to ligate the 1800bp, 1900bp and 3550bp fragments into pGEM@-T, pcR-Scriptru andpT-ErOrM-2 (Invitrogen@¡ vectors were unsuccessful. Ligation Reaction TableT. 4 Ligation reaction conditions PCR Fragment 3.5pI 10xT4 DNA Ligase 0.5pl pGEM@-TlpCR-ScriptrM vector 0.5pl 10x T4 DNA Ligase Buffer 0.5trl The ligation was conducted overnight at RT. 2¡tl of the above ligation mixture was added to 50pl of JM109 E. coli highly competant cells (Promega) and the cells were placed on ice for 20 minutes. The cells were heat shocked at 42"C for 45 seconds and then 950m1 of SOC (Section 2. 13) was added per tube. The cells were incubated and gently agitated at 37'C and 200rpm for 1.5 hours. 200p1 and 800p1 of culture were separately plated out onto LA plates containing Ap, X-gal and IPTG (Section 2. 13). The plates were incubated for 24 hours at 37"C and the number of transformants (white colonies) were determined. DNA Isolation from E coli Cells,Insert Analysis and Sequencing Plasmid DNA was isolated from E. coli clones using the miniprep method of Sarrbrook et aI. (1939) described in Section 2. 11. Restriction enzymes were used to exise insert DNA as shown in Table 7. 5. 100 Genetics of Crystal Production in Bt Table 7. 5 Digestion reaction of miniprep plasmid DNA isolated from recombinant E. coli clones. pGEM@-t pCR-Script TM Apa I O.25¡tl Sac I 0.25pl Kpn I 0.25pI Sac II 0.25pl Buffer A 0.5pl 0.5pI sH20 3.0p1 3.0p1 E. colí miniprep plasmid DNA 1.0p1 1.0p1 l.gpl of the miniprep DNA sample was incubated with 4.0p1 of the digestion reaction mixture as indicated above, at 37'C for 3 hours. The size of the insert DNA was assessed by analysis of l.Qpl of the digested miniprep DNA on a l7o TBE agarose gel as described in Section 2. l l and 2. 12. Insert DNA was sequenced on an Applied Biosystems Sequencer Model 3734 using the di-deoxy method of Sanger et al. (1977) by Dr Neil Shirley, of the University of Adelaide, Nucleic Acid and Protein Chemistry Unit. Sequencing Strategy Following confirmation of succesful insertion of DNA into the vector, the DNA sequence of the inserts was determined twice in both the forward and reverse directions. Additional internal forward and reverse primers (Table 7 . 6) were designed to complete the sequencing of inserts using the strategy outlined in Figure 7. 2. 101 tr l7c CRY2 I.I F8'^' CR}'I Fl flrT tìl?B --Þ p800 -' 3' p1700 s' --+ --> --> 3' +- <--Rl7;\ <- <-R8A C]RY]+_ RI lì l7R CIìY I Rf cR]:2 [ì2 I]IIA CRY IF2 p1100 s' --> -+ 3' p1850 5' --> 3' +- +- <- <- {- RI IA CRY2 R2 R t95IÌ R 19.5¡\ clìI r lì2 Figure 7. 2 Sequencing strategy for Bt strain \VB3S 16 cryIA and cry2A genes Genetics of Crystal Production in Bt Strain WB3S16 Table 7. 6 Internal oligonucleotide sequencing primer pairs used to sequence Bt strain \VB3S I 6 cryl A and cry2A genes. NAME PRIMER SEQUENCE NUCLEOTIDE POSITION* Forward Oligonucleotide Sequencing Primers F8A 5'- CCT AGT GGT AGT ACA AAT C - 3' 246 -263 Fl1A 5'- GGC AGA CAG AAT CCT TTC. 3' 359 - 277 F17A 5'- AGG CGA TGA CGT ATT CAA AG - 3' 336 - 355 F17B 5'- GGG ATG GAG AAA ACT GTG A - 3' 653 - 671 F17C 5'- CGT ACA AGG AGG GAT ATG G - 3' 1308 - 1326 F1954 5'- TAG AGA GTG GGA AGC AG 3' 341 - 358 F1958 5' . CGG AT.T CTA GAG ATT GGG 3' 630 - 648 Reverse Oligonucleotide Sequencing Primers R8A 5'- TAA ACG CAC TTT GAT ACG - 3' 676 - 693 Rl1A 5'- CCG GAG TTT AAT GTC AC - 3' 1026 - 1009 R17A 5' - GCA CCT CCG TAT TCT TCT TG - 3' 1468 - t449 R178 5'- TCA CAG ACA GCT CAG G - 3' 1053 - 1037 R1954 5'- GCC TGA ATT GAA GAC ATG AG 3' r45t - 1432 R1958 5' . CCA GAG CCA AGA TTA GTA G 3' 1778 - 1759 * Nucleotides are labelled consecutively from the first base of the sequenced gene (Figures 7. 8 - 7. ll). The DNA sequence of the 800bp, 1100bp, l950bp and 1700bp gene fragments was translated and analysed using the Lasergene DNAstar@ DNA analysis program. The amino acid sequences deduced from these gene fragments were aligned with published CrylA and Cry2A protein sequences, and a BLAST alignment using the S\MISS-PROT protein sequence database at GenomeNet (Tokyo centre) was used to determine the similarity of Bt strain WB3S16 CrylA and Cry2A proteins with these sequences. Chou-Fasman (1978) and Kyte- lo2 Genetics of Crystal Production in Bt Strain WB3S16 Doolittle (L982) analysis was used to predict cr and ß regions and hydrophobic domains in the proteins translated from the gene fragments. 7. 3 REST]LTS: 7. 3. I The Role of Ptasmids and cry Genes inBt StrainWB3S16 The plasmid DNA profiles of Bt strains WB3S16, HD-1 and HD-2 and of the crystal- mutant strains #8, #9, #5, #g'7, #18 and #20 are shown in Figure 7. 3 and represented schematically in Figure 7. 4. The largest number of plasmids (9 in total), were isolated from Bt strain WB3S16 and single plasmids of greater than 24kb and of approximately 24kb, l8kb, 17kb, 8.5kb, 5kb, 4.5 kb, 2kb and 1.4kb were evident. Strain HD-l exhibited a similar plasmid profile to WB3S16. However, the 8.5kb plasmid and the plasmid of greater than 24kb were not evident. Six plasmids were evident in the profile of strain H.D-z which was similar to that of strain \V83S16. However, the WB3S16 DNA bands of 4.5kb, 2kb and 1.4kb were not evident in the profîle of strain HD-z. Plasmids of greater than 24kb and of 8.5kb were evident only in Bt strains V/B3S16 and HD-2. Fewer plasmids were evident in the DNA isolated from crystal- strains compared to the WB3S16 parent strain. Seven plasmids of 24kb,l8kb, 17kb, 5kb,4.5kb, 2kb and 1.4kb were evident in the DNA isolated from crystal- strains #18 and #20. Plasmids of greater than 24kb and of 18kb, 8.5kb and 5kb were not present in crystal- strains #5 and #97. In addition to these five plasmids, plasmids of l7kb, 4.5kb and 1.4kb were absent in the crystal- strains #8 and #f9. Plasmids of 24kb and 2kb were common to all crystal- strains and to WB3S16, HD-l and HD-2. The strain IWB3S16 plasmids of 8.5kb and of greater than 24kb were not presQnl in the DNA profiles of any crystal- strains. A 3.5kb plasmid was evident in the DNA of ) -/ strains #8 and #9 only. The 1900bp cryZ[probe hybridised strongly to DNA of a24kb plasmid in strains WB3S16, HD-2 and HD-l and weakly to DNA of the same size in all crystal- strains (Figure 7. 5). The 3550bp crylLprobe hybridised strongly to DNA of 24kb in strains WB3S16, HD-2 and HD- I and weakly to DNA of the same size in all crystal-strains (Figure 7. 5). Both probes hybridised strongly to DNA which remained in the wells after electrophoresis. 103 Genetics of Crystal Production in Bt Strain WB3S16 Figure 7. 3 Agarose gel electrophoresis of plasmid DNA from Bt strains V/B3S16, HD-1 and HD-2 and crystal- strains. Lane l, Lamda Hindln size ma¡ker;2,Bt subsp. kurstaki strain WB3S16; 3, Bt subsp. kurstaki strain HD-1; 4, Bt subsp. thuringiensis strain HD-2; Bt crystal- mutant strains, Lane: 5, #8; 6, 119; 7 , #5; 8, #97;9, #18; lO, lt20; I 1, Lamda HindIII size ma¡ker. bp | 2 3 4 5 6 7 I 9 l0ll * r¡ 23,644- 9,58E - 6,742 - 4,467 - 2,298 - 1,974 - Genetics of Crystal Production in Bt Strain \MB3S16 Lamda Híndlll \MB3S16 HD-lHD-z I 9 5 97 18 20 (bp) 23,644 9,588 6,742 41467 2,298 1r974 Figure 7. 4 Schematic representation of the plasmid profile of Bt strains \ry83s16, HD-l and HD-2 and crystal- mutants # 8, 9, 5,97, 18 and 20 run against the Lamda HindIfI size standard. 104 Genetics of Crystal Production in Bt Strain WB3S16 Figure 7. 5 a) Hybridisation of the l900bpcry2A probe with plasmid DNA from Bt strain \VB3S16 and crystal- strains. Lane: 1, Bt subsp. kurstaki strain WB3S16; 2,Bt subsp. thuringiens¿s strainHD-2 3,Btsubsp.kurstakistrainHD-l;Btcrystalstrains:4,#8;5,#9; 6, #5; 7, ll97 ; 8, #18; 9, #2O. \ b) Hybridisatioq of the 3550bp cryl| probe with DNA from Bt strain WB3S16 and crystal- strains. Lane: 1, Bt subsp. kurstaki strain WB3S16; 2, Bt subsp. thuringiensis strain HD-2;3, Bt subsp. kurstaki strain HD-l; Bt crystal- strains, Lane: 4, #8; 5, l*9; 6, #5; 7, l*97 ; 8, #18; 9, #20. a) 123456189 24kb b) 123456789 24kb Genetics of Crystal Production in Bt Strain WB3S16 7. 3. 2 Sequencing of Bt Strain WB3S16 cryl{and cry2{ Genes The PCR reaction successfully amplified the gene fragments of expected sizes of 800bp, l100bp, 1700bp, 1800bp, 1900bp, 1950bp and 3550bp from the DNA of Bt strain V/B3Sl6 (Figure 7. 6 (a), (b) ¿nd (c)). The absence of contaminating DNA bands in thcse samplcs and in control samples (PCR reaction components excluding Bt strain WB3S16 DNA) indicated that the PCR products were not contaminated with DNA from extraneous sources. The DNA nucleotide sequences and deduced amino acid sequences of the Bt strain WB3S16 1950bp and 1700bp cryIA andthe 800bp and 1100bp cry2{ gene fragments are given in Figures 7. 7 - 7. 10. Results showed that the 800bp, l100bp, 1950bp and 1700bp gene fragments were composed of 838, 1077, 1953 and 1709 nucleotides, respectively. The four gene fragments coded for polypeptides of 279,359,657 and 569 amino acids, respectively. BLAST results using the SIMISS-PROT protein sequence database at GenomeNet (Tokyo centre), summarised in Table 7. 7, showed that the amino acid sequences deduced from the 1950bp and 1700bp gene fragments were highly homologous to CrylAa and CrylAc crystal proteins, respectively. Similarly, the amino acid sequence deduced from the 800bp gene fragment was highly homologous to a Cry2Ìrb protein (Dankoscik et al., 1990), whilst that from the 1100bp gene fragment was completely homologous to a Cry2fua protein (Donovan et aI., l9S9). These results are reflected in the protein aligments shown in Figures 7 . II to 7 . 14. Table 7. 7 BLAST sequence homology of protein sequences deduced from the WB3S16 crylLand cry2A 5' and 3' terminal gene fragments to published crystal protein sequences. Protein Reference Accession 800bp 1100bp 1700bp 1950bp Number Cry2A. Cry2A CrylA CrvlA CrylAa Schnepf et al. (1985) Ml1250 96.ÙVo 99.5Vo CrylAb V/abiko et al. (1986) M13898 92.17o 89.7Vo CrylAc Adang et al. (1985) Ml1068 99.5Vo 76.ZVo Cry2Aa Donovan et al. (1989) M31738 88.27o l00.ÙVo Cry2Ab Dankocsik et al. (1990) x55416 98.97o 86.9Vo BLAST sequence homology conducted using the SWISS-PROT protein sequence database at GenomeNet (Tokyo Centre). NCBVGenBanlc/EMBL Nucleotide Sequence Data Libraries accession numbers are listed. 105 Genetics of Crystal Production in Bt Strain WB3S16 Figure 7. 6 PCR amplification of.cryl[andcryZ[ gene fragments. (a) Lane: 1, Boehringer-Mannheim VI lvtw standard; Amplified PCR fragments: 2, 800bp; 3, control; 4, 1l00bp; 5, control; 6, 1700bp; 7, control; 8, 1800bp; 9, control; 10, Boehringer-Mannheim VI MW standard. (b) Lane: 1, Boehringer-Mannheim IV MW standardi2, amplified 1950bp cryIA PCR fragment; 3, control. (c) Lane: 1, Boehringer-Mannheim VI MW standard:'2, 1900bpcry24 gene fragment; 3, 3550bpcry lA gene fragment;4, Boehringer-Mannheim VI MW standard. a) bp I 2 3 4 56 7 E 9 l0 2176 - 1766 - 1230 - 1033 - ó53 5t7 453 394 298 234 b) c) bp t23 bp l2 3 4 19 329. r) t9 329- 7 742 al> 7742 - 5 526 .D ss26 - 4254 4254 - 3 140 3 140 2 690 t ó90 2 322 -lD 2 ltt I 8E2 ,- I 882 1489 - l4E9 - tl50 - ll50 - 925 925 697 697 Genetics of Crystal Production in Bt Strain WB3S16 CTTATGGATAACAATCCGAACATCAATGAATGCATTCCTTATAAÏTGTTTAAGTAACCCTGAAGTAGAAGTATTAGGTGG 80 LI1D N NP N I N EC I P Y NC LSN PE V E VL G G AGAAAGAATAGAAACTGGTTACACCCCAATCGATATTTCCTTGTCGCTAACGCAATTTCTTTTGAGTGAATTTGTTCCCG 160 ER I ETGYTP I D I SLSLTOFLLSEFVP GTGCTGGATTTGTGTTAGGACTAGTTGATATAATATGGGGAATTTTTGGTCCCTCTCAATGGGACGCATTTCTTGTACAA 240 GAGFVLGLVD I I WG I FGPSOWDAFLV O ATTGAACAGTTAATTAACCAAAGAATAGAAGAATTCGCTAGGAACCAAGCCATTTCTAGATTAGAAGGACTAAGCAATCT 320 I EOL I NOR I EEFARNOA I SRLEGLSNL TTATCAAATTTACGCAGAATCTTTTAGAGAGTGGGAAGCAGATCCTACTAATCCAGCATTAAGAGAAGACATGCGTATTC 4OO Y O I Y A E S F R E W E A D P T N P A L R E D I,I R I AAÏTCAATGACATGAACAGTGCCCTTACAACCGCTATTCCTCTTTTGGCAGTTCAAAATÏATCAAGTTCCTCTTTTATCA 48O O F N D I'1 N S A L T T A I P L L A V O N Y O V P L L S GTATATGTTCAAGCTGCAAATÏTACATTTATCAGTTTTGAGAGATGTTTCAGTGTTTGGACAAAGGTGGGGATTTGATGC 560 V Y V O A A N L H L S V L R D V S V F G O R \./ G F D A CGCGACTATCAATAGTCGTTATAATGATTTAACTAGGCTTATTGGCAACTATACAGATTATGCTGTACGCTGGTACAATA 640 AT I NSRYNDLTRL I GNYTDYAVR\./YN CGGGATTAGAACGTGTATGGGGACCGGATTCTAGAGATTGGGTAAGGTATAATCAATTTAGAAGAGAATTAACACTAACT 720 T G L E R V W G P D S R D I./ V R Y N O F R R E L T L T GTATTAGATATCGTTGCTCTGTTCCCGAATTATGATAGTAGAAGATATCCAATTCGAACACTTTCCCAATTAACAAGAGA 8OO VLD I VALFPNYDSRRYP I RTVSOLTRE AATTTATACAAACCCAGTATTAGAAAATTTTGATGGTAGTTTTCGTGGAATGGCTCAGAGAATAGAACAGAATATTAGGC 880 I YTNPV LENFDGSFRGNAOR I EON I R AACCACATCTTATGGATATCCTTAATAGTATAACCATTTATACTGATGTGCATAGAGGCTTTAATTATTGGTCAGGGCAT 960 O P H L I,I D I L N S I T I Y T D V H R G F N Y I.I S G H CAAATAACAGCTTCTCCTGTAGGGTTTTCAGGACCAGAATTCGCATTCCCTTTATTTGGGAATGCGGGGAATGCAGCTCC IO4O O I TASP V GFSGPEFAFPLFGNAGNAAP ACCCGTACTTGïCTCATTA4CTGGTTTGGGGATTTTTAGAACATTATCTTCACCTTTATATAcAAcAATTATACTTccTT I 120 PVLVSLTGLG I FRTLSSPLYRR I I LG CAGGCCCAAATAATCAGGAACTGTTTGTCCTTGATGGAACGGAGTTTTCTTTTGCCTCCCTAACGACCAACTTGCCTTCC I2OO SGPNNO ELFV LD GT EFSFA SLT TNLP S ACTATATATAGACAAAGGGGTACAGTCGATTCACTAGATGTAATACCGCCACAGGATAATAGTGTACCACCTCGTGCGGG I280 T I YRORGTVDSLDV I PPODNSVPPRAG ATTTAGCCATCGATTGAGTCATGTTACAATGCTGAGCCAAGCAGCTGGAGCAGTTTACACCTTGAGAGCTCCAACGTTTT I360 FSHRLSHVTMLSOAAGAVYTLRAPTF CTTGGCAGCATCGCAGTGCTGAATTTAATAATATAATTCCTTCATCACAAATTACACAAATACCTTTAACAAAATCTACT I44O SWOHRSAEFNN I I PSSO I T O I PLTKST AATCTTGGCTCTGGAACTTCTGTCGTTAAAGGACCAGGATTTACAGGAGGAGATATTCTTCGAAGAACTTCACCTGGCCA I52O NLGSGTSVVKGPGFTGGDILRRTSPGO GATÏTCAACCTTAAGAGTAAATATTACTGCACCATTATCACAAAGATATCGGGTAAGAATTCGCTACGCTTCTACTACAA I600 ISTLRVNITAPLSORYRVRIRYASTT ATTTACAATTCCATACATCAATTGACGGAAGACCTATTAATCAGGGTAATTTTTCAGCAACTATGAGTAGTGGGAGTAAT I680 N LO F H T S I D G R P I N O G N FS AT I,I S S G S N TTACAGTCCGGAAGCTTTAGGACTGTAGGTTTTACTACTCCGTTTAACTTTTCAAATGGATCAAGTGTATTTACGTTAAG 1760 LOSGSFRTVGFITPFNFSNGSSVFTLS Genetics of Crystal Production in Bt Strain \ry83s16 TGCTCATGTCTTCAATTCAGGCAATGAAGTTTATATAGATCGAATTGAATTTGTTCCGGCAGAAGTAACCTTTGAGGCAG 1 840 AHVFNSGNEVY I DR I EFVPAEVTFEA AATATGAfTTAGAAAGAGCACAAAAGGCGGTGAATGAGCTGTTTACTTCTTCCAATCAAATCGGGTTAAAAACAGATGTG 1920 EYDLERAOKAVNELFTSSNOIGLKTDV ACGGATTATCATATTGAfCAAGTGTCCAATTTA 1953 TDYHIDOVSNL Figure 7. 7 DNA nucleotide sequence and deduced amino acid sequence of the 1950bp fragment of the Bt strain WB3S16 cryt[gene. The one letter amino acid code has been used. Genetics of Crystal Production in Bt Strain WB3S16 80 GACAGAATTGAATTTGTTCCAGTTACTGCAACACTCGAGGCTGAATATAATCTGGAAAGAGCGCAGAAGGCGGTGAATGC DR I EFVP VTATLEAEYNLERAOKAVNA 160 GCTGTTTACGTCTACAAACCAACTAGGGCTAAAAACAAATGTAACGGATTATCATATTGATCAAGTGTCCAATTTAGTTA LFTSTNOLGLKTNVTDYHIOOVSNLV GACTCAGTGAC 240 CGTATTTAT C GGATGAA TTTTGTCTGGATGAAAAGCGAGAATTGTCCGAGAAAGTCAAACATGCGAAAC TYLSDEFCLDEKRELSEKVKH AKRLSD GAAC GCAATTTACTCCAAGATTC AAATTTCAAAGACATTAATAGGCAACCAGAAC GTGGGTGGGGC GGAAGTACAGGGAT 320 ERNLLODSNFKDINROPERGWGGSTGI TATC CAACAT rl00 TAC CATC CAAGGAGGGGATGAC GTATTC AAAGAAAATTACGTCACAC TATCAGGTAC CTTTGATGAGTGC TIOGGDDVFKENYVTTSGTFDECYPT ATTTGTATCAAAAAATC GATGAATCAAAATTAAAAGC CTTTAC CC GTTATCAATTAAGAGGGTATATCGAAGATAGTCAA 480 YLYOK I DESKLKAFTRYOLRGY I EDSO GACTTAGAAATC TATTTAATTCGCTAC AATGCAAAACATGAAACAGTAAATGTGC CAGGTAC GGGTTCCTTATGGC CGC T 560 DLE I YL I RY NAK HE T V N V PGT GSLWP L TTCAGC CCAAAGTC CAATCGGAAAGTGTGGAGAGCCGAATCGATGC GCGCCACACCTTGAATGGAATC CTGACTTAGATT ô40 SAOSP I GKC GEPNRCAPHLEWNPDLD GTTCGTGTAGGGATGGAGAAAAGTGTGCCCATCATTCGCATCATTTCTC CTTAGACATTGATGTAGGATGTACAGACTTA 720 CSCRDGEKCAHHSHHFSLD]DVGCTDL AATGAGGACC TAGGTGTATGGGTGATCTTTAAGATTAAGAC GCAAGATGGGCACGCAAGACTAGGGAATCTAGAGTTTCT 800 NEDLGVWVIFKIKTODGHARLGNLEFL CGAAGAGAAAC CATTAGTAGGAGAAGC GC TAGCTC GTGTGAAAAGAGCGGAGAAAAAATGGAGAGACAAACGTGAAAAAT 880 EEKPLVGEALARVKRAEKKWRDKREK TGGAATGGGAAACAAATATCGTTTATAAAGAGGCAAAAGAATCTGTAGATGCTTTATTTGTAAACTCTCAATATGATCAA 960 LEWETN I V YKEAKESVDALF VNSOYDO TTACAAGCGGATACGAATATTGCCATGATTCATGCGGCAGATAAAC GTGTTCATAGCATTCGAGAAGCTTATCTGCCTGA 1040 tO A D T N I A I'I I I{ A A D K R V H S I R E A Y L P E GCTGTCTGTGATTC CGGGTGTCAATGCGGCTATTTTTGAAGAATTAGAAGGGCGTATTTTCACTGCATTCTCCCTATATG r 120 LSV I PGV NAA I FEELEGR I FTAFSLY ATGCGAGAAATGTCATTAAAAATGGTGATTTTAATAATGGCTTATCCTGCTGGAACGTGAAAGGGCATGTAGATGTAGAA I2OO DARNV I KNGDFNNGLSCI./NV KGHVDV E GAACAAAACAACCAACGTTCGGTCCTTGTTGTTCCGGAATGGGAAGCAGAAGTGTCACAAGAAGTTCGTGTCTGTCCGGG 128O EON N OR S V L V V P EVJE AE V S O E V R V C P G TCGTGGCTATATCCTTCGTGTCACAGCGTACAAGGAGGGATATGGAGAAGGTTGCGTAACCATTCATGAGATCGAGAACA I360 RGY I LRV TAYKEGYGEGCV T i HE I EN ATACAGACGAACTGAAGTTTAGCAACTGCGTAGAAGAGGAAATCTATCCAAATAACACGGTAACGTGTAATGATTATACT I 440 NTDELKFSNCVEEE I YPNNT VTCNDY T GTAAATCAAGAAGAATACGGAGGTGCGTACACTTCTCGTAATCGAGGATATAACGAAGCTCCTTCCGTACCAGCTGGTTA I 520 VNOEEYGGAYTSRNRGYNEAPSVPAG Y TGCGTCAGTCTATGAAGAAAAATCGTATACAGATGGACGAAGAGAGAATCCTTGTGAATTTAACAGAGGGTATAGGGATT 1 600 ASV YEEK SYTDGRRENPCEFNRGYRD ACACGCCACTACCAGTTGGTTATGTGACAAAAGAATTAGAATACTTCCCAGAAACCGATAAGGTATGGATTGAGATTGGA I 680 YTP L P V G Y V TKEL E Y F P ET O K VVJ I E I G GAAACGGAAGGAACATTCATCGTGGACAG 1709 ETEGTFIVDR Figure 7. 8 DNA nucleotide sequence and deduced amino acid sequence of the 1700bp fragment of the Bt strain WB3S 16 cryly'^ gene. The one letter amino acid code has been used. Genetics of Crystal Production in Bt Strain WB3S16 8O GATTATAGTGTATTGAATAGCGGAAGAACTACTATTTGTGATGCGTATAATGTAGCGGCTCAAGATCCATTTAGTTTTCA DYSVLNSGRTT I CDAYNVAAOOPFSFO ACACAAATCATTAGATACCGTACAAAAGGAATGGACGGAGTGGAAAAAAAATAATCATAGTTTATACCTAGATCCTATTG I60 H K S L D T V O K E t¿/T EW K K N N H S L Y L D P I TTG GAACTGTGGCTAGTTTTCTGTTAAAGAAAGTGGGGAGTCTTGTTGGAAAAAGGATACTAAGTGAGTTACGGAATTTA 240 VGTVASFLLKKVGSLVGK RILSELRNL TC C TGAATCAAAGAC TTAATAC 320 ATATTTC C TAGTGGTAGTACAAATC TAATGCAAGATATTTTAAGAGAGACAGAAAAAT I FP S G S T N L 11 O D I L R E T E K F L N O R LN T AGACACTC TTGCC CGTGTAAATGCGGAATTGACAGGGCTGCAAGCAAATGTAGAAGAGTTTAATCGACAAGTAGATAATI 400 DTLARVNAELTGLOANVEEFNROVDN TTTTGAAC C CTAACC GAAACGCTGTTC CTTTATCAATAAC TTCTTCAGTTAATACAATGCAACAATTATTTCTAAATAGA 480 FLNPNRNAVPLSITSSVNTMOOLFLNR TTACCC CAGTTC C AGATGCAAGGATAC CAACTGTTATTATTAC CTTTATTTGCACAGGCAGC CAATTTACATCTTTCTTT 560 LPOFOMOGYOLLLLPTFAQAANLHLSF TATTAGAGATGTTATTCTAAATGCAGATGAATGGGGAATTTCAGCAGCAACATTAC GTAC GTATCGAGATTACTTGAAAA 640 I R D V I L N A D EÌ'/G I S AATL R T Y R D Y L K ATTATACAAGAGATTAC TCTAACTATTGTATAAATACGTATCAAAGTGC GTTTAAAGGTTTAAACACTCGTTTACAC GAT 720 NYTROYSNYCINTYOSAFKGLNTRLHD ATGTTAGAATTTAGAACATATATGTTCTTAAATGTATTTGAGTATGTATCTATCTGGTCGTTGTTTAAATATCAAAGTCT 800 M L E F R T Y I'I F L N V F E Y V S I VJ S L F K Y O S L TCTAGTATCTTCCGGTGCTAATTTATATGCGAGTGGTA 838 LVSSGANLYASG Figure 7. 9 DNA nucleotide sequence and deduced amino acid sequence of an 800bp fragment of the Bt strain WB3S16 cry2{ gene. The one letter amino acid code has been used. Genetics of Crystal Production in Bt Strain WB3S16 TTATATGCGAGTGGTAGTGGACCACAGCAGACACAATCATTTACAGCACAAAACTGGCCATTTTTATATTCTCTTTTCCA 80 LYASGSGPOOTOSFTAONWPFLYSLFO AGTTAATTCGAATTATATATTATCTGGTATTAGTGGTACTAGGCTTTCTATTACCTTCCCTAATATTGGTGGTTTACCGG 160 VNSNYILSGISGTRLSITFPNIGGLP GTAGTACTACAACTCATTCATTGAATAGTGCCAGGGTTAATTATAGCGGAGGAGTTTCATCTGGTCTCATAGGGGCGACT 240 GSTTTHSLNSARVNYSGGVSSGLIGAT AATCTCAATCACAACTTTAATTGCAGCACGGTCCTCCCTCCTTTATCAACACCATTTGTTAGAAGTTGGCTGGATTCAGG 320 NLNHNFN C S T V LPP LST PF V R SWLDS G TACAGATCGAGAGGGCGTTGCTACCTCTACGAATTGGCAGACAGAATCCTTTCAAACAACTTTAAGTTTAAGGTGTGGTG 4OO TDREGVATSTNWOTESFOTTLSLRCG CTTTTTCAGCCCGTGGAAATTCAAACTATTTCCCAGATTATTTTATCCGTAATATTTCTGGGGTTCCTTTAGTTATTAGA 480 AFSARGNSNYFPDYF I RN I SGVPLV i R AACGAAGATCTAACAAGACCGTTACACTATAACCAAATAAGAAATATAGAAAGTCCTTCGGGAACACCTGGTGGAGCACG 560 NEDLTRPLHYNOIRNIESPSGTPGGAR GGCCTATTTGGTATCTGTGCATAACAGAAAAAATAATATCTATGCCGCTAATGAAAATGGTACTATGATCCATTTGGCGC 640 AYLVSVHNRKNN I YAANENGTM I HLA CAGAAGATTATACAGGATTTACTATATCGCCAATACATGCCACTCAAGTGAATAATCAAACTCGAACATTTATTTCTGAA 720 PEDYTGFT I SP I HATOVNNOTRTF I SE AAAlTTGGAAATCAAGGTGATTCCTTAAGATTTGAACAAAGCAACACGACAGCTCGTTATACGCTTAGAGGGAATGGAAA 8OO KFGNOGDSLRFEOSNTTARYTLRGNGN TAGTTACAATCTTTATTTAAGAGTATCTTCAATAGGAAATTCAACTATTCGAGTTACTATAAACGGTAGAGTTTATACTG 880 SYNLYLRVSS I GNST I RVT I NGRVYT TTTCAAATGTTAATACCACTACAAATAACGATGGAGTTAATGATAATGGAGCTCGTTTTTCAGATATTAATATCGGTAAT 960 VSNVNTTTNNDGVNDNGARFSD I N I GN ATAGTAGCAAGTGATAATACTAATGTCACACCGCTAGATATAAATGTGACATTAAACTCCGGTACTCCATTTGATCTCAT 1O4O I V A S D N T N V T P L D I N V T L N S G T P F D L I'I GAATATTATGTTTGTGCCAACTAATCTTCCACCACTA 1077 NIIlFVPTNLPPL Figure 7. 10DNA nucleotide sequence and deduced amino acid sequence of an 1100bp fragment of the Bt strain WB3S16 cryZA gene. The one letter amino acid code has been used. q¡-ylÀ 1950h fi:agrrent MDNNPN rNE C I P YNC L S NP EVEVLGGER I ETGYT P I D I S L S L T QF LLSE F50 CrtÉÂaN termirn:s MDNNPN I NE C I P YNC L S N PEVEVLG G E R I E TG YT P I D I S L S L T QF LLSE F50 trylåbN termirn:s M DNN PN f NE C f P YNC L S N P EVEVLG G E R I E TG YT P I D I S L S L T QF LLSE F50 q1¡1ÀcNtermi¡n:s MDNNPN I NE C I PYNC L SNPEVEVLGG ER I ETGYT P I D I S L S LT QF LLSE F50 qr¡ß, 1950þ f::agrrurt V P G A G F V L G L V D f I V'IGIFGP SQ $TDAF LVQ I E Q L I NQ R I EEFARNQA I S RL 1OO E S RL 1OO C?l¡LAa N terrni¡rus V P G A G F V L G L V D I I WGIFGP SQ I¡¡DATE]VQ I E Q L T NQ R I E FARNQA I CrjrlÄbNtermi¡ms VPGAGFVLGLVD I I V'IGIFGP sQ V'rDAF LVQ r E Q L I NQR I EEFARNQA I S RL 100 OryLAcN termirn¡s VPGAGFVLGLVD I f V'fGIFGP sQ WDAF LVQ I E Q L I NQR I E E FARNQA I S RL 1OO D T 150 CylA 1950bp fragrrenÈ EGLSNLYQIYAE s FR E V'l E A DP TN PALREDMRI QF N MN SA LT AIPLLAV qÉåa N tenni¡n:s EGLSNLYQIYAE S FR EW E A DP TN P À L R EIEIM R I QF N D MN SA LT T ÀIPLLAV 150 l-so N termirn:s EGLSNLYQIYAE s FR EW E A DP TN PALnnIeIMRI QF N D MN SA LT T ArPllilev eylÂb rso ClrylAc N termi-lrus EGLSNLYQIYAE S FR EW E A DP TN PALREIEIMRI QF N D MN SA LT T AIPIIdEV 1-950þ fi:agnstt QNYQVPLLSVYV a AA NL H L sv LR DVSVFGQRVÙ GF D A AT IN SR Y NDLTRLT 2OO eyß 2OO G:¡flÀa N tenni¡n:s QNYQVPLLSVYV a AA NL H L sv LR DVSVFGQRVÙ GF D A AT IN SR Y NDLTRLT trylAb N termi¡n:s QNYQVPLLSVYV o AA NL H L sv LR DVSVFGORW GF D A AT rN SR Y NDLTRLI 2OO 2OO 4ry1Àc N tenni¡nrs QNYQVPLLSVYV o AA NL H L SV LR DVSVFGQRV'f GF D A AT IN SR Y NDLTRLI 250 frJ¡l-A 1950tp f::agrrstÈ GNYTDYAVRWYN T GL ER V W GP DS RDü¡VRYNQF RR E L TL TV LD I VALFPNY 250 frylAa N termirn:s GNYTDYAVRWYN T GL ER V hI GP DS RDV'IVRYNQF RR E L TL TV LD I vÀLrBnY F P N Y 250 Clry1Ab N termirn:s G N Y T DEA V R !ìT Y N T GL ER v w GP DS R D WER Y N Q F RR E L TL TV LD I VEL 250 fr121Àc N termi¡n¡s GNYTDYAVRWYN T GL ER v I/,ù GP DS RDtt¡VRYNQF RR E L TL TV LD I VALFPNY E N 300 orylÀ 1-9501æ fragrrerrt D s RRY P I RTV S Q L T RE I Y TN PVL E NF DG S F RGMAQ R I a TRQPHLMDIL CrVf¡"N termi¡nrs D S RRY P I RTV S Q LT RE I Y TN PVL ENF D G S F RGMAQ R I E N IRQPHLMDIL 3OO cïylAbN rermi¡n:s ;;;E;; i R rv s Q L r RE r Y rN Pv L E N F D G s F lg[9] qlql: TRISìPHLMDIL 3OO orrf¡" N tennirn:s D s RRy P r RTv s Q L T RE r Y TN PvL ENF DG s F RGlslAQlGJr E TRIEIPHLMDTL 3oo L 349 1950fp f::agrrænt N s I T I Y T D v H R G FN YI¡IS GHQ I TAS PVGF S G PE FAF P LFG NAGNAAPP eylÀ L 349 ey1.AaN termi¡n:s NS I T I YTDVHRG FN YWS GHQ I TAS PVGF SG PEFAF PLFG GNAAP N S I T I YTo[4H RG EY ; üü ; c H õ r[MlÀ s p vc F s c P E rldlr P tltlc GNAAP QQRI 350 eylAbN termí¡n:s 350 Gy1ÀcN termirn:s NS I T I YTDIÀHRG YY Y !4, s G H Q rME S P V G F S G P E FI-TIF P LIIIG GNAAP CYylÀ L950h fragrrart VSLTGLG rF RTLSSPLYR R III,GS G P NNQELFVLDGTEF SFAS LTTNLP s 399 N termirn:s IF RTLSSPLYR R IILGS G P NNOEL FVLDGTEF SFA S LTTNL P s 399 fryl.Aa VSLTGLG p C1ÉAb N termi¡us vleõ! c[-aìc RTLSSI-TILYR R P_FN G I Ñ Ñ õl-alrlElv L D G r E FIATG r --=iN L s 398 OrylÀc N termi¡rus vle o il elalc RTLss|dLYR G T N N alojllsjv L D c r E FIA Y c r - s slN L P s 398 L M7 fry]À l-95obp fragrrørt T I Y R Q R G T V D s L D V Ï P P QDNSVP P RAGF S HRL S HVTML S Q AÀGAVYT À GA L M7 N termi¡n:s TI Y R GTVDSLDVI P PODNSVP PRAGF SHRLSHVTM LS v YT eyßa V s I 48 GylAb N termirn:s AV Y K GTVDSLPIEI T P P õlñrvlñv P P Rfõlc F s H R L s H vlslM FRSGFSNSS I p p H vLsJM v s T T M8 frylÀc N termi¡n:s Àv Y GTVDSLDIEII P P aNrvNv nlgjc F s H R L s S PGFTGG D 497 Ory1A 1950þ fr.agnert RAPTF StlnlQHRSÀE¡NN I I P S S Q I TQ I P L TK S TNLG GT SVVKG Èy1\an t"=miro:s RAPTF SvtgHRsAEFNN I I P s S Q I TQ I P LTKs TNLG s GT SvVKG PG FTGG D 497 ct¿¡uN rermi¡rus na elr'{r swlÏlH R sAE F NN r r p s s Q r r o r P L T K S TNLG S G T SVVKG P G F TGG D 498 plãTKlc P G F c c D 497 GylAc N rermi¡n:s *; ;lt; ;wËl; ; ;;; ;;,i ñ ; ;E;trÉi r a r ñ FILIF ñìcE s vE-slc r L R R T S P G I S T L RVN I T À P L s a RYRVRIRYASTTNLQFHT SID cv2 q/14 l-950tp fragrrerrt I Q SID Gil2 eylÃaN tel:rd¡¡:s f LRRT S P G Q I S T L RVN I TÀ P s a RYRVRIRYASTTNLQFHT HT SID c 543 C:rylAbN termi¡n:s I L RRT S! \t TLRVNITAPL s o RYRVRIRYASTTNIJ p il1 ouro" N termi¡n¡s ft, v]nbT sE nlcTlrlsl S E RYRVREIRYASET INQGNFS ATMSSGSNLQSGS F RTVG F TT P FNF SNG S SVF TL SAHVFNS 592 IN9GNFS ATMSSGSNLQSGS F RTVGF TT P FNF SNG S SVF TL SAHVFNS 592 593 IN G ATMSSGSNLQSGS F GFTTP FNFSNGSS VF SAHV FNS e rlaf, sf LpIN L e slsõl r[r3 sE e [ru il rls el ss¿ OqÉ.A' ]-95OIp fT.agTTanT GNEVY T D R I E FV PA EVTF EA EY DL E RAQ KAVNEL F T S S NQ I G L KT DVTDY æ2 qid-AaN Ielfnirll¡s GNEVY I DR I E FV PAEVTF EAE Y DL E RÀ Q KAVNE L F T S S NQ I G L K T DVT DY &2 qÉåbN TeTmi¡n¡s GNEVY I D R T E FV PAEVT F EA EY DL E RAQ KAVNE L F T S S NQ I G L K T DVTDY 643 eyucNÈermi¡n:s lrAdvErDRElEFEplîrãltEnAEyEilLEReõxevr,¡ElLFrsEuõE"r,xrNv rDy &4 qr¡lÂ' 1950tp fr"agrrenÈ H I D Q V S N L V T 652 qÉÀaNtermi¡n¡s H I DQVSNL 650 qÉ.AbN trermi¡n¡s H I D QV S N L 651- ey]Àc N termirn:s H I DQV S NL 652 Figure 7. ll 5' end of the Bt strain WB3S16 CrylA amino acid sequence deduced from the l950bp gene fragment aligned with published CrylAa (Schnepf et al.,l935), CrylAb (Wabiko et a1.,1986) and CrylAc (Adang et a1.,1985) amino acid sequences. The one letter amino acid code has been used. Differences in amino acids at a given position are boxed. CTyl-A 1700tp fragrrent DRIEFV PVTA TLEAEYNLERAQKAVN A LFT ST NQ L GL KTNVTDYHIDQVS 50 Cr1dÀa C termi¡n:s DRIEFV P AEV rlrlr A E Y|DIL E R A e K A v N E LFT S NQ I GL KT VTDYHIDQVS 50 C?1¿Äb C termi¡n:s DRTEFV P ÀEV tlde A E Y[plL E R A e K A v N F: LFT s H NQ T GL KT VTDYHIDQVS 50 C?ylÂc C termj¡n:s DREEFE PVTA TLEAEYNLERAQKAVN A LFT ST NQ L GL KTNVTDYHIDQVS 50 CYylÀ 1700þ fragrrurt NLVTY L S D E F C L DE K RE L S E KVKHAK RL S DE RNL L Q D S.NF KD INRQ PE RG 100 cyj'tÀa c rermi¡rus Ntv[EEL s D E F c L D E rfõ;le L s E KVKHAKR L s D E RNL L a D|PINF RG INRQ LD RG t_00 a:yub c rermirnrs rvLvls clL s DE F c L DE KIIdE L s E KVKHAKRL s DE RNL L Q oldrvr RG rNRQ LD RG 100 O:y1Àc C Eermi¡n:s NLVTY L S D E F C L DE K RE L S EKVKHAKRL S DE RNL L Q D S NF K D I NRQ P E RG 100 Ç¡1rlÀ 1700þ fragrrenE V'f cc S T G I T I Q GG D DV F K E NYVT L S G TF D E C Y P TY L Y QK I DE S K LKA F TR Y l_50 cyylaa c rermi¡rus wlnlc s r|-Dlr r r e c c D DV F K E N Y v r Llqc r F D E c Y P T Y L Y Q K r D E s K L K A Y TR Y 150 cb¡LAbc Èermi¡n:s wlglc s Tldr T r QGGDDVF KENYVTLLLIG TF DEC Y P TYLYQK I DE S KLKA Y TR Y 150 q¡ryLAc C termi¡n:s Vüc c S T c I T r Q G G DDVF K ENYVT L S G TF DE C Y P TY LY Q K I DE S K L KAF TR Y 150 O1r1À 1-700þ fragnent Q L RGY I E D S Q DL E I Y L I RYNAKH E TVNV P GT G S LW P L S AQ S P I G K C G E PN 200 CylÀa C termi¡n:s Q L R G Y I E D S Q D L E T Y L I RYNA K H E TVNV P G T G S L üT P L S AgS P I G K C GEPN 200 Cf:ylAb C terminus Q L R G Y I E D S Q D L E T Y L I R Y NA K H E T VNV P G T G S L hT P L S ALPJS P I G K C 197 OryLAc C termi¡n:s Q L RcY I E D S Q DL E I Y L I RYNAKH E TVNV P G T G S LW P L S A Q S P I G KC G E PN 20O qr.y] 1700þ fi:agnsrt RC A P H L E$rN P DL D C S C R DG EKC AH H S H H F S L D I DVG C T D LNE D L GVV'¡V I F 250 trl¡lÀa C termi¡n:s RCAP EVÙNPDLDCSCRDGEKC AHH S HHF S LD I DVG C TDLNE DLGVWVI F 250 fry1Äb C tsmi¡n:s ÀHH S HH F S LD I DVG C TDLNEDLGVWV I F 224 Cn¡lAc C terrni::r:s R C A P H L EWN P D L D C S C R D G E K C ÀH H S H H F S L D I DVG C T D LN E D L G VWV I F 250 çIrylÄ 1700þ fragnerrt K I K T Q Dc HAR LGNL E F L E EK P LVG EALARVK RÀEKKVtRDK RE KL EwE TN I 300 g1,'1la C termi¡n:s K I K T Q DG HAR LcNL E F L E EK P LVG EALARVK RAE KKI¡üRDK RE K L EWE TN I 300 Ory]ÀbC terrni¡n¡s K I K T Q Dc HA RL GNL E F L E EK P LVG EALA RVK RAE KKü¡RDK RE K L EVÙ E TN I 274 Cry1}c C termi¡n:s K I K T Q DG HA RL cNL E F L E EK P LVG EALÀRVKRAE KKf'IRDKRE K L EI,t¡E TN I 300 CTidA 1700tp fragrrent. V Y K E A K E S V D A L F V N S Q YDQ LQADTN IAM I HAADKRVH S I REAYL P E L SV 350 ey1Àa C termi¡n:s VY K EÀKE SVDAL FVN S Q YDgLQADTN I AM I HAADKRVH S I REAY L P E L SV 350 kylAbC termi¡¡¡s VYKEAKE SVDALFVNS Q y Dlslr, eADTN r AM r HAAD K RvH s r R EAY L P E L sv 324 fryl.Ac C terminus VY K EAK E SVDAL FVN S Q Y DQL QADTN I AM I HAADKRVH S I REAYL P E L SV 350 EylA 17OOIB fTagTTeTTT I P GVNAA I F E E L E G R T F TAF S L Y DARNV I KNG DFNNG L S CWNVKG HVDVE 4OO C?ylÄA C TETmi¡n:s I P G VNAA I F E E L E G R I F T A F S L Y ÐA RNV T KN G D F NNG L S C $INV K G HVDVE 4OO C"}'1Àb C TE¡mi¡nTS I P GVNAA I F E E L E G R I F TAF S LY DÀRNV I KNG DFNNG L S CV{¡NVKG HVDVE 374 CþdÀc C TETmi¡n:S T P GVNAA I F E E L E G R I F TAF S LY DARNV I KNG DFNNG L S CV'INVKG HVDVE 4OO 450 Clld.A 1-700tp fragrrrent EQ NN O R S V LVV P E V\I E A EV S Q EVRVC P G R G Y I L RV TAY K E GY G E G C V T I H E cr1dÀa C termi¡n:s EQ NN õ R s v LVEP E W EA E V s Q EVRvc P G R G Y I L RVTAY K E G Y G E G C V T I H E 1150 424 CTyl-Ab C termim:s EQ NNER S V LVv P E W E A EV S Q EvRvc P G R G Y I L RVTAY K E G Y G E G C V T THr, C H 450 Clry1,Ac C terminus EQ NNe R S V LVV P EV.ir E A E V S Q EVRVC P G R G Y I L RV TAY K E G Y G E G VT I E C]¡1À 1700tp fragnert I ENNTD E L K F S NCVE E E I Y PNNTVTCND Y TVN Q E E Y GGAYT S RNRG YNEA 500 o¡¡f¡" C termi¡n:s I ENNT D E LK F s NcvE E E I Y PNNTVT C NDY TvN.Q E E Y GGAY T s RNRG YNEA 500 y R N R G YIDEI 474 CIaÁAb c rerrni¡nrs r E N N r D E L K F s N c v E;;8"; ÑÑ r r ð Ñ D rfãTlõ vEcEY r s A evfe" C Þrmi¡n:s I ENNT D E L K F s NcVE E E I Y PNNTVTcNDY" TvNQ E" EYGGÀYT" s RNRGYNEA 50o 546 CtirlÀ 1700tp fi:agrrrent P SVPAGYASVYEEKSYTDGRRENPC EFNRGYRDYTPL PVGYVTKEL D P P V G Y V T K E L g6 CT:]r1Àa C termi¡n¡s P s v P A[dV A S V Y E E K S Y T D G R R E N P C E F N R G Y R Y T L p K E L 524 eylAb C termi¡n:s YES ; ; ; ;lil; ; ;tr; ; ; üE; ; ; c n nEN c EEN R G YED Y r P L PEc v v r T L E¡úÃc C termi¡n:s P s V P A[dYÀ S VY E E K S Y T DG R R E N P C E F N RG Y R D Y T P L PVG YV KE il6 trylA 1700tp fragnrs¡t EYF PETDKVW f E I GE T E G TF I VD 569 569 Cra']Àa C termi¡n:s EY F P E T DKVW I E I G E T EG TF I VD Cra'lÄbC termi¡rus EY F P E T DKVW I E I G E T E G T F I VD il1 fr¡dÀc C terrni¡n:s EY F PE T DKVh¡ I E I G E T E G T F M s69 published CrylAa Figure 7. 12 3'end of the Bt strain \VB3S 16 CrylA amino acid sequence deduced from the l700bp gene fragment aligned with acid code has been used. (Schnepf et a1.,1985), CrylAb (Wabiko et al., 1986) and CrylAc (Adang et al.,1935) amino acid sequences. The one letter amino Differences in amino acids at a given position are b(rxed. ey2A 800þ fragnent SVLNSGRT TICDAYNVAAQDPFSF ]}HKS LDTI¿Q KEv{¡TEWKKNNH S LYL D P I VGTVA S F 178 60 N Tìermirnæ Èl2Aa. VLNSGRT r r c D A Y N vEolnlo P F s F É"l< é r, o ttrô K E vüEE w KIR,I--DIH s L YlvãpMv c r vEs F D S 60 N tìerndrus ey2^Ab SVLNSGRT TICDAYNVAAITIIDPFSF QHK S L DTVQ K EWT EV{¡K KNNH S LY L P I VG TVA F ey2À 800tp fragnent IJ L K KVG S LVG KR I L S E L RNL I F P S G S TNLMQ D I L R ET E K.F LN Q RLNT DTLARVNAE LT GL 358 N D L A R v N À E L uo N Tbrnnirus e!2Aa' ; ; ;ì ;ì ; ; ; ;til ¡ç | ; ; ; ; ;rdËi ; ; ; ; ; ñ M e D r L R E r EE F L N õ r r Ec i, ^ " D E L T G 120 N TÞrmirl¡s Gy2^Ab L L K KVG S LVG" K R I L S E L RN L I F P S G" S TNLM' " Q D I L R E T E K F L N Q RL N T T LA RVNA L M QA 538 CYy2A 800þ fragnenE O ÀNVE EF NRQVDNFLNP NR NAV PLSITSSVNTM oa LFLNRLP QFQ QGYQLLLLPLFÀ QA 180 N Tìermirni-s ÈlzAa O A NIJã EF NEavDNFLNP ¡rE v PLSITSSVNTM OQ LFLNRLP QFQ tr QGYQLLLLPLFA m M QA 180 N Tbrmirnrs eY2Ab O ANVE EF NRQVDNFLNP NR NAV PLSITSSVNTM OQ LFLNRLP QFQ QGYQLLLLPLFA L H D 718 ey2A 800þ fragrrenb ANLHL S F I RDV I LNAD EV\¡G I SAATL RTYRDY L K NYTRDYSN YC I NTY Q SAF KG LNTR L R L H D 240 N 1ìerrfdrus e-/{2Aâ, ANEHL S F I RDV I LNAD E$¡G I SAATLRTYRDY L tr NYTRDYSN Y C r N T Y Otre rEc NT RL H D 240 N Írermi¡n¡s Q"]¿Àb ANLHL S F I RDV I LNÀDEhTG I SAATLRTYRDY LK NYTRDYSN Y C I NTY Q SAF KG LNT 838 Cry2A 800tp fragrrent MLEFRTYMF LNVF EYVS IVÙS L FKYQ S LLVS S GANLYAS GR ¿tv N TÞrmirus d1'2^Aa MLEFRTYMF I, N V F E Y V S I Vü S L F K Y O S tEV S S G A N L Y A S G 219 N TÞunirus O¡/2Àb MLEFRTYMF LNVF EYVS IWS LF KYO S LLVS SGÀNLYAS G Figure 7. 13 5, end of the Bt strain \ry83s 16 CryZA amino acid sequence deduced from the 800bp gene fragment aligned with published Cry2Aa in amino (Donovan et aI.,l9S9) and Cry2Ab (Dankoscik et al., 1990) amino acid sequences. The one letter amino acid code has been used. Differences acids at a given position are boxed' Ol¡24 L100þ f::agrrærrt L Y A S G S G P Q Q T Q S F TAQNI¡¡PFLYSLFQVNSNY IL SGISGTRLSITFPNIG 50 C termi¡nrs Ctf2Âa LYA S G S G P QQTQ S F TAQNWPFLYSLFQVNSNY I L Þ GISGTRLSITFPNIG 50 C Èermi¡n:s Ol2¡b LYAS G S G P Q Q TQ S F rEoEvùPFLYSLFQVNSNY M L ñ cEscEnLSñrFPNrEso fry2A 1100tp firagnent GLPGS T TTHSLNSARVN Y SG GVS SGLTGATNLNHNFN c STVL PPLST P FV 100 100 C Èermi¡n:s ùy2Aa GLPGS T TTHSLNSARVN Y SG GVS SGLIGATNLNHNFN c STVL PPLST P FV pTlmEn p r.l P l-00 C tsermi¡n:s C1f2Âb GLPGS T rrHEltll,ãARvN Y SG eEs s cE r c AIE c s rElr P P LE]T FV qf2A 1-1-00þ fi:agnenÈ RSWLD s GTDREGVATST N WQ TES FQTTLSLRCGAFSA R GNSN YFPDY F rR 150 F 150 C termi¡us ù!2Aa RSIì¡LD s GTDREGVATST N lìI Q TES FOTTLSLRCGAFSA R GNSN YFPDY IR C termi¡us Cry2¡b RSV{LD S GEDREGVATET N hIQ TES rÉTTtELREGAFEA R GNSN YFPDY F IR 150 200 e!2A 11-00tp fragrrert NISGV P LVIRNEDLTRP L HY NQI RNIESPSGTPGGÀR A YLVS VHNRK N NI 200 C Èermi¡n¡s G!2]a NISGV P LVTRNEDLTRP L HY NOI RNIESPSGTPGGAR A YLVS VHNRK N NI 200 C termi¡n:s Cf¿Àb NISGV P rvElRNEolEnp L HY r¡É r RNIESPSGTPGGAR A vEv s VHNRK N NI el2A l-100tp fragnent. YAANE N GTMIHLAPEDY T GF TIS PIHATQVNNQTRTF I SEKF GNQGD S LR 250 C termi¡L¡s e!2Àa YÀANE N GTMIHLAPEDY T GF TIS PIHATQVNNQTRTF I SEKF GNQGD S LR 250 s 250 C termi¡n:s Gî¿¡b E a[vE e N cEurHLapElov T GF TIS PIHATQVNNQTRTF I SEKF GNQGD LR Ctf2A 1100þ f¡:agrrer¡t. FEQSN T TARYTLRGNGN s YN LYL RVSSIGNSTIRVTI N GRVY TVSNV N TT 300 C tsermi¡us Cry2Aa FEQSN T TARYTLRGNGN s YN LYL RVSSTGNSTIRVTI N GRVY TVSNV N TT 300 C termi¡¡us Q1¿¡b F E OEN T TARYTLRGNGN S YN LYL RVSSIGNSTIRVTI N GRVY rlã rln v N TT 300 ey2A 11-00þ fi:agner¡t, T NNDGVNDNG A R F S D I N I GN I VA S D NTNVT P LD INVTLNSGTPF DLMNI M 350 M 349 C termi¡n:s Gry2Aa TNNDGVNDNGARF S D I N I GN I VA Sp NT NvTI-IL D I NV T LN S G T P F D L MN I C Èermi¡us Crry2.êb TNNDGVNDNGÀR F S D r N I GNEIVA sE nß-ilvlã-lL D r NV r L N s c rEF D L MN r M 349 qf2A 1100tp fr^agnent. F V P T N L P P L 359 C termi¡¡us Ory2Aa FV P TNI,P P LY 359 c te¡mi¡nrs c1¿Ab Ev P T Nfr_slP L Y 359 published Cry2Aa Figure 7. 14 3' end of the Bt strain WB3S 16 Cry2A amino acid sequence deduced from the 1 l00bp gene fragment aligned with given (Donovan et al.,l9g9) and Cry2Ab (Dankoscik et a1.,1990) amino acid sequences. The one letter amino acid code. Differences in amino acids at a position a¡e boxed. cTirlÀ 1950bp DR r E FV PAEVT F EAE Y DL E RAQ KAVNE L F T s S NQ lG L K T DvTDY H I D QV S NL n s N L n fry]å, 1700þ D R r E F v plt rãrEne n v Ñ1, n *" O xavNE.L F r sElN AEc L K rEv r D Y H r D QV Figure 7. tS Partial amino acid alignment of the region of overlap between sequences deduced from the 3' end of the l950bp cryIA gene fragment and the 5' end of the l700bp cryl|gene fragment. The one letter amino acid code has been used. Differences in amino acids at a given position are boxed. 567 p1950 36aa PROI SÐ YQ VPLLSVYVQAANLHLSVLRD VSVFG RVÙGFDAAT p800 36aa PRtf SÐ YQ Éi LIP L F ilõ ooN L H I slr rln o w cllElA A r 612 Figure 7. 16 partial amino acid alignments of Bt strain WB3S16 Cry1A and Cry2A proteins. A highly conserved 36 amino acid stretch of the polypeptide (nucleotide base numb er 475 to 582 of the CrylA and 504 to 6t I of the CryZA) is shown. The one letter amino acid code has been used- Differences in amino acids at a given position are boxed. Genetics of Crystal Production in Bt Strain WB3S16 Figure 7. l7 Predicted Kyte-Doolittle hydrophobicity plot and Chou-Fasman cr and ß regions of the: (a) N terminal segment deduced from the 1950bp crylA gene fragment, (b) C terminal segment deduced from the 1700bp cryIA gene fragment from Bt strain V/83S16. Poisitive values on the Kyte-Doolittle hydrophobicity plot indicate hydrophobic regions and negative values indicate hydrophilic regions in the deduced protein. Genetics of Crystal Production in Bt Strain WB3S16 a) A f Alpha, Reg¡ons B I Beta, Begiorrs tt ¿h AÄ[- A rd.A.r*¡ -u ^ .)1.¡. E Hydrophobicity Plot F "TTIil 9"rF Y ', ' Y lÏT' tl-'- 'T l¡FY= ' "'Y*l G I Hydrophobic Regions 50 100 150 550 b) A f Alpha, Regions B I Beta, Begions 0 I Hydrophobic¡ty Plot G l Hydrophobic Regions 50 100 150 200 250 300 350 400 4s0 Genetics of Crystal Production in Bt Strain WB3S16 The region of overlap between the proteins deduced from the 1950bp and 1700bp gene fragments was not homologous (Figure 7. 15). However, the 800bp and 1l00bp gene fragments had a region of overlap with five amino acids in common. It was not possible to produce recombinant E. coli clones containing the 1900bp and 3550bp entire cryZA and cryl{gene inserts. F3S and R3bS primers were used to amplify the 1950bp segment of the 5' end of the'WB3S16 cryLA gene and were designed to ensure that the 3' end of the amplif,red 1950bp crylL gene fragment would overlap with that of the 5' end of the amplified 1700bp cryIA gene fragment. This overlap enabled fusion of the two gene fragments for the purpose of expression studies. Consequently, the 1800bp cryl[ fragment became redundant and sequencing of this fragment was not completed. Expression studies using the 800bp, 1l00bp, 1700bp and l950bp gene fragments are currently being undertaken. Amino acid residues 169 to 2O5 of the 800bp cry2{ and 154 to 190 of the 1950bp crylA gene fragments from Bt strain WB3S16 had a stretch of 36 amino acids in common (Figure 7. 16). Analysis of WB3S16 crystal protein primary structure showed that all the Cys residues were located in the amino acid sequence corresponding to the l700bp gene fragment, with the exception of two Cys residues located at positions 10 and 15 of the protein deduced from the 1950bp cryll. gene fragment. The Chou-Fasman and Kyte-Doolittle analysis of V/B3S16 crystal protein secondary structure, predicted more ß-sheet structures and hydrophobic domains in the amino acid sequence deduced from the l950bp gene fragment than that deduced from the 1700bp fragment (Figure 7. l7). 7. 4 DISCUSSION: 7. 4. I The Role of Plasmids and cry Genes in Bt Strain WB3S16 Twelve plasmids have been isolated from subsp. kurstaki (Carlton and Gonz¡fle2, L984a) and seventeen plasmids have been isolated from subsp. thuringiensis (Carlton and Gonzólez, 19S4b). The modified Eckhardt lysate method is known to give lower yields with increasing plasmid size and may not detect large plasmids (Cunier and Nester,1976; Hansen and Olsen, 1978). In this study, a total of nine and seven plasmids were isolated from the Bt subsp. kurstaki strains WB3S16 and HD-l respectively, whilst a total of six plasmids were isolated from Bt subsp. thuringiensis strain HD-z. These strains may possesses more plasmids than were evident on the gel and poor plasmid recovery may result from use of the modified Eckhardt lysate method (González et a1.,1981). The traces of DNA evident in loading wells following electrophoresis may be non-dissolved DNA resulting from insufficient re- suspension of plasmid pellets prior to electrophoresis. The number of plasmids evident on 106 Genetics of Crystal Production in Bt Strain WB3S16 gels may have been increased by the use of a lower percentage agarose gel or different extraction procedures. Plasmid gels can be used to substantiate relationships between strains of Bt. Bt subsp. kurstaki strains WB3S16 and HD-l were previously serotyped as 3a3b according to the flagellar H serotyping system developed by de Barjac (1981). The plasmid gel also indicates a close relationship between these strains as they share seven common plasmids. Six plasmids common to serotype 1 Bt subsp. thuringiensis strain HD-z and strain WB3S16 indicate some degree of relatedness between these two strains. However, plasmid size alone does not indicate DNA similarity and cross-hybridisation experiments are required to demonstrate relationships between plasmids of the same size. The smaller 4.5kb, 2kb and 1.4kb plasmids isolated from Bt strain WB3S16 and HD-l were not evident in the profile of strain HD-z and may be present either in low copy number or absent from the HD-2 genome. The plasmids of greater than 24kb and 8.5kb found in strains WB3S16 and HD-2, were not present in strain HD-l or the crystal- strains. Plasmids of 24kb and 2kb were coûImon to strain WB3S16 and the crystal- strains and the genes carried on these plasmids may code for factors toxic to B. ovis. The function of plasmids identified in this study and their contribution to lousicidal activity is unknown and should be investigated further using deletion mutants. GonzâIez et aI. (1981) also reported that both crystalliferous and acrystalliferous strains possess a minimum of three plasmids. Crystal- strains #8 and #9 possessed the least number of plasmids (three in total) compared to the parent strain WB3S16. No crystal- strains were isolated in this study which had fewer than three plasmids and these results suggest that certain plasmids may have a vital function in Bt. During curing, strains #8 and #9 acquired an additional plasmid of 3.5kb and the function of the genes carried on this plasmid have not 'been ,,'' investigated. This may be a cointegrate plasmid and southern hybridisation using a full , complement of native plasmid probes is required to confirm this. Loss of the ã-endotoxin phenotype was directly correlated with the loss of two plasmids of greater than 24kb and 8.5kb from all crystal- strains. These plasmids may carry genes essential for production of the ð-endotoxin crystal. Similar findings have been made by Stahly et aI. (1978) and González and Carlton (1980), although Miteva (1978) described crystal- strains with apparently unchanged plasmids which may have resulted from point mutations and/or gene rearangements of cry gene bearing plasmids. to7 Genetics of Crystal Production in Bt Strain WB3S16 The results of Chapter 6 showed that the loss of the crystal phenotype did not result in a decrease of crystal- strain toxicity to B. ovis as the toxicity of these strains to B. ovis was not statistically different from that of Bt strain V/83S16 (Section 6. 3. 3). However, the results of Chapter 6 showed that all crystal- strains produced proteins of 140kDa and 70kDa, which cross-reacted with anti-crystal protein antibodies. The Southern hybridisation results showed that the cryll^ and cry2A probes hybridised to a plasmid of 24kb common to strain WB3S16 and all crystal- strains. There was no hybridisation of either probe to the 2kb plasmid common to strain WB3S16 and the crystal- strains. This is consistent with the observations of Klier et ø1. (1982); Kronstad et aI. (1983) and Schnepf and Whiteley (1981) reported that Bt cry genes occur primarily on large plasmids. This study indicates that louse toxic crystal- strains carry crylL and cry2A genes, possibly on a plasmid which in this experiment was approximately 24kb, and provides strong evidence that these strains produce CrylA and Cry2A proteins. These results, in combination with those of Chapters 4, 5 and 6, are consistent with the original hypothesis of crystal protein toxicity to B. ovis. In Chapter 6 it was shown that crystal- strains produced less crystal protein than strain WB3S16 yet there was no significant difference between the toxicity of these strains and that of WB3S16 to B. ovis. Experiments to correlate the amount of crystal protein expressed by crystal- strains with the levels of their lousicidal toxicity and Northern blots to assess the levels of cryl/^ and cry2{ gene expression, may clarify the discrepancies discussed above. The present study did not examine the presence of cry genes in the Bt chromosome. Cry genes have been located on transposable elements (Gonzalez and Carlton, 1984) in some Bt strains and a chromosomalkurstaki HD-l cry gene was studied by Held et al. (1982), Adang et al. (1985) and Minnich and Aronson (1984). Expression of crystal protein by chromosomal cry genes of strain WB3S16 and crystal- strains may contribute to levels of crystal protein by these strains, and consequently to their B. ovis toxicity. Strong hybridisation of the crylA and cry2{ probes to strain \MB3S16 DNA was anticipated as the probes were amplified from the cry genes of this strain (Section 7. 3. 2). The weak hybridisation signal obtained with both probes to the 24kb plasmids in crystal- strains suggests that this plasmid is present in low copy number in these strains compared to WB3SI6. Heat curing strain WB3S16 may have reduced the copy number of larger plasmids in crystal- strains. The signal from both probes could not be attributed to non specific binding as the membranes were washed under relatively stringent conditions (Section 7. 2. I. 2). lt is unlikely that mutations or deletions of cry genes in crystal- strains would result in weak hybridisation ofthe probes to these genes. 108 Genetics of Crystal Production in Bt Strain \ry83s16 For reasons unknown, the CrylA and Cry2A proteins produced by crystal- strains are not incorporated into a ô-endotoxin crystal or form crystals which are not visible by light microscopy at 1,000x magnification. Electron micrographs of sections through crystal- strains would confirm the presence of small ð-endotoxin crystals. Similar to the findings of Miteva (1978), this may result from a deletion or mutation within the cry genes. Although unconfirmed, it is possible that Bt strain WB3S16 has genes which code for factors involved in formation of the â-endotoxin crystal. Cryptic plasmids of 4.9MDa,29MDa and 110MDa may function to regulate protoxin synthesis in Bt subsp. kurstaki (Minnich and Aronson, 1984). A polypeptide product of the orf2 gene, the second gene of the three gene CryZA operon, is required for efficient expression of Cry24, without which the protein does not form a crystalline inclusion (Crickmore and Ellar, 1992). These plasmids may have been rendered non-functional or deleted in the crystal- strains, resulting in reduced expression of crystal protein in these strains compared to WB3S16 (refer to Chapter 6). The factors which cause crystallisation of â-endotoxin proteins a¡e unclear and low concentrations of crystal protein in crystal- strains may be insufficient for crystallisation and formation of the ð-endotoxin crystal in these strains. Crystal- strains produced crystal protein which did not appear to be incorporated into a ð- endotoxin crystal. This finding, in conjunction with the toxicity results of Chapters 4 and 5 and the binding studies of Chapter 6, supports the theory that crystal protein accounts either wholly or partially for the toxicity of Bt strain WB3SI6 and crystal- derivatives to B. ovis. In addition, these strains may also produce a variety of unidentified louse toxic factors. The toxicity of strain \ry83s16 and crystal- strains may also be due to other unidentified toxins and further studies are required to investigate these possibilities. 7 . 4. 2 Sequencing of Bt Strain WB3S 16 cryl/^ and cryZA Genes BLAST results (Table 7. 7) and protein alignments (Figures 7. ll - 7. l4), showed that Bt strain WB3S16 crystal proteins were closely related to published Cry1A and Cry2A proteins and suggested that Bt subsp. kurstaki strain WB3S16 has cryl{a, crylfuc, cryZXa and cry2A+b genes. This finding is in agreement with the results of Adang et al. (1985); Schnepf et aI. (1985); Geiser et aI. (1986); Thorne et al. (1986); Kondo et al. (1987) and V/idner and V/hiteley (1989) who reported that subsp. kurstaki strain HD-1 possessed crylAa, cryL\b, cryl\c, cry2Aa and cryZÌ+b genes. It is likely that strain WB3S 16 also carries a cryLAb gene which may not have been amplified with the primers used in this experiment. 109 Genetics of Crystal Production in Bt Strain WB3S16 In theory, fusion of the 1950bp and 1700bp fragments would produce a crylé^ gene with an open reading frame (ORF) of 3414 nucleotides, coding for aprotein of 1138 amino acids. Likewise, fusion of the 800bp and 1100bp fragments would produce a cry2A gene with an ORF of 1899 nucleotides, coding for a protein of 633 amino acids. These results are comparable to the findings of Schnepf et aI. (1985) and Geiser et aI. (1986) who studied cryl{genes of 3527 and 3468 nucleotides which coded for proteins of 1I76 and 1155 amino acids, respectively and with the results of V/idner and V/hitetey (1989) who reported that cry2Aa and cry2l+b genes were 1, 899 nucleotides in length and coded for polypetides of 633 amino acids. The results of Geiser et aI. (1986); Höfte et al. (1990) and Dardenne et aI. (I99O) indicate that the putative minimum toxic fragment of the WB3S16 CrylA protein would be generated either by in vivo or in vitro proteolytic removal of amino acids from the C-terminus of the 1950bp gene fragment protein up to residue 609. Theoretically this would produce a protease resistant peptide of 60-70kDa, which may act as a toxin against lice through a mode of action similar to that of other ð-endotoxin crystal proteins. Although unconfirmed, this protein may be the 70kDa protein produced by degradation of the CrylA protein and/or the crystal protein found in association with the spore, membrane and culture supernatant fractions. The region of overlap between the proteins deduced from the 1950bp and l700bp gene fragments was not homologous (Figure 7. 15). Protein alignments (Figure 7. ll - 7. L2) suggest that the l950bp gene fragment is the 5' end of a cryl{a, whilst the 1700bp fragment is the 3' end of a cryIAc gene (V/ong et a1.,1983). Nucleotide substitutions occurr only in a non conserved region between the highly homologous 5' and 3'regions of the crylAa, crylfub and cryLAc genes. It was not known which of these genes were present in Bt strain WB3S16 and consequently, it was not possible to design primer pairs which would distinguish between them. It was not possible to confirm whether the l950bp and 1700bp gene fragments represented the 5' and 3' ends of the same cryly'^ gene within the time frame of this project. Consequently, these gene fragments and their corresponding amino acid sequences are shown separately in Figures 7. 7 - 7. 8. It was not possible to design primers which would differentiate between the WB3S16 cry2Aa and cry2{b genes because the 5' and 3' terminal regions of these two genes are highly homologous. The chances of amplifying and cloning a cry2Àb gene were thought to be relatively low. The cry2fub gene was thought to be relatively uncorlmon as reports of Bt strains carrying cry2I+b genes are less frequent than of those carrying cry2Aa genes. In addition, production of CryZ&aby the highty expressed cryZAa gene is thought to mask the production, if any, of the Cry2Ab gene (Dankocsik er al., 1990). Despite five common amino r10 Genetics of Crystal Production in Bt Strain WB3S16 acids in the region of overlap between the 800bp and I l00bp gene fragment proteins, protein alignments suggest that the 800bp gene fragment is the 5' end of a cry2\b gene whilst the 1l00bp gene fragment is the 3'end of a cry2Aa gene (Figure 7. 13 - 7. l4). It was not possible to confirm whether these gene fragments represented the 5' and 3'terminal regions of the same cry2\ gene and consequently, these gene fragments and their corresponding amino acid sequences have been shown separately in Figures7 . 9 - 7 . lO. To avoid cloning segments of different classes of cry genes, repeated attempts were made to clone and sequence entire cryl{andcry21^ gene inserts, For reasons not yet understood, despite the use of three different cloning vectors (pGEM@-f, pCR ScriptrM and pZErOrM), blunt ended ligation, variation of ligation and transformation conditions and an increase in the number of colonies screened for DNA inserts, this procedure was unsuccessful. Failure of the DNA polymerase to add an A nucleotide to the 3' end of PCR products, loss of the 3' T overhangs at the vector insertion site, degradation of the DNA ligase and ligase buffer and sub-optimal vector:insert DNA ratios were eliminated as possible reasons for failure of this procedure. It was not possible to verify and quantify the toxicity of expressed CrylA and Cry2{proteins to B. ovis by bioassay within the time frame of this project In an alternative approach, expression studies are currently being undertaken with the cryIA and cry2A gene fragments to determine the CrylA and Cry2A protein terminal portions toxic to B. ovis. Schnepf and V/hiteley (1985) showed that a minimum of 645 amino acids were necessary for biological activity of ð-endotoxin crystal proteins. The three dimensional structure of ô-endotoxins is known to govern the interaction of these proteins with the midgut epithelium and hence, their toxicity to target insects (Convents et a1.,1990). However, the secondary and tertiary structure of the expressed rWB3S16 CrylA and Cry2A protein fragments may be different from that of the corresponding entire â-endotoxin proteins. This factor may reduce or alter the toxicity of the CrylA and Cry2A expression product fragments to B. ovis and these proteins may not therefor, truly reflect the lousicidal toxicity of the entire CrylA and Cry2A proteins. The amino acid sequence deduced from the 800bp cry2A gene fragment had a 36 amino acid region of limited sequence homology to a stretch of 36 amino acids deduced from the 1950bp cryIA gene fragment. This region was also identified by V/idner and rWhiteley (1989) and Donovan et aI. (1988) and its significance is unclear. This result supports the proposal of Gonzalez et aI. (1981) who suggested an evolutionary relationship between cryLA and cry2{ genes resulting from homologous recombination events of cry genes carried on transmissible plasmids. lll Genetics of Crystal Production in Bt Strain WB3S16 Analysis of the primary structure of Bt strain WB3S16 CrylA and Cry2A proteins revealed similarities between these and other crystal proteins. As reported by Geiser et al. (1986), the majority of the Cys residues were located in the amino acid sequence deduced from the 1700bp fragment, which represents the C-terminus of the WB3S16 CrylA protein. Cysteine residues are involved in formation of the â-endotoxin crystal (Huber et al., 1981) and their arrangement is of interest as sulphydryl bonds have been implicated in maintaining crystalline structure and in conferring the unusual solubility properties of crystal proteins (Schnepf et al., 1985). Susceptibility of strain WB3S16 crystal proteins to dissolution.Snd activation to a toxic peptide may be a factor involved in the toxicity of this strain to B. ovis. Toxicity differences between â-endotoxin inclusions may also be due to solubilising conditions within particular larval guts (Aronson ¿/ aI.,l99l). The effect of B. ovis midgut fluid extracts on the solubilisation and activation of WB3S16 â-endotoxin crystal proteins could be assessed by gel electrophoresis and bioassaYs. The C-termini of crystal proteins greater than 125kDa are thought to be involved in the packaging of the toxins within the inclusion (Höfte and \Mhiteley, 1989). Amino acid substitutions in this region may reduce the incorporation of CrylA proteins produced by strain WB3S16 and crystal- strains into the the crystal. Minor amino acid substitutions were evident between the deduced CrylA and Cry2A protein sequences of Bt strain WB3S16 and published sequences (Figures 7 . ll - 7 . I4). Changes in three amino acid residues can alter the toxicity spectrum of crystal proteins, converting a monospecific toxin to a toxin effective against several different insects (Haider et aL.,1986) possibly by affecting the protein recognised by the midgut cell receptors (Haider and Ellar, 1987). Conformational changes which result from residue substitutions may expose cryptic sites of crystal proteins to gut proteases. This may increase the susceptibility of the Bt strain WB3S16 CrylA protein to proteolytic degradation or result in cleavage of proteins to an active form (V/ard et aI., 1988) effective against B. ovis. The effect of the amino acid differences on the lousicidal activity of Bt strain WB3S16 crystal proteins is unknown and could be pursued in subsequent site directed mutagenesis studies. The secondary structure of the Bt WB3S16 CrylA protein appears to be similar to that of published CrylA proteins. The Kyte-Doolittle hydrophobicity plots showed that hydrophilic regions rvere more numerous in the amino acid sequence deduced from the 1700bp gene fragment, corresponding to the C-terminus of a WB3SI6 CrylA protein. Hydrophobic regions were more numerous in the sequence deduced from the 1950bp fragment, which corresponded to the N-terminus of a WB3SI6 CrylA protein. The Chou-Fasman analysis showed that the amino acid sequence deduced from the 1700bp fragment had more predicted tt2 Genetics of Crystal Production in Bt Strain WB3S16 alpha-helices, whilst that deduced from the 1950bp fragment had more predicted ß-structure. Similar findings were made for CrylA proteins by Geiser et aI. (1986); Höfte et aI. (1986) and Schnepf et al. (1985). Alpha-helices and the hydrophobic CrylA N-terminal domain may be crucial for the creation of amphipathic transmembrane spanning channels proposed in the CrylA mode of action, whilst the hydrophilic C-terminal region may be involved in recognition and binding of the toxin to midgut cell receptors in the target insect (Gill et al., 1992). WB3S16 CrylA proteins appear to be homologous to other CrylA proteins and may act against B. ovis through the same mode of action as CrylA proteins effective against lepidopteran and coleopteran larvae. 7. 4. 3 General Discussion It is likely that strain WB3SI6 possesses cryL&a, crylfuc, cry2Aa and cry2Ab genes, although it was not possible to confirm this in the present study. Results indicate that the cryl{ and cry2A genes are carried on a24kb plasmid cortmon to Bt strain WB3S16 and all crystal- strains. Acrystalliferous mutants produced detectable amounts of CrylA and Cry2A protein and were significantly toxic to B. ovis (Chapter 6) even though these strains did not produce a detectable ð-endotoxin crystal. The CrylA and Cry2A crystal proteins of strain WB3S16 were highly homologous to other classes of Bt crystal proteins and no unusual characteristics were identified which would indicate a novel host range. Therefor, CrylA and Cry2A proteins may have a mode of action against B. ovis which is similar to that of ð- endotoxin crystal proteins effective against lepidopteran and coleopteran larvae. The results of Chapters 5 and 6 suggest that the CrylA and Cry2A proteins of strain WB3S16 act as a toxins against B. ovis and the above study has provided a molecular analysis of these potentially louse toxic proteins and their corresponding genes. 113 General Discussion CHAPTER 8 General Discussron As previously discussed, Bacillus thuringiensis (Berliner) (Bt) produces a heterogeneous range of insecticidal toxins which are effective against a number of different insect species. Bt is characterised by the production of one or more crystalline parasporal inclusions composed of Cry or Cyt ð-endotoxin crystal proteins which have insecticidal action against lepidopteran, coleopteran and dipteran la¡vae. Dulmage (1981) reported that some Bt strains produce an unidentified toxin termed the "louse factor" which is active against Phthiraptera. To date, the biochemical nature of the louse factor and its mode of action against lice has not been determined. Bt subsp. kurstaki strain IVB3S16, isolated from sheep fleece at the University of Adelaide, is highly toxic to the sheep biting louse, Bovicola ovis (Schrank) and is cunently being developed as a microbial insecticide to control this cosmopolitan pest. The aim of the present study was to investigate the nature and mode of action of the louse factor(s) produced by Bt strain WB3S16. Following ingestion, the Bt crystal is dissolved and activated in the alkaline midgut of susceptible insect larvae to produce ð-endotoxin crystal proteins (Höfte and Whiteley, 1989). These proteins are thought to bind to cell membrane receptors and to form pores in the microvilli of midgut epithelial cells by a mechanism of "colloid osmotic lysis" suggested by Knowles and Ellar (1987). Lyophilised powders produced from cultures of Bt strain WB3S16 cause rapid mortality and massive midgut disruption when ingested by B. ovds (Hill, 1992). Histopathologicat investigations undertaken by Hill and Pinnock (1998) suggested that the mode of action of the Bt strain WB3SI6 louse toxin is similar to that of the ð-endotoxin crystal proteins effective against susceptible lepidopteran and coleopteran larvae. The hypothesis under investigation in this study was that the WB3S16 louse toxin is related or identical to the ð-endotoxin crystal proteins produced by this st¡ain. Bt produces a range of other insecticidal toxins which are reviewed in Section 1. 4. There is limited information available about the chemical structure and the insecticidal mode of action of many of these toxic factors (Lysenko and Kucera, l97l). Common Bt toxins with broad insecticidal activity were examined in an attempt to elucidate the nature of the louse toxin(s) produced by Bt strain WB3S16. A standard lecitho-vitellin test confirmed that Bt strain V/83S16 did not produce phospholipase C enzyme. A Lucilia cuprina bioassay and HPLC analysis of the supernatant from strain WB3S l6 showed that this strain did not produce tt4 General Discussion detectable amounts of the ß-exotoxin. Therefor, mortality of. B. ovis fed Bt strain WB3S16 could not be attributed to the ß-exotoxin nor phospholipase C and may be caused by an unidentifîed louse-active toxin. A culture fractionation experiment revealed that the Bt strain WB3SI6 louse toxin was associated with the bacterial membrane fraction and the culture supernatant. This finding supported the suggestion of Pinnock and Drummond (1992) that the WB3S 16 louse toxin is membrane bound. Similarly, Luthy et al. (1970) reported that a lepidopteran toxin was associated with the Bt membrane fraction. Spores of Bt strain WB3S16 were not toxic to B. oyis, but caused septicaemia when they germinated in the louse midgut after several days. Electron micrographs revealed that the ô-endotoxin crystals of strain WB3S16 remained intact in the gut of B. ovis fed the WB3S16 preparation, even when the insects were paralysed or dead. As suggested by Hoffman and Gingrich (1968), the â-endotoxin crystals did not cause significant mortality of B. ovis, possibly due to the fact that lice do not possess the highly alkaline midgut environment essential for the solubilisation and activation of the ð-endotoxin crystal into toxic peptides (HiIl,1992). However, consistent with the original hypothesis, the ð-endotoxin crystals solubilised in vitro were toxic to B. ovis and caused general paralysis of the insect. Similarly, Lambert et al. (1992) described a novel ô-endotoxin crystal protein with silent activity against coleopteran larvae and found that toxicity of the Cry3C protein to the Colorado potato beetle was revealed only following in vitro solubilisation and activation of the crystal. The WB3S16 ð-endotoxin crystal proteins were further investigated by SDS-PAGE and N terminal sequence analysis. Strain'rWB3Sl6 produced both 140kDa CrylA and 70kDa Cry2A crystal proteins. Dissolved CrylA and Cry2A proteins from Bt strains other than WB3Sl, caused general paralysis and were highly toxic when fed to B. ovis, the CrylA being significantly more toxic than the Cry2A protein. This is the first study to report toxicity of ð- endotoxin crystal proteins to a phthirapteran species. The CrylA protein was highly susceptible to degradation and over time, produced a 70kDa protein which was resistant to further degradation. This protein was a major contaminant of the 70kDa Cry2A fraction and attempts to obtain a pure fraction of the 70kDa CrylA protein and subsequently to test its toxicity to B. ovis were unsuccessful. It is possible that the primary structure of the WB3S16 Cry1A protein renders it susceptible to degradation by proteases. Similar findings have been made by Yamamoto and Mclaughlin (1981). Yamamoto and Mclaughlin (1981) and Chestukhina et aI. (I98O) found traces of proteases associated with the Bt crystal. Crystal associated proteases or susceptibility of the CrylA protein to proteolytic degradation may be a key to the lousicidal toxicity of Bt strain 115 General Discussion wB35 16. The sequential harvest experiments revealed that a louse toxic factor was present in the cellular particulate material of strain WB3S16 cultures. Vegetative WB3S16 cells were significantly toxic to B. ovis and the WB3S16 Bt preparation became increasingly more toxic to lice as the culture matured, reaching a maximum level at 50Vo cell lysis. 70kDa and l4gkDa crystal proteins were immunologically detected in WB3S16 vegetative cell harvests prior to sporulation. This result is in agreement with that of Luthy et aI. (1970) but contradicts the findings of Somervilte (1971) and Lecadet and Dedonder (1971) who found that Bt crystal protein production coincided with bacterial sporulation. This finding suggests that crystal production coÍlmences prior to sporulation in WB3S16 or that crystal protein production and sporulation are difficult to detect by light microscopy. Early crystal protein production may lead to an over production of crystal protein by the Bt cell and this may be a ÌWB3S16. key to the lousicidal toxicity of Bt strain SDS-PAGE analysis showed a correlation between the amount of crystal protein in the particulate matter preparation and the toxicity of these preparations to B. ovis. Although it was not possible to confirm a relationship between the toxic factors present in the particulate fraction and the supernatant, the louse toxin produced by WB3S16 cells may have been exported to the supernatant during culture of the bacterium. Following lysis, the toxicity of the Bt preparation decreased and the louse toxin present in the supernatant may have been degraded by protease enzymes produced by the Bt cell (Li and Yousten, 1975). This result suggested that the WB3S16 louse toxin is proteinaceous and this theory was further supported by the finding that the lousicidal toxicity of the WB3S16 preparation was significantly reduced by treatment with proteinase K enzyme. A 70kDa protein immunologically related to the V/83S16 crystal proteins was found in association with the louse toxic \VB3S16 membranes and supernatant fractions. Similarly, Lecadet and Dedonder (1971) reported that some acrystalliferous Bt strains preferentially synthesised soluble ð-endotoxin like proteins which were found in association with Bt membrane structures. Asano et aI. (1994) found evidence for a ð-endotoxin fraction in the Bt culture supernatant. Soluble 70kDa CrylA or Cry2A proteins associated with the membrane and supernatant fractions may act as a toxin against B. ovis and may be liberated from the membranes by the louse midgut lipases identified by Sinclair et aI. (1989). ð-endotoxin like crystal proteins have been found in association with the Bt spore coat (Delafield et a1.,1968; Somerville et a1.,1968) and have been localised to the inner side of the exposporium and spore coat (Short et aI., 1974). In this study, a 70kDa protein immunologically related to the ð-endotoxin crystal proteins of V/83S16, was found in association with the spore coat of strain WB3S16. It is unlikely that B.ovis would have the ability to liberate these proteins from the spore coat as the louse midgut is not conducive to 116 È General Discussion dissolution and activation of ð-endotoxin crystal proteins. This theory is supported by the result of the fractionation experiment which showed that purified spores were not toxic to B. ovis and only caused death through septicaemia after germinating in the gut of the insect. In addition, electron micrographs revealed that spores remained undigested in the midgut of B. ovis affected by the IWB3S 16 preparation. SDS-PAGE showed that crystal- mutants prepared by heat curing Bt strain V/B3S16 of plasmids bearing cry genes, did not produce detectable amounts of crystal protein. All crystal- strains were significantly toxic to B. ovis even though they did not produce a crystal and this result was not consistent with the outcome expected from the hypothesis. Further investigation using a more sensitive western blot technique showed that crystal- mutants produced detectable amounts of both the 70kDa and l40kDa crystal proteins. In addition, a southern blot analysis showed that all Bt crystal- mutants had plasmid DNA which hybridised to cryIA and cry2A oligonucleotide probes. Therefor, it is unlikely that the crystal- mutants were cured of all cry gerLe bearing plasmids. It is also possible that crystal protein may be encoded by cry genes carried on the chromosome of crystal- strains, as suggested by Schnepf and V/hitely (1981). Although there may have been a low copy number of residual plasmids carrying cryl| and cry2A genes after curing, this experiment provided strong evidence that all crystal- strains had the ability to produce CrylA and Cry2A crystal proteins. In addition, bioassays showed that the amount of crystal protein produced by the crystal- strains was directly correlated with the toxicity of the strains to B. ovis and these experimental results supported the original hypothesis. The low concentration of the CrylA and Cry2A proteins in mutant strains may have been insufficient for passive association of the molecules to form a crystal. Alternatively, genes coding for factors involved in crystal formation (Minnich and Aronson, 7984; Crickmore and Ellar, 1992) may have been disrupted by the curing. Immunogold labelling was used to study the interaction of crystal proteins with the B. ovis midgut epithelial cells. Cry proteins are thought to bind to specific receptors on the midgut epithelial membrane of susceptible insects (Hofmann et a1.,1988; Vadlamudi et aI., 1995). Bravo et al. (1992a and 1992b) and Aranda et al. (1996) employed an immunocytochemical localisation technique to study the binding of crystal protein to the insect brush border membrane of lepidopteran larvae. Consistent with the results of Hill (1992) and Hill and Pinnock (1998), V/83S16 lyophilised culture preparations, dissolved WB3516 crystal proteins and dissolved Cry1A and Cry2A proteins caused disruption of. B. ovis midgut cells, loss of cell organelles and disintegration of midgut microvilli. Dissolved Cry14, Cry2A and V/B3S16 ð-endotoxin crystal proteins exhibited significant binding to B. ovis midgut microvilli in comparison to controls and of these, the CrylA protein exhibited the greatest amount of binding to the microvilli. These results suggest that CrylA and Cry2A crystal proteins bind to putative B. ovis midgut receptors, causing colloid osmolysis of the midgut tt7 General Discussion cell. ð-endotoxin toxicity appears to be correlated with receptor concentration (Hofmann et a1.,1988b, Van Rie et a1.,1990a and b) and the greater concentration of Cry1A binding sites on the B. ovis microvilli may explain why the Cry1A protein is significantly more toxic to B. oyis than the Cry2A. B. ovis midgut cell ð-endotoxin protein receptors could be isolated and investigated using the techniques described by Ki¡þht et aI. (1994b) and Vadlamudi ¿r ot./y (lees). Attempts to separate WB3S16 CrylA and Cry2A proteins using the traditional techniques of differential solubilisation (Yamamoto and lizuka, 1983), iso-electric focusing and column chromatography (Yamamoto and Mclaughlin, l98l) were unsuccessful because the CrylA protein was rapidly degraded or was insoluble within certain pH ranges. In an alternative approach, crylL and cry2A genes from IWB3S16 were cloned, sequenced, and studied for homology to published sequences. An attempt was made to clone and express these proteins in an E coli QlAexpress pQE (Qiagen) expression system to separately verify and quantify the toxicity of both CrylA and Cry2A proteins to B. ovis. BLAST results and protein alignments showed that the strain WB3S16 crystal proteins were closely related to published CrylA and Cry2A proteins and suggested that this strain posesses crylNa, crylfuc, cry2Aa and cry2{b genes. The cry1Ab gene was not detected in the V/B3SI6 genome. Primary and secondary features of the CrylA and Cry2A proteins were similar to that of other crystal proteins and no amino acid substitutions or protein structural features were identified which indicated that the WB3SI6 crystal proteins had a novel mode of insecticidal action. The sequencing evidence suggested that the V/83S16 crystal proteins could act against B. ovis through a mechanism similar to that of other ð-endotoxin crystal proteins. Certain Bt toxic factors described by a number of researchers have cha¡acteristics in common with the WB3S16 louse toxin. For instance, like the Vip3A vegetative insecticidal proteins described by Estruch et al. (1996), the WB3S16 louse toxin appears to be heat labile (Drummond, pers comm.) and is expressed from the vegetative stage of Bt growth through to sporulation. Bt strain WB3S16 clears egg-yolk agar and may produce the 1-exotoxin described by Heimpel (1967). Like the thermosensitive exotoxin described by Krieg (1971), the WB3S16 louse toxin is found in the supernatant and is produced during log phase growth of the bacterium. It is also possible that strain'ïWB3S16 produces the labile toxin (Smirnoff and Berlinguet, 1996), the water soluble toxin (Fast, l97l) and a variety of other enzymes or unidentified toxins effective against B. ovis or capable of augmenting the toxicity of Bt to this insect. This study focused on the ð-endotoxin crystal proteins of strain WB3S16. Further experiments are required to verify the production by strain IWB3S16 of the toxic factors discussed above and to investigate their insecticidal activity against B. ovis. Unfortunately, such investigations would be limited by the lack of available information regarding these toxins. 118 General Discussion This is the first study to investigate the "louse factor" produced by Bt, and to report toxicity of ð-endotoxin crystal proteins to a phthirapteran species. Due to the lack of information provided in the original statement of Dulmage (1981), it was not possible to confirm whether the louse toxin investigated in this study was identical to the "louse factor" described by Dulmage. The study did not disprove the original hypothesis of a relationship between the \VB3S16 louse toxin and the ð-endotoxin crystal proteins of this strain. The results suggest that a soluble 70kDa crystal protein produced by strain WB3S16 and all crystal- mutant strains, may act as a toxin against B. ovis, having a mode of action similar to that of the ð- endotoxin crystal proteins effective against susceptible lepidopteran larvae. The 70kDa protein may be a Cry2A protein, a breakdown product of the CrylA protein or a combination of both. The protein may exist free or loosely bound in the Bt cell, and may become associated with the membrane and supernatant fractions and the spore coat. Even though lice lack the ability to dissolve and activate the ð-endotoxin crystal into toxic peptides, the pre- solubilised 70kDa protein could cause colloid osmotic lysis of B. ovds midgut cells. Therefor, incomplete incorporation of crystal proteins into the WB3S16 â-endotoxin crystal and./or susceptibility of the CrylA protein to degradation may result in louse toxic Bt strains. Lecadet and Dedonder (1971) reported that crystal- mutant strains synthesised one or more â- endotoxin crystal protein like proteins in a non-aggregated form. The abundance of Bt subspecies which possess this characteristic and correlations between such strains and their toxicity to lice have not been investigated to date. This project has answered some basic questions regarding the louse toxin produced by Bt strain WB3S16 and has generated many new avenues for scientific exploration in this area of Bt toxicology. The findings of this project have extended the known host range of solubilised Bt ð-endotoxins and in context with the results of Hilbeck et aI. (1997) and'Walters and English (1995) who reported toxicity of solubilised â-endotoxin proteins to Neuroptera and Hemiptera, suggest that the use of Bt as a microbial insecticide may have a significant impact on non-target organisms which a¡e not commonly considered in pest management situations. Although the involvement of other toxic factors can not be discounted, this study has presented strong evidence that Bt strain WB3S16 CrylA and Cry2A proteins significantly contribute to the toxicity of this strain to B. ovis and in addition, has provided valuable information to guide the development of Bt as a microbial insecticide for B. ovis control. 119 References REFERENCES Adang, M. T., Staver, M. J., Rocheleau, T. 4., Leighton, J., Barker, R. F. and Thompson, D. 1985. Characterised full-length and truncated plasmid clones of the crystal protein of Bacillus thuringiensls subsp. kurstakiHD-73 and their toxicity to Manduca sexta. Gene. 36,289-300. Ang, B. J. and Nickerson, K. V/. 1978. Purifîcation of the protein crystal ftom Bacillus thuringiensis by zonal gradient centrifugation. Appl. Env. Microbiol. 36,625-626. Angus, T. A. 1954. Abacterial toxin paralysing silkworm larvae. Nature. 1731 545-546. Angus, T. A. 1956a. General characteristics of certain insect pathogens related to Bacillus cereus. Can. J. Microbiol. 2,lll-121. Angus, T. A. 1956b. Association of toxicity with protein crystalline inclusions of Bacillus sotto Ishiwata. Can. J. Microbiol. 2,122-131. Angus, T. A. 1956c. Extraction, purifîcation and properties of Bacillus sotto toxin. Can. J. Microbiol. 2,416-426. Aquino de Muro, M., Mitchell, IV'. J. and Priest, F. G. t992. Differentiation of mosquito- pathogenic strains of Bacillus sphøericus from non-toxic varieties by ribosomal RNA gene restriction patterns. J. Gen. Microbiol. L38' I 159-1166. Aranda, E., Sancher, J., Peferoen, M., Guereca, L. and Bravo, A. 1996. Interactions of Bacillus thuringiensis crystal proteins with the midgut epithelial cells of Spodoptera frugiperda(Lepidoptera: Noctuidae). J. Invert. Pathol. 68, 2O3-2t2. Argauer, R. J., Cantwell, G. E. and Cantelo, W. V/. 1991. Evidence for a novel insecticidally active exotoxin produced by the HD-116 strain of Bacillus thuringiensis var morrisoni. J. EntomoL Sci. 26,205-213. Aronson, A. I., Beckman, W. and Dunn, P. 1986. Bacillus thuringiensis and related insect pathogens. Microbiol. Rev. 50, l-24. 120 References Aronson, A. I., Han, E-S., McGaughey, W. and Johnson, D. 1991. The solubility of inclusion proteins from Bacillus thuringiensis is dependant upon composition and is a factor in toxicity to insects. AppI. Env. Microbiol. 57,981-986. Asano, S., Hori, H. and Cui, Y. 1994. A unique insecticidal activity in Bacillus thuringiensrs growth medium. Appl. Entomol. Zool. 29,39-45. Baines, D., Brownright, A. and Schwartz,I. L. 1994. Establishment of primary and continuous cultures of epithelial cells from larval lepidopteran midguts. J. Insect Physiol. 40,347-357. Baum, J. A. and Malavar, T. 1995. Regulation of insecticidal crystal protein production in Bacillus thuringiensis. MoI. Microbiol. t8, I-I2. Baumann, P., Clark, M. A,, Baumann, L. and Broadwell, A. H. 1991. Bacillus sphaericus as a mosquito pathogen: properties of the organism and its toxin. Microbiol. R¿v. 55, 425-436. Bechtel, D. B. and Bulla, L. A. (Jr.). 1976. Electron microscopic study of sporulation and parasporal crystal formation in Bacillus thuringiensis. J. Bacteriol. 127, 1472-1481. Berliner, E. 1915. Über die Schlaffsucht der Mehlomottenraupe (Ephestia kühniella Z'e'll.) und ihren Erreger Bacillus thuringiensis n. sp. Z. Agnew. Ent. 2129-56. Bernhard, K., Schrempf, H. and Goebel, V/. 1978. Bacteriocin and antibiotic resistance plasmids inBacillus cereus andBacillus subtilis. J. Bacteriol. 133,879-903. Bietlot, H., Carey, P. R., Choma, C., Kaplan, H., Lessard, T. and Pozsgay, M. 1989. Facile preparation and characterisation of the toxin from Bacillus thuringiensis var. kurstaki. Biochern. J. 260, 87 -91. Bietlot, H., Vishnubhatla,I., Carey, P. R., Pozsgay, M. and Kaplan, H. 1990. Characterisation of the cysteine residues and disulphide linkages in the protein crystal of Bacillus thuringiensis. Biochem. J. 267,309-315. Bond, R. P. M., Boyce, C. B. C., Rogoff, M. H. and Shieh, T. R. 1971. In "Microbial 'W. Control of Insects and Mites". H. D. Burges and N. Hussey (Eds.), Academic Press,Inc., London. pp 275-303. L2l References Bone, L. W., Botder, K. P. and Gill, S. S. 1985. Trichostrongylus colubriþrmis: egg lethality due to Bacillus thuringiensis crystal toxin. Exp. Parasitol. 60,314-322 Bottjer, K. P., Bone, L. W. and Gill, S. S. 1985. Nematoda: susceptibility of the egg to Bacillus thuringiensis toxin. Exp. Parasitol. 60, 239-244. Braun, L. and Keddie, B. A. 1997. Anew tissue technique for evaluating effects of Bacillus thuringiensis toxins on insect midgut epithelium. J. Invert. Pathol. 69,92-lM. Bravo, 4., Hendrickx, K., Jansens, S. and Peferoen, M. 1992a. Immunocytochemical analysis of specific binding of Bacillus thuringiensis insecticidal crystal proteins to lepidopteranandcoleopteranmidgutmembranes. ,L Invert. Pathol. 60,247-253. Bravo, A., Jansens, S. and Peferoen, M. 1992b. Immunocytochemical localisation of Bacillus thuringiens¿s insecticidal crystal proteins in intoxicated insects. J. Invert. Pathol. 60,237-246. Bizzard,B. L. and Whiteley, H. R. 1988. Nucleotide sequence of an additional crystal protein gene cloned from Bacillus thuringiensis subsp. thuringiensis. Nucleic Acids. Res. 16,4168-4169. Brousseau, R. and Masson, L. 1988. Bacillus thuringiens¿s insecticidal crystal toxins: gene structure and mode of action. Biotechnol. Adv. 6,697-724- Bulla, L. A. (Jr.), Bechtel, D. 8., Kfamer, K. J., Shethna, Y. I. and Aronson, A. I. 1980. Ultrastructure, physiology and biochemistry of. Bacillus thuringiensis. CRC Crit Rev Microbiol. 8,147-204. Bulla, L. A. (Jr.), Kramer, K. J. and Davidson, L. I. 1977. Characterization of the entomocidalparasporalcrystal of.Bacillusthuringiensis. J. Bacteriol. 1301375-383 Bubenschikova, S. N., Kagramanova, V. K., Baratova, L. 4., Danilova, E. B. and Kruglyak, E. B. 1983. Determination of heat stable exotoxin of Bacillus thurtngiensr,s by high performance anion-exchange chromatography. J. Invert. Pathol. 42,344-347. Burges, H. D. 1975. Teratogenicity of the thermostable beta-exotoxin of Bacillus thuringiensis in Galleria mellonella. J. Invert. Pathol. 26, 419420. r22 References Calaby, J. H. and Murray, M. D. 1991. Pthiraptera (Lice). In "CSIRO Insects of Australia" 2nd Edn., Vol 1, Melbourne University Press, Melbourne. pp 42I-428. Campbell, D. P., Dieball, D. E. and Brackett, J. M. 1987. Rapid HPLC assay for the ß- exotoxin of Bacillusthuringiensis. J. Agric. Food. Chem. 35, 156-158. Cannon, R. J. C. 1993. Prospects and progress for Bacillus thuringiensis-based pesticides Pestic. Sci. 37,331-335. Carlton, B. C. and González,J. M (Jr.). 1984a. The genetics and molecular biology of Bacillus thuringiensis. In "The Molecula¡ Biology of the Bacilli". D. Dubnau (Ed.), Y ol 2., Academic Press, Inc., New York. Carlton, B. C. and González, J. M. (Jr.). 1994b. Plasmid associated delta-endotoxin production in Bacillus thuringiensis. In "Genetics and Biotechnology of Bacilli". A. T. Ganesan and J. A. Hoch (Ed.), Academic Press,Inc., New York. pp 387-400. Carlton,B. C. andGonzález,J. M. (Jr.). 1995. Plasmidsanddelta-endotoxinproductionin different subspecies of Bacillus thuringiensis. In "Molecular Biology of Microbial Differentiation". J. A. Hoch and P. Setlow (Ed.), American Society for Microbiology, Washington, D. C. pp 246-252. Chapman, R. F. 1991. General Anatomy and Function. In "CSIRO Insects of Australia". 2nd Edn., Vol 1, Melbourne University Press, Melbourne. pp 33-67. Chestukhina, G. G., Kostina, L. I., Zalunin,I. 4., Kotova, T. S., Katrukha, S. P., Kutnetsov, Y. S. and Stepanov, V. M. 1978. Proteinase bound to crystals of B acillus thurin giensis. Biokhimiya. 43, 857-864. Chestukhina, G. G., Kotova, T. S., Zalunin,I. A. and Stepanov, V. M. 1979. Proteinases during growth and spore formation of Bacillus thuringiensis. Biokhimiya. 44,796- 802. Chestukhina, G. G., Zalunin,I. 4., Kostina, L. I., Kotova, T. S., Katrukha, S. P. and Stepanov, V. M. 1980. Crystal forming proteins of Bacillus thuringiensis. Biochem. J. 187,457-465. t23 References Chilcott, C. N. and Wigley, P. J. 1993. Insecticidal activity of Bacillus thuringiensis crystal proteins. Proc. 2nd. Int. Canberra Meeting on Bacillus thuringiensis. Canberra, September, 1993. R. J. Akhurst (Ed.), CPN Publications Pty. Ltd. pp 43-52. Choma, C. T. and Kaplan,H. 1992. Bacillus thuringiensis crystal protein: effect of chemical modification of the cysteine and lysine residues. J. Invert. Pathol. 59175- 80. Choma, C. T., Surewicz, W. K., Carey, P. R., Pozsgay, M., Raynor, T. and Kaplan, H' 1990. Unusual proteolysis of the protoxin and toxin from Bacillus thuringiensis: structural implications. Eur. J. Biochem. 189, 523-527. Chou, P. Y. and Fasman, G. D. 1978. Prediction of the secondary structure of proteins from their amino acid sequence. Adv. Eprymol. 47,45-148. Chow, E., Singh, G. J. P. and Gill, S. S. 1989. Binding and aggregation of the25- kilodalton toxin of Bacillus thuringiensds subsp. israelensis to cell membranes and alteration by monoclonal antibodies and amino acid modifiers. AppI. Environ. Microbiol. 55, 2779-27 88. Ciordia, H. and Bizzell,W. E. 1961. A preliminary report on the effects of. Bacillus thuringiensis Berliner on the development of free-living stages of some cattle nematodes. J. Parasitol. 47,41. (Abstr.). Convents, D., Houssier, C., Lasters, L. and Lauwereys, M. 1990. The Bacillus thuringiensis ð-endotoxin: Evidence for a two domain structure of the minimal toxic fragment. J. BioI. Chem. 265, 1369-1375. Cooksey, K. E. 197L. The protein crystal toxin of Bacillus thuringiensis: Biochemistry and mode of action. In "Microbial Control of Insects and Mites". H. D. Burges and N. 'W. Hussey (Eds.), Academic Press,Inc., London. pp 247-274- Cooper, D. 1994. Bacillus thuringiensis toxins and mode of action. Agric. Eco. Env. 49, 2t-26. Cooper, D. J., Pinnock, D. E. and Were, S. T. 1985. Bacterial pathogens of the Australian sheep blowfly Lucilia cuprina. Proc. 4th. Australasian. Conf. on Grassl.and Invert. EcoI. Lincoln College, Cantebury, New 7¿aland, May, 1985. pp236-243. r24 References Cowan, S. T. 1974. "Cowan and Steel's Manual for the Identification of Medical Bacteria". S. T. Cowan (Ed.), 2nd Edn., Cambridge University Press, London. Crickmore, N. and Ellar, D. J. 1992. Involvement of a possible chaperonin in the efficient expression of a cloned crytrA ð-endotoxin gene in Bacillus thuringiensis. Mol. Microbiol. 6, 1533-1537. Currier, T. C. and Nester, E. W. 1976. Isolation of covalently closed circula¡ DNA of high molecular weight from bactena. AnaI. Biochem. 76,431-Ml. Dankocsik, C., Donovil, W. P. and Jany, C. S. 1990. Activation of a cryptic protein gene of Bacillus thuringiensls subsp. kurstøki by gene fusion and determination of the crystal protein insecticidal specificity. Mol. Microbiol. 4,2087 -2094. Dardenne, F., Seurink, J., Lambert, B. and Peferoen, M. 1990. Nucleotide sequence and deduced amino acid sequence of a cryl{(c) gene variant from Bacillus thuringiensis. Nuc. Acids. Res. 18,5546. Davidson, E. W. 1989. Variation in binding of. Bacillus sphaericus toxin and wheat germ agglutinin to larval midgut cells of six species of mosquitoes. ,/. Invert. Pathol. 53, 251-259. Davidson, E. W. and Titus, M. 1987. Ultrastructural effects of the Bacillus sphaericus mosquito larvicidal toxin on cultured mosquito cells. J. Invert. Pathol. 501213-220. de Barjac, H. 1981. Identification of H serotypes of Bacillus thuringier¿sis. In "Microbial Control of Pests and Plant Diseases 1970-1980". H. D. Burges (Ed.), Academic Press,Inc., London. pP 35-43. de Barjac, H. and Bonnefor, A. 1973. Classification of Bacillus thuringiensis Entomophaga. 18,5-17. Delafield, F. P., Somerville, H. J. and Rittenberg, S. C. 1968. Immunological homology between crystal and spore protein of Bacillus thuringiensis. J. Bacteriol. 96,7L3- 720. Devisetty, B. N. 1993. Production and formulation aspects of Bacillus thuringiensis. Proc. 2nd. Int. Canberra Meeting on Bacillus thuringiensis. Canberra, September, 1993. R. J. Akhurst @d.), CPN Publications Pty. Ltd. pp 95-102. r25 References Donovan, W. P., Dankocsik, C. C., Gilbert, M. P., Gawron-Burke, M. C., Groat, R. G. and Carlton, B. C. 1988. Amino acid sequence and entomocidal activity of the P2 crystal protein. J. BioI. Chem' 263,561-567. Donovan, W. P., Dankocsik, C. C., Gilbert, M. P., Gawron-Burke, M. C., Groat, R. G. and carlton,B. C. 1989. Additionandcorrections J. Biol. chem. 264,4740. Drobniewski, F. A. and Ella¡, D. J. 1988. Toxin-membrane interactions of Bacillus thuringiensis delta-endotoxin' Biochem. Soc' Trans. 16, 39-40. Drummond, J., Miller, D. K. and Pinnock, D. E. 1992. Toxicity of Bacillus thuringiensis against Damaliniaovrs (Pthiraptera: Mallophaga). J. Invert. Pathol. 60, 102-103. Drummond, J. and Pinnock, D. E. 1991. Host spectrum of Bacillus thuringiensis. Proc. Workshop on Bt , Canberra, 1991. pp 13-15. Drummond, J. and Pinnock, D. E. 1992. Potential of BøciIIus thuringiensis in the control of sheep lice. Proc. Aust. Vet. Assoc. Conf. Christchurch, New kaland, 1992. Dulmage, H. T. 1970. Insecticidal activity of HD-l, a new isolate of Bacillus thuringiensis var. alesti. J. Invert. Pathol. 15,232-239. Dulmage, H. T and Cooperators. 1981. Insecticidal activity of isolates of. Bac.illus thuringiensis and their potential for pest control. In "Microbial Control of Pests and Plant Diseases 1970-1980". H. D. Burges (Ed.), Academic Press, London. pp 193- 222. Dulmage, H. T. and Rhodes, R. A. I97I. In "Microbial Control of Insects and Mites". H. D. Burges and N. W. Hussey (Eds.), Academic Press, London. pp 507-540. Ebeling, W., Hennrich, N., Klockow, M., Metz, H., Orth, H. D. and Lang, H. 1974. Proteinase K from Tritirachium album (Limber). Eur. J. Biochem. 47,91-97. Eckha¡dt., T. 1978. A rapid method for the identification of plasmid desoxyribonucleic acid in bacteria. Plasmid. 1, 584-588. 126 References Egorov, N. S., Loriya, Zh. K. and Yudina, T. G. 1983. Influence of amino acids on the synthesis of exoprotease by Bacillus thuringiensis. Prikladnaya Biokhimiya i Mikrobiolo giya. 19, 6 10-6 1 6. Ely, S. 1993. The engineering of plants to express Bacillus thuringiensis ð-endotoxin. In "Bacillus thuringiensis, an Environmental Pesticide". P. F. Entwistle, J. S. Cory, 'Wiley, M. J. Bailey and S. Higgs (Eds.), Chichester. pp IO5-124. English, L. H. and Cantley,L. C. 1985. Delta-endotoxin inhibits Rb+ uptake, lowers cytoplasmic pH and inhibits a K+ ATPase in Manduca sexta CFIE cells. J. Membrane Biol. 85, 199-204. 'W., Estruch, J. J., Wa¡ren, G. Mullins, M. 4., Nye, G' J., Craig, J. A. and Koziel, M. G 1996. Vip3A, a novel Bacillus thuringiensls vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc. NatI. Acad. Sci. usA. 93,5389-5394. Farkas, J., Sebesta, K., Horská, K., Samek,2., Dolejs, L. and Sorm, F. 1977. Structure of thuringiensin, the thermostable exotoxin from Bacillus thuringiensis. CoIl. Czech. Chem. Commun. 34, lI18-l 120. Fast, P. G. 1971. Isolation of a water-soluble toxin from a commercial microbial insecticide based onBacillus thuringiensis. J. Invert. Pathol. 17,301. Fast, P. G. 1972. The ð-endotoxin of Bacillus thuringiensis III: a rapid method for separating parasporal bodies from spores. J. Invert. Pathol. 20,139-l4O- Fast, P. G. 1981. Crystal toxin of Bacillus thuringiensis. "Microbial Control of Pests and Plant Diseases 1970-1980". H. D. Burges (Ed.), Academic Press, Inc., London. pp 223-248. Fast, P. G. and Milne, R. 1979. Bacillus thuringiensis parasporal toxin: dissolution of crystals with retention of toxicity. J. Invert. Pathol. 34,319. Faust, R. M. 1971. Toxins of Bacillus thuringiensis: mode of action. Biological Regulation of Vectors, Conference Report. US Deparnnent of Health, 1971. pp 3148. 127 References Faust, R. M., Hallam, G. M. and Travers, R. S. 1973. Spectrographic elemental analysis of the parasporal crystals produced by Bacillus thuringiensis var. dendrolimus and the polyhedral inclusion bodies of the nucleopolyhedrosis virus of the fall armyworn, Spodoptera frugiperda. J. Invert. Pathol. 22, 478-480' Faust, R. M. 1977. Toxins of Bøcillus thuringiensis'. Mode of Action. In "Biological Regulation of Vectors. The Saprophytic and Aerobic Bacteria and Fungi". J. D. Briggs (Ed.),'Washington, DC. pp 3l-48. Feitelson, J. S., Payne, J. and Kim, L. 1992. Bacillus thuringiensis: insects and beyond. Bio/Technol. 10, 27 l-27 5. Ferré, J., Real, M. D., Van Rie, J., Jansens, S. and Peferoen, M: 199I. Resistance to the Bacillus thuringiensis bioinsecticide in a field population of Plutella ryIostella is due to achange in amidgut membrane receptor. Proc. NatL Acad. Sci. USA. 88, 5119- 5t23. Finney, D. J. I97 L "Probit Analysis". cambridge uni. Press., cambridge. Garcia-Patrone, M. and Tandecarz,J. S. 1995. A glycoprotein multimer from Bacillus thuringiensis sporangia: dissociation into subunits and sugar composition- MoI. CelI Biochem. 145,29-37. Garczynski, S. F., Crim, J. W. and Adand, M. J. 199L. Identification of putative insect brush border membrane binding molecules specifc to Bacillus thuringiensisð- endotoxin by protein blot analysis. Appl. Env. Microbiol. 57,2816-2820. Geiser, M., Schweitzer, S. and Grimm, C. 1986. The hyperva¡iable region in the genes coding for entomopathogenic crystal proteins of Bacillus thuringiensls: nucleotide sequenceofthe kurhd.l geneof subsp. kurstakiHDl. Gene.48, 109-118. Gill, S. S., Cowles, E. A. and Pietrantonio, P. Y. 1992. Mode of action of. Bacillus thuringiensis endotoxins. 37, 615-636. Gilmore, M. S., Cruz-Rodz, A. L., Leimeister-'Wachter, M., Kreft, J. and Goebbel,IV. 1989. A Bacillus cereus cytolytic determinant, cereolysin AB, which comprises the phospholipase C and sphingomyelinase genes; nucleotide sequence and genetic linkage. J. Bacteriol. l7l,7$-753. t28 References Gingrich, R. E., Allan, N. and Hopkins, D. E. 1974. Bacillus thuringiensis'.laboratory test against four species of biting lice (Mallophaga: Trichodectidae). J. Invert. Pathol. 23,232-236. Goldberg, I. and Margalit, J. 1977. A bacterial spore demonstrating rapid larvicidal activity against Anopheles serenti, (Jranotoenia unguisulatata, Culex invitatus, Aedes aegypti and Culex pipiens. Mosq News. 37, 355-358. Gonzílez,J. M. (Jr.), Brown, B. S. and Carlton, B. C. 1982. Transfer of Bacillus thuringiensis plasmids coding for ð-endotoxin among strains of B. thuringiensis and B. cereus. Proc. Natl. Acad. Sci. USA. 79'695I-6955. Gonz6lez,J. M. (Jr.) and Carlton, B. C. 1980. Patterns of plasmid DNA in crystalliferous and acrystalliferous strains of. Bacillus thuringiensis. Plasmid. 3,92-98. Gonz6lez,J. M. (Jr.) and Carlton, B. C. 1981. Correlation between specific plasmids and â- endotoxin production in Bacillus thuringiensis. Plasmid. 5, 351-365. Gonzâlez,J. M. (Jr.) and Carlton, B. C. 1984. A large transmissible plasmid is required for crystal toxin production in Bacillus thuringiensis variety israelensis. Plasmid. 11,28- 38. Gonzátrez,J. M. (Jr.), Dulmage, H. T. and Carlton, B. C. 1981. Conelation between specific plasmids and ð-endotoxin production in Bacillus thuringiensis. Plasmid. 5, 351-365. Goodman, N. S., Gottfried, R. J. and Rogoff, M. H. 1967. Biphasic system for separation of spores and crystals of Bt. J. Bacteriol. 94,485. Griego, V. M., Fancher, L. J. and Spence, K. D. 1980. Scanning electron microscopy of the disruption of tobacco hornworm, Manduca sexta midgutby Bacillus thuringiensis endotoxin. J. Invert. Pathol. 35, 186-189. Haider, M. Z. and Ellar, D. J. 1987. Analysis of the molecular basis of insecticidal specificity of Bacillus thuringiensis crystal â-endotoxin. Biochem. J. ?48,197-201 Haider, M. 2., Knowles, B. H. and Ella¡, D. J. 1986. Specificity of Bacillus thuringiensis var colmeri insecticidal ð-endotoxin determined by differential proteolytic processing of the protoxin by larval gut juices. Eur. J. Biochem. 156,531-540. 129 References Hannay, C. L. 1953. Crystallineinclusionsinaerobicsporeformingbacteria. Nature. 172, 1004. Hannay, C. L. and Fitz-James, P. 1955. The protein crystals of Bacillus thuringiensis (Berliner). Can. J. Microbiol. 1,694-7L0. Harlow, E. and Lane, D. 1988. "Antibodies: a Laboratory Manual". Cold Spring Harbour Laboratory, New York Hansen, J. B. and Olsen, R. H. 1978. Isolation of large bacterial plasmids and characterisation of theP2 incompatability group group plasmids pMGl and pMG5. ,I Bacteriol. I35, 227 -238. Hefford, M. A., Brousseau, R., Prefontaine, G., Hanna, 2., Condie, J. A. and Lau, P. C. K. 1987. Sequence of a lepidopteran toxin gene of Bacillus thuringiensis subsp. kurstaki NRD-12. J. Biotechnol. 6,307-322. Heimpel, A. M. 1967. Acritical review of Bacillus thuringiensis var thuringiensis Berliner and other crystalliferous bacteria. Ann. Rev. Entomol. 12, 287 -322. Heimpel, A. M. and Angus, T. A. 1960. The site of action of crystalliferous bacteria in lepidoptera larvae. J. Insect Pathol. 1,152-170. Hein, J. 1990. Unified Approach to Alignment and Phylogenies. "Methods in Enzymology" Vol. 183. Academic Press,Inc., San Diego, CA. pp 626-645. Held, G. 4., Bulla, L. A. (Jr.), Fenari,8., Hoch, J. 4., Atonson, A. I. and Minnich, S. A. 1982. Cloning and localisation of the lepidopteran protoxin gene of Bacillus thuringiensis subsp. kurstaki. Proc. NatI. Acad. Sci. USA. 79,6065-6069. Henner, D. J., Y*g, M., Chen, E., Hellmiss, R., Rodrigtez, H. and Low, M. G. 1988. Sequence of the Bacillus thuringiensls phosphatidylinositol specific phospholipase C. Nucleic Acids. Røs. 16, 10383. Herbert, B. N. and Gould, H. J. 1973. Biosynthesis of the crystal protein of. Bacillus thuringiensis var tolworthi. I. Kinetics of formation of the polypeptide components of the crystal protein in vivo. Eur. J. Biochem. 37,44148. 130 References Herbert, D. A. and Harper, J. D. 1985. Food consumptionby Heliothis zea (Lepidoptera: Noctuidae) larvae intoxicated with a beta-exotoxin of Bacillus thuringiensis. J. Econ. Entomol. 80,593-596. Herrnstadt, C., Soares, G. G.,'Wilcox, E. R. and Edwards, D. L. 1986. A new strain of Bacillus thuringiens¡s with activity against coleopteran insects. Bio/Technol. 4,305- 308. Hilbeck,A.,Moar,W. J.,Pusztai-Carey,M. andBigler,F. 1997.Impactof CrylAbtoxin and protoxin Spodoptera littoralis la¡vae on immature fitness of the non-target, beneficial insect Chrysoperla carnea (Neuroptera: Chrysopidae). 30th. Ann. Meeting. Soc. Invert. Pathol. Banff, Canada,August, 1997. pp25' Hill, C. A. 1992. The histopathology and mode of action of. Bacillus thuringiensis (Berliner) against the sheep louse, Damalinia oyis. Honours Thesis, University of Adelaide, November,1992. Hill, C. A. and Pinnock, D. E. 1998. Histopathological effects of Bacillus thuringiensis on the alimentary canal of the sheep louse, Bovicola ovis. J. Invert. Pathol. Accepted 13th January, 1998. Hofmann, C., Lüthy, P., Hütter, R. and Pliska, V. 1988a. Binding of the delta-endotoxin from Bacillus thuringiensis to brush-border membrane vesicles of the cabbage butterfly (Pieris brassicae). Eur. J. Biochem. 173' 85-91. Hofmann, C., Vanderbruggen, H., Höfte, H., Van Rie, J., Jansens, S. and Van Mellaert, H. 1988b. Specificity of. Bacillus thuringiensis ð-endotoxins is correlated with the pÍesence of high affinity binding sites in the brush border membrane of target insect midguts. Proc. Natl. Acad. Sci. USA. 85,78M-7848- Hoffman, R. A. and Gingrich, R. E. 1968. Dusts containing Bacillus thuringiensis for control of chicken body, shaft and wing lice. J. Econ. Entomol. 61, 85-88. Höfte, H., de Greve, H., Seurinck, J., Jansens, S., Mahillon, J., Ampe, C., Vandekerckhove, J., Vanderbruggen, H., van Montagu, M.,Zabeau, M. and Vaeck, M. 1986. Structural and functional analysis of a cloned delta-endotoxin of Bøcillus thuringiensis berliner 1715. Eur. J. Biochem. L61,272-280. 131 References Höfte, H., Soetaert, P., Jansens, S. and Peferoen, M. 1990. Nucleotide sequence and deduced amino acid sequence of a new lepidoptera-specific crystal protein gene from Bacillus thuringiensis. Nuc. Acids. R¿s. 18, 5545. Höfte, H., Van Rie, J., Jansens, S., Van Houten, 4., Vanderbruggen, H. and Vaeck, M. 1988. Monoclonal antibody analysis and insecticidal spectrum of three types of lepidopteran-specific insecticidal crystal proteins of Bacillus thuringiensis. AppI. Env. Microbiol. 54, 2010-2017. Höfte, H. and Whiteley, H. R. 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol. Rev. 53, 242-255. Holmes, K. C. and Munro, R. E. 1965. Studies on the structure of parasporal inclusions fromBacillus thuringiensis. J. MoI. BioI. 14,572-58I. Honda, T., Shiba, A., Seo, S., Yamamoto, J., Matsuyama, J. and Miwatani, T. 1991. Identity of hemolysins producedby Bacillus thuringiensis and Bacillus cereus. FEMS Microbiol. Lett. 79, 205-210. Horák, P.,'Weiser, J., Mikes, L. and Kolárová, L. 1996. The effect of. Bacillus thuringiensis M-exotoxin on trematode cercariae. J. Invert. Pathol. 68, 4l-49. Huber, H. E., Lutþ, P., Ebersold, H. R. and Cordier, J. L. 1981. The subunits of the parasporal crystal of Bacillus thuringiensis subsp. israelensis: size, linkage and toxicity. Arch. Microbiol. 129, 14-18. Ignoffo, C. M. and Gard, l. 1970. Use of an agar-base diet and housefly larvae to assay ß- exotoxin activity of. Bacillus thuringiensis. J. Econ. Entomol. 63, 1987-1989. Ignoffo, C. M. and Gregory,B. 1972. Effects of Bacillus thuringiensrs beta-exotoxin on larval maturation, adult longevity, fecundity and egg viability in several species of Lepidoptera. Environ. Entomol. l, 269-272. Ikezawa, H., Nakabayashi, T., Suzuki, K., Nakajima, M., Taguchi, T. and Taguchi, R. 1983. Complete purification of a phosphatidylinositol-specific phospholipase C from a strain of. Bacillus thuringiensis. J. Biochem. 93, l7l7 -L719. r32 References Johansen, T., Holm, T., Guddal, P. H., Sletten, K., Haugli, F. B. and Little, C. 1988. Cloning and sequencing of the gene encoding the phosphatidylcholine-preferring phospholipase C of. Bacillus cereus. Gene. 65,293-304. Johnson, D. E. 1994. Cellula¡ toxicities and membrane binding characteristics of insecticidal crystal proteins from Bacillus thuringiensis toward cultured insect cells. J. Invert. Pathol. 63,123-129. Juttner, J. A. Studies on the genetic control and production of thuringiensin (ß-exotoxin) in Bacillus thuringiensis var thuringiensis strain HD-2. Honours Thesis, University of Adelaide, November 1993. Khawaled, K., Cohen, T. and Zaritsky, A. 1992. Digestion of Bacillus thuringiensis var israelensis spores by larvae of.Aedes aegypti. J. Invert. Pathol. 59, 186-189. Kettle, P. R. and Lukies, J. M. 1982. Long term effects of sheep body lice (Damalinia ovis) on body weight and wool production. NZ J. Exp. Ag. 2,219-221. Klier, 4., Fargette, F., Ribier, J. and Rapaport, G. 1982. Cloning and expression of the crystal protein genes from Bacillus thuringiensis strain berliner 1715. EMBO J. l, 79r-799. Knight, P. J., Crickmore, N. and Ellar, D. J. I994a. The receptor for Bacillus thuringiensis CrylA(c) delta-endtoxin in the brush border membrane of the lepidopteran Manduca sexta isaminopeptidase N. MoL Microbiol. ll, 429436. Knight, P. J., Nicholoson, M., Crickmore, N., Van Rie, J. and Ella¡, D. J. 1994b. Purification, cloning and cha¡acterisation of a Manduca sØcta epithelial receptor for a Bacillus thuringiensis ð-endotoxin. IIIrd. Int. Workshop on the Molecular Biology and Genetics of Lepidoptera. Kolympa4 Crete, Greece, 1994. Knowles, B. H., Blatt, M. R., Tester, M., Horsnell, J. M., Carroll, J., Menestrina, G. and Ellar, D. J. 1989. A cytolytic ð-endotoxin from Bacillus thuringiensis var israelensis forms cation-selective channels in planar lipid bilayers. FEBS Leu. 244,259-262. Knowles, B. H. and Dow, J. A. T. 1993. The crystal â-endotoxins of Bacillus thuringiensis: models for their mechanism of action on the insect gut. BioEssøys. 15, 469-476. 133 References Knowles, B. H. and Ellar, D. J. 1986. Cha¡acterisation and partial purif,rcation of a plasma membrane receptor for Bacillus thuringie¡nsis var kurstaki lepidopteran-specific ð- endotoxin. J. Cell. Sci. 83,89-101. Knowles, B. H. and Ellar, D. J. 1987. Colloid-osmotic lysis is a general feature of the mechanism of action of Bacillus thuringiensis â-endotoxins with different insect specificity. Biochem. Biophys. Acta. 974,509-518. Knowles, B. H., Francis, P. H. and Ellar, D. J. 1986. Structurally related Bacillus thuringiensl,s â-endotoxins display major differences in insecticidal activity in vivo andinvitro. J. CelI Sci. 84,221-236. Knowles, B. H., Nicholls, C. N., Armstrong, G., Tester, M. and Ellar, D. J. 1990. Broad spectrum cytolytic toxins made by Bacillus thuringiensis. Vth. Int. CoI. Invert. Pathol. Adelaide, August, 1990. pp 283-287. Knowles, B. H.,'White, P. J., Nicholls, C. N. and Ellar, D. J. 1992. A broad spectrum cytolytic toxin from Bacillus thuringiensis var þushuensis. Proc. Roy. Soc. Ser. B. 248, r-7. Kolsto, A-8. and Carlson, C. 1993. Study of Bacillus cereus andBacillus thuringiensis chromosomes by physical mapping. K. Devine, E. Ferra¡i, J. A. Hoch and G. Rapoport (Eds.), 7th. Int. Conf. on Bacillus (Abs.), Institut Pasteur, Paris, 1993. Kondo, S., Tamura, N., Kunitate, A., Hattori, M., Akashi, A. and Ohmori, I. 1987. Cloning and nucleotide sequence of two insecticidal delta-endotoxin genes from Bacillus thuringiensis. Agric. Biol. Chem. 52'455-463. Koni, P. A. and Ella¡, D. J. 1993. Cloning and characterisation of a novel Bacillus thuringiensis cytolytic delta-endotoxin. J. MoI. Biol. 229, 319-327. Krieg, A. 1971. Concerning alpha-exotoxin produced by vegetative cells of B¿ciIIus thuringiens¿s ¿nd Bacillus cereus. J. Invert. Pathol. 17, 134-135. Krieg, H., Huger, A. M., Langenbruch, G. A. and Schnetter, W. 1983. Bacillus thuringiens¡s va¡ tenebrionis, a new pathotype effective against larvae of coleoptera. Z. Agnew. Entomol. 96,500-508. 134 References Krieg, H. and Langenbruch, G. 1981. Susceptibility of arthropod species to Bacillus thuringiensis. In "Microbial Control of Pests and Plant Diseases 1970-1980". H. D. Burges (Ed.), Academic Press,Inc., London. pp 838-896. Kronstad, J. W., Schnepf, H. E. and Whiteley, H. R. 1983. Diversity of locations for Bacillus thuringiensis crystal protein genes. J. Bacteriol. 154,419-428. Kronstad, J. W. and Whiteley, H. R. 1986. Three classes of homologous Bacillus thuringiensrs crystal protein genes. Gene' 43,29-40. Krywienczyk, J. and Angus, T. A. 1967. A serological comparison of several crystalliferous insect pathogens. J. Invert. Pathol. 9,126-128. Krywienczyk, J., Dulmage, H. T. and Fast, P. G. 1978. Occurrence of two serologically distinct groups within Bacillus thuringiensis serotype 3ab var kurstaki. J. Invert. Pathol. 31,372-375. Krywienczyk, J., Dulmage, H. T., Hall, I. M., Beegle, C. C., Arakawa, K. Y. and Fast, P. G. 1981. Occurrence of kurstaki K-l crystal activity inBacillus thuringiensis subsp. thuringiensis serovar (H1). J. Invert. Pathol. 37, 62-65. Krywienczyk, J. and Fast, P. G. 1980. Serological relationships of the crystals of Bacillus thuringiensis var israelensis. J. Invert. Pathol. 36r I39-14O. Kyte, J. and Doolittle, R. F. 1982. A simple method for displaying the hydropathic character of a protein. J. MoI. BioI. 157, 105-132. Lambert, B., Höfte, H., Annys, K., Jansens, S., Soetaert, P. and Peferoen, M. L992. Novel Bacillus thuringiensis insecticidal crystal protein with a silent activity against coleopteran larvae. AppI. Env. Microbiol. 58, 2536-2542. Lecadet,M-M. and Dedonder, R. 1971. Biogenesis of the crystalline inclusion of Bacillus thuringiensis during sporulation. Eun J. Biochem. 23, 282-294. Lechner M., Kupke, T., Stefanovic, S. and Gotz, F. 1989. Molecular characterisation and sequence of phosphatidylinositol-specific phospholipase C of. BacíIIus thuringiensis MoI. Microbiol. 3, 62I-626. 135 References Levinson, B. L., Kasyan, K. J., Chiu, S. S., Currier, T. C. and Gonzalez,J. M. (Jr.). 1990. Identification of ß-exotoxin production, plasmids encoding ß-exotoxin and a new exotox in in B acillus thurin g iensrs using high-perforrnance liquid chromatography. J. Bacteriol. 172,3172-3179. Levot, G. W. 1992. Highlevel resistance to cypermethrin in the sheep body louse. Aust. Vet. J. 69,120. Li, E. and Yousten, A. A. 1975. Metalloprotease from Bacillus thuringiensis. AppI. Microbiol. 30, 354-36L. Li, J., Carroll, J. and Ellar, D. J. 1991. Crystal structure of insecticidal ô-endotoxin from B acillus thuringiensis at 2.5 Ìtresolution. Nature. 353, 8 1 5-82 1. Luthy, P., Hayashi, Y. and Angus, T. A. 1970. Presence of endotoxin in vegetative cells of BacíIIus thuringiensis var. sotto. Cøn. J. Microbiol. 16, 905-906. Luo,K.,Lu,Y-J. andAdang,M. J. 1996. Al06kDaformofaminopeptidaseisareceptor for Bacillus thuringiensis CryIC ð-endotoxin in the brush border membrane of Manduca sexta. Insect Biochem. Molec. BioI. 26,783-791'. Lüthy, P. and Ebersold, H. R. 1981. The entomocidal toxins of. Bacillus thuringiensis. Pharmac. Ther. L3, 257 -283 Lutz, F., Maurer, M. and Failing, K. 1987. Cytotoxic protein ftomPseudomonas aeruginosa: formation of hydrophilic pores in Ehrlich ascites tumor cells and effect on cell viability. Toxicon. 25, 293-305. Lysenko, O. and Kucera, M. 1971. Micro-organisms as sources of new insecticidal chemicals: Toxins. In "Microbial Control of Insects and Mites" H. D. Burges and N. W. Hussey (Eds.), Academic Press, Inc., London. pp 205-227. Maddrell, S. H. P., Lane, N. J., Harrison, J. B., Overton, J. A. and Moreton, R. B. 1988. The initial stages in the action of an insecticidal ð-endotoxin of Bacillus thuringiensis var israele¡nsis on the epithelial cells of the malpighian tubules of the insect, Rhodnius prolixus. J. CeIISci. 90, l3l-14/. Manker, D. C., Lidster, W. D., Starnes, R. L. and Maclntosh, S. C. May L994. Patent Cooperation Treaty Patent Application WO 94109630. 136 References McDonel, J. L. 1986. Toxins of. Clostridium perfringens types A, B, C, D and E. In "Pharmacology of Bacterial Toxins". F. Dorner and J. Drews (Eds.), Pergamon Press, Oxford. PP 477-517. MacFarlane, R. G., Oakley, C. L. and Anderson, C. G. 1941. Haemolysis and the production of opalescence in serum and lecitho-vitellin by the alpha-toxin of Clostridiumwelchii. J. Path. Bact. 52199. McGaughey, W. H. 1985. Insect resistance to the biological insecticide Bacillus thuringiensis. Science. 229, 193-195. McGaughey, C. A. and Chu, H. P. 1948. The egg-yolk reaction of aerobic sporing bacilli. J. Gen. Microbiol. 2,334-341. McKenna, C. T. and Fearne, J. T. 1952. Sheep lice and keds - their habits and control. /, Dept. Ag. SA. 53,335-347 and$I-4g. Milne, R., Murphy, D. and Fast, P. G. 1977. Bacillus thuringiensis ð-endotoxin: an improved technique for the separation of crystals from spores. J. Invert. Pathol. 29, 230-231. Minnich, S. A. and Aronson, A. I. 1984. Regulation of protoxin synthesis in Bacillus thuringiensis. J. Bacteriol. 158, 47 454. Miteva, V. I. 1978. Isolation of plasmid DNA from va¡ious strains of Bacillus thuringiensis andBacillus cereus. C. R. Acad. BuIg. Sci. 31,913-916. Mohd-Salleh, M. B. and Lewis, L. C. 1982. Feeding deterrent response of corn insects to beta-exotoxin of. Bacillus thuringiensis. J. Invert. Pathol. 39, 323-328. Monro, R. E. t96la. Protein turnover and the formation of protein inclusions during sporulation of Bacillus thuringiensis. Biochem. J. 81' 225-232. Monro, R. E. 1961b. Serological studies on the formation of protein parasporal inclusions in Bacillus thuringiensis. J. Biophys. Biochem. Cytol llr32t-331. Morris, O. N., Kanagaratnam, P. and Converse, V. 1997. Suitability of 30 agricultural products and by-products as nutrient sources for laboratory production of Bacíllus thuringiensrs subsp. aizawai (HD133). J. Invert. Pathol. 70,113-120. 137 References Muthukumtr, G. and Nickerson, K. W. 1987' The glycoprotein toxin of BøciIIus thuringiensis subsp. israelensis indicates a lectin-like receptor in the larval mosquito gut. AppI. Environ. Microbiol. 53,2650-2655. Murphy, D. tW., Sohi, S. S. and Fast, P. G. 1976. Bacillus thuringiensrs enzyme digested â-endotoxin: effect on cultured insect cells. ,Sc¡¿nce. I94,954-954. Nairn, R. C (Ed.). 1969. "Fluorescent Protein Tracing". E & S Livingston Ltd., London. Narayanan, K. and Jayaraj, S. 1974. The effect of Bacillus thuringiensis endotoxin on hemolymph cation levels in the citrus leaf caterpillar, Papilio demoleus. J. Invert. Pathol. 23,125-126. Nickerson, K. W. 1980. Structure and function of the Bacillus thuringiensis protein crystal. Biotechnol. Bioeng. 12, 1305-1335. Norris, J. R. 1971. The protein crystal toxin of Bacillus thuringiensis: biosynthesis and physical structure. In "Microbial Control of Insects and Mites". H. D. Burges and N W. Hussey (Eds.), Academic Press, London' pp 229-246. Oeda, K., Oshie, K., Shimizu, M., Nakamura, K., Yamamoto, H., Nakayama,I. and Ohkawa, H. 1987. Nucleotide sequence of the insecticidal protein gene of Bacillus thuringiensis strain aizawai IPLT and its high level expression in Escherichia coli. Gene. 53, 113-119. Oehler, P. D., Gingrich, R. E. and Haufler, M. 1982. High performance liquid chromatographic determination of ß-exotoxin produced by the bacterium Bacillus thuringiensis. J. Agric. Food. Chem. 30,407-408. Ogiwari, K.,Indrasith, L. S., Asano, S. and Hori, H. 1992. Processing of ð-endotoxin from Bacillus thuringiensis subsp. kurstaki HD-l and HD-73 by gut juices of various insect larvae. J. Invert. Pathol. 60, t2l-126. Pais,M. anddeBarjac,H. 1974. J. Carbohyd. NucleosidesNucleotides. 1,213-223. Pang. A. S. D. 1993. Use of synthetic peptides to probe functional domains of aBacillus thuringiensis toxin. J. Invert. Pathol. 61,260-266. r38 References Pendelton, I. R., Bernheimer, A. W. and Grushoff,P. 1973. Purification and partial characterisationof hemolysins fromBacillusthuringiensis. J. Invert. Pathol 2l, 13 1-135. Pendelton,I. R. and Morrison, R. B. 1966. Analysis of the crystal antigens of Bacillus thuringiensrs by gel diffusion. J. AppL Bacteriol. 29,519-528. Pfannenstiel, M. A., Muthukumar, G., Couche, G. A. and Nickerson, K. V/. 1987. Amino suga.rs in the glycoprotein toxin fromBacillus thuringiensis subsp. israelensis. J. Bacteriol. 169, 796-801. Pinnock, D. E. and Drummond,I. 1992. Biological control of the sheep louse, Damalinia ovis using louse-toxic strains of Bacillus thuringiensis. Wool Research and Development Corporation Application for a Continuing Project 1992-1993. Pinnock, D. E., Lyness, E. W. and Cooper, D. J. 1993. Microbial control by colonisation: the development of Bacillus thuringiensis for control of sheep ectoparasites. Proc. 2nd. Int. Canberra Meeting on Bacillus thuringiensis Canberua, September, 1993, R. J. Akhurst (Ed.), CPN Publications Pty. Ltd. pp 153-158. Powles, R. J. and Rogers, P. L. 1989. Bacil/øs toxins for insect control - a review. Aust. J. Biotechnol. 3, 223-228. Priest, F. G., Aquino de Muro, M. and Kaji, D. A. 1994. Systematics of insect pathogenic bacilli: uses in strain identification and isolation of novel pathogens. In "Bacterial Diversity and Systematics". F. G. Priest, A. Ramos-Cormenzana and B. Tindatl (Eds.), Plenum Press, New York. pp275-295. Ramakrishnffi, N. and Tiwari, L. D. 1968. Histological changes in Plusia orichalcea caused by Bacillus thuringiensis. J. Invert. Pathol. 9' 579-580. Reisner, W. M., Feir, D. J., Lavrik, P. B. and Ryerse, J. S. 1989. Effect of Bacillus thuringiensis kurstaki ð-endotoxin on insect malpighian tubule structure and function. J. Inverl. Pathol. 54,175-190. Rowe, G. E. and Margaritus, A. 1987. Bioprocess developments in the production of biopesticidesby Bacillus thuringiensis. CRC Critical Reviews in Biotechnology. 6, 87-127. 139 References Sakharova ,2. Y.,Ignatenko, Y. N., Khovrychev, M. P., Lykov, V. P., Rabotnova, I. L. and Shevtsov, V. V. 1984. Sporulation and crystal formation in Bacillus thuringiensis ssp. galleriae during limitation of its growth with nutrient sources. Mikrobiolo giya. 53, 27 9 -284. Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. "Molecular cloning: A Laboratory Manual". 2nd. Edn. Cold Spring Harbour Laboratory Press., New York. Sanger, F., Nicklen, S. and Coulson, A. R. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. 74,5463-5467. Schesser, J. H. and Bulla, L. A. (Jr.). 1973. Toxicity of. Bacillus thuringiensds spores to the tobacco hornworm, Manduca sexta. AppI. Environ. Microbiol. 35,121-123. Schnepf, H. E. and Whiteley, H. R. 1981. Cloning and expression of the Bacillus thuringiensls crystal protein gene in Escherichia coli. Pro. NatI. Acad. Sci. USA. 78,2893-2897. Schnepf, H. E., Wong, H. C. and V/hiteley, H. R. 1985. The amino acid sequence of a crystal protein fromBacillus thuringiensis deduced from the DNA base sequence. ,L BioI. Chem. 260, 6264-6272. Sebesta, K. and Horska, K. 1968. Biochim. Biophys. Acta. L69,28I-282 Sebesta, K., Farkas, J., Horska, K. and Vankova, J. 1981. Thuringiensin, the beta-exotoxin of Bacillus thuringiensis. In "Microbial Control of Pests and Plant Diseases l97O- 1980". H. D. Burges (Ed.), Academic Press, London. pp 249-281. Sharpe, E. S. and Baker, F. L. 1979. Ultrastructure of the unusual crystal of the HD-l isolate of Bacillusthuringiensisva¡ kurstaki. J. Invert. Pathol. 341320-322. Sharpe, E. S., Herman, A. I. and Toolan, S. C. 1979. Separation of spores and parasporal crystals of Bacillus thuringiensis by flotation. J. Invert. Pathol 34,3t5-316. Sharpe, E. S., Nickerson, K. Vy'., Bulla, L. A. and Aronson, J. N. 1975. Separation of spores and parasporal crystals of. Bacillus thuringiensis in gradients of certain X-ray contrasting agents. Appl. Miuobiol. 30, 1052-1053. r40 References Shibano, Y., Yamagata, 4., Nakamura, N., Iizuka, T', Sugisaki, H. and Takanami, M' 1985. Nucleotide sequence coding for the insecticidal fragment of the Bacillus thuringiensis crystal protein gene. Gene. 34, 243-25I. Shin, B-S., Park, S-H., Choi, S-K., Koo, B-T. and Kim, J-L. 1995. Distribution of CryV- type insecticidal protein genes in Bacillus thuringiensis and cloning of CryV-type genes ftom Bacillus thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. entomocídus. AppI. Env. Microbiol. 61, 2402-2407. Short, J. 4.,'Walker, P. D., Thompson, R. O. and Somerville, H. S. 1974. J. Gen. Microbiol. 84, 26I-27 6. Singh, p. and Jerram, E. M. 1976. Rearing housefly larvae in polythene bags. NZ J. ZooI. 3,57-58. Sinclair, A. N. 1989. Crusts on the epidermis of some louse-infested merino sheep. Ausf Vet. J. 66,151-152. Smirnofl W. A. and Berlinguet, L. 1966. A substance in some commercial preparations of Bacillus thuringiensds var. thuringiensis toxic to sawfly larvae. J. Invert. Pathol. 8, 376-381. Smith, R. A. 1987. Use of crystal serology to differentiate among varieties of Bacillus thuringiensis. J. Invert. Pathol. 50' 1-8. Somerville, H. J. 1971. Formation of the parasporal inclusion of Bacillus thuringiensis. Eur. J. Biochem. 18,226-237. Somerville, H. J., Delafield, F. P. and Rittenberg, S. C. 1968. Biochemical homology between crystal and spore protein of Bacillus thuringiensis. J. Bacteriol. 961721- 726. Somerville, H. J. and James, C. R. 1970. Association of the crystalline inclusion of Bacillus thuringiensis with the exopsorium. ,I. Bacteriol. 102, 580-583. Somerville, H. J. and Jones, M. L. 1972. DNA competition studies within the Bacillus cereus group of bacilli. J. Gen. Microbiol. 73,257-265. l4r References Somerville, H. J. and Pockett, H. V, 1975. An insect toxin from spores of Bacillus thuringiensis and Bacillus cereus. J. Gen. Microbiol. 87,359-369. Southem, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. MoI. Ùiol 98,503-517. Spencer, E. Y. 1968. Comparative amino acid composition of the parasporal inclusions of five entomogenous bacteria. J. Inven. Pathol. 10, 444-M5' Stabb, E. V., Jacobson, L. M. and Handelsman, J. 1994. Zwitternl/rcin A-producing strains of Bacillus cereus from diverse soils. Appl. Env. Microbiol. 60,4O4-4I2. Stahly, D. p., Dingman, D. W., Bulla, L. A. and Aronson, A. I. 1978. Possible origin and function of the parasporal crystal ínBacillus thuringiensis. Biochem. Biophys. Res. Comm. 84' 581-588. Sutter, G. R. and Raun, E. S. 1967. Histopathology of european corn borer larvae treated with Bacillus thuringiensis. J. Invert. Pathol. 9, 90-103. Taguchi, R., Asatri, Y. and Ikezawa, H. 1980. Purification and properties of phosphatidylinositol-specific phospholipase C of. Bacillus thuringiensis. Biochim. Biophys. Acta. 6191 48-57 . J., Jackson-Yap, J. and Berry, C. 1991. Cloning, sequencing and Thanabalu,\ T., Hindley, expressron of a gene encoding a l0O-kilodalton mosquitocidal toxin from Bacillus sphaericus SStr-1. J. Bacteriol llS, 2776-2785. Thanabalu, T and Porter, A. G. 1996. A Bacillus sphaericus gene encoding a novel type of mosquitocidal toxin of 31.8kDa. Gene. 170' 85-89. Thomas, W. E. and Ellar, D. J. 1983 . Bacillus thuringiensis va¡ israelensis crystal â- endotoxin: Effects on insect and mammalian cells in vitro and in vivo. J. CeII. Sci. 60, 181-197. Thorne, L., Garduno, F., Thompson, T., Decker, D. and Zounes, M. 1986. Structural similarity between the Lepidoptera- and Diptera-specific insecticidal endotoxin genes of Bacillus thuringiensrs subsp. kurstaki and israelensis. J. Bacteriol. 166, 801-811. 142 References Titball,R. W. 1993. Bacterialphospholipases C. Microbiol. Rev. 57,347-366- Toumanoff, C. 1953. Description de quelques souches entomophytes de Bacillus cereus Frank, et Frank., avec remarques sur leur action et celle d'autres bacilles sur le jaune d'oeuf. Ann. Inst. Pasteur Paris. 85, 90-99' Tyrell, D. J., Bulla, L. A. (Jr.) and Davidson, L. I. 1981. Characterisation of spore coat proteins of Bacillus thuringiensis and Bacillus cereus. Biochem. Physiol. 70,535- 539. vadlamudi, R. K., Weber, E., Ji,I., Ji, T. H. and Bulla, L. A. (Jr.). 1995. Cloning and expression of a receptor for an insecticidal toxin of Bacillus thuringiensis. J. Biol. Chem. 270,5490-5494. Van Rie, J., Jansens, S., Höfte, H., Degheele, D. and Van Mellaert, H. 1989' Specificity of Bacillus thuringiensis ð-endotoxins: Importance of specific receptors on the brush border membrane of the midgut of target insects. Eur. J. Biochem. 186, 239-247. Van Rie, J., Jansens, S., Höfte, H., Degheele, D. and Van Mellaert, H. 1990a. Receptors on the brush border membrane of the insect midgut as determinants of the specificity of Bacillus thuringiensis delta-endotoxins. App. Env. Microbiol. 56, 1378-1385. Van Rie, J., McGaughey, V/. H., Johnson, D. E., Barnett, B. D. and Van Mellaert, H. 1990b. Mechanism of insect resistance to the microbial insecticide Bacillus thuringiensis. Science. 247, 72-77 . von Tersh, M. 4., Robbins, H. L., Jany, C. S. and Johnson, T. B. 1991. Insecticidal toxins fromBacillus thuringiensis subsp. kenyae; gene cloning and characterisation and comparison with B. thuringiensis subsp. kurstaki CryIA(c) toxins. AppI. Env. Microbiol. 57, 349-358. V/aalwijk, C., Dullemans, A. M., van Workum, M. E. S. and Visser, B. 1985. Molecular cloning and the nucleotide sequence of the Mr 28, 000 crystal protein gene of Bacillus thuringiensds subps. israelensis. Nuc. Acids. R¿s. 13,8207-82L7. Wabiko, H., Raymond, K., Bulla, L. A. (Jr.). 1986. Bacillus thuringiensis entomocidal protoxin gene sequence and gene product analysis. DNA. 5, 305-314. r43 References Walters, F. S. and English, L. H. 1995. Toxicity of. Bacillus thuringiensis ð-endotoxin towards the potato aphid in an artificial diet bioassay. Ent. Exp. AppI. 77,211-216. Ward, E. S., Ellar, D. J. and Todd, J. A. 1984. Cloning and expression in Escherichia coli of the insecticidal delta endotoxin of Bacillus thuringiensis var israelensis. FEBS Lett. 175,377-382. 'Ward, E. S., Ridley, A. R., Ellar, D. J. and Todd, J. A. 1986. Bacillus thuringiensis var israelensis delta-endotoxin: cloning and expression of the toxin in sporogenic and asporogenic strains of Bqcillus subtilis. J. MoI. Biol. l9I, L3-22. Ward, E. S., Ellar, D. J. and Chilcott, C. N. 1988. Single amino acid changes in the Bacillus thuringiensis var. israelensis ð-endotoxin affect the toxicity and expression of theprotein. J. MoI. BioI. 202,521-535. 'Weiser, J., Tonka, T., Weiser, J. (Jr.) and Horák, P. 1992. A water soluble molluscicidal metabolite of Bacillus thuringiensis. Abstract 173. Trans. 25th Ann. Meeting Soc Invertr. Pathol., Heidelberg, Germany, 1992. Whiteley, H. R. and Schnepf, H. E. 1986. The molecular biology of parasporal crystal body formation in Bacillus thuringiensis. Ann. Rev. Microbiol 40, 549-576. Widner, W. R. and Whiteley, H. R. 1989. Two highly related insecticidal crystal proteins of Bacillus thuringiensis subsp. kurstaki possess different host range specificities. ./. Bacteriol. 17 l, 965-97 4. Willis,A. T. 1960. Thelipolyticactivityof someClostridia. J. Path. Bact.801379 V/illis, A. T. and Gowland,G. 1962. Some observations on the mechanism of the Nagler reaction. J. Path. Bact. 83,219. Wolfersberger, M. G. 1990. Specificity and mode of action of Bacillus thuringiensis insecticidal crystal proteins toxic to lepidopteran larvae: recent insights from studies utilising midgut brush border membrane vesicles. Vth. Int. CoI. Invert. Pathol. Adelaide, 1990. pp 278-282. 'Wong, H. C., Schnepf, H. E. and Whiteley, H. R. 1983. Transcriptional and translational start sites for the Bacillus thuringiensis crystal protein gene. "/. BioI. Chem. 258, t960-t967. t4 References 'Wu, D. and Aronson, A. I. 1990. Use of mutagenic oligonucleotides for defining regions of a Bacillus thuringiensis ð-endotoxin involved in toxicity. Vth. Int. CoI. Invert. Pathol Adelaide, 1990. pp273-271. Wu, D., Cao, X. L., Bai, Y. Y. and Aronson, A' J. 1991. Sequence of an operon containing a novel ð-endotoxin gene from Bacillus thuringiensis. FEMS Mirobiol Letts. 81, 31-36. Yamamoto, T. 1983. Identification of entomocidal toxins of Bacillus thuringiensis by high performance liquid chromatography. J. Gen. Microbiol. 129,2595-2603. Yamamoto, T. and Iizuka, T. 1983. Two types of entomocidal toxins in the parasporal crystals of.Bacillusthuringiensiskurstaki. Arch. Biochem. Biophys. 227,233-24I Yamamoto, T. and Mclaughlin, R. E. 1981. Isolation of a protein from the parasporal crystals of Bacillus thuringiensis var kurstaki toxic to the mosquito larva, Aedes taeniorþnchus. Biochem. Biophys. Res. Comm. 103, 414-421' Yool, A. J. and Schwarz, T. L. 1991. Alteration of ionic selectivity of a K+ channel by mutation of the H5 region. Nature. 349,70O-7O4. Young, I. E. and Fitz-James, P. C. 1959. Chemical and morphological studies of bacterial spore formation. tr. Spore and parasporal protein formation in Bacillus cereus var. alesti. J. Biophys. Biochem. Cytol. 6,483-498. Zhang, M-Y. 1994. Molecular studies of virulence factors of the insect pathogen, Bacillus thuringiensis. PhD Dissertation, 1994. Dept. Microbiol., Stockholm University, Stockholm, Sweden. Zhtt,Y. S., Brookes, 4., Carlson, K. and Filner, P. 1989. Separation of protein crystals from spores of Bacillus thuringierzsis by ludox gradient centrifugation. AppI. Env. Microbiol. 55, 1279-1281. t45