Group 1 CD1 Genes in Rabbit Sandra M

Group 1 CD1 Genes in Rabbit Sandra M. Hayes and Katherine L. Knight J Immunol 2001; 166:403-410; ; This information is current as doi: 10.4049/jimmunol.166.1.403 of September 23, 2021. http://www.jimmunol.org/content/166/1/403 Downloaded from References This article cites 45 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/166/1/403.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 23, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Group 1 CD1 Genes in Rabbit1

Sandra M. Hayes2 and Katherine L. Knight3

CD1 is an Ag-presenting molecule that can present lipids and glycolipids to T cells. The CD1 genes were first identified in the human, and since then, homologs have been identified in every mammalian species examined to date. Over a decade ago, CD1B and CD1D homologs were identified in the rabbit. We have extended this earlier study by identifying additional CD1 genes with the goal of developing the rabbit as an animal model to study the function of CD1 proteins. We constructed a thymocyte cDNA library and screened the library with CD1-specific probes. Based on nucleotide sequence analyses of the CD1؉ cDNA clones obtained from the library, we have identified two CD1A genes and one CD1E gene as well as determined the complete sequence of the previously identified CD1B gene. The CD1E؉ cDNA clones lacked the transmembrane and cytoplasmic domains and, if translated, would encode for a soluble or secreted CD1E protein. In addition, expression studies demonstrated that the CD1 genes were expressed in peripheral lymphoid tissues as well as in skin, gut, and lung. Of interest is the finding that CD1A2, CD1B, and

CD1E genes were found to be expressed by rabbit B cell populations. The rabbit, with a complex CD1 locus composed of at least Downloaded from two CD1A genes, one CD1B gene, one CD1D gene, and one CD1E gene, is an excellent candidate as an animal model to study CD1 proteins. The Journal of Immunology, 2001, 166: 403–410.

he immune system has evolved to cope with a diverse CD1d. The deduced amino acid sequence of the CD1E gene places array of Ags. The presentation of peptide Ags by class I it in an intermediate position between the two groups (8). ϩ ϩ T and class II MHC molecules to CD8 and CD4 T cells, Even though group 1 and group 2 CD1 proteins differ in their http://www.jimmunol.org/ respectively, has been the paradigm for an Ag presentation system amino acid sequences, these two groups share a similar tissue dis- (1–3). However, not all Ags are peptides. Glycolipids and lipids tribution and cellular expression. Human CD1 proteins are primar- can also serve as Ags. CD1 is an Ag-presenting molecule that ily expressed by cortical thymocytes, certain thymic leukemias, presents such nonpeptide Ags. and APC (reviewed in Ref. 4). However, differential expression of The CD1 family represents a third lineage of Ag-presenting the CD1 proteins is observed on some cell populations. For in- molecules that is distinct from the class I and class II MHC fam- stance, CD1c and CD1d are the only CD1 proteins found on B ilies (4). Unlike MHC molecules that display allelic polymor- cells (13, 14), CD1a is the predominant CD1 protein found on the phism, CD1 molecules display little or no polymorphism between Langerhans’ cells in the skin (15), and CD1d is the only CD1 individuals of an outbred population (5). This conservation in CD1 protein found on intestinal epithelium (16). by guest on September 23, 2021 structure suggests that CD1 has evolved to present Ags of limited Structural similarities with the class I and class II molecules structural variability (4). along with expression on professional APC led Porcelli et al. (17) The human CD1 locus is composed of five genes, designated to propose that CD1 is an Ag-presenting molecule for human T CD1A, CD1B, CD1C, CD1D, and CD1E (6–8). The CD1 locus, cells. The first reported CD1-restricted ␣␤ and ␥␦ T cell clones which encompasses 190 kb, is located on chromosome 1, whereas recognized group 1 CD1 Ags on the MOLT-4 thymic leukemia the classical MHC locus is located on chromosome 6 (9–11). Pro- cell line and on transfected cell lines (17). Human T cell clones teins for all the human CD1 genes, except the CD1E gene, have that recognize CD1d on CD1d-transfected cell lines have also been been identified (7, 8, 12). Like the MHC proteins, CD1 proteins identified (18). Subsequent studies demonstrated that group 1 CD1 have three extracellular domains, with the first and second domains molecules could present mycobacterial Ags to ␣␤ T cells (19). The ␤ binding Ag and the third domain binding to 2-microglobulin (6, chemical nature of these mycobacterial Ags differed from that of 8, 12). The CD1 proteins can be divided into two groups on the the mycobacterial peptide Ags in that they were resistant to pro- basis of shared sequence homology (8). The group 1 CD1 proteins teases. Fractionation of the mycobacterial extract and subsequent are CD1a, CD1b, and CD1c, whereas the group 2 CD1 protein is purification of the fractions showed that mycolic acid and li- poarabinomannan were two mycobacterial Ags presented by CD1b and CD1c to T cells (20–22). To date, no presentation of mycobacterial lipid or glycolipid Ags by human CD1d has been shown. Department of Microbiology and Immunology, Loyola University Chicago, May- However, human CD1d has been shown to present a synthetic wood, IL 60153 glycolipid, ␣-galactosylceramide, to T cells (23, 24). Received for publication July 7, 2000. Accepted for publication October 4, 2000. Because in vivo studies cannot be performed in humans, animal The costs of publication of this article were defrayed in part by the payment of page models are needed to study the function of CD1-restricted T cells. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Mice are the only established animal model used to study the func- 1 This work was supported by American Cancer Society, Illinois Division, Research tion of CD1-restricted T cells. Because mice lack group 1 CD1 Grant 99-33 (to S.M.H.), and National Institutes of Health Grant AI11234 (to K.L.K.). genes (25), mice can only be used to study T cells restricted to the 2 Current address: Laboratory of Mammalian Genes and Development, National In- group 2 protein and not to the group 1 proteins. Therefore, another stitute of Child Health and Human Development, National Institutes of Health, Be- animal is needed as a model to study group 1 CD1-restricted T thesda, MD 20892. cells. CD1 genes or proteins have been found in sheep, guinea pig, 3 Address correspondence and reprint requests to Dr. Katherine L. Knight, Depart- ment of Microbiology and Immunology, Loyola University Chicago, 2160 South First pig, cattle, and rabbit (26–32). However, there are differences be- Avenue, Maywood, IL 60153. E-mail address: [email protected] tween humans and these animal species in the size and complexity

Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00 404 RABBIT CD1 GENES of their CD1 loci. Sheep, with approximately seven CD1 genes, ␮g/ml salmon sperm DNA. The nucleotide sequences of DNA from col- ϩ have had three CD1B homologs and one CD1D homolog cloned ony-purified CD1 clones were determined using primers specific for the and sequenced (26, 27). In addition, a CD1E homolog has been flanking T7 and SP6 polymerase sites in the pSPORT vector. All sequencing was performed on the automated sequencer, ABI PRISM 310 Genetic identified by NH2-terminal sequencing of a protein immunopre- Analyzer (Applied Biosystems, Foster City, CA). cipitated with a putative anti-CD1 mAb (27). The guinea pig, even An amplified rabbit partial MboI-digested genomic library in the phage with ϳ10 CD1 genes, does not display as much complexity as the EMBL4, previously constructed in our laboratory, was used in this study. 6 human, in that the majority of cloned and sequenced CD1 genes The library (1 ϫ 10 PFU) was plated with Escherichia coli (KH803) cells and was screened as described for the thymocyte cDNA library. Plaque- are CD1B and CD1C homologs (28). The rabbit, with approxi- purified CD1ϩ phage clones were restriction mapped, fragments containing mately eight CD1 genes, as estimated by Southern blot analysis, the CD1 gene or portions thereof were subcloned into pUC19, and the has had one CD1B and one CD1D homolog cloned and partially nucleotide sequence was determined. sequenced (32). Therefore, the rabbit is similar to the human in ϩ Generation of rabbit CD1 transfectants that it has both group 1 and group 2 CD1 genes and, by having multiple CD1 genes, has a potentially complex CD1 locus. The cDNA for rabbit CD1B was subcloned into the expression vector Because of these data, we chose to develop the rabbit as an pSFFV-gpt, while those of rabbit CD1A1 and CD1A2 were subcloned into the expression vector pIRES-neo (Clontech, Palo Alto, CA). Mouse my- animal model to study the role of group 1 CD1 molecules in pro- eloma SP2/0 cells were transfected by electroporation and selected with 1 tective immunity. To accomplish this, we first cloned and se- ␮g/ml mycophenolic acid (Sigma, St. Louis, MO; pSFFV-CD1B) or with quenced rabbit group 1 CD1 genes by constructing and screening 1 mg/ml G418 (Calbiochem, San Diego, CA; pIRES-CD1A1 and -CD1A2). a thymocyte cDNA library. Here we report the identification of Cells that survived selection were then screened with the panel of anti-CD1 mAbs to detect surface expression of rabbit CD1 proteins. two CD1A genes, one CD1B gene, and one CD1E gene. The iden- Downloaded from tification of these three homologs combined with the previous mAbs and flow cytometric analysis identification of a CD1D homolog make the rabbit the only animal The mAbs used in this study were anti-human CD1b (clone SN13/K5-1B8; species in which four homologs of the five human CD1 genes have Ancell, Bayport, MN), anti-human CD1c (clone M241, Ancell; clone been identified. L161, Serotec, Raleigh, NC; clones F10/2A3.1 and F10/21A3, provided by Dr. Steven Porcelli, Albert Einstein School of Medicine, New York, NY), anti-human CD1a (clone NA1/34-HLK, Serotec; clone OKT6, provided by Materials and Methods Dr. Steven Porcelli), anti-rabbit thymocyte (clones LAT-1, LAT-2, and http://www.jimmunol.org/ CD1 probes LAT-3, provided by Dr. Stewart Sell, Albany Medical College, Albany, Human CD1A and CD1C probes were amplified by RT-PCR from human NY), anti-rabbit IgM (clone 367), and anti-rabbit MHC class II (clone neonatal thymocyte RNA using the primer sets whose sequences are listed 2C4). Polyclonal goat anti-mouse IgG Abs were affinity purified on a in Table I. The products were gel purified and radiolabeled with [32P]dCTP mouse IgG column, adsorbed against a rabbit IgG column, and FITC- using a random hexamer primer system (33). A full-length rabbit CD1B conjugated for flow cytometric analysis or biotinylated for immunohisto- probe was PCR-amplified from rabbit thymocyte cDNA using degenerate chemical analysis. One- and two-color flow cytometric analyses were per- PCR primers (see Table I). The resulting PCR product was cloned into formed as previously described (34). The cells were analyzed on a pGEMT Easy (Promega, Madison, WI), and its nucleotide sequence was FACSCalibur (Becton Dickinson, Mountain View, CA) using CellQuest determined to confirm that it was rabbit CD1B. An EcoRI digest of the software (Becton Dickinson). by guest on September 23, 2021 clone containing the full-length rabbit CD1B gene resulted in a 308-bp Immunohistochemical analysis product containing the exons encoding the leader and ␣1 domains (radiolabeled and used to screen library) and a 694-bp product containing the Popliteal lymph nodes from adult rabbits were embedded in OCT com- exons encoding the ␣2, ␣3, transmembrane, and cytoplasmic domains (ra- pound (Tissue-Tek, Torrance, CA), snap-frozen in liquid nitrogen, and diolabeled and used as a pan CD1 probe for Southern blot analysis of rabbit stored at Ϫ80°C. Frozen lymph node samples were sectioned (5–7 ␮m) and CD1 PCR products). fixed in acetone for 3 min. The fixed sections were stained with the anti- rabbit CD1b mAb (LAT-3) and developed with biotinylated polyclonal Construction and screening of DNA libraries goat anti-mouse IgG Abs, and avidin-biotin complexes were conjugated with alkaline phosphatase (Vector, Burlingame, CA) and visualized with For the thymocyte cDNA library, poly(A) mRNA was purified from freshly the alkaline phosphatase substrate, Vector Red (Vector). The sections were isolated rabbit thymocytes using the QuickPrep Micro mRNA Purification then counterstained with hematoxylin to visualize individual nuclei. Kit (Amersham Pharmacia Biotech, Piscataway, NJ). Synthesis of double- stranded cDNA and directional cloning of the double-stranded cDNA prod- RT-PCR and Southern blot analyses ucts were performed using the Superscript Plasmid System for cDNA synthesis and plasmid cloning (Life Technologies, Gaithersburg, MD). The RNA was isolated from several adult rabbit lymphoid and nonlymphoid resulting cDNA library was transformed into electrocompetent DH10B tissues, adherent and nonadherent splenocytes, and FACS-sorted IgMϩ cells and plated at a density of 7000–8000 colonies/150 ϫ 15-mm plate for lymph node cells using TRIzol (Life Technologies), according to the man- a total of ϳ80,000 colonies. The library was transferred to nitrocellulose ufacturer’s directions, and amplified by RT-PCR with the rabbit CD1 gene- membrane filters and screened with each of the three probes. The library specific primer sets listed in Table I. The PCR conditions were as follows: filters were hybridized overnight with radiolabeled probe at 60°C in 6ϫ 94°C for 30 s, 57°C for 30 s, and 72°C for 60 s for 28 cycles (for tissues) SSC, 0.5% SDS, 5ϫ Denhardt’s reagent, 10% dextran sulfate, and 100 or 35 cycles (for cell populations). PCR products were separated by PAGE

Table I. PCR primer sets for the ampliﬁcation of human- and rabbit-speciﬁc genes

Ј3 Ј Ј3 Ј a Gene Sense Primer (5 3 ) Antisense Primer (5 3 ) tann Human CD1Ab AAACAAAATCTGGTCTCAGGTT CCTGTCACCTGTATCTCAAAAGGA 60 Human CD1Cb TGGGCACGAGGTCAGGGCTCAG TTCACCTGTACTTCAAAGGGATAT 60 Rabbit CCD1Bb ATGCTGC/TTTCTGCCA/GTTTC TCAT/CA/GGATA/GAT/CCTGATATGA 54 Rabbit CD1A1 ATGCTGTTCTGTTTCTTCCA CCAGTGGAGGATAATGTCTTG 57 Rabbit CD1A2 ATGCTGTTTCTGCATCTTGCATTT TCACTTCAAAGGGAGAAGAGAGTT 57 Rabbit CD1E ATGCTCCTCCTGCTCCACAAGGGACTT CCAGGGAACGACGATGTCATGT 57 Rabbit GAPDH ATCAAGTGGGGTGATGCTGGT CCTGCTTCACCACCTTCTTGA 64

a Annealing temperature used for primer set in PCR. b Primer set sequences are based on previously reported nucleotide sequences: human CD1A (GenBank, M28825), human CD1C (GenBank, M28827), human CD1B (GenBank, M28826), and rabbit CD1B (GenBank, M26248). The Journal of Immunology 405 and transferred to nitrocellulose membranes (0.2-␮m pore size; Schleicher of the CD1 molecule (8), to screen the thymocyte cDNA library. & Schuell, Keene, NH). The blots were hybridized overnight at 56°C in 6ϫ Using this probe, we identified two rabbit CD1A genes, which we ϫ ␮ SSC, 0.5% SDS, 5 Denhardt’s reagent, and 100 g/ml salmon sperm termed CD1A1 and CD1A2. Comparison of the nucleotide se- DNA with a rabbit CD1B probe containing exon 4 (␣3 domain). The blots were then washed twice at 56°C in 2ϫ SSC and 0.1% SDS and once at quences of these two CD1A genes with those of all human CD1 56°C in 1ϫ SSC and 0.1% SDS. After the final wash, blots were air-dried genes showed that these were indeed rabbit CD1A homologs and exposed to film. A GAPDH PCR (for primer sequences see Table I; (GenBank accession no. AF276977 and AF276978). In Fig. 1A the 94°C for 30 s, 64°C for 30 s, and 72°C for 60 s for 25 cycles) was also performed to demonstrate that equivalent amounts of RNA were used for deduced amino acid sequences of rabbit CD1a1, rabbit CD1a2, and all tissues and cell populations. human CD1a are shown. There is 67% amino acid identity between CD1a1 and human CD1a, 70% amino acid identity between Results CD1a2 and human CD1a, and 71% amino acid identity between Cloning and sequencing of rabbit group 1 CD1 genes from a the two rabbit homologs. The major difference between the rabbit thymocyte cDNA library and human CD1a homologs is in the cytoplasmic domain (Fig. Mammalian homologs of all human group 1 CD1 genes have been 1A). The cytoplasmic domain of human CD1a is composed of reported (26–29, 32). Comparison of the nucleotide sequences of three amino acids, whereas the cytoplasmic domains of rabbit these mammalian CD1 genes with those of human CD1 genes CD1a1 and rabbit CD1a2 are much longer, each with 14 amino shows that there is more homology for a given CD1 isoform acids. Recently, a CD1A homolog was identified in the pig, and among all species than among all CD1 genes for a given species analysis of the predicted amino acid sequence of this gene also displayed a cytoplasmic tail composed of 14 amino acids (29).

(reviewed in Ref. 4). Because of this conservation in the sequence Downloaded from of each CD1 isoform, we developed a cloning strategy to identify Within the cytoplasmic domain of pig CD1a is a serine-containing CD1A, CD1B, and CD1C homologs in the rabbit by constructing motif similar to one found in the cytoplasmic tail of MHC class I a thymocyte cDNA library and screening it with probes specific for molecules (SD/EXSL; where X is any amino acid) (35, 36). A similar each group 1 CD1 isoform. serine-containing motif is found in rabbit CD1a2, but not in CD1a1. To identify rabbit CD1A homolog(s), we used a human CD1A This motif, SPNSL, is shown boxed in Fig. 1A. Therefore, rabbit probe specific for the ␣1 domain, the most isoform-specific region CD1a1 and CD1a2 share structural similarities with pig CD1a. http://www.jimmunol.org/ by guest on September 23, 2021

FIGURE 1. Comparison of deduced amino acid sequences of rabbit and human CD1 genes. Dots depict amino acid identity, and spaces have been introduced to maximize homology. Arrows mark the boundaries of the structural domains. A, CD1a. The boxed area represents a serine-containing motif that is similar to one (SD/EXSL, where X is any amino acid) found in the cytoplasmic tails of MHC class I molecules. B, CD1b. The boxed areas represent a tyrosine-containing motif (YXXZ, where X is any amino acid and Z is a hydrophobic amino acid) found in human CD1b, CD1c, and CD1d molecules that is required for trafﬁcking to the endosome. C, CD1e. The GenBank accession numbers for the rabbit CD1 genes are CD1A1 (AF276977), CD1A2 (AF276978), CD1B (AF276979), and CD1E (AF276980). 406 RABBIT CD1 GENES

do not know whether this is a splice variant of a full-length CD1E gene or whether this is a CD1E gene encoding for a soluble product. In summary, our cloning strategy led to the identification of three new rabbit CD1 genes, CD1A1, CD1A2, and CD1E, as well as the complete sequence of the previously identified CD1B gene. Identification of rabbit CD1 genes from a genomic phage library In addition to screening a thymocyte cDNA library, we screened a genomic phage library to obtain CD1 genes that may be expressed at low levels in the thymus, such as a putative CD1C gene. We screened the genomic phage library with a mixture of the CD1A-, CD1B-, and CD1C-specific probes. Using this approach, we isolated four CD1ϩ phage clones. Restriction map analysis of these phage clones revealed that they were nonoverlapping and contained distinct genes (Fig. 2). Southern hybridization of the restric- FIGURE 2. Partial restriction maps of four CD1ϩ phage clones ob- tion digests with the group 1 CD1-specific probes (5Ј region) and tained from a rabbit genomic phage library. A, Phage 20B, containing the the pan rabbit CD1 probe (3Ј region) allowed us to locate and Downloaded from CD1A1 gene. B, Phage 18, containing the CD1B1 gene. Detailed restric- orient the CD1-coding regions on the restriction map (Fig. 2). The tion mapping of the 3.7-kb BamHI/XbaI fragment is shown in the inset. C, smallest restriction fragments that hybridized to the probes were Phage 19, containing the CD1B2 gene. Detailed restriction mapping of the then subcloned and sequenced to determine their identities. Nu- 3.7-kb BamHI/XbaI fragment is shown in the inset. D, Phage 12, contain- cleotide sequence analysis of the 1.5-kb HindIII fragment of phage ing the CD1E gene. Mapping of the EcoRI sites in phage 12 is incomplete. 20B (Fig. 2A) demonstrated that it was identical with the rabbit Solid boxes represent the CD1 genes, and arrows represent orientation of

CD1A1 gene identified from the thymocyte cDNA library (data http://www.jimmunol.org/ the genes, shown here 5Ј to 3Ј. Enzyme abbreviations are: R, EcoRI; B, BamHI; H, HindIII; S, SalI; SI, SacI; SII, SacII; X, XbaI; K, KpnI. not shown). Phages 18 and 19 (Fig. 2, B and C), even though their restriction maps differ, both contain CD1B genes with identical nucleotide sequences for the regions sequenced (5Ј untranslated Even though a CD1B homolog has been identified in the rabbit, region, exon 1, intron 1, exon 2, exon 6, and 3Ј untranslated region; only the leader and ␣1 domains were sequenced (32). Therefore, data not shown). Furthermore, the nucleotide sequences of these we screened the cDNA library with a rabbit CD1B ␣1 domain CD1B genes are identical with the sequence of the CD1B gene probe to obtain the full-length cDNA of this rabbit CD1B gene and isolated from the thymocyte cDNA library. The existence of these to identify any new rabbit CD1B genes. Because multiple CD1B two clones may represent a gene duplication event that took place homologs have been identified in both guinea pig (28) and sheep within the rabbit CD1 locus, an allelic polymorphism of the rabbit by guest on September 23, 2021 (26), we expected to identify more than one CD1B homolog in the CD1B gene, or a library cloning artifact. They have been desig- rabbit. When we screened the thymocyte cDNA library with the nated CD1B1 (phage 18) and CD1B2 (phage 19) in Fig. 2. Be- rabbit CD1B probe, we identified seven CD1Bϩ cDNA clones. cause we cannot identify which CD1B gene gave rise to the CD1B Sequence analysis of these clones demonstrated that they were all cDNA identified in the thymocyte cDNA library, we will refer to derived from the same CD1B gene. Four cDNA clones contained the cDNA species simply as CD1B. We determined by partial intron 1, two clones were mis-spliced to nucleotides Ͼ30 bp down- nucleotide sequence analysis of the 4.3- and 2.0-kb HindIII frag- stream from the beginning of exon 2, and one clone was the pu- ments that the fourth clone, phage 12 (Fig. 2D), contained the tative full-length cDNA (Fig. 1B and data not shown). Comparison CD1E gene (data not shown). However, in the total 2 kb of DNA of the deduced amino acid sequences of the full-length rabbit and sequenced we were unable to locate exons 1 and 5 and, conse- human CD1B genes showed 76% amino acid identity between the quently, do not know whether the CD1E gene encodes for a sol- two CD1B genes (Fig. 1B). A structural component of the human uble or transmembrane protein. Therefore, screening of the CD1b molecule that plays a role in intracellular trafficking is a genomic library resulted in the identification of one CD1A gene tyrosine motif found in the cytoplasmic tail (37). This motif, (CD1A1), two CD1B genes (CD1B1 and CD1B2), and one YXXZ (where X is any amino acid and Z is a hydrophobic amino CD1E gene. acid), targets the CD1b molecule to the endosome, thereby allow- ing CD1b to sample exogenous lipids and glycolipid Ags (38). Tissue distribution and cellular expression of rabbit CD1 This motif is also conserved in rabbit CD1b and is shown boxed in homologs Fig. 1B. Therefore, the rabbit CD1b homolog that we have iden- Because of the relatively high degree of amino acid sequence identified is structurally similar to human CD1b. tity between rabbit and human CD1 homologs (65–75%), we To identify a CD1C homolog in the rabbit, we screened the tested whether any anti-human CD1 mAbs cross-reacted with rab- thymocyte cDNA library with a human CD1C probe specific for bit CD1 proteins to identify reagents that can be used to examine the ␣1 domain. However, we identified not a rabbit CD1C ho- CD1 protein expression in rabbit tissues and cell populations. In molog but, instead, a rabbit CD1E homolog. Comparison of the addition, we tested a panel of anti-rabbit thymocyte mAbs to de- deduced amino acid sequences for rabbit and human CD1e is termine whether any of them recognized rabbit CD1 molecules. By shown in Fig. 1C. There is 65% amino acid identity between rabbit screening these mAbs on rabbit thymocytes and CD1-transfected and human CD1e. It is important to note that none of the three cell lines, we determined both cross-reactivity and specificity. isolated cDNA clones encoded for the transmembrane and cyto- From the panel of anti-human CD1 mAbs tested (listed in Ma- plasmic domains. Sequence analysis showed that the coding re- terials and Methods), only the anti-human CD1b mAb, K5-1B8, gions of these cDNA clones were terminated shortly after the end stained rabbit thymocytes and CD1B-transfected SP2/0 cells (Fig. of exon 4, the exon that encodes for the ␣3 domain (Fig. 1C). We 3, A and C). An anti-rabbit thymocyte mAb, LAT-3, also reacted The Journal of Immunology 407

In addition to the IgMϩ B cells in the popliteal lymph node that expressed CD1b, we detected an IgMϪ population that expressed high levels of CD1b (Fig. 3E). These IgMϪ CD1bhigh cells were large, based on forward and side light scatter, and expressed high levels of MHC class II (data not shown). To aid in the identification of these IgMϪ CD1bhigh class IIhigh cells, we performed im- munohistochemistry on lymph node sections (Fig. 4). We observed staining with the anti-rabbit CD1b mAb on clusters of cells in the B cell follicles (Fig. 4A) as well as bright staining on large cells in the paracortex or T cell area (Fig. 4B). Because of their large size, location in the T cell area, and MHC class II expression, we be- lieve these cells to be interdigitating dendritic cells. To examine the tissue distribution and cellular expression of the other rabbit CD1 genes, we employed RT-PCR and Southern blot analyses. We isolated RNA from various lymphoid and nonlymphoid tissues and from purified cell populations and performed RT-PCR using rabbit CD1 gene-specific primers (Table I). The resulting PCR products were separated by PAGE, transferred to Downloaded from FIGURE 3. Flow cytometric analysis of rabbit lymphocytes and rabbit nitrocellulose membranes, and probed by Southern hybridization CD1B-transfected SP2/0 cells stained with anti-CD1 mAbs. Detection of with a pan CD1 probe. Transcripts of all rabbit CD1 homologs CD1 expression on rabbit thymocytes with an anti-human CD1b mAb were detected at high levels in all lymphoid tissues, especially the (SN13/K5-1B8; A) and an anti-rabbit CD1 mAb (LAT-3; B). Detection of thymus (Fig. 5A). In addition, CD1A1 transcripts were detected in CD1b expression on CD1B-transfected SP2/0 cells with both the anti- skin and gut, whereas CD1A2 and CD1E transcripts were detected human CD1b mAb (C) and the anti-rabbit CD1 mAb (D). The bold line in skin, lung, and gut. Of all the genes, only CD1A2 was found in

represents staining with the anti-CD1 mAb, and the thin line represents http://www.jimmunol.org/ significant amounts in all tissues examined, including liver and staining with an isotype control mAb. Expression of rabbit CD1b on sub- populations of peripheral B cells (E) from 2-year-old New Zealand White kidney (Fig. 5A). Two different m.w. transcripts were observed for rabbits was determined. PBMC, splenocytes, and popliteal lymph node both CD1A genes. The higher m.w. transcript, when sequenced, cells were stained with the anti-human CD1b mAb and an anti-rabbit IgM represented the full-length cDNA, whereas the lower m.w. tran- mAb and were analyzed by flow cytometric analysis. script represented splice variants in which the upstream region of exon 2 is missing (data not shown). To determine which cell populations in the lymphoid tissues with a similar staining profile (Fig. 3, B and D). Neither mAb expressed the rabbit CD1A and CD1E genes, we performed RT- reacted with nontransfected SP2/0 cells or with rabbit CD1A- PCR and Southern blot analyses on purified cell populations. First, by guest on September 23, 2021 transfected cells (data not shown). Therefore, both K5-1B8 and we fractionated splenocytes into adherent and nonadherent cell LAT-3 recognize the protein encoded by the rabbit CD1B gene populations to examine whether the CD1 genes were expressed by and can be used to examine the tissue distribution and cellular myelomonocyte lineage cells (predominantly found in adherent expression of rabbit CD1b. fraction) and by lymphocytes (predominantly found in nonadher- ϩ Two-color immunofluorescence staining of rabbit PBMC, ent fraction). In addition, we FACS-sorted IgM cells, to deter- splenocytes, and popliteal lymph node cells with anti-human CD1b mine whether any of the homologs were expressed by B cells. At mAb and anti-rabbit IgM mAb demonstrated that CD1b is ex- this time, we are unable to examine the levels of CD1 transcripts pressed by tissue IgMϩ cells, but not by peripheral blood IgMϩ in T cells, because the anti-T cell mAbs that are available also stain (Fig. 3E). Two subsets of B cells expressed CD1b: an IgMhigh small numbers of other cell types. The results of this experiment population and an IgMlow population. These two populations are are shown in Fig. 5B. All three CD1 homologs are transcribed in best observed in the spleen, where ϳ30% of all splenic B cells adherent and nonadherent splenocytes, albeit at different levels. express CD1b (Fig. 3E). We also detected CD1bϩ IgMϩ cells in This is not the case for expression in B cells, where CD1E is the other lymphoid tissues, such as Peyer’s patch and mesenteric predominant transcript detected (Fig. 5B). For the two CD1A lymph node (data not shown). Therefore, B cells located in lym- genes, we detected the higher m.w. transcript of CD1A2, but nei- phoid tissues express CD1b, whereas those circulating in the blood ther species of CD1A1, in IgMϩ B cells. Taken together, these do not. This difference in CD1b expression between B cells in findings suggest that, like CD1B, CD1A2 and CD1E genes are peripheral blood and those in lymphoid tissues may reflect differ- expressed by B cell populations in peripheral lymphoid tissues. ences in the activation or differentiation state of these B cells. However, not until specific mAbs are available will we know

FIGURE 4. Localization of CD1ϩ cells in the popliteal lymph node by immunohistochemical analysis. Frozen sections of popliteal lymph node were stained with the anti-rabbit CD1b mAb (LAT-3), developed with biotinylated goat anti-mouse Abs and avidin-biotin complexes conjugated with alkaline phosphatase, and then visualized with Vector Red alkaline phosphatase substrate. Magniﬁcation: A, ϫ64; B, ϫ200. 408 RABBIT CD1 GENES Downloaded from

FIGURE 6. Phylogenetic analysis of the deduced amino acid sequences of FIGURE 5. Digital image of RT-PCR and Southern blot analyses of known CD1 proteins using the multiple alignment software, CLUSTALX. The CD1A1, CD1A2, and CD1E mRNA expression in various tissues and cell rabbit CD1 proteins are in bold type, and the group 1 and group 2 classi- populations. Total RNA was isolated from various lymphoid and nonlym-

fications are noted. The cottontail rabbit CD1d (marked as rabbit CD1d) http://www.jimmunol.org/ phoid tissues (A), adherent and nonadherent splenocytes, and FACS-sorted and the nonrabbit CD1 protein sequences were obtained from GenBank, ϩ IgM cells (B) and amplified with gene-specific primers. Products were and their respective accession numbers are as follows: cottontail rabbit separated by PAGE, blotted onto nitrocellulose membranes, and hybridized CD1d, M26249; human CD1a, P06126; human CD1b, P29061; human with a rabbit CD1 probe containing the ␣3 domain of rabbit CD1b, which CD1c, P29017; human CD1d, P15813; human CD1e, P15812; mouse hybridizes to all rabbit CD1 homologs. A GAPDH PCR was also per- CD1d1.1, I49582; sheep CD1b25, CAA85359; sheep CD1b42, S47246; formed to demonstrate that equivalent amounts of RNA were used for all sheep CD1d, AJ006722; guinea pig CD1b2, AF145484; guinea pig CD1b3, tissues and cell populations. AF145485; guinea pig CD1e, AF145490; and pig CD1a, AF059492.

Rabbit and pig are the only two mammals in which homologs of by guest on September 23, 2021 whether rabbit CD1A and CD1E transcripts are translated into human CD1A have been identified (Ref. 29 and this study). Rabbit their respective proteins. CD1a and pig CD1a have longer cytoplasmic tails (14 aa) than human CD1a (3 aa; Fig. 1A) (29). Within this longer cytoplasmic Phylogenetic analysis of mammalian CD1 genes tail, there is a motif that is very similar to a serine-containing In this study we identified four CD1 genes: two CD1A genes, one motif, SD/EXSL (where X is any amino acid), that is found in the CD1B gene, and one CD1E gene. This means that, to date, CD1A, cytoplasmic tail of MHC class I molecules (35, 36). Vega and CD1B, CD1D, and CD1E homologs have been identified in the Strominger (36) have shown that this motif is required for endo- rabbit. To find out how the rabbit homologs compare with human cytosis and is similar to one found in other molecules that undergo CD1 proteins and most of the known mammalian CD1 homologs, endocytosis. In pig CD1a, the motif is CDPSS (29), where the first we used the multiple alignment analysis program, CLUSTALX, to serine residue is replaced by cysteine, and the leucine residue is generate a phylogenetic tree (Fig. 6). The dendogram shows that replaced by serine. We also found a similar motif in rabbit CD1a2, indeed there is more homology for each CD1 homolog among but not in CD1a1. This motif, SPNSL, shows a substitution of the different species than among all CD1 homologs for each species. D/E residue with proline (Fig. 1A). Therefore, rabbit CD1a2 and This conservation in protein structure for each CD1 homolog may pig CD1a have extracellular domains similar to human CD1a mol- reflect conservation in both the type of lipids it presents to T cells ecules and intracellular domains similar to MHC class I molecules. and the mechanism by which it traffics through the cell to sample The significance of this motif is presently unknown, but one can lipid Ags. speculate that it plays a role in recycling of the mammalian CD1a molecule, in marking the molecule for degradation, and/or in tar- Discussion geting the molecule to endosomes for sampling of lipid and In this study our goal was to identify group 1 CD1 genes in rabbit glycolipid Ags. to develop this animal as a model to study the function of group 1 Even though multiple CD1B homologs have been identified in CD1 proteins. We chose the rabbit as a candidate for an animal sheep (26) and guinea pig (28), we were only able to identify one model because previous studies have demonstrated that the rabbit rabbit CD1B homolog from the thymocyte cDNA library. Inter- has a complex CD1 locus, with approximately eight CD1 genes estingly, when we screened a genomic phage library, we isolated and has both group 1 (CD1B) and group 2 (CD1D) homologs (32). two phage clones containing CD1B genes. Restriction map anal- To identify additional group 1 CD1 genes, we screened a rabbit ysis of these two phage clones demonstrated that they were indeed thymocyte cDNA library with probes specific for group 1 CD1 distinct genes (Fig. 2, B and C). However, nucleotide sequence genes. As a result, we identified two CD1A genes and one CD1E analysis showed that they were identical for all regions sequenced. gene and determined the full-length sequence of the previously Because rabbits are maintained as outbred animals, these two reported CD1B gene. genes may be allelic polymorphisms of the CD1B gene. Indeed, The Journal of Immunology 409 polymorphisms have been found for all human CD1 genes, and the sheep CD1e (27) are expressed by B cell populations. This ex- polymorphic differences are usually located in exon 2 (39). Be- pression of multiple CD1 proteins by rabbit B cells may be due to cause we did not observe differences in the sequences of the genes differences between the human and rabbit in the evolutionary pres- but in the regions flanking the genes, the two phage clones may sures that shaped their CD1 loci. The amino acid differences in contain two CD1B genes and not two CD1B alleles. Due to their both the ␣1 and ␣2 domains and the cytoplasmic tails allow the complete identity in the sequences of their introns and exons, these human CD1 proteins to traffic to different cellular compartments clones may represent a gene duplication event that occurred within and to bind different lipid and glycolipid Ags. Therefore, the ex- the rabbit CD1 locus. Another possibility is that a cloning artifact pression of group 1 CD1 isoforms in rabbit B cell populations may occurred during the construction of the library, resulting in the ensure that different lipid and glycolipid Ags are being sampled addition of a fragment of DNA upstream of the CD1B gene in from a variety of cellular compartments and then presented to T phage 19 (Fig. 2, B and C). Not until a physical map of the rabbit cells. CD1 locus is generated will we know whether these CD1Bϩ phage The majority of lipid and glycolipid Ags presented by group 1 clones represent allelic polymorphisms, distinct genes, or a cloning CD1 proteins are derived from the cell wall of mycobacteria. Con- artifact. sequently, T cells that recognize these foreign lipid Ags may play We have successfully used CD1A- and CD1B-specific probes to a role in protective immunity to mycobacterial infection. Sieling et identify rabbit CD1A and CD1B genes, respectively. However, al. (46) have shown that there is a correlation between a strong when we used a CD1C-specific probe to screen the thymocyte cell-mediated response to M. leprae and the expression of group 1 cDNA library, we identified a rabbit CD1E gene rather than a CD1 proteins by dendritic cells in the dermis of leprosy patients.

CD1C gene. There is ϳ76% homology in the ﬁrst 100 bp of exon In lepromatous skin lesions, where there is a weak cell-mediated Downloaded from 1(␣1 domain) of human CD1C and rabbit CD1E, which may response, little or no group 1 CD1 expression was detected in the explain why we isolated CD1E cDNA clones with the human dermis. However, in tuberculoid skin lesions, where there is strong CD1c ␣1 probe. A CD1E gene has also been identiﬁed in guinea cell-mediated response, group 1 CD1 proteins were expressed at pig (28), and it appears to be similar to the one in the human, in high levels in the dermis. These correlative data suggest that the that it is transcribed in the thymus but is not translated into a expression of group 1 CD1 proteins by dermal dendritic cells is

protein. However, recent data in sheep demonstrate that a CD1E linked to protective cell-mediated immunity (46). The rabbit has http://www.jimmunol.org/ gene can encode for a functional protein (27). Rhind et al. (27) been used as an animal model to study tuberculosis for almost 50 performed NH2-terminal sequencing on a CD1 protein that was yr (47). In addition, rabbits are similar to humans in that they are purified using an anti-sheep CD1 mAb. Comparison of this amino relatively resistant to tuberculosis, and they develop both liquefied acid sequence with those of human CD1 proteins resulted in the caseous and cavitary tuberculous lesions (48, 49). However, these identification of a sheep CD1E homolog. Although we can identify lung lesions do not occur in mice and rarely occur in guinea pigs rabbit CD1E transcripts in a variety of tissues and cell populations, (48, 49). Therefore, by cloning and characterizing the rabbit group future experiments are required to determine whether the rabbit 1 CD1 genes, we have provided the foundation on which to study CD1E gene encodes for functional protein. the regulation of CD1 gene expression and the role of group 1 CD1 Based on the deduced amino acid sequence of the CD1Eϩ proteins in mycobacterial infection. by guest on September 23, 2021 cDNA clones, we predict that they encode for soluble and/or secreted forms of rabbit CD1e. Transcripts encoding for soluble mol- Acknowledgments ecules have been found at relatively high frequencies for human We thank Ann Mathies and Marcia Credo for their assistance with the CD1A, CD1C, and CD1E genes (40). Using isoform-specific analysis of the genomic phage clones. mAbs, Woolfson and Milstein (41) have shown that truncated CD1A and CD1C transcripts are indeed translated, and their pro- References tein products are detected in the culture supernatants of CD1A and 1. Germain, R. N., and D. H. Margulies. 1993. The biochemistry and cell biology of antigen processing and presentation. Annu. Rev. Immunol. 11:403. CD1C transfectants. Even though secreted forms of HLA class I 2. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules. (41), class II (42), and HLA-G (43) molecules have been detected, Annu. Rev. Immunol. 12:259. little is known about their role in T cell development and function. 3. Heemels, M.-T., and H. Ploegh. 1995. Generation, translocation, and presentation of MHC class I-restricted peptides. Annu. Rev. Biochem. 64:463. Recent data suggest that these secreted Ag-presenting molecules 4. Porcelli, S. A. 1995. The CD1 family: a third lineage of antigen-presenting mol- have immunomodulatory roles, as demonstrated by the ability of ecules. Adv. Immunol. 59:1. soluble HLA class I molecules to induce apoptosis in alloreactive 5. Amniot, M., H. Dastot, M. Fabbi, L. Degos, A. Bernard, and L. Boumsell. 1988. ϩ Intermolecular complexes between three human CD1 molecules on normal thy- CTL (44) and mitogen-stimulated CD8 cells (45). Future studies mus cells. Immunogenetics 27:187. are required to determine the role, if any, that soluble CD1 mol- 6. Martin, L. H., F. Calabi, and C. Milstein. 1986. Isolation of CD1 genes: a family of major histocompatibility complex-related differentiation antigens. Proc. Natl. ecules play in the development and function of CD1-restricted T Acad. Sci. USA 83:9154. cells. 7. Martin, L. H., F. Calabi, F. A. Lefebvre, C. A. Bilsland, and C. Milstein. 1987. Despite the conservation in the nucleotide sequences of human Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc. Natl. Acad. Sci. USA 84:9189. and rabbit group 1 CD1 isoforms, we observed a significant dif- 8. Yu, C. Y., and C. Milstein. 1989. A physical map linking the five CD1 human ference between human and rabbit in the expression of these CD1 thymocyte differentiation antigens. EMBO J. 8:3727. 9. Albertson, D. G., R. Fishpool, P. Sherrington, E. Nacheva, and C. Milstein. 1988. isoforms in peripheral B cell populations. In the human, CD1c is Sensitive and high resolution in situ hybridization to human chromosomes using the only group 1 CD1 protein expressed in peripheral B cell pop- biotin labelled probes: assignment of the human thymocyte CD1 antigen genes to ulations (14). However, in the rabbit we detected the CD1b protein chromosome 1. EMBO J. 7:2801. low high 10. Calabi, F., and C. Milstein. 1986. A novel family of human major histocompat- on a subset of IgM B cells and a subset of IgM B cells in ibility complex-related genes not mapping to chromosome 6. Nature 323:540. ␤ secondary lymphoid tissues (Fig. 3E and data not shown). In ad- 11. Bilsland, C. A., and C. Milstein. 1991. The identification of the 2-microglobulin dition, we detected CD1A2 and CD1E transcripts in FACS-sorted binding antigen encoded by the human CD1D gene. Eur. J. Immunol. 21:71. ϩ 12. Calabi, F., J. M. Jarvis, L. Martin, and C. Milstein. 1989. Two classes of CD1 IgM lymph node cells (Fig. 5B). These data suggest that many of genes. Eur. J. Immunol. 19:285. the rabbit CD1 isoforms are expressed by peripheral B cells. How- 13. Exley, M. J. Garcia, S. B. Wilson, F. Spada, D. Gerdes, S. M. Tahir, K. T. Patton, R. S. Blumberg, S. Porcelli, A. Chott, et al. 2000. CD1d structure and regulation ever, the rabbit is not the only mammal in which CD1 isoforms on human thymocytes, peripheral blood T cells, B cells and monocytes. Immu- other than CD1c are expressed by B cells. Both pig CD1a (29) and nology 100:37. 410 RABBIT CD1 GENES

14. Delia, D., G. Cattoretti, N. Polli, E. Fontanella, A. Aiello, R. Giardini, F. Rilke, 31. Wang, C.-R., G.-H. Chen, M. Newkirk, J. D. Capra, and W. J. Mandy. 1988. and G. Della Porta. 1988. CD1c but neither CD1a nor CD1b molecules are ex- Biochemical properties of a novel rabbit thymocyte specific class I-like antigen. pressed on normal, activated, and malignant human B cells: identification of a Mol. Immunol. 25:945. new B-cell subset. Blood 72:241. 32. Calabi, F., K. T. Belt, C. Y. Yu, A. Bradbury, W. J. Mandy, and C. Milstein. 15. Fithian, E., P. Kung, G. Goldstein, M. Rubenfeld, C. Fenoglio, and R. Edelson. 1989. The rabbit CD1 and the evolutionary conservation of the CD1 gene family. 1981. Reactivity of Langerhans cells with hybridoma antibody. Proc. Natl. Acad. Immunogenetics 30:370. Sci. USA 78:2541. 33. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA 16. Blumberg, R. S., C. Terhorst, P. Bleicher, F. V. McDermott, C. H. Allan, restriction endonuclease fragments to high specific activity. Anal. Biochem. S. B. Landau, J. S. Trier, and S. P. Balk. 1991. Expression of a nonpolymorphic 132:6. MHC class I-like molecule, CD1d, by human intestinal epithelial cells. J. Immu- 34. Raman, C., and K. L. Knight. 1992. CD5ϩ cells that predominate in peripheral nol. 147:2518. tissues of rabbit. J. Immunol. 148:3858. 17. Porcelli, S., M. B. Brenner, J. L. Greenstein, S. P. Balk, C. Terhorst, and 35. Guild, B. C., and J. L. Strominger. 1984. Human and murine class I MHC an- P. A. Bleicher. 1989. Recognition of cluster of differentiation 1 antigens by hu- tigens share conserved serine 335, the site of HLA phosphorylation in vivo. man CD4Ϫ CD8Ϫ cytolytic T lymphocytes. Nature 341:447. J. Biol. Chem. 259:9235. 18. Exley, M., J. Garcia, J., S. P. Balk, S., and Porcelli. 1997. Requirements for CD1d 36. Vega, M. A., and J. L. Strominger. 1989. Constitutive endocytosis of HLA class recognition by human invariant V␣24ϩ CD4Ϫ CD8Ϫ T cells. J. Exp. Med. 186: I antigens requires a specific portion of the intracytoplasmic tail that shares struc- 109. tural features with other endocytosed molecules. Proc. Natl. Acad. Sci. USA 19. Porcelli, S. A., C. T. Mortia, and M. B. Brenner. 1992. CD1b restricts the re- 86:2688. sponse of human CD4Ϫ CD8Ϫ T lymphocytes to a microbial antigen. Nature 37. Sugita, M., R. M. Jackman, E. van Donselaar, S. M. Behar, R. A. Rogers, 360:593. P. J. Peters, M. B. Brenner, and S. A. Porcelli. 1996. Cytoplasmic tail-dependent 20. Beckman, E. M., S. A. Porcelli, C. T. Morita, S. M. Behar, S. T. Furlong, and localization of CD1b antigen-presenting molecules to MIICs. Science 273:349. M. B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted ␣␤ϩ T 38. Jackman, R. M., S. Stengers, A. Lee, D. B. Moddy, R. A. Rogers, K. R. Niazi, cells. Nature 372:691. M. Sugita, R. L. Modlin, P. J. Peters, and S. A. Porcelli. 1998. The tyrosine- 21. Sieling, P. A., D. Chatterjee, S. A. Porcelli, T. I. Prigozy, R. J. Mazaccaro, containing cytoplasmic tail of CD1b is essential for its efficient presentation of T. Soriano, B. R. Bloom, M. B. Brenner, M. Kronenberg, P. J. Brennan, et al. bacterial lipid antigens. Immunity 8:341. 1995. CD1-restricted T cell recognition of microbial lipoglycan antigens. Science 39. Han, M., L. I. Hannick, M. DiBrino, and M. A. Robinson. 1999. Polymorphism Downloaded from 269:227. of human CD1 genes. Tissue Antigens 54:122. 22. Beckman, E. M., A. Melian, S. M. Behar, P. A. Sieling, D. Chatterjee, 40. Woolfson, A., and C. Milstein. 1994. Alternative splicing generates secretory S. T. Furlong, R. Matsumoto, J. P. Rosat, R. L. Modlin, and S. A. Porcelli. 1996. isoforms of human CD1. Proc. Natl. Acad. Sci. USA 91:6683. Cd1c restricts responses of mycobacteria-specific T cells: evidence for antigen 41. Krangel, M. S. 1986. Secretion of HLA-A and -B antigens via an alternative RNA presentation by a second member of the human CD1 family. J. Immunol. 157: splicing pathway. J. Exp. Med. 163:1173. 2795. 42. Briata, P., S. F. Radka, S. Sartoris, and J. S. Lee. 1989. Alternative splicing of 23. Brossay, L., M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, and HLA-DQB transcripts and secretion of HLA-DQ ␤-chain proteins: allelic poly- ␣

M. Kronenberg. 1998. CD1d-mediated recognition of an -galactosylceramide morphism in splicing and polyadenylation sites. Proc. Natl. Acad. Sci. USA 86: http://www.jimmunol.org/ by natural killer T cells is highly conserved through mammalian evolution. 1003. J. Exp. Med. 188:1521. 43. Chu, W., M. E. Fant, D. E. Geraghty, and J. S. Hunt. 1998. Soluble HLA-G in 24. Spada, F. M., Y. Koezuka, and S. A. Porcelli. 1998. CD1d-restricted recognition human placentas: synthesis in trophoblasts and interferon-␥-activated macro- of synthetic glycolipid antigens by human natural killer T cells. J. Exp. Med. phages but not placental ﬁbroblasts. Hum. Immunol. 59:435. 188:1529. 44. Zavazava, N., and M. Kronke. 1996. Soluble HLA class I molecules induce 25. Bradbury, A., K. T. Belt, T. M. Neri, C. Milstein, and F. Calabi. 1988. Mouse apoptosis in alloreactive cytotoxic T lymphocytes. Nat. Med. 2:1005. CD1 is distinct from and co-exists with the TL in the same thymus. EMBO J. 45. Puppo, F., F. Indiveri, M. Scudeletti, and S. Ferrone. 1997. Soluble HLA anti- 7:3081. gens: new roles and uses. Immunol. Today 18:154. 26. Ferguson, E. D., B. M. Dutia, W. R. Hein, and J. Hopkins. 1996. The sheep CD1 46. Sieling, P. A., D. Julien, M. Dahlem, T. F. Tedder, T. H. Rea, R. L. Modlin, and gene family contains at least four CD1B homologues. Immunogenetics 44:86. S. A. Porcelli. 1999. CD1 expression by dendritic cells in human leprosy lesions: 27. Rhind, S. M., J. Hopkins, and B. M. Dutia. Amino-terminal sequencing of sheep correlation with effective host immunity. J. Immunol. 162:1851.

CD1 antigens and identiﬁcation of a sheep CD1D gene. Immunogenetics 49:225. 47. Lurie, M. B., S. Abramson, and A. G. Heppleston. 1952. On the response of by guest on September 23, 2021 28. Dascher, C. C., K. Hiromatsu, J. W. Naylor, P. P. Brauer, K. A. Brown, genetically resistant and susceptible rabbits to the quantitative inhalation of hu- J. R. Storey, S. M. Behar, E. S. Kawasaki, S. A. Porcelli, M. B. Brenner, et al. man-type tubercle bacilli and the nature of resistance to tuberculosis. J. Exp. Med. 1999. Conservation of a CD1 multigene family in the guinea pig. J. Immunol. 95:119. 163:5478. 48. Dannenberg, A.M., Jr. 1984. Pathogenesis of tuberculosis: native and acquired 29. Chun, T., K. Wang, F. A. Zuckerman, and H. R. Gaskins. 1999. Molecular clon- resistance in animals and humans. In Microbiology. American Society for Mi- ing and characterization of a novel CD1 gene from the pig. J. Immunol. 162:6562. crobiology, Washington, D.C., p. 344. 30. Howard, C. J., P. Sopp, K. R. Parsons, G. P. Bembridge, and G. Hall. 1993. A 49. McMurray, D. N., F. M. Collins, A.M. Dannenberg Jr., and D. W. Smith. 1996. new bovine leukocyte antigen cluster comprising two monoclonal antibodies Pathogenesis of experimental tuberculosis in animal models. In Tuberculosis. CC43 and CC118, possibly related to CD1. Vet. Immunol. Immunopathol. 39:69. T. M. Shinnick, ed. Springer-Verlag, Berlin, p.157.