Established: 1959. The year 2015 is the 57th anniversary of continuous publication

ISSN 0036-4665 ISSN 1678-9946 on line EDITORS EMERITUS EDITORS Prof. Dr. Thales F. de Brito Prof. Dr. Luis Rey (Founding Editor) Prof. Dr. Thelma S. Okay Prof. Dr. Carlos da Silva Lacaz Associate Editor: Prof. Dr. Pedro Paulo Chieffi

EDITORIAL BOARD Alan L. de Melo (Belo Horizonte, MG) Fernando A. Corrêa (S. Paulo, SP) Maria L. Higuchi (S. Paulo, SP) Alberto Duarte (S. Paulo, SP) Fernando Montero‑Gei (San José, Costa Rica) Mario Mariano (S. Paulo, SP) Angela Restrepo M. (Medellin, Colombia) Flair J. Carrilho (S. Paulo, SP) Mirian N. Sotto (S. Paulo, SP) Anna Sara S. Levin (S. Paulo, SP) Gil Benard (S. Paulo, SP) Moisés Goldbaum (S. Paulo, SP) Antonio A. Barone (S. Paulo, SP) Gioconda San-Blas (Caracas, Venezuela) Moysés Mincis (S. Paulo, SP) Antonio Carlos Nicodemo (S. Paulo, SP) Govinda Visvesvara (Atlanta, USA) Moysés Sadigursky (Salvador, BA) Antonio Sesso (S. Paulo, SP) Heitor F. Andrade Jr. (S. Paulo, SP) Myrthes T. Barros (S. Paulo, SP) Antonio W. Ferreira (S. Paulo, SP) Hiro Goto (S. Paulo, SP) Nilma Cintra Leal (Recife, PE) Barnett L. Cline (New Orleans, USA) Ises A. Abrahamsohn (S. Paulo, SP) Paulo C. Cotrim (São Paulo, SP) Carlos F. S. Amaral (Belo Horizonte, MG) João Carlos Pinto Dias (Belo Horizonte, MG) Paulo M. Z. Coelho (Belo Horizonte, MG) Celso Granato (S. Paulo, SP) João Renato Rebello Pinho (Sao Paulo, SP) Regina Abdulkader (S. Paulo, SP) Cesar A. Cuba Cuba (Brasília, DF) José Ângelo A. Lindoso (S. Paulo, SP) Ricardo Negroni (B. Aires, Argentina) César Naquira V. (Lima, Peru) José Eduardo Levi (S. Paulo, SP) Robert H. Gilman (Baltimore, USA) Clarisse M. Machado (S. Paulo, SP) Julia Maria Costa-Cruz (Uberlândia, MG) Roberto Martinez (Rib. Preto, SP) Claudio S. Pannuti (S. Paulo, SP) Julio Litvoc (S. Paulo, SP) Ronaldo Cesar B. Gryschek (S. Paulo, SP) Dalton L. F. Alves (Belo Horizonte, MG) Luiz Carlos Severo (P. Alegre, RS) Semíramis Guimarães F. Viana (Botucatu, SP) Eridan Coutinho (Recife, PE) Luiz T. M. Figueiredo (Rib. Preto, SP) Silvio Alencar Marques (Botucatu, SP) Ernesto Hofer (Rio de Janeiro, RJ) Lygia B. Iversson (S. Paulo, SP) Tsutomu Takeuchi (Tokyo, Japan) Euclides A. Castilho (S. Paulo, SP) Marcello Fabiano de Franco (S. Paulo, SP) Venâncio A. F. Alves (S. Paulo, SP) Eufrosina S. Umezawa (S. Paulo, SP) Marcos Boulos (S. Paulo, SP) Vicente Amato Neto (S. Paulo, SP) Expedito J. A. Luna (S. Paulo, SP) M. A. Shikanai‑Yasuda (S. Paulo, SP) Zilton A. Andrade (Salvador, BA) Fan Hui Wen (S. Paulo, SP) Maria I. S. Duarte (S. Paulo, SP)

Executive Board: Maria do Carmo Berthe Rosa. Librarians: Maria Ângela de Castro Fígaro Pinca; Carlos José Quinteiro

The Revista do Instituto de Medicina Tropical de São Paulo is abstracted and/or indexed in: Index Medicus, Biological Abstracts, EMBASE/Excerpta Medica, Hepatology/Rapid Literature Review, Tropical Diseases Bulletin, Referativnyi Zhurnal: All-Russian Institute of Scientific and Technical Information (VINITI), Periódica ‑ Índice de Revistas Latinoamericanas en Ciencias, Helminthological Abstracts, Protozoological Abstracts, Review of Medical and Veterinary Mycology, PubMed, PubMed Central (PMC), UnCover, HealthGate, OVID, LILACS, MEDLINE, New Jour, ExtraMED, Free Medical Journals, ISI (Institute for Scientific Information), BIOSIS Previews, Scopus, Science Citation Index Expanded (SciSearch), Journal Citation Reports/Science Edition, Current Contents®/Clinical Medicine and Index Copernicus. ON LINE ACCESS ‑ http://www.imt.usp.br/revista ‑ FREE PDF ACCESS TO ALL PAST ISSUES, from 1959 on (Financial support by “Alves de Queiroz Family Fund for Research). http://www.scielo.br/rimtsp ‑ FULL TEXT, SINCE 1984. E‑mail: [email protected] Reprints may be obtained from Pro Quest Inf. and Learning, 300 North Zeeb Road, Ann Arbor, Michigan 48106‑1346 ‑ USA. The Revista do Instituto de Medicina Tropical de São Paulo is supported by: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Universidade de São Paulo and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). This issue was financed by:Fundação de Amparo à Pesquisa do Estado de São Paulo - FAPESP Proc. 15/50053-9 and CNPq Proc. 470638/2014-1. Desktop Publishing by: Hermano - e-mail: [email protected]. Phone: 55.11.5571-8937. - Printed by: Elyon Indústria Gráfica, Phone: 55.11.3783-6527. English Revision: [email protected]

UNIVERSIDADE DE SÃO PAULO - BRAZIL FACULDADE DE MEDICINA Instituto de Medicina Tropical de São Paulo Director: Prof. Dr. Paulo C. Cotrim I The purpose of the “Revista do Instituto de Medicina Tropical de São Paulo” (Journal of the São Paulo Institute of Tropical Medicine) is to publish the results of researches which contri- bute significantly to knowledge of all transmissible diseases.

TO WHOM IT MAY CONCERN

From 2016 on, the REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO (Journal of the São Paulo Institute of Tropical Medicine) will be published only on line, free access.

REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO (JOURNAL OF THE S. PAULO INSTITUTE OF TROPICAL MEDICINE). São Paulo, SP-Brasil, 1959 - v. ilust. 28 cm

1959-2014, 1-56 1973-2002 (supl. 1-12) 2003 (supl. 13 - on-line only) 2005-2012 (supl. 14-18) 2015, 57 (1-5)

ISSN 0036-4665 ISSN 1678-9946 on line

II Impact Factor: 1.007 5-year Impact Factor: 1.088

ISSN 0036-4665 ISSN 1678-9946 on line

Rev. Inst. Med. Trop. Sao Paulo Vol. 57 No. 5 P. 369-460 September-October, 2015

CONTENTS

PARASITOLOGY BRIEF COMMUNICATION 369 Human toxoplasmosis outbreaks and the agent infecting form. 427 Immunodiagnosis of human strongyloidiasis: use of six different Findings from a systematic review antigenic fractions from Strongyloides venezuelensis parasitic L.R. MEIRELES, C.C.J. EKMAN, H.F. ANDRADE Jr. & E.J.A. LUNA females M.A. CORRAL, F.M. PAULA, M. GOTTARDI, D.M.C.L. MEISEL, V.L.P. CASTILHO, 377 New primers for detection of Leishmania infantum using polymerase E.M.N. GONÇALVES, P.P. CHIEFFI & R.C.B. GRYSCHEK chain reaction K.P. GUALDA, L.M. MARCUSSI, H.C. NEITZKE-ABREU, S.M.A. ARISTIDES, 431 Prevalence of Chagas disease in a rural area in the state of Ceará, M.V.C. LONARDONI, R.F. CARDOSO & T.G.V. SILVEIRA Brazil E.C. FREITAS, M.F. OLIVEIRA, M.C. ANDRADE, A.S.O.B. VASCONCELOS, J.D. 385 Adenosine deaminase activity and serum C-reactive protein as SILVA FILHO, D.S. CÂNDIDO, L.S. PEREIRA, J.P.R. CORREIA, J.N.M. CRUZ & prognostic markers of Chagas disease severity L.P.G. CAVALCANTI I.D. BRAVO-TOBAR, C. NELLO-PÉREZ, A. FERNÁNDEZ, N. MOGOLLÓN, M.C. PÉREZ, J. VERDE, J.L. CONCEPCIÓN, C. RODRIGUEZ-BONFANTE & R. 435 Geographical expansion of canine visceral leishmaniasis in Rio de BONFANTE-CABARCAS Janeiro State, Brazil D.A. SILVA, M.F. MADEIRA & F.B. FIGUEIREDO BACTERIOLOGY 393 Isolation and molecular identification of potentially pathogenic 439 Toxoplasma-specific IgG subclass antibody response in cerebrospi- Escherichia coli and Campylobacter jejuni in feral pigeons from nal fluid samples from patients with cerebral toxoplasmosis an urban area in the city of Lima, Peru F.S. NASCIMENTO, L.A. SUZUKI, N. BRANCO, R.M.B. FRANCO, P.D. ANDRADE, M. CABALLERO, I. RIVERA, L.M. JARA, F.M. ULLOA-STANOJLOVIC & C. SHIVA S.C.B. COSTA, M.N. PEDRO & C.L. ROSSI

MEDICINAL PLANTS 443 A new possibility for surveillance: do we identify all cases of lep- 397 Chemical characterization and evaluation of antibacterial, antifun- tospirosis? gal, antimycobacterial, and cytotoxic activities of Talinum panicu- R.M. FONTES, L.P.G. CAVALCANTI, A.C.A. OLIVEIRA, L.F.M. BEZERRA, A.M.M. latum GOMES, J.K.B. COLARES & D.M. LIMA L.F.C. DOS REIS, C.D. CERDEIRA, B.F. DE PAULA, J.J. SILVA, L.F.L. COELHO, M.A. SILVA, V.B.B. MARQUES, J.K. CHAVASCO & G. ALVES-DA-SILVA CASE REPORT 447 First case of human infection by Bertiella studeri (Blanchard, 1891) VIROLOGY Stunkard, 1940 (Cestoda; Anoplocephalidae) in Brazil 407 Morbidity and mortality due to AIDS: a study of burden of disease V.V. LOPES, H.A. SANTOS, A.V.M. SILVA, G. FONTES, G.L.VIEIRA, A.C. at a municipal level FERREIRA & E.S. SILVA J. DA SILVA, V. RAMOS, H.C.G. DA SILVA & J. TRAEBERT 451 First report of cutaneous leishmaniasis caused by Leishmania CORRESPONDENCE (Leishmania) infantum chagasi in an urban area of Rio de Janeiro, 412 Pathogenic fungi in bird excreta: a forgotten public health problem Brazil B. JOOB & V. WIWANITKIT M.R. LYRA, M.I.F. PIMENTEL, M.F. MADEIRA, L.F. ANTONIO, J.P.M. LYRA, A. FAGUNDES & A.O. SCHUBACH MYCOLOGY 413 Related factors for colonization by Candida species in the oral 455 Protective levels of varicella-zoster antibody did not effectively cavity of HIV-infected individuals prevent chickenpox in an X-linked agammaglobulinemia patient R.P. MENEZES, A.S. BORGES, L.B. ARAUJO, R.S. PEDROSO & D.V.D.B. RÖDER F.A. NOBRE, I.G.S. GONZALEZ, M.I. MORAES-PINTO & B.T. COSTA-CARVALHO

421 The relevance of nutritional status and histopathological findings LETTER TO THE EDITOR on the infectious process of BALB/c mice inoculated with Lacazia 458 Diversity and infectivity potential of emerging fungi in an area of loboi babaçu trees in the state of Maranhão, Brazil A.S.A.A. BARBOSA, S.M. DIÓRIO, S.C.B. PEDRINI, A.J.F. NUNES, A.F.F. M.D.S.B. NASCIMENTO, V.M.S. LEITÃO, M.A.C.N. SILVA, A.C.B. NASCIMENTO, BELONE, S.M.U.R. SILVA, B.G.C. SARTORI, S.A. CALVI, F.R. VILANI-MORENO G.F.B. BEZERRA & G.M.C. VIANA & P.C.M. PEREIRA.

ADDRESS SUBSCRIPTIONS INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO FOREIGN COUNTRIES Av. Dr. Enéas de Carvalho Aguiar, 470 One year (six issues)...... U$ 200.00 05403-000 São Paulo, SP - Brazil Single issue...... U$ 50.00 Phone/Fax: 55.11.3062.2174; 55.11.3061-7005 e-mail: [email protected] III Impact Factor: 1.007 5-year Impact Factor: 1.088

ISSN 0036-4665 ISSN 1678-9946 on line

Rev. Inst. Med. Trop. Sao Paulo Vol. 57 No. 5 P. 369-460 Setembro-Outubro, 2015

CONTEÚDO

PARASITOLOGIA COMUNICAÇÃO BREVE 369 Surtos de toxoplasmose humana e a forma infectante do agente. 427 Imunodiagnóstico da estrongiloidíase humana: o uso de seis dife- Achados de revisão sistemática rentes frações antigênicas de fêmeas parasitas de Strongyloides L.R. MEIRELES, C.C.J. EKMAN, H.F. ANDRADE Jr. & E.J.A. LUNA venezuelensis M.A. CORRAL, F.M. PAULA, M. GOTTARDI, D.M.C.L. MEISEL, V.L.P. CASTILHO, 377 Novos iniciadores para detecção de Leishmania infantum pela reação E.M.N. GONÇALVES, P.P. CHIEFFI & R.C.B. GRYSCHEK em cadeia da polimerase K.P. GUALDA, L.M. MARCUSSI, H.C. NEITZKE-ABREU, S.M.A. ARISTIDES, 431 Prevalência da doença de Chagas em área rural no estado do Ceará, M.V.C. LONARDONI, R.F. CARDOSO & T.G.V. SILVEIRA Brasil E.C. FREITAS, M.F. OLIVEIRA, M.C. ANDRADE, A.S.O.B. VASCONCELOS, J.D. 385 Atividade da adenosina deaminase e níveis de proteina C reativa SILVA FILHO, D.S. CÂNDIDO, L.S. PEREIRA, J.P.R. CORREIA, J.N.M. CRUZ & sérica como marcadores de gravidade na doença de Chagas L.P.G. CAVALCANTI I.D. BRAVO-TOBAR, C. NELLO-PÉREZ, A. FERNÁNDEZ, N. MOGOLLÓN, M.C. PÉREZ, J. VERDE, J.L. CONCEPCIÓN, C. RODRIGUEZ-BONFANTE & R. 435 Expansão geográfica da leishmaniose visceral canina no estado do BONFANTE-CABARCAS Rio de Janeiro, Brasil D.A. SILVA, M.F. MADEIRA & F.B. FIGUEIREDO BACTERIOLOGIA 393 Isolamento e detecção de Escherichia coli e Campylobacter jejuni 439 Resposta de anticorpos específicos das subclasses da IgG para potencialmente patogênicos em pombos selvagens de uma área Toxoplasma em amostras de líquido cefalorraquidiano de pacientes urbana na cidade de Lima, Perú com toxoplasmose cerebral M. CABALLERO, I. RIVERA, L.M. JARA, F.M. ULLOA-STANOJLOVIC & C. SHIVA F.S. NASCIMENTO, L.A. SUZUKI, N. BRANCO, R.M.B. FRANCO, P.D. ANDRADE, S.C.B. COSTA, M.N. PEDRO & C.L. ROSSI PLANTAS MEDICINAIS 397 Caracterização química e avaliação das atividades antibacteriana, 443 Uma nova possibilidade de vigilância: identificamos todos os casos antifúngica, antimicobacteriana e citotóxica de Talinum paniculatum de leptospirose? L.F.C. DOS REIS, C.D. CERDEIRA, B.F. DE PAULA, J.J. SILVA, L.F.L. COELHO, R.M. FONTES, L.P.G. CAVALCANTI, A.C.A. OLIVEIRA, L.F.M. BEZERRA, A.M.M. M.A. SILVA, V.B.B. MARQUES, J.K. CHAVASCO & G. ALVES-DA-SILVA GOMES, J.K.B. COLARES & D.M. LIMA

VIROLOGIA RELATO DE CASO 407 Morbidade e mortalidade por AIDS: estudo sobre o impacto da 447 Primeiro caso de infecção humana por Bertiella studeri (Blanchard, doença em nível municipal 1891) Stunkard,1940 (Cestoda; Anoplocephalidae) no Brasil J. DA SILVA, V. RAMOS, H.C.G. DA SILVA & J. TRAEBERT V.V. LOPES, H.A. SANTOS, A.V.M. SILVA, G. FONTES, G.L.VIEIRA, A.C. FERREIRA & E.S. SILVA CORRESPONDÊNCIA 412 Pathogenic fungi in bird excreta: a forgotten public health problem 451 Primeiro relato da leishmaniose cutânea causada por Leishmania B. JOOB & V. WIWANITKIT (Leishmania) infantum chagasi em uma área urbana do Rio de MICOLOGIA Janeiro, Brasil M.R. LYRA, M.I.F. PIMENTEL, M.F. MADEIRA, L.F. ANTONIO, J.P.M. LYRA, A. 413 Fatores relacionados a colonização da cavidade bucal de indivíduos FAGUNDES & A.O. SCHUBACH portadores do HIV por espécies de Candida R.P. MENEZES, A.S. BORGES, L.B.A. ARAUJO, R.S. PEDROSO & D.V.D.B. RÖDER 455 Nível sérico adequado de anticorpo contra o vírus da varicela-zoster não foi suficiente para prevenir a infecção em criança com agama- 421 A relevância do estado nutricional e alterações histopatológicas globulinemia ligada ao X F.A. NOBRE, I.G.S. GONZALEZ, M.I. MORAES-PINTO & B.T. COSTA-CARVALHO no processo infeccioso de camundongos BALB/c inoculados com Lacazia loboi CARTA AO EDITOR A.S.A.A. BARBOSA, S.M. DIÓRIO, S.C.B. PEDRINI, A.J.F. NUNES, A.F.F. BELONE, S.M.U.R. SILVA, B.G.C. SARTORI, S.A. CALVI, F.R. VILANI-MORENO 458 Diversity and infectivity potential of emerging fungi in an area of & P.C.M. PEREIRA. babaçu trees in the state of Maranhão, Brazil M.D.S.B. NASCIMENTO, V.M.S. LEITÃO, M.A.C.N. SILVA, A.C.B. NASCIMENTO, G.F.B. BEZERRA & G.M.C. VIANA

ENDEREÇO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO Av. Dr. Enéas de Carvalho Aguiar, 470 05403-000 São Paulo, SP - Brasil Fone/Fax: 55.11.3062.2174; 55.11.3061-7005 IV e-mail: [email protected] Rev. Inst. Med. Trop. Sao Paulo 57(5):369-376, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500001

HUMAN TOXOPLASMOSIS OUTBREAKS AND THE AGENT INFECTING FORM. FINDINGS FROM A SYSTEMATIC REVIEW

Luciana Regina MEIRELES(1), Claudio Cesar Jaguaribe EKMAN(1), Heitor Franco de ANDRADE JR.(1,2) & Expedito José de Albuquerque LUNA(1)

SUMMARY

Toxoplasmosis, a worldwide highly prevalent zoonotic infection, is transmitted either by the oocysts, from water and soil, or the tissue cysts, in raw or undercooked infected meat, of Toxoplasma gondii. An ongoing debate is whether there are differences between the clinical and epidemiological characteristics of the outbreaks due to one or the other infective form of the agent. We performed a systematic review, recovering 437 reported outbreaks of which 38 were selected. They were complete reports containing ascribed Toxoplasma infecting form, and clinical and demographic data. There was no gender or age group selection in the outbreaks, which were described more often in the Americas. A large number of individuals were affected when oocysts, associated with soil and water contaminated with cat feces, were considered the transmission source. Onset of symptoms occurred early when the infection was ascribed to meat tissue cysts (11.4 ± 6.7 days) with sharpened temporal distribution of cases, while a broader and prolonged appearance of new cases was observed when oocysts in water were the source of the infection (20 ± 7 days, p < 0.001). Such information may be useful in the design and implementation of control strategies.

KEYWORDS: Toxoplasmosis; Toxoplasma gondii; Outbreaks; Oocyst; Cyst; Foodborne diseases; Waterborne diseases.

INTRODUCTION as in the Midwest36, Southeastern region22, Amazon/North R-region6 and South -region3,11, attributing the outbreaks to several infective forms of T. Toxoplasmosis is one of the most prevalent parasitic infections gondii. These outbreaks have been mainly related to clusters of cases, in worldwide, affecting at least one billion people and a large fraction of families or other small population groups, but some outbreaks have also meat-producing animals43. The disease is caused by the Apicomplexa been described in larger populations, such as small cities16 or industrial protozoon Toxoplasma gondii, which has felids as definitive hosts and plants22. However, little is known regarding severity of the disease all warm-blooded animals as intermediate hosts, including man18. The associated to the infective form of the agent. We decided to perform a transmission occurs by ingestion of either water, vegetables or soil systematic revision of reported outbreaks of human toxoplasmosis in contaminated with oocysts from cat feces; or raw, or undercooked, meat medical literature, in order to clarify whether the infecting form of the containing viable tissue cysts, characterizing this disease as a foodborne protozoan is related to the clinical and epidemiological characteristics zoonosis43. of the outbreaks. Such information may be useful in the design and implementation of control strategies. Usually benign and/or asymptomatic, T. gondii infection can cause ocular disease in a small fraction of infected individuals, or severe MATERIALS AND METHODS disease in congenitally infected fetuses and immunosuppressed patients. Toxoplasmosis prevalence varies from 10 to 90% of the adult population, The systematic review was performed according to the Cochrane according to each region or food habits43. guidelines25. We have searched the keywords “human toxoplasmosis outbreak” in the following public health bibliographical databases: In Brazil, 50 to 80% of adults have been infected with Toxoplasma16, Embase, Food Sciences & Tech Abstracts, Lilacs, PubMed, Scopus demonstrating the need for greater emphasis on measures to prevent and Web of Science. We have also searched the Cochrane Reviews the disease, which involve meat and water quality control20,43. Several Database, and the collections of the Brazilian public health surveillance toxoplasmosis outbreaks have been reported in Brazil, the first one bulletins, published by the Brazilian Federal Ministry of Health (“Boletim being described in the 1960s, in a university31. After this report, several Eletrônico Epidemiológico”), and by the State Health Department of others have been described in all regions of the Brazilian subcontinent, Sao Paulo (“BEPA - Boletim Epidemiológico Paulista”). We have also

(1) Universidade de São Paulo, Instituto de Medicina Tropical de São Paulo, São Paulo, SP, Brasil. (2) Universidade de São Paulo, Faculdade de Medicina, São Paulo, SP, Brasil. Correspondence to: Luciana Regina Meireles, Universidade de São Paulo, Instituto de Medicina Tropical de São Paulo, Laboratório de Protozoologia. Av. Dr. Enéas de Carvalho Aguiar 470/1º andar, 05403-000 São Paulo, SP, Brasil. Tel/Fax: +55+11+30617010. E-mail: [email protected] MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

included in our search meeting and congress abstracts retrieved from the Demographic and general clinical findings are shown in Table 2. above databases either in English, Portuguese or other languages. We Gender predominance was informed in all reports, male being more selected and included only those reports that adequately described human frequent in 21 of 38 reports. Water was implicated as the source in 21% toxoplasmosis outbreaks, summarized the clinical characteristics of the (8/38) of the outbreaks, contact with soil in 26.3% (10/38), and raw affected patients, and also suggested or defined the infective form of T. vegetables in 5.3% (2/38). Meat consumption, raw or undercooked, was gondii. We excluded reports of outbreaks that only presented description the source in 44.7% (17/38) of the outbreaks. The ingestion of cysts in of clinical cases of T. gondii infection without epidemiological data intrinsically contaminated meat has been frequently reported in human or parasitological studies about the infective form associated to the toxoplasmosis outbreaks in Australia13,37, Brazil3, Canada33, Korea9 outbreak. Duplicate reports of the same outbreak were checked and the and the USA28. However, oocysts have also been implicated in several more complete report was included for subsequent analysis. All selected toxoplasmosis outbreaks, ascribing the transmission to environmental reports were analyzed for identification of the agent’s infective form contamination4,12,44. Oocyst contamination of drinking water was responsible for the outbreak, such as tissues cysts, oocysts or tachyzoites. associated with large outbreaks in Canada4 and Brazil12. Tachyzoites, In each report, we have searched for the source of the agent: water, the rapid growing form of T. gondii, found in acute infection, have been vegetables, meat or contact with soil. Number of cases, their gender, rarely implicated as a source in outbreaks, but these forms can be found age and symptomatology were collected, as well as the method used for in raw milk. Outbreaks associated with raw goat milk ingestion were confirmation of the diagnosis. The affected groups and population at risk described in Brazil8, USA39 and United Kingdom41. were also researched in each outbreak report, as well as their distribution in time and space. The attributed incubation period in days and the clinical Quantitative data are presented in Table 3. Those data have shown a presentation of the acute infection, if symptomatic or asymptomatic, large variability in the number of affected cases and population at risk, were considered as informed by the authors’ description in each report. suggesting differences between epidemiological profiles, according to the infective form involved in the outbreak. Interestingly, the proportion Taking into account these inclusion and exclusion criteria, each report of infected people and the proportion of symptomatic cases, among was carefully read and the data were recorded by two independent readers, the infected, presented low dispersion, suggesting a more uniform composing a database analyzed by sorting according to the outbreak’s distribution pattern of the disease. The incubation period reported by the infective form of T. gondii defined by the author of the report. We did not authors is around twenty days, but with a higher dispersion. attempt to combine the data for a meta-analysis, however, it was possible to estimate combined figures for some clinical and epidemiological Gender and age groups were similar and independent of the type of variables, which are presented in Table 3. Quantitative variables were source. Outbreaks associated with water and soil contact were attributed analyzed by ANOVA or, in the absence of variance homogeneity, by mainly to oocysts, while meat consumption was attributed to tissue cysts, the Kruskal-Wallis test. Qualitative variables were analyzed by the Chi- as expected. No differences in general clinical picture were observed, but square test. Differences were considered significant when the probability quantitative data showed that the number of cases was larger in outbreaks of equality was less than 5% (p < 0.05). attributed to oocysts, while cyst and tachyzoites were related to clustered and smaller outbreaks (Fig. 2C). Despite this fact, the disease spread, RESULTS shown by the proportion of infected or symptomatic cases, was very similar in each attributed source. We have failed to demonstrate that a Research and selection of outbreak reports: We performed more widespread source, as oocysts in water, resulted in large populations the research of human toxoplasmosis outbreak reports, in the above at risk, probably due to the limited number of reports dealing with water mentioned databases, recovering 431. We also checked citations from contamination. The incubation period was shorter in outbreaks attributed complete articles and found another six, resulting in 437 reports. We to cysts, with a mean of less than 12 days, while oocysts associated selected 269 (62.4%) outbreak reports after the exclusion of 162 that were outbreaks presented longer incubation periods, with a mean of 20 days. duplicated. The next step was data quality; we excluded 214 incomplete, partial, limited or merely descriptive reports, especially those found in The summary of the outbreaks’ quantitative data, related to the Food Sciences & Tech Abstracts database. We selected 55 (20.40%) different infective forms of the agent, is shown in Figure 2. The large available reports that fulfilled all the inclusion criteria for the study, as affected population is evident for outbreaks with oocysts source, with a described in the Materials and Methods section, but 13 had incomplete few outliers associated to water ingestion (Fig. 2A). On the other hand, data from affected patients, six focused only on the differential diagnosis oocysts-associated outbreaks in which the source of infection was soil with other food or waterborne diseases, six were incomplete regarding tend to affect a smaller number of people, in a similar way to clusters the parasitological data and four were only related to the characterization observed in cysts or tachyzoites-associated outbreaks. There was also a of the agent and laboratorial data, resulting in 38 outbreaks reports very similar distribution of reports, according to the proportion of infected available for systematic review (Table 1). The algorithm of this process (Fig. 2B) or symptomatic cases (Fig. 2D), suggesting that the source of is shown in Figure 1. infection is unrelated to the clinical profile.

Outbreak analysis: The study design, in most reports, was The distribution of the outbreaks’ incubation period, according to merely descriptive (31/38) in addition to four case control studies, the attributed infective form of the agent, is presented in Figure 3. As two retrospective cohorts and one case series. Selected outbreaks were may be seen, a large proportion of oocysts associated outbreaks did not described in the Americas (27/38) equally distributed in North (14/38) report the incubation period, especially those associated with water, due and South (13/38) America. to the longer survival of this form and difficulty to define the time of ingestion. But the available data was sufficient to show a significantly

370 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

Table 1 Eligible complete reports of human toxoplasmosis outbreaks included in the systematic review

Year Geographical Transmis- Water Meat Vegetable Soil Confirmed % Symp- Risk % Infected I.P (days) Dissemina- Articles references distribution sion forms cases tomatic population tion 1966 South America Cysts 0 1 0 0 110 87 10.000 1,1 NI Focal Magaldi et al.31 1968 North America Cysts 0 1 0 0 5 100 29 17 7 Focal Kean et al.28 1974 North America Cysts 0 1 0 0 4 50 19 42 10 Focal Center for Disease Control7 1975 North America Cysts 0 1 0 0 6 83 7 83 12 Focal Masur et al.32 1976 North America Oocysts 0 0 0 1 10 70 30 33 30 Focal Stagno et al.42 1977 Europe Cysts 0 1 0 0 3 66 NI NI 8 Focal Fertig et al.23 1977 North America Oocysts 0 0 0 1 37 95 88 42 15 Focal Teutsch et al.44 1978 North America Tachyzoites 0 0 0 0 10 NA 24 42 38 Focal Sacks et al.38 1979 Central Oocysts 1 0 0 0 31 91 98 32 20 Wide Benenson et al.2 America 1979 Oceania Cysts 0 1 0 0 5 40 6 83 NI Focal de Silva et al.13 1979 North America Oocysts 0 0 0 1 9 44 13 69 NA Focal Shenep et al.40 1980 North America Cysts 0 1 0 0 3 100 NA NA 15 Focal Sacks et al.39 1981 North America Oocysts 0 0 0 1 6 33 9 67 NI Focal Luft e Remington (Outbreak 2)29 1981 South America Oocysts 0 0 0 1 5 40 6 83 NI Focal Luft e Remington (Outbreak 3)29 1981 North America Cysts 0 1 0 0 1 100 4 25 NI Focal Luft e Remington (Outbreak 5)29 1982 North America Oocysts 0 0 0 1 2 50 6 33 NI Focal Luft e Remington (Outbreak 1)29 1982 North America Oocysts 0 0 0 1 1 100 5 20 NI Focal Luft e Remington (Outbreak 4)29 1983 South America Tachyzoites 0 0 0 0 3 66 5 60 30 Focal Chiari et al.8 1986 Europe Cysts 0 1 0 0 3 66 4 75 NI Focal Humphreys et al.26 1987 North America Cysts 0 1 0 0 4 NA 22 36 90 Focal McDonald et al.33 1988 Europe Tachyzoites 0 0 0 0 2 100 4 50 NA Focal Skinner et al.41 1993 South America Cysts 0 1 0 0 17 100 NI NI 11 Focal Bonametti et al.3 1994 Asia Cysts 0 1 0 0 3 100 6 50 NI Focal Choi et al. (Outbreak 1)9 1994 Oceania Cysts 0 1 0 0 12 75 38 32 11 Focal Robson et al.37 1995 North America Oocysts 1 0 0 0 100 82 321.585 0,03 NI Wide Bowie et al.4 1995 Asia Cysts 0 1 0 0 5 100 11 45 7 Focal Choi et al. (Outbreak 2)9 1999 South America Oocysts 1 0 0 0 113 NI NI NI NI Focal Gattás et al.24 2001 South America Oocysts 1 0 0 0 176 88 2.884 6,1 NI Wide de Moura et al.12 2001 Asia Oocysts 1 0 0 0 178 71 NI NI NI Wide Palanisamy et al.35 2002 Asia Oocysts 0 0 0 1 171 100 1797 9,5 NI Focal Doganci et al.15 2003 South America Oocysts 1 0 0 1 11 100 33 33,33 NI Focal Demar et al.14 2004 Asia Oocysts 1 0 0 0 248 100 NI NI NI Wide Balasundaram et al.1 2004 South America Oocysts 0 0 0 1 40 85 186 21 NI Wide Carmo et al.6 2005 South America Cysts 0 1 0 0 10 100 16 62,5 30 Focal de Almeida et al.11 2005 South America Oocysts 1 0 0 0 9 100 800 1,2 NI Focal Madeira et al.30 2006 South America Cysts 0 1 0 0 6 100 NI NI 6 Focal Eduardo et al.21 2006 South America Cysts 0 1 0 0 61 97 315 19 8 Focal Renoiner et al.36 2009 South America Oocysts 0 0 1 0 11 72 45 35 15 Focal Ekman et al.22 NI = not informed; 0 = is not the source of infection; 1= is the source of infection.

371 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

longer period when compared to cyst attributed outbreaks. DISCUSSION

Our systematic review recovered a large number of outbreak reports, but many of them described the same outbreak or were incomplete. This fact resulted in a small fraction of complete reported outbreaks of human toxoplasmosis; nevertheless, this restricted sample allowed the analysis of the outbreaks as a group and according to the agent form involved. We performed a careful review of citations on recovered reports and this approach allowed the detection of six more outbreaks. This fact demonstrated that the automatic research was excellent, but not a perfect tool, and must be completed by careful personal review.

Gender association was not found in our systematic review, a fact described in some other studies of risk factors for toxoplasmosis27. No outbreaks were associated with exposure in slaughterhouses or in meat processing activities, thus our results were randomly distributed and not Fig. 1 - Systematic review flowchart. gender-associated due to an occupational bias. There were descriptions

Table 2 Frequency of reports of categorical variables in the systematic review of human toxoplasmosis outbreaks according to the infective form of T.gondii attributed as source

Total % Infective form Significance Variable [Confidence Interval 95%] χ2 (n/total) Oocysts Cysts Tachyzoites 55.26% 44.44% 64.70% 66.67% Gender as % of male [38.3 - 71.4] [21.5 - 69.2] [38.3 - 85.8] [9.4 - 99.2] NS reported predominance (21/38) (8/18) (11/17) (2/3) % of less than 15 15.78% 33.33% 22.22% 5.89% year age group [6.0 - 31.3] [0.8 - 90.6] NS [6.4 - 47.63] (4/18) [0.2 - 28.7] (1/17) predominance (6/38) (1/3) % of more than 44.73% 33.33% 58.82% 33.33% 25 year age group NS [28.6 - 61.7] (17/38) [13.3 - 59.0] (6/18) [32.9 - 81.6] (10/17) [0.8 - 90.6] (1/3) predominance 44.44% % of water attributed 21.05% 0% 0% [21.5 - 69.2] - reports [9.6 - 37.3] (8/38) [0 -19.5] (0/17) [0 - 70.7] (0/3) (8/18) 44.73% % of meal attributed 0.00% 100.00% 0% [28.6 - 61.7] - reports [0.0 - 18.5] (0/18) [80.5 - 100] (17/17) [0 - 70.7] (0/3) (17/38) 5.26% 11.11% % of vegetables 0% 0 % [0.6 - 17.7] [1.4 - 34.7] NS attributed reports [0 -19.5] (0/17) [0.00 - 70.8] (0/3) (2/38) (2/18) 26.31% % of soil contact 55.55% 0% 0% [13.4 - 43.1] - attributed reports [30.8 - 78.5] (10/18) [0-19.5] (0/17) [0 - 70.8] (0/3) (10/38) % reports with acute 92.10% 94.44% 88.23% 100.00% NS disease cases [78.6 - 98.3] (35/38) [72.7 - 99.9] (17/18) [63.6 - 98.5] (15/17) [29.2 - 100] (3/3) % reports with other 9.67% 6.67% 14.28% 0% NS than acute disease cases [2.0 - 25.8] (3/31) [0.2 - 32] (1/15) [1.8 - 42.8] (2/14) [0 - 84.2] (0/2) % reports attributing 81.57% 66.67% 94.11% outbreak to a limited NT p < 0.05* [65.7 - 92.3] (31/38) [41 - 86.7] (12/18) [71.3 - 99.9] (16/17) clustered source * This analysis was performed without data from outbreaks attributed to tachyzoite source. NS = non significant at 0.05.

372 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

Table 3 Analysis of quantitative variables from reports of the systematic review of human toxoplasmosis outbreaks according to the infective form of T. gondii attributed as source

Total Infective form Variable attributed by Significance Mean ± S.D. author (n) Oocysts Cysts Tachyzoites Numbers of confirmed 37.7 ± 62,3 64.3 ± 79.0 15.2 ± 28.1 5.0 ± 4.4 p < 0.05 cases (38) (18) (17) (3) Proportion of infected 39.8 ± 24,4 32.3 ± 25.9 45.5 ± 23.7 50.7 ± 9 cases in population at NS (30) (14) (13) (3) risk Proportion of reported 81.5 ± 21.5 77.7 ± 23.2 85.3 ± 20.0 83 ± 21.5 NS symptomatic cases (35) (17) (16) (2) Numbers of persons at 16069 ± 54414 75.2 ± 152.6 11 ± 11.2 7532.6 ± 3944 (30) NS risk in the outbreak (14) (13) (3) Incubation period in 20.2 ± 19.9 20.0 ± 7.1 11.4 ± 6.7 34 ± 5.79 p < 0.001 days (17) (4) (11) (2) Data were expressed as the mean of the attributed means in each report. ANOVA or Kruskall Wallis tests were used to compare them. Available data were expressed as mean and standard deviation (S.D.). NS = non-significant.

Fig. 2 - Quantitative data distribution of human toxoplasmosis outbreak reports according to the attributed infective form of T. gondii. A. Total population at risk. B. Percent of infected people in the risk population. C. Number of confirmed cases. D. Number of symptomatic cases. Bars represent mean plus standard deviation of the sample. See Table 3 for statistical analysis.

373 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

Water associated outbreaks ascribed to oocysts were so dispersed that authors fail to define an incubation period, however, cyst attributed outbreaks presented a longer incubation period. Those findings could also be related to the infectivity of oocysts and bradyzoites of T. gondii for intermediate hosts as reported elsewhere19,20. T. gondii has adapted to a tissue cyst-oral route in carnivores19, thus, it is not surprising that cyst attributed outbreaks had a shorter incubation period. For cats, the time needed for shedding of oocysts after primary infection (prepatent period) also varies with the stage of the T. gondii ingested18,19. The prepatent period after ingesting bradyzoites is short (3-10 days) while it is long (18 days or longer) after ingesting oocysts or tachyzoites18. Those findings were similar to the incubation period of cyst-associated outbreaks reported in our systematic review.

Symptomatology could be also related to the parasite burden or virulence of infecting strains14, but the proportions of symptomatic cases were similar in the three types of outbreaks, demonstrating that the infective form of T. gondii did not affect the clinical symptoms of infected individuals.

Fig. 3 - Distribution of reported incubation period in human toxoplasmosis outbreaks according An important issue in all outbreak reports is the accuracy of the to attributed infective form of T. gondii. Data from oocysts attributed reports was available serological diagnosis in acute toxoplasmosis. The conventional serology only for meal-related outbreaks. Bars represent mean plus standard deviation of the sample. techniques by detection of IgM or IgG may be confusing due to presence of asymptomatic individuals, which are reagent for both IgM and IgG of gender association with T. gondii infection in meat processing or tests. Actually, these individuals probably present chronic toxoplasmosis butchering27, but this factor is much more related to chronic exposure which may just be elucidated by IgG avidity. Therefore, IgG avidity to cyst-infected meat than to the conditions found in outbreaks, usually assays could be included in the outbreak evaluation to enhance the with a unique exposure to a detectable source. accurate diagnosis of acute infection22,36.

No age-related risk was observed in our study. Older groups presented We have failed to demonstrate any relationship between the an increased seroprevalence of toxoplasmosis by cumulative exposure, geographical distribution of the outbreaks with disease severity. Although a fact referenced by several authors27. The amount of ingested food most of the outbreaks have been described in the Americas, there was no could result in a bias in the age effect, which could be less important association of those outbreaks with the prevalence of a possibly more in younger groups, who tend to ingest a lower volume of food, but we virulent T. gondii strain in the region. have failed to find these effects in the outbreaks, probably due to the small number of those age groups. Children also could be more affected Toxoplasmosis outbreaks are common occurrences in public health by poor hygiene habits, geophagy and environmental exposure, which and usually anecdotally reported, but the careful analysis of cases, their are usually referenced in oocyst attributed outbreaks42. The ingestion of distribution and the determination of the extent of the outbreak provide raw or undercooked meat could vary in age groups, usually being more clues about the ascribed source of the infection. The knowledge of the frequent in food habits of older groups and the main cause of infection infection source is essential for adequate preventive measures, especially in pregnant women in Europe10. None of those effects were observed in when the contamination of a large water reservoir is implicated with a the outbreak reports in our study. large population at risk, and an increased incidence of T. gondii infection.

Geographical distribution showed that the reports were more frequently RESUMO described in the Americas, probably due to awareness of medical and research staff that resulted in more outbreaks detected and described, a Surtos de toxoplasmose humana e a forma infectante do agente. phenomenon elsewhere described and extensively discussed16. Achados de revisão sistemática

Results on affected or in risk populations were not surprising. The Toxoplasmose, infecção zoonótica altamente prevalente no mundo, é population data was proportional to the dispersion of the infective form transmitida pela ingestão de oocistos em água e solo ou cistos teciduais in the environment, with small groups in outbreaks ascribed to cysts or em carne crua ou mal cozida. Um debate em andamento é se há diferenças tachyzoites, which were related to a common and restricted food source, nas características clínicas e epidemiológicas de surtos devido a uma ou and large populations in dispersed outbreaks associated with water outra forma infectante do agente. Realizamos revisão sistemática a partir contamination. In our review, some clustered outbreaks were associated de 437 relatos de surtos da doença, selecionando 38 artigos completos with transmission by oocysts, due to contamination of a raw vegetable que descreveram a forma infectante do Toxoplasma com dados clínicos or cereal meal, as described elsewhere42. Those outbreaks allowed the e epidemiológicos. Não houve seleção por gênero ou faixa etária nos determination of the incubation period when the oocyst was the source surtos, descritos mais frequentemente nas Américas. Quantidade maior of T. gondii infection. de indivíduos foi afetada quando oocistos, associados com solo ou

374 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

água contaminados com fezes de gato, foram considerados a fonte de 12. de Moura L, Bahia-Oliveira LM, Wada MY, Jones JL, Tuboi SH, Carmo EH, et al. transmissão. O início dos sintomas ocorreu mais precocemente quando a Waterborne toxoplasmosis, Brazil, from field to gene. Emerg Infect Dis. 2006;12:326- 9. infecção foi atribuída a cistos na carne (11,4 ± 6,7 dias) com distribuição temporal nítida de casos, embora um aspecto mais amplo e prolongado 13. De Silva LM, Mulcahy DL, Kamath KR. A family outbreak of toxoplasmosis: a de novos casos foi observado quando oocistos na água foram a fonte de serendipitous finding. J Infect. 1984;8:163-7. infecção (20 ± 7 dias, p < 0.001). Essas informações podem ser úteis no desenvolvimento e implantação de estratégias de controle. 14. Demar M, Ajzenberg D, Maubon D, Djossou F, Panchoe D, Punwasi W, et al. Fatal outbreak of human toxoplasmosis along the Maroni River: epidemiological, clinical, and parasitological aspects. Clin Infect Dis. 2007;45:e88-95. ACKNOWLEDGEMENTS 15. Doganci L, Tanyuksel M, Araz ER, Besirbellioglu BA, Erdem U, Ozoguz CA, et al. A Authors affiliations: Institute of Tropical Medicine of São Paulo, probable outbreak of toxoplasmosis among boarding school students in Turkey. Clin University of São Paulo (Luciana R. Meireles, Claudio C.J. Ekman, Heitor Microbiol Infect. 2006;12:672-4.

F. Andrade Jr. & Expedito J.A. Luna) and School of Medicine, University 16. Dubey JP, Lago EG, Gennari SM, Su C, Jones JL. Toxoplasmosis in humans and animals of São Paulo (Heitor F. Andrade Jr.). All authors contributed equally in the in Brazil: high prevalence, high burden of disease, and epidemiology. Parasitology. design, execution and writing of this manuscript. The authors fail to find 2012;139:1375-424. any conflicts of interests in this work. This work was partially supported by grants from the Laboratório de Investigação Médica do Hospital das 17. Dubey JP, Lindsay DS, Speer CA. Structures of Toxoplasma gondii tachyzoites, bradyzoites, and sporozoites and biology and development of tissue cysts. Clin Clínicas da Faculdade de Medicina, USP (LIMHCFMUSP-49). We Microbiol Rev. 1998;11:267-99. gratefully thank the cooperation of the SIBI-USP staff for support during report recoveries. C. C. J. Ekman uses this work as part of his Tropical 18. Dubey JP. Advances in the life cycle of Toxoplasma gondii. Int J Parasitol. 1998;28:1019- Medicine M.Sc. degree. H. F. Andrade Jr. is a fellow from CNPq. 24.

19. Dubey JP. Comparative infectivity of oocysts and bradyzoites of Toxoplasma gondii for REFERENCES intermediate (mice) and definitive (cats) hosts. Vet Parasitol. 2006;140:69-75.

1. Balasundaram MB, Andavar R, Palaniswamy M, Venkatapathy N. Outbreak of acquired 20. Dubey JP. Toxoplasmosis - a waterborne zoonosis. Vet Parasitol. 2004;126:57-72. ocular toxoplasmosis involving 248 patients. Arch Ophthalmol. 2010;128:28-32. 21. Eduardo MBP, Katsuya EM, Ramos SRTS, Pavanello ORP, Brito SN, Madalosso G. 2. Benenson MW, Takafuji ET, Lemon SM. Oocyst-transmitted toxoplasmosis associated Investigação do surto de toxoplasmose associado ao consumo de prato à base de with ingestion of contaminated water. N Engl J Med. 1982;307:666-9. carne. crua (“steak tartar”), nos municípios de São Paulo e Guarujá, SP, Novembro de 2006. BEPA. 2007;4(41). [cited 2012 Set 14]. Available at: http://www.cve.saude. 3. Bonametti AM, Passos JN, da Silva EM, Bortoliero AL. Outbreak of acute toxoplasmosis sp.gov.br/agencia/bepa41_toxoplas.htm transmitted thru the ingestion of ovine raw meat. Rev Soc Bras Med Trop. 1996;30:21- 5. 22. Ekman CCJ, Chiossi MF, Meireles LR, Andrade Júnior HF, Figueiredo WM, Marciano MA, et al. Case-control study of an outbreak of acute toxoplasmosis in an industrial 4. Bowie WR, King AS, Werker DH, Isaac-Renton JL, Bell A, Eng SB, et al. Outbreak plant in the state of São Paulo, Brazil. Rev Inst Med Trop Sao Paulo. 2012;54:239-44. of toxoplasmosis associated with municipal drinking water. The BC Toxoplasma Investigation Team. Lancet. 1997;350:173-7. 23. Fertig A, Selwyn S, Tibble MJK. Tetracycline treatment in a food borne outbreak of toxoplasmosis. Br Med J. 1977;1(6068):1064. 5. Carellos EV, de Andrade GM, Vasconcelos-Santos DV, Januário JN, Romanelli RM, Abreu MN, et al. Adverse socioeconomic conditions and oocyst-related factors are 24. Gattás VL, Nunes EM, Soares ALB, Pires MA, Pinto PLS, de Andrade HF. Acute associated with congenital toxoplasmosis in a population-based study in Minas Gerais, toxoplasmosis outbreak at Campus of the University of Sao Paulo related to food or Brazil. PLoS One. 2014;9:e88588. water oocyst contamination. Annals of the International Conference on Emerging Infectious Diseases. Atlanta: Georgia; 2000. p. 135. 6. Carmo EL, Póvoa MM, Monteiro NS, Marinho RR, Nascimento JM, Freitas SN, et al. Surto de Toxoplasmose humana no Distrito de Monte Dourado, Município de 25. Higgins JPT, Green S. Cochrane handbook for systematic reviews of interventions Almeirim, Pará, Brasil. Rev Pan-Amaz Saude. 2010;1:61-6. Version 5.0.2 [updated September 2009]. London: The Cochrane Collaboration; 2009. Available at: http://www.cochrane-handbook.org 7. Center for Disease Control, Department of Health, Education and Welfare. Toxoplasmosis- Pennsylvania. MMWR.1975;24:85-6. 26. Humphreys H, Hillary IB, Kiernan T. Toxoplasmosis: a family outbreak. Ir Med J. 1986;79:191. 8. Chiari CA, Neves DP. Toxoplasmose humana adquirida através da ingestão de leite de cabra. Mem Inst Oswaldo Cruz. 1984;79:337-40. 27. Jones JL, Dargelas V, Roberts J, Press C, Remington JS, Montoya JG. Risk factors for Toxoplasma gondii infection in the United States. Clin Infect Dis. 2009;49:878-84. 9. Choi WY, Nam HW, Kwak NH, Huh W, Kim YR, Kang MW, et al. Foodborne outbreaks of human toxoplasmosis. J Infect Dis. 1997;175:1280-2. 28. Kean BH, Kimball AC, Christenson WN. An epidemic of acute toxoplasmosis. JAMA. 1969;208:1002-4. 10. Cook AJ, Gilbert RE, Buffolano W, Zufferey J, Petersen E, Jenum PA, et al. Sources of Toxoplasma infection in pregnant women: European multicentre case-control study. 29. Luft BJ, Remington JS. Acute Toxoplasma infection among family members of patients European Research Network on Congenital Toxoplasmosis. BMJ. 2000;321:142-7. with acute lymphadenopathic toxoplasmosis. Arch Intern Med.1984;144:53-6.

11. de Almeida MAB, de Alencar LR, do Carmo GMI, de Araújo WN, Garcia MHO, Reis 30. Madeira A, Búrigo MJ. Surto de toxoplasmose no município de Agronômica em Santa AKV, et al. Surto intra familiar de toxoplasmose, Santa Vitória do Palmar-RS, Julho Catarina. Estudos e Avaliação [Internet]. Florianópolis: Secretaria de Estado de de 2005. Boletim Eletrônico Epidemiológico. 2006. Available from: http://portalsaude. Saúde, s.d. [cited 2012 Sept 14]. Available from: http://www.dive.sc.gov.br/conteudos/ saude.gov.br/images/pdf/2014/julho/18/Ano06-n03-surto-familiar-toxoplasmose-rs- articulacao_tecnica/toxoplasmose-boletim-epidemiológico.pdf completo.pdf

375 MEIRELES, L.R.; EKMAN, C.C.J.; ANDRADE Jr, H.F. & LUNA, E.J.A. - Human toxoplasmosis outbreaks and the agent infecting form. Findings from a systematic review. Rev. Inst. Med. Trop. Sao Paulo. 57(5): 369-76,2015.

31. Magaldi C, Elkis H, Pattoli D, Coscina AL. Epidemic of toxoplasmosis at a university 38. Sacks JJ, Delgado DG, Lobel HO, Parker RL. Toxoplasmosis infection associated with in São-José-dos Campos, S.P. Brazil. 1. Clinical and serologic data. Rev Latinoam eating undercooked venison. Am J Epidemiol. 1983;118:832-8. Microbiol Parasitol (Mex). 1969;11:5-13. 39. Sacks JJ, Roberto RR, Brooks NF. Toxoplasmosis infection associated with raw goat’s 32. Masur H, Jones TC, Lempert JA, Cherubini TD. Outbreak of toxoplasmosis in a family milk. JAMA. 1982;248:1728-32. and documentation of acquired retinochoroiditis. Am J Med.1978;64:396-402. 40. Shenep JL, Barenkamp SJ, Brammeier SA, Gardner TD. An outbreak of toxoplasmosis 33. McDonald JC, Gyorkos TW, Alberton B, MacLean JD, Richer G, Juranek D. An outbreak on an Illinois farm. Pediatr Infect Dis.1984;3:518-22. of toxoplasmosis in pregnant women in northern Quebec. J Infect Dis. 1990;161:769- 74. 41. Skinner LJ, Timperley AC, Wightman D, Chatterton JMW, Ho-Yen DO. Simultaneous diagnosis of toxoplasmosis in goats and goatowner’s family. Scand J Infect Dis. 34. Minot S, Melo MB, Li F, Lu D, Niedelman W, Levine SS, et al. Admixture and 1990;22:359-61. recombination among Toxoplasma gondii lineages explain global genome diversity. Proc Natl Acad Sci USA. 2012;109:13458-63. 42. Stagno S, Dykes AC, Amos CS, Head RA, Juranek DD, Walls K. An outbreak of toxoplasmosis linked to cats. Pediatrics. 1980;65:706-12. 35. Palanisamy M, Madhavan B, Balasundaram M, Andavar R, Venkatapathy N. Outbreak of ocular toxoplasmosis in Coimbatore, India. Indian J Ophthalmol. 2006;54:129-31. 43. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: from animals to humans. Int J Parasitol. 2000;30:1217-58. 36. Renoiner EIM, Siqueira AA, Garcia MH, Alves RM, Cardoso ME, Ferreira ABPL, et al. Surto de toxoplasmose adquirida, Anápolis-GO, fevereiro de 2006. Boletim 44. Teutsch SM, Juranek DD, Sulzer A. Epidemic toxoplasmosis associated with infected Eletrônico Epidemiológico 2007. Available from: http://portalsaude.saude.gov.br/ cats. N Engl J Med. 1979;300:695-9. images/pdf/2014/julho/16/Ano07-n08-toxoplasmose-adquirida-go-completo.pdf Received: 16 March 2015 37. Robson JMB, Wood RN, Sullivan JJ, Nicolaides NJ, Lewis BR. A probable foodborne Accepted: 9 June 2015 outbreak of toxoplasmosis. Communicable Diseases Intelligence. 1995;19:517-22.

376 Rev. Inst. Med. Trop. Sao Paulo 57(5):377-383, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500002

NEW PRIMERS FOR DETECTION OF Leishmania infantum USING POLYMERASE CHAIN REACTION

Kézia Peres GUALDA(1), Lílian Mathias MARCUSSI(2), Herintha Coeto NEITZKE-ABREU(1,4), Sandra Mara Alessi ARISTIDES(3), Maria Valdrinez Campana LONARDONI(3), Rosilene Fressatti CARDOSO(3) & Thaís Gomes Verzignassi SILVEIRA(3)

SUMMARY

Leishmania infantum causes visceral leishmaniasis (VL) in the New World. The diagnosis of VL is confirmed by parasitological and serological tests, which are not always sensitive or specific. Our aim was to design new primers to perform a Polymerase Chain Reaction (PCR) for detecting L. infantum. Sequences of the minicircle kinetoplast DNA (kDNA) were obtained from GenBank, and the FLC2/RLC2 primers were designed. Samples of DNA from L. infantum, Leishmania amazonensis, Leishmania braziliensis, Leishmania guyanensis, Leishmania naiffi, Leishmania lainsoni, Leishmania panamensis, Leishmania major and Trypanosoma cruzi were used to standardize the PCR. PCR with FLC2/RLC2 primers amplified a fragment of 230 bp and the detection limit was 0.2 fg of L. infantum DNA. Of the parasite species assayed, only L. infantum DNA was amplified. After sequencing, the fragment was aligned to GenBank sequences, and showed (99%) homology with L. infantum. In the analysis of blood samples and lesion biopsy from a dog clinically suspected to have VL, the PCR detected DNA from L. infantum. In biopsy lesions from humans and dogs with cutaneous leishmaniasis, the PCR was negative. The PCR with FLC2/RLC2 primers showed high sensitivity and specificity, and constitutes a promising technique for the diagnosis of VL.

KEYWORDS: Visceral leishmaniasis; Polymerase Chain Reaction; Leishmania infantum; Diagnosis.

INTRODUCTION rapid diagnosis of disease, is more sensitive than conventional methods, and can help to identify the parasite species27,30. Another advantage is that Visceral leishmaniasis (VL) is an infectious, parasitic disease with a PCR can be performed in different biological samples, such as human worldwide distribution; India, Sudan, Nepal and Brazil account for 90% and canine blood, lymph nodes, buffy coat, canine conjunctival scrapings, of cases35. In the New World, VL is caused by Leishmania infantum (syn. urine and lesions10,12,16,17,21,24. Leishmania chagasi), and in Brazil there were 74,980 cases of VL from 1990 to 20137. VL is a severe and eventually lethal disease, and produces In view of the limitations of conventional methods, it is necessary to signs and symptoms common to other diseases, making its diagnosis standardize new methodologies for the diagnosis of VL. PCR has proven complex and time-consuming19. to be a valuable, rapid and sensitive tool, and can identify the parasite species in different clinical samples from humans, reservoirs and vectors. Confirmation of clinical suspicion of VL is based on clinical, The aim of this study was to design new primers to perform a PCR for epidemiological and laboratory tests. Among the conventional diagnostic detecting L. infantum. methods for confirmation of VL are parasitological and serological tests8. Parasitological examination can directly demonstrate the presence of MATERIAL AND METHODS L. infantum in aspirates from the liver, spleen, lymph nodes and bone marrow. However, due to the low sensitivity of direct microscopic Design of oligonucleotides: The specific forward and reverse PCR examination many patients do not receive confirmation of the diagnosis2. primers FLC2 (5’-GTCAGTGTCGGAAACTAATCCGC-3’) and RLC2 The serological tests include the indirect immunofluorescence assay (5’-GGGAAATTGGCCTCCCTGAG-3’) were designed to amplify a 230 (IFA) and enzyme-linked immunosorbent assay (ELISA)3,14. However, bp segment of the conserved region of the DNA minicircle kinetoplast these techniques may produce false negative results and cross-reactions (kDNA) of L. chagasi [GenBank:AF308682 LOCUS] with 716 bp (Fig. with other diseases13,20. 1). The used sequence to design the primers was analyzed by CLUSTAL W (www.ebi.ac.uk) and primer-BLAST 2.0 server (“Basic Alignment Molecular biology techniques have been proposed as an alternative Search Tool”) of the National Center for Biotechnology Information in the diagnosis of VL. The Polymerase Chain Reaction (PCR) enables (NCBI) to detect their specificity to the proposed PCR template.

(1) Universidade Estadual de Maringá, Programa de Pós-Graduação em Ciências da Saúde, Maringá, PR, Brasil (2) Universidade Estadual de Maringá, Programa de Pós-Graduação em Biociências e Fisiopatologia, Maringá, PR, Brasil (3) Universidade Estadual de Maringá, Departamento de Análises Clínicas e Biomedicina, Maringá, PR, Brasil (4) Present address: Universidade Federal da Grande Dourados, Faculdade de Ciências da Saúde, Dourados, MS, Brasil. Correspondence to: Thaís Gomes Verzignassi Silveira, Laboratório de Leishmanioses, Departamento de Análises Clínicas e Biomedicina, Universidade Estadual de Maringá, Av. Colombo 5790, 87020-900 Maringá, PR, Brasil. Phone: 55.44.3011-4878. E-mail: [email protected]. GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

human urine, 10% fetal-calf serum (Invitrogen, Paisley, Scotland, UK) and 2 mM L-glutamine (Gibco-BR, Paisley, Scotland, UK), at 25 °C in a B.O.D. incubator (Logen Scientific, Brazil). Epimastigotes of T. cruzi were grown in LIT (Liver Infusion Tryptose) at 25 °C. The parasites were washed by centrifugation at 1,600 g for 10 min with phosphate-buffered saline (PBS) pH 7.2. Parasites were counted in a Neubauer chamber and stored at -18 °C until DNA extraction.

DNA preparation: The DNA from scrapings of skin lesions was extracted according to VENAZZI et al.33 and from the canine lesion biopsy was extracted with a Puregene kit (Gentra, USA). The DNA from Fig. 1 - Leishmania chagasi kinetoplast minicircle DNA, complete sequence (GenBank: blood was extracted with guanidine isothiocyanate and phenol34 and the AF308682 LOCUS) with 716 bp and the primers localization. The underlined bold sequences DNA from Leishmania isolated from hamsters was obtained by heating22. represent the FLC2/RLC2 primers. The DNA of Leishmania spp. and T. cruzi was extracted with guanidine isothiocyanate and phenol34. The DNA was re-suspended in 50 µL of TE

Clinical samples: The sensitivity and specificity of primers FLC2/ buffer (1 M Tris, 0.5 M Na2EDTA, pH 8.0) and stored at -18 °C until use. RLC2 were analyzed in clinical samples: lesion biopsy and blood from a dog with clinical suspicion of VL, lesions biopsies from three dogs with The DNA samples were quantified by fluorometry using a Quant-iT™ cutaneous leishmaniasis, and five samples obtained by scraping the edge dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and a Qubit™ of lesions from humans with cutaneous leishmaniasis. The samples were Fluorometer Kit (Invitrogen, USA). placed in eppendorf vials with 50 μL STE buffer (10 mM TRIS, 1 mM EDTA, 0.1 M NaCl, pH 8.0) and stored at -20 ºC for later DNA extraction. Polymerase Chain Reaction: For PCR standardization, some The present study received approval from the Permanent Committee for conditions were tested. The reaction mixture contained 0.5 µM of each Ethics in Research involving Humans (Process No. 533/2009) of the primer (Invitrogen Life Technologies, Sao Paulo, Brazil), 0.2 mM dNTP Universidade Estadual de Maringá. All participants were informed about (Invitrogen, Carlsbad, CA, USA), 1 U Taq DNA polymerase (Invitrogen the importance and objectives of the study, and were assured of both Life Technologies, Sao Paulo, Brazil), 1.5 or 2.0 mM MgCl2, 1X enzyme anonymity and confidentiality. We obtained written informed consent buffer and 2 μL of the DNA sample in a final volume of 25 μL. Ultrapure from patients who agreed to participate. All procedures involving humans water was used as a negative control. Amplification was performed in a were conducted according to protocols approved by the National Health thermocycler (Biometra Personal Cycler, Germany) under the following Council of the Brazilian Ministry of Health (Resolution No. 196/1996). conditions: initial denaturation at 95 °C for five min, followed by 30 or 35 cycles of one min at 95 °C, one min at 56 °C or 58 oC and one min at An aliquot of 2 mL of dog blood was added to an equal volume 72 °C. After 10 min at 72 °C, the amplified material was maintained at 4 of ACD solution (25 mM citric acid, 50 mM sodium citrate, 81 mM °C until analysis. The amplified product was analyzed by electrophoresis glucose), and centrifuged at 3,500 g for 10 min. The buffy coat was then in 2% agarose gel (Invitrogen, Paisley, Scotland, UK) at 10-15 V/cm. removed and added to a tube containing ACD and stored at -20 ºC for The gel was stained with ethidium bromide and analyzed under UV later DNA extraction. light in a transilluminator (MacroVue™ UV-20, Hoefer). A 100 bp DNA ladder (Invitrogen Life Technologies, São Paulo, Brazil) was used as a Two hamsters were inoculated in the footpad with 50 µL of Leishmania molecular marker. culture from a lesion and venous blood of a dog with clinical suspicion of VL. After seven months, the hamsters were euthanized, and material from Analysis of the sensitivity and specificity of FLC2/RLC2 primers their regional lymph node was placed in culture medium for the isolation in parasites: Assessment of PCR sensitivity (FLC2/RLC2 primers) of the parasite and later DNA extraction. All procedures involving animals was performed using DNA extracted from L. infantum (MHOM/ followed the Ethical Principles of Animal Experimentation established BR/1974/PP75) at concentrations of 200 ng to 0.002 fg. To determine by the Brazilian College of Animal Experimentation (COBEA) and were the specificity, DNA (100 pg) from different species of Leishmania, performed according to protocols approved by the Committee for Ethical two strains of L. infantum, and T. cruzi were analyzed (Table 1). DNA Conduct in Animal Experimentation of the Universidade Estadual de (100 pg) from L. braziliensis (serodemes I, II, III and VII) obtained Maringá (report 015/2007 on 04/03/2007). from patients in northwestern Paraná and identified by reactivity with monoclonal antibodies at the Instituto Evandro Chagas (Belém, Pará, Parasites: L. infantum, Leishmania amazonensis, Leishmania Brazil) was also analyzed. braziliensis, Leishmania guyanensis, Leishmania naiffi, Leishmania lainsoni, Leishmania panamensis, Leishmania major and Trypanosoma Analysis of the sensitivity and specificity of primers FLC2/RLC2 cruzi (Y strain) were employed for assessing the specificity and sensitivity in clinical samples: DNA samples from the blood and lesion of a dog of PCR. Samples of L. braziliensis from different serodemes obtained with clinical suspicion of VL, living in a VL-endemic area, and DNA from dogs and humans in the northwestern of the Parana State were also extracted from Leishmania isolated from hamsters that were inoculated analyzed (Table 1). with lesions and blood from a dog with clinical suspicion of VL were analyzed to assess the sensitivity of the primers. Promastigotes of Leishmania spp. were grown in Medium 199 (Invitrogen, Paisley, Scotland, UK) supplemented with 1% female DNA samples from lesions of five humans and three dogs, all with a

378 GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

Table 1 Parasite species used in the study

Species Isolates International Code Sample Source Leishmania (Viannia) braziliensis - serodeme I M14405 MHOM/BR/1993/M14405 1 Leishmania (Viannia) braziliensis - serodeme II M15490 MHOM/BR/1995/1077 1 Leishmania (Viannia) braziliensis - serodeme III M14046 MHOM/BR/1992/M14046 1 Leishmania (Viannia) braziliensis - serodeme VII M20932 MHOM/BR/2002/M20932 1 Leishmania (Viannia) braziliensis - serodeme I M11272 MHOM/BR/1987/M11272 1 Leishmania (Viannia) braziliensis - serodeme I M20171 CAN/BR/2001/M20171 7 Leishmania (Viannia) braziliensis M2903 MHOM/BR/1975/M2903 2 Leishmania (Leishmania) infantum CUR392 MCAN/BR/2010/CUR392 3 Leishmania (Leishmania) infantum PP75 MHOM/BR/1974/PP75 4 Leishmania (Leishmania) infantum L2906 MHOM/BR/2002/LPC-RPV 6 Leishmania (Leishmania) amazonensis M2269 MHOM/BR/1973/M2269 2 Leishmania (Viannia) lainsoni M6426 MHOM/BR/1981/M6426 2 Leishmania (Viannia) panamensis M4037 MHOM/PA/1967/BOYTON 2 Leishmania (Viannia) naiffi M5533 MDAS/BR/1979/M5533 2 Leishmania (Leishmania) major LV39 MRHO/SU/1959/P 2 Leishmania (Viannia) guyanensis M4147 MHOM/BR/1975/M4147 2 Trypanosoma cruzi Y strain 5 1: Isolates from humans with cutaneous leishmaniasis attended at Laboratório de Ensino e Pesquisa em Análises Clínicas, Universidade Estadual de Maringá, Maringá, Paraná and identified at Instituto Evandro Chagas, Belém, Pará. 2: Provided by Dr. Jeffrey J. Shaw, Instituto Evandro Chagas. 3: Provided by Dra. Vanete T. Soccol, Universidade Federal do Paraná, Curitiba, Paraná. 4: Provided by Dr. Carlos H. N. Costa, Instituto de Doenças Tropicais Natan Portella, Universidade Federal do Piauí, Teresina, Piauí. 5: Provided by Dr. Mônica L. Gomes, Departamento de Ciências Básicas da Saúde, Universidade Estadual de Maringá, Maringá, Paraná. 6: Provided by Collection of Leishmania (CLIOC), Instituto Oswaldo Cruz. 7:Isolate from dog with cutaneous leishmaniasis attended at Laboratório de Ensino e Pesquisa em Análises Clínicas da Universidade Estadual de Maringá, Maringá, Paraná and identified at Instituto Evandro Chagas, Belém, Pará. confirmed diagnosis of cutaneous leishmaniasis [direct parasite search, that produced a single sequence kDNA. The single sequence was aligned IFA and PCR Leishmania (Viannia)] were also analyzed to verify the using the primer-BLAST 2.0 server of the NCBI. specificity of the primers. The PCR Leishmania (Viannia) was carried out using the MP3H and MP1L primers that amplify a fragment of 70 bp RESULTS of the conserved region of DNA from the minicircle of the kinetoplast 18 (kDNA) of the subgenus Leishmania (Viannia) . Initially, the conditions for the PCR, including the MgCl2 concentration, the number of cycles, and the annealing temperature for the Sequencing reaction: For the sequencing reaction, PCR products primers were optimized. The annealing temperatures tested were based from two strains of L. infantum (MHOM/BR/1974/PP75 and MHOM/ on the GC content and length of the FLC2/RLC2 primers. The condition BR/2002/LPC-RPV) were purified (Axygen Kit) and quantified using in which only one fragment was amplified was chosen. The reaction the Nanodrop Spectrophotometer (NanoDrop Technologies, Inc., mixture contained 0.5 µM of each primer, 1 U Taq DNA polymerase,

Wilmington, DE, USA). Samples were diluted to a concentration of 4 2.0 mM MgCl2, 1X enzyme buffer and 2 μL of the DNA sample in a final ng/µL. For sequencing, 1 µL of Big Dye Terminator v3.1, 0.4x dilution volume of 25 μL. Amplification was performed at 95 °C for five min, buffer, 0.4 mM of each primer (forward and reverse), and 2 µL of sample, 35 cycles of one min at 95 °C, one min at 56 °C and one min at 72 °C, totaling 10 µL of reaction volume were used. The reaction was carried out followed by 10 min at 72 °C. in an Applied Biosystems Thermal Cycler, with 1 cycle at 96° C for one min, followed by 30 cycles at 96° C for 15 sec, 56 °C for 15 sec and 60 With regard to the sensitivity of the PCR, the FLC2/RLC2 primers °C for four min, and stored at 4 °C overnight. The sequencing product was amplified a DNA segment of 230 bp in the presence of quantities of DNA precipitated and purified with ethanol/EDTA according to the protocol. template equal to or greater than 0.2 fg (Fig. 2). Next, it was re-suspended in 10 µL of formamide, and sequenced in an ABI 3500XL automated sequencer (Applied Biosystems). Analysis of DNA from different species of Leishmania (100 pg) and T. cruzi (100 pg) showed that only a 230 bp fragment from L. Alignment of sequences: Sense and anti-sense strand sequences of infantum was amplified. No fragment was observed with DNA of the kDNA obtained were examined in the DNAstar Lasergene SeqMan L. braziliensis isolated from dogs and humans (100 pg). In all PCR v.7.00 package, which produced a consensus strand for each sample. The analyses performed in this study, only L. infantum samples showed sequences were aligned using the software MEGA 532 for each sample the 230 bp expected amplification product indicating that there was no

379 GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

Fig. 2 - Gel showing the analytical sensitivity of the 230 bp fragment of the kDNA of Leishmania infantum. The PCR with FLC2/RLC2 primers was carried out using as template the serially diluted DNA extracted from promastigotes of L. infantum (MHOM/BR/1974/ PP75). M, 100 bp molecular marker. contamination or reaction inhibition (Fig. 3). Analysis of DNA samples from different human patients with a confirmed diagnosis (Fig. 4A) of cutaneous leishmaniasis indicated that the primers showed specificity for L. infantum. Figure 4B shows the specificity of the primers in DNA samples from lesions of dogs diagnosed with cutaneous leishmaniasis (parasitological, serological and molecular diagnoses) and a DNA sample from the blood and lesion of a dog with clinically suspected VL.

The specificity of the FLC2/RLC2 primers for different isolates of L. infantum was also analyzed (Fig. 4C). DNA of promastigotes isolated from two hamsters inoculated with the blood and lesion of a dog with clinical suspicion of VL showed an amplified fragment of 230 bp. The DNA from another strain of L. infantum also showed this fragment.

No false positive result or inhibition of the reaction was observed in the controls.

After the two samples were sequenced, the consensus strands containing 230 bp were identical, and the sequence alignment to GenBank Fig. 3 - Gel showing specificity of the 230 bp fragment of the kDNA of Leishmania infantum. sequences showed homology with L. chagasi (99%), L. infantum, and The PCR with FLC2/RLC2 primers was carried out using as template the DNA extracted L. donovani (89%) (Fig. 5). from promastigotes of Leishmania species (100 pg), epimastigotes of T. cruzi (100 pg) and L. braziliensis isolates from humans and dogs (100 pg). kDNA, kinetoplast DNA; M, 100 bp molecular marker. Panel A. Lane 1: L. amazonensis; Lane 2: L. lainsoni; Lane 3: L. DISCUSSION panamensis; Lane 4: L. guyanensis; Lane 5: L. braziliensis (MHOM/BR/1987/M11272); Lane 6: L. infantum (MHOM/BR/1974/PP75); Lane 7: negative control (water). Panel B. Lane 1: In endemic areas where it is possible to find patients with different L. naiffi; Lane 2: L. major; Lane 3: T. cruzi; Lane 4: L. infantum (MHOM/BR/1974/PP75); forms of leishmaniasis, detecting the correct parasite species of the genus Lane 5: negative control (water). Panel C. Lane 1: L. braziliensis (CAN/BR/2001/M20171) Leishmania in a clinical sample is very important to confirm a suspected isolated from dog (serodeme I); Lane 2: L. braziliensis (MHOM/BR/1993/M14405) isolated case of visceral or cutaneous leishmaniasis. Although no autochthonous from human (serodeme I); Lane 3: L. braziliensis isolated from human (serodeme II); Lane cases of VL have been found in Parana, the neighboring states of Sao 4: L. braziliensis isolated from human (serodeme III); Lane 5: L. braziliensis isolated from Paulo and Mato Grosso do Sul are endemic areas for VL. Therefore, human (serodeme VII); Lane 6: L. braziliensis (MHOM/BR/1987/M11272) isolated from it is necessary to standardize methodologies that allow rapid and safe human (serodeme I); Lane 7: L. infantum (MHOM/BR/1974/PP75). diagnosis of VL, as well as for disease control. standardization of PCR with FLC2/RLC2 primers showed high specificity A number of molecular techniques for the identification of Leishmania and sensitivity, confirming the results obtained in the primer-BLAST 2.0 have been reported, such as RFLP-PCR (restriction fragment length software of the NCBI. polymorphism-PCR)6,29, RAPD (random amplified polymorphic DNA)5,26 and multiplex-PCR. Although these methods require technical skills The sensitivity obtained (0.2 fg) was similar to the related by of professional and equipped laboratories in their implementation, the OLIVEIRA et al.25 (2 fg) and DE BRUJIN & BARKER11 (1 fg) but it continuing search for specific targets, safer and faster molecular diagnosis was higher than the one related by SILVEIRA NETO et al.31 (1 pg/µL) in seems to be more advantageous than using conventional techniques. a PCR for L. infantum. The high sensitivity was checked by the positive results obtained with low concentrations of DNA from L. infantum, The application of PCR in the identification of L. infantum has demonstrating the ability to detect parasite DNA in peripheral blood great potential as a valuable tool in the detection of parasite DNA. and lesions, even in situations where the number of parasites is low. PCR can identify the species of parasite involved, and is more sensitive The primers were specific for L. infantum, since they amplify a 230 bp than microscopy and serology1,28. Under the conditions used here, the fragment of DNA only from L. infantum. The several different species

380 GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

and 95.5% in asymptomatic dogs. According to QUARESMA et al.29, in canine visceral leishmaniasis (CVL), PCR can detect infection even when conventional tests fail to diagnose the disease. QUARESMA et al.29 suggested PCR as a method for detection of CVL since it is highly reliable, sensitive and reproducible, requires a relatively short time for assay, and can turn into a valuable tool for epidemiological surveillance in endemic areas.

ANTINORI et al.4 compared conventional tests with PCR on peripheral blood samples and bone-marrow aspirates from patients with VL who were infected, or not, with HIV, and reported that PCR showed 98.5% sensitivity in peripheral blood and 95.7% in bone-marrow aspirates. ALAM et al.1 performed PCR on DNA extracted from blood collected on filter paper, and detected parasites in 38 of 39 samples tested, in contrast to direct microscopy, which gave positive results for only 66.7% of the samples. BRUSTOLONI et al.9 extracted DNA from histological sections of patients with positive parasitological diagnoses for VL, and the PCR showed 94.8% sensitivity.

In this study, PCR with FLC2/RLC2 primers proved to be a reliable tool for the detection of DNA from L. infantum. Showing high sensitivity and specificity, PCR with FLC2/RLC2 primers detected the parasite in clinical samples of peripheral blood and lesions. In addition, this method does not involve laborious, invasive or complex procedures.

RESUMO

Novos iniciadores para detecção de Leishmania infantum pela reação em cadeia da polimerase

Leishmania infantum causa leishmaniose visceral (LV) no Novo Mundo. O diagnóstico de LV é confirmado por testes parasitológicos e Fig. 4 - Gel showing the specificity of the 230 bp fragment of the kDNA of Leishmania infantum sorológicos, os quais nem sempre são sensíveis ou específicos. Nosso in clinical samples. The PCR with FLC2/RLC2 primers was carried out using as template the objetivo foi desenhar novos iniciadores para realizar uma Reação em DNA extracted from clinical samples. kDNA, kinetoplast DNA; M, 100 bp molecular marker. Cadeia da Polimerase (PCR) para detecção de L. infantum. Sequências do Panel A. Lanes 1, 2, 3, 4 and 5: DNA from lesions in different humans with confirmed diagnosis DNA do minicírculo do cinetoplasto (kDNA) foram obtidos do GenBank, of cutaneous leishmaniasis (parasitological, serological and molecular diagnoses); Lane 6: e os iniciadores FLC2/RLC2 foram desenhados. Amostras de DNA de L. L. braziliensis (MHOM/BR/1987/M11272); Lane 7: L. infantum (MHOM/BR/1974/PP75). infantum, Leishmania amazonensis, Leishmania braziliensis, Leishmania Panel B. Lane 1: DNA from the lesion of a dog with clinical suspicion of VL; Lane 2: DNA from the blood sample of a dog clinically suspected to have VL; Lanes 3, 4 and 5: DNA from guyanensis, Leishmania naiffi, Leishmania lainsoni, Leishmania lesions of different dogs with confirmed diagnosis of cutaneous leishmaniasis (parasitological, panamensis, Leishmania major e Trypanosoma cruzi foram usados serological and molecular diagnoses); Lane 6: L. braziliensis (MHOM/BR/1987/M11272); para padronizar a PCR. PCR com iniciadores FLC2/RLC2 amplificou Lane 7: L. infantum (MHOM/BR/1974/PP75). Panel C. Lane 1: DNA from promastigotes um fragmento de 230 pb e detectou 0,2 fg de DNA de L. infantum. isolated from a hamster inoculated with tissues from the lesion of a dog with clinical suspicion Das espécies de parasitos analisadas, somente DNA de L. infantum of VL (Isolate I); Lane 2: DNA from promastigotes isolated from a hamster inoculated with the foi amplificado. Após sequenciamento, o fragmento foi analisado no blood sample of a dog with clinical suspicion of VL (Isolate II); Lane 3: L. infantum (MCAN/ GenBank, que mostrou homologia com L. infantum. Em análises de BR/2010/CUR392); Lane 4: L. infantum (MHOM/BR/1974/PP75). amostras de sangue e lesão de cão com suspeita clínica de LV, a PCR detectou DNA de L. infantum. Em amostras de lesão de humanos e cães of Leishmania and serodemes of L. braziliensis tested did not show com leishmaniose cutânea, a PCR foi negativa. A PCR padronizada com any amplification. The sequenced fragment showed homology with the os iniciadores FLC2/RLC2 mostrou alta sensibilidade e especificidade, L. chagasi (99%), L. infantum and L. donovani (89%) available in the sendo técnica promissora para o diagnóstico de LV. GenBank. The high specificity of the FLC2/RLC2 primers could also be seen in the clinical samples from dogs and humans diagnosed with ACKNOWLEDGMENTS cutaneous leishmaniasis. Kézia Peres Gualda performed the experiments, participated in the MOREIRA et al.23 compared the effectiveness of parasitological, sequence alignment, analyzed the data, and drafted the manuscript. Lílian immunological and molecular methods for diagnosing dogs with different Mathias Marcussi performed the experiments. Herintha Coeto Neitzke- clinical signs of VL. In samples of lymph-node aspirates from dogs, PCR Abreu performed the experiments, analyzed the data, participated in the showed 100% sensitivity in symptomatic, 96% in mildly symptomatic, sequence alignment, and drafted the manuscript. Sandra Mara Alessi

381 GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

Fig. 5 - Alignment of PCR product obtained showing homology with DNA minicircle kinetoplast (kDNA) of isolates from GenBank. Including L. chagasi (GenBank accession No. AF308682.1|AF308682), L. infantum strain IranJWinf (GenBank accession No. AB678348.1), L. infantum strain MCAN/ES/98/10445 (GenBank accession No. EU437407.1) and L. donovani (GenBank accession No. L19877.1), respectively. Underlined nucleotides represent additional bases and bolded positions represent different bases.

Aristides participated in the design of the study. Maria Valdrinez Campana 7. Brasil. Ministério da Saúde. Casos confirmados de leishmaniose visceral, Brasil, grandes Lonardoni participated in the design of the study. Rosilene Fressatti regiões e unidades federadas, 1990 a 2013. [cited 2014 Sept 10]. Available from: http://portalsaude.saude.gov.br/images/pdf/2014/setembro/09/LV-Casos.pdf Cardoso participated in the design of the study, in the sequence alignment, and analyzed the data. Thaís Gomes Verzignassi Silveira participated in 8. Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Leishmaniose visceral the design and coordination of the study, analyzed the data, and drafted grave: normas e condutas. Brasília: Ministério da Saúde; 2006. the manuscript. All authors read and approved the final manuscript. 9. Brustoloni YM, Lima BR, da Cunha VR, Dorval ME, Oshiro ET, de Oliveira ALL, et al. Sensitivity and specificity of polymerase chain reaction in Giemsa-stained The authors would like to thank the Complexo de Centrais de slides for diagnosis of visceral leishmaniasis in children. Mem Inst Oswaldo Cruz. Apoio à Pesquisa (COMCAP-UEM) for their collaboration in the use 2007;102:497-500. of equipments. The study received financial support from the Fundação Araucária and the Conselho Nacional de Desenvolvimento Científico e 10. Cascio A, Calattini S, Colomba C, Scalamogna C, Galazzi M, Pizzuto M, et al. Polymerase Tecnológico (CNPq - award number 410550/2006-0). chain reaction in the diagnosis and prognosis of Mediterranean visceral leishmaniasis in immunocompetent children. Pediatrics. 2002;109:E27.

REFERENCES 11. De Brujin MHL, Barker DC. Diagnosis of New World leishmaniasis: specific detection of species of the L. braziliensis complex by amplification of kinetoplast DNA. Acta 1. Alam MZ, Shamsuzzaman AK, Kuhls K, Schõnian G. PCR diagnosis of visceral Trop. 1992;52:45-58. leishmaniasis in an endemic region, Mymensingh district, Bangladesh. Trop Med Int Health. 2009;14:499-503. 12. de Queiroz NMGP, da Silveira RCV, de Noronha ACF Jr, Oliveira TMFS, Machado RZ, Starke-Buzetti WA. Detection of Leishmania (L.) chagasi in canine skin. Vet Parasitol. 2. Al-Jawabreh A, Schoenian G, Hamarsheh O, Presber W. Clinical diagnosis of cutaneous 2011;178:1-8. leishmaniasis: a comparison study between standardized graded direct microscopy and ITS1- PCR of Giemsa-stained smears. Acta Trop. 2006;99:55-61. 13. Ferreira EC, de Lana M, Carneiro M, Reis AB, Paes DV, Silva ES, et al. Comparison of serological assays for the diagnosis of canine visceral leishmaniasis in animals 3. Alvar J, Cañavate C, Molina R, Moreno J, Nieto J. Canine leishmaniasis. Adv Parasitol. presenting different clinical manifestations. Vet Parasitol. 2007;146:235-41. 2004;57:1-88. 14. Gradoni L. The diagnosis of canine leishmaniasis. In: Canine leishmaniasis: moving 4. Antinori S, Calattini S, Longhi E, Bestetti G, Piolini R, Magni C, et al. Clinical use of towards a solution. Proceedings of the Second International Canine Leishmaniasis polymerase chain reaction performed on peripheral blood and bone marrow samples Forum: 6-9 February 2002. Sevilla: Intervet International; 2002. p. 7-14. for the diagnosis and monitoring of visceral leishmaniasis in HIV-infected and HIV uninfected patients: a single-center, 8-year experience in Italy and review of the 15. Harris E, Kropp G, Belli A, Rodriguez B, Agabian N. Single-step multiplex PCR literature. Clin Infect Dis. 2007;44:1602-10. assay for characterization of New World Leishmania complexes. J Clin Microbiol. 1998;36:1989-95. 5. Baptista C, Schubach AO, Madeira MF, Leal CA, Pires MQ, Oliveira FS, et al. Leishmania (Viannia) braziliensis genotypes identified in lesions of patients with atypical or 16. Lachaud L, Chabbert E, Dubessay P, Reynes J, Lamothe J, Bastien P. Comparison of typical manifestations of tegumentary leishmaniasis: evaluation by two molecular various sample preparation methods for PCR diagnosis of visceral leishmaniasis markers. Exp Parasitol. 2009;121:317-22. using peripheral blood. J Clin Microbiol. 2001;39:613-7.

6. Botilde Y, Laurent T, Tintaya WQ, Chicharro C, Cañavate C, Cruz I, et al. Comparison 17. Lachaud L, Marchergui-Hammani S, Chabbert E, Dereure J, Dedet JP, Bastien P. of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol. Comparison of six PCR methods using peripheral blood for detection of canine 2006;6:440-6. visceral leishmaniasis. J Clin Microbiol. 2002;40:210-5.

382 GUALDA, K.P.; MARCUSSI, L.M.; NEITZKE-ABREU, H.C.; ARISTIDES, S.M.A.; LONARDONI, M.V.C.; CARDOSO, R.F. & SILVEIRA, T.G.V. - New primers for detection of Leishmania infantum using polymerase chain reaction. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 377-83, 2015.

18. Lopez M, Ingá R, Cangalaya M, Echevarria J, Llanos-Cuentas A, Orrego C, et al. Diagnosis 27. Oshaghi MA, Ravasan MH, Hide M, Javadian E-A, Rassi Y, Sedaghat MM, et al. of Leishmania using the polymerase chain reaction: a simplified procedure for field Development of species-specific PCR and PCR-restriction fragment length work. Am J Trop Med Hyg. 1993;49:348-56. polymorphism assays for L. infantum/L. donovani discrimination. Exp Parasitol. 2009;122:61-5. 19. Luz ZMP, Carneiro M, Schall V, Rabello A. The organization of health services and visceral leishmaniasis: an integrated intervention to improve diagnosis and treatment. 28. Ozerdem D, Eroglu F, Genc A, Demirkazik M, Koltas IS. Comparison of microscopic Cad Saude Publica. 2009;25:1177-84. examination, rK39 and PCR for visceral leishmaniasis diagnosis in Turkey. Parasitol Res. 2009;106:197-200. 20. Maia C, Campino L. Methods for diagnosis of canine leishmaniasis and imune response to infection. Vet Parasitol. 2008;158:274-87. 29. Quaresma PF, Murta SMF, Ferreira EC, da Rocha-Lima ACVM, Xavier AAP, Gontijo CMF. Molecular diagnosis of canine visceral leishmaniasis: identification of 21. Manna L, Vitale F, Reale S, Caracappa S, Pavone LM, Morte RD, et al. Comparison of Leishmania species by PCR-RFLP and quantification of parasite DNA by real-time different tissue sampling for PCR based diagnosis and follow-up of canine visceral PCR. Acta Trop. 2009;111:289-94. leishmaniosis. Vet Parasitol. 2004;125:251-62. 30. Reithinger R, Dujardin JC. Molecular diagnosis of leishmaniasis: current status and future 22. Marcussi VM, Marcussi LM, Barbosa-Tessmann IP, Lonardoni MVC, Silveira TGV. applications. J Clin Microbiol. 2007;45:21-5. Leishmania (Viannia) braziliensis: new primers for identification using polymerase chain reaction. Exp Parasitol. 2008;120:300-5. 31. Silveira Neto OJ, Duarte SC, Costa HX, Linhares GFC. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR. 23. Moreira MAB, Luvizotto MCR, Garcia JF, Corbett CEP, Laurenti MD. Comparison Rev Bras Parasitol Vet. 2012;21:304-7. of parasitological, immunological and molecular methods for the diagnosis of leishmaniasis in dogs with different clinical signs. Vet Parasitol. 2007;145:245-52. 32. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, volutionary distance, and 24. Motahareh M, Fakhar M, Motazedian MH, Hatam G, Mikaeili F. A urine-based polymerase maximum parsimony methods. Mol Biol Evol. 2011;28:2731-9. chain reaction method for the diagnosis of visceral leishmaniasis in immunocompetent patients. Diagn Microbiol Infect Dis. 2008;60:151-4. 33. Venazzi EAS, Roberto ACBS, Barbosa-Tessmann IP, Zanzarini PD, Lonardoni MVC, Silveira TGV. Polymerase chain reaction with lesion scrapping for the diagnosis of 25. Oliveira DM, Lonardoni MVC, Teodoro U, Silveira TGV. Comparison of different primes human American tegumentary leishmaniasis. Mem Inst Oswaldo Cruz. 2006;101:427- for PCR-based diagnosis of cutaneous leishmaniasis. Braz J Infect Dis. 2011;15:204- 30. 10. 34. Venazzi EAS, Roberto ACBS, Barbosa-Tessmann IP, Zanzarini PD, Lonardoni MVC, 26. Oliveira JP, Fernandes F, Cruz AK, Trombela V, Monteiro E, Camargo AA, et al. Genetic Silveira TGV. Detection of Leishmania (Viannia) DNA in blood from patients with diversity of Leishmania amazonensis strains isolated in northeastern Brazil as revealed American cutaneous leishmaniasis. Exp Parasitol. 2007;115:399-402. by DNA sequencing, PCR-based analyses and molecular karyotyping. Kinetoplastid Biol Dis. 2007;6:5. 35. World Health Organization. Leishmaniasis. Available from: http://goo.gl/PiM9n

Received: 15 September 2014 Accepted: 16 January 2015

383 Revista do Instituto de Medicina Tropical de São Paulo on line.

Publications from 1984 to the present data are now available on: http://www.scielo.br/rimtsp PAST ISSUES FROM 1959 ON (PDF) www.imt.usp.br/portal/

SciELO – The Scientific Electronic Library OnLine - SciELO is an electronic virtual covering a selected collection of Brazilian scientific journals. The library is an integral part of a project being developed by FAPESP – Fundação de Amparo à Pesquisa do Estado de São Paulo, in partnership with BIREME – the Latin American and Caribbean Center on Health Sciences Information. SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a search by word of serial titles, publisher names, city of publication and subject. The interface also provides access to the full text of articles via author index or subject index or a search form on article elements such as author names, words from title, subject and words from full text.

FAPESP/BIREME Project on Scientific Electronic Publications Latin American and Caribbean Center on Health Sciences Information Rua Botucatu 862 – 04023-901 São Paulo, SP – Brazil Tel. (011) 5576-9863 [email protected] Rev. Inst. Med. Trop. Sao Paulo 57(5):385-392, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500003

ADENOSINE DEAMINASE ACTIVITY AND SERUM C-REACTIVE PROTEIN AS PROGNOSTIC MARKERS OF CHAGAS DISEASE SEVERITY

Iván Darío BRAVO-TOBAR(1), Carlota NELLO-PÉREZ(1), Alí FERNÁNDEZ(2), Nora MOGOLLÓN(1), Mary Carmen PÉREZ(1), Juan VERDE(3), Juan Luis CONCEPCIÓN(4), Claudina RODRIGUEZ-BONFANTE(3) & Rafael BONFANTE-CABARCAS(1)

SUMMARY

Chagas disease is a public health problem worldwide. The availability of diagnostic tools to predict the development of chronic Chagas cardiomyopathy is crucial to reduce morbidity and mortality. Here we analyze the prognostic value of adenosine deaminase serum activity (ADA) and C-reactive protein serum levels (CRP) in chagasic individuals. One hundred and ten individuals, 28 healthy and 82 chagasic patients were divided according to disease severity in phase I (n = 35), II (n = 29), and III (n = 18). A complete medical history, 12-lead electrocardiogram, chest X-ray, and M-mode echocardiogram were performed on each individual. Diagnosis of Chagas disease was confirmed by ELISA and MABA using recombinant antigens; ADA was determined spectrophotometrically and CRP by ELISA. The results have shown that CRP and ADA increased linearly in relation to disease phase, CRP being significantly higher in phase III and ADA at all phases. Also, CRP and ADA were positively correlated with echocardiographic parameters of cardiac remodeling and with electrocardiographic abnormalities, and negatively with ejection fraction. CRP and ADA were higher in patients with cardiothoracic index ≥ 50%, while ADA was higher in patients with ventricular repolarization disturbances. Finally, CRP was positively correlated with ADA. In conclusion, ADA and CRP are prognostic markers of cardiac dysfunction and remodeling in Chagas disease.

KEYWORDS. Chagas disease; Adenosine deaminase; C-reactive protein; Prognostic markers.

INTRODUCTION seen during Chagas disease, results from an immune imbalance in the production of pro and anti-inflammatory cytokines due to the persistence The importance of Chagas disease as a public worldwide health of the parasite that causes activation of inflammatory cells and a problem can be explained by three main reasons: 1) the high residual permanent inflammatory infiltrate9. prevalence in Latin American endemic countries, where the number of infected individuals has been estimated to be 7,694,500 people, which C-reactive protein (CRP), liberated during the acute phase of represents a prevalence of 1.45%; 2) the Latin American migration from inflammation, is the most widely studied nonspecific marker of systemic endemic areas to non-endemic developed countries such as those in North inflammatory processes. The increased serum levels of CRP reflect a America, Europe and Australia; where the prevalence of these migrant vascular inflammation state and they are associated with the development populations has been estimated from 0.6 to 25%; 3) the re-emergence of cardiovascular events4. Increased levels of serum CRP have been of the disease’s transmission, as oral transmission outbreaks in certain reported in advanced clinical stages of Chagas cardiomyopathy2,18,21, Latin American countries16. however, this increase was similarly observed in non-chagasic cardiomyopathy5. Chagas chronic cardiomyopathy is the most important consequence of Trypanosoma cruzi (T. cruzi) infection that affects 20-30% of Adenosine (Ado) is an endogenous nucleoside, known as a infected people. It is considered an inflammatory cardiac disease, in cardioprotective regulator of cardiovascular function20; it has recently which the inflammation is triggered by parasitic infection and/or by been implicated as a mediator of inflammation and immune response17. autoimmune process19. T. cruzi invades predominantly macrophages Adenosine levels are regulated by the activity of the enzyme adenosine and cardiomyocytes, which generates an intense progressive multifocal deaminase (ADA), which catalyzes the irreversible deamination of Ado. inflammatory reaction, mononuclear cell infiltration and fibrosis, which ADA activity increases as a consequence of hypoxia and inflammation lead to cardiac dysfunction. The damage and myocardium remodeling associated with immunologic events11,24. T. cruzi infection causes

(1) Universidade Centro Occidental “Lisandro Alvarado”, Unidade de Bioquímica y Unidade de Investigacões em Parasitología Médica, Decanato de Ciencias de la Salud, Barquisimeto, Venezuela. (2) Ministerio del Poder Popular para la Salud, Hospital de Chabasquén, Chabasquén, Venezuela. (3) Universidade Centro Occidental “Lisandro Alvarado”, Unidade de Investigacões em Parasitología Médica, Decanato de Ciencias de la Salud, Barquisimeto, Venezuela. (4) Universidad de los Andes, Laboratório de Enzimologia, Facultad de Ciencias, Mérida, Venezuela. Correspondence to: Dr. Rafael Bonfante-Cabarcas, Unidade de Bioquímica, Decanato de Ciencias de la Salud, Universidade Centro Occidental “Lisandro Alvarado”, Av. Libertador con Av. Andrés Bello, código postal 3001, Barquisimeto, Lara, Venezuela. Teléfono:+58-251-2591854. E-mail: [email protected] BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

alterations in the coronary microvasculature, which leads to multifocal a substrate, according to a previously validated protocol30,32. necrosis, cardiac ischemia, severe inflammation, and hipoxia1. Consequently, the degree of cardiac hypoxia and inflammation must be Statistical Analysis: Results are presented as the mean ± standard related to the degree of myocardial function impairment. error (SEM).

Because inflammation and hypoxia are important pathological events Because CRP serum levels and ADA serum activity showed not in the development of Chagasic cardiomyopathy, biochemical markers to have a normal distribution, the differences observed between the of these events could be prognostic markers of the evolution of Chagas experimental groups were determined by Kruskal-Wallis test, followed disease. In the present study, we analyzed the relationship between serum by Dunn’s post hoc analysis. Wilcoxon test was used to analyze the CRP levels (as a marker of inflammation) and the serum activity of ADA observed difference between two experimental variables. A linear (as marker of hypoxia) in relation to the clinical status of Chagas disease. correlation analysis was performed using Pearson. In all cases, a p < 0.05 was accepted as significant. METHODS RESULTS Sample: A cross-sectional study was conducted in individuals from Unda municipality, located in the central west region of Venezuela. A The average age for the sample was 50.33 ± 1.58 (95% CI: 47.2- sample of 110 individuals aged between seven and 91 years old were 53.45) years old, being the minimum age seven and the maximum age included: 82 chagasic patients and 28 healthy volunteers. Chagasic 91-years-old. Mean ages in years according to the group were: control patients were classified according to the Andes classification7 as 39.21 ± 1.58 (95% CI: 35.97-42.46), phase I 48.4 ± 2.76 (95% CI: 42.79- follows: Phase I, asymptomatic patients with no electrocardiographic 54.01), phase II 52.9 ± 2.88 (95% CI: 46.99-58.8) and phase III 67.22 or echocardiographic evidence of cardiac involvement; Phase II: ± 3.25 (95% CI 60.37-74.08) years old, the age of phase III patients asymptomatic patients with electrocardiographic or echocardiographic being significantly higher when compared to the other groups, a fact that evidence of cardiac involvement; and Phase III: patients with heart could be linked to the time necessary for the disease’s development. No failure. All participants underwent a complete medical history, statistically significant difference between patients in phase I and II was physical examination, posteroanterior chest radiography, 12-lead observed. Of the total, 40 patients were male (nine controls, 12 in phase electrocardiogram and transthoracic echocardiogram. I, 10 in phase II and nine in phase III) and 70 female (19 controls, 23 in phase I, 19 in phase II and nine in phase III); no significant association For this study, exclusion criteria were non-chagasic heart disease, between sex and clinical phase of the disease was observed. In Tables liver disease, acute and chronic inflammatory processes, diabetes mellitus, 1, 2 and 3 clinical (physical examination), electrocardiographic, and hypertension, pneumonia, tuberculosis and consumption of illicit drugs. echocardiographic characteristics of patients are shown.

The study protocol was submitted and approved by the Ethics Serum levels of C-reactive protein in the sample were 1.64 ± 0.36 Committee at the Health Sciences at the Universidad Centro Occidental mg/L (n = 28) for controls and 4.27 ± 0.73 mg/L (n = 82) for chagasic “Lisandro Alvarado”, Barquisimeto, Venezuela. All patients or their patients, being the difference statistically significant p( < 0.05). By representatives understood and willingly signed the informed consent analyzing the values in relation to clinical stages of the disease, we before being included in the study. observed that serum levels increased linearly and significantly, as the disease progresses to more advanced stages (see Fig. 1). Serum levels of Serological diagnosis of Chagas disease: It has been based on the C-reactive protein were negatively correlated with left ventricle ejection determination of anti-T cruzi antibodies by ELISA and MABA (multiple fraction, indicating that it could be a marker of ventricular function antigen blot assays or three-band immunoblot assay) techniques; specific (Fig. 3). In contrast, serum levels of C-reactive protein were positively recombinant antigens were used in both cases (PGR31-His, PGR24- correlated with systolic and diastolic left ventricular diameter, with left His, and PGR30-His); in ELISA as a chimeric protein and in MABA ventricular mass, and left ventricular mass index; the same results were individually. These recombinant antigens represent peptide sequences obtained regarding the diastolic diameter of the right ventricle, indicating encoded specifically by the T. cruzi genome, which allows the test to that CRP is a marker of cardiac remodeling (Table 4 and Fig. 4). This have 100% specificity. The use of three antigens allows us to achieve a finding was confirmed by observing that CRP levels were significantly higher than 95% sensitivity. The MABA was considered positive when at (p < 0.05) higher in patients with ≥ 50% cardiothoracic index (5.56 ± least two of the three recombinant antigen bands were reactive. Samples 1.25) when compared with patients with a cardiothoracic index < 50% were considered positive only if both ELISA and MABA proved reactive (2.63 ± 0.54) (Fig. 5). and were considered negative if one or both tests were nonreactive25. Similarly, serum CRP levels were positively correlated with the Determination of serum CRP levels: Serum CRP levels were frequency of different types of electrocardiographic abnormalities measured with ELISA kit VITRO 250 (Johnson & Johnson), according (Table 4), also it was observed that patients with one or more types to manufacturer instructions. of electrocardiographic abnormalities had significantly higher serum CRP levels when compared with patients without electrocardiographic Determination of ADA activity: ADA serum activity was disorders (patients with disorders: 5.43 ± 1.12 mg/L; patients without determined spectrophotometrically using the colorimetric method disorders: 2.03 ± 0.37 mg/L, p < 0.05). described by GIUSTI & GALANTI (1984)15, which is based on the indirect measurement of the formation of ammonia, using adenosine as In the present study, there were no significant differences (p < 0.05) in

386 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

Table 1 Findings on physical examination in control individuals and patiens with Chagas disease

CONTROL PHASE I PHASE II PHASE III TOTAL Sigs n % n % n % n % n % JVD 0 0 0 0 0 0 14 77.77 14 12.72 Dyspnoea 0 0 0 0 5 17.24 13 72.22 18 16.36 Orthopnea 0 0 0 0 0 0 2 11.11 2 1.81 Pulmonary rales 0 0 0 0 0 0 3 16.66 3 2.72 VPA 0 0 0 0 5 17.24 13 72.22 18 16.36 HJR 0 0 0 0 0 0 1 5.55 1 0.90 Hepatomegaly 0 0 0 0 0 0 2 11.11 2 1.81 Ascites 0 0 0 0 0 0 2 11.11 2 1.81 Gallop rhythm 0 0 0 0 0 0 3 16.66 3 2.72 ASHS 0 0 0 0 0 0 2 11.11 2 1.81 Alternating pulse 0 0 0 0 0 0 1 5.55 1 0.90 Bimalleolar edema 0 0 0 0 3 10.34 17 94.44 20 18.18 JDU: jugular venous distension; VPA: visible and palpable apex; HJR: hepatojugular reflux; ASHS: accentuated second heart sound.

Table 2 Electrocardiographic abnormalities

CONTROL PHASE I PHASE II PHASE III TOTAL ECG tracing n % n % n % n % n % No sinus rhythm 0 0 0 0 0 0 4 25.00 4 3.77 Sinus bradycardia 2 7.69 0 0 5 17.24 1 6.25 8 7.69 Sinus tachycardia 0 0 0 0 1 3.44 0 0 1 0.96 Atrial fibrillation 0 0 0 0 0 0 3 18.75 3 2.88 Ventricular extrasystole 0 0 0 0 0 0 2 11.11 2 1.81 AV block 0 0 0 0 0 0 1 6.25 1 0.96 Left anterior hemiblock 2 7.69 0 0 14 48.27 7 43.75 23 22.11 Left posterior hemiblock 0 0 0 0 1 3.44 0 0 1 0.96 Right bundle branch block 0 0 0 0 13 44.82 3 18.75 16 15.38 Left bundle branch block 0 0 0 0 5 17.24 3 16.66 8 7.69 Left ventricular enlargement 0 0 0 0 3 10.34 1 6.25 4 3.84 Repolarization disorders 0 0 0 0 6 18.18 9 56.25 15 14.23 the levels of serum CRP in patients with a medical history of hypertension age and analyzed the results again against the clinical phase of Chagas compared to those patients with no hypertension history (patients with disease, and we found similar results compared to uncorrected data, history: 5.51 ± 0.58 mg/L, n = 18; patients without history: 3.12 ± 0.58 confirming that the increased levels of ADA were in fact related to the mg/L, n = 56), as well as in patients with blood pressure values ≥ 90 severity of the disease. mmHg (3.26 ± 1.31 mg/L) when compared with patients with blood pressure values < 90 mmHg (3.89 ± 0.67 mg/L) at physical examination. Serum ADA enzyme activity was negatively correlated with the ejection fraction of the left ventricle, also turning into a marker of The serum activity of the enzyme adenosine deaminase in the sample ventricular function and was positively correlated with left ventricular was 33.7 ± 2.17 nmol/mL (n = 28) for control patients and 53.97 ± 2.76 systolic diameter, left ventricular mass, left ventricular mass index, nmol/mL (n = 82) for chagasic patients; being the difference statistically and frequency of different types of electrocardiographic abnormalities, significant (p < 0.05). By analyzing the values in relation to clinical indicating that ADA activity is related to muscle and electrical remodeling stages of the disease, we observed that serum enzyme activity increased of the heart (Table 4; Fig. 3 and 4). linearly and significantly as the disease was in an advanced phase (see Fig. 2); however, values of ADA were correlated with age, being higher This was confirmed by the fact that serum ADA activity was in aged individuals; for this reason, we corrected ADA levels based on significantly higher (p < 0.05) in patients with a cardiothoracic index ≥

387 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

Table 3 Echocardiographic characteristics of healthy and chagasic patients

Chagasic patients Parameters CONTROL PHASE I PHASE II PHASE III Mean ± SEM Mean ± SEM Mean ± SEM Mean ± SEM RVDD (mm) 14.62 ± 0.35 13.95 ± 0.61 15.29 ± 0.81 17.71 ± 1.76*C,I LVEDD (mm) 48.85 ± 0.56 49.90 ± 1.05 51.15 ± 1.12 57.37 ± 2.84*C,I,II LVESD (mm) 29.88 ± 1.36 33.85 ± 0.76 34.80 ± 1.02 41.00 ± 3.25* C,I,II IVS (mm) 8.48 ± 0.0 8.91 ± 1.27 9.48 ± 2.41 10.53 ± 2.66*C LVT (mm) 10.56 ± 0.14 8.82 ± 0.42*C 9.66 ± 0.48 9.90 ± 0.65 LA (mm) 30.56 ± 0.77 26.75 ± 1.38 27.18 ± 1.31 35.55 ± 3.11*I,II EF (%) 68.33 ± 0.73 64.85 ± 1.12 63.13 ± 2.08 53.83 ± 3.77*C,I,II LVMI (gr/m2 SC) 132.16 ± 5.09 173.80 ± 6.23 188.75 ± 8.49 260.72 ± 8.88 RVDD: right ventricular diastolic diameter; LVEDD = left ventricular end diastolic diameter; LVESD = left ventricular end sistolic diameter; IVS = interventricular septum at end diastole; LVT: diastolic left ventricular posterior wall thickness; LA: diastolic diameter of the left atrium; EJ: ejection fraction; LVMI: left ventricular mass index. *means p < 0.05 as compared with C (Control), I (Phase I) or II (Phase II) using ANOVA followed by Bonferroni post test.

Fig. 1 - C-reactive protein serum levels related to Chagas disease stage. At left is shown CRP serum levels in control and chagasic patients stratified in three phases according to Andes classification. At right, a linear regression is plotted through points obtained from the mean ± SEM of serum CRP levels, severity is indicated in numbers, 0 being the control group, 1 chagasic patients at phase I, 2 chagasic patients at phase II and 3 chagasic patients at phase III. Linear regression results indicate a significant linear correlation (Pearson´s r: 0.96, r2: 0.93; p < 0.05) between CRP serum levels and severity of the Chagas disease. * means p < 0.05 as compared with control patients.

Fig. 2 - Adenosine deaminase serum activity related to Chagas disease stage. On the left is shown ADA activity in control and chagasic patients in relation to disease severity. On the right, a linear regression is plotted through points obtained from the mean ± SEM of serum ADA activity, severity is indicated as in Figure 1. Linear regression outcomes indicate a significant linear correlation (Pearson´s r: 0.96, r2: 0.92; p < 0.05) between CRP serum levels and severity of the Chagas disease. *means p < 0.05 as compared with control patients.

388 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

Fig. 3 - Correlation curves of serum markers and cardiac ejection fraction. Correlation between CRP serum levels (left panel) or ADA serum activity (right panel) and cardiac ejection fraction are shown. Results are displayed in Table IV.

Table 4 Correlation analysis between serum levels of C-reactive protein or adenosine deaminase serum enzyme activity in relation to echocardiographic and electrocardiographic parameters

CRP ADA Parameter Pearson r IC95% R2 p Pearson r IC95% R2 p EF -0.55 -0.72 - (-0.34) 0.31 < 0.01 -0.33 -0.52 - (-0.09) 0.11 0.01 RVDD 0.63 0.37 - 0.8 0.4 < 0.01 0.17 -0.14 - 0.46 0.03 0.28 LVEDD 0.27 0.02 - 0.5 0.08 0.04 0.22 -0.02 - 0.44 0.05 0.07 LVESD 0.42 0.17 - 0.62 0.18 < 0.01 0.29 0.05 - 0.50 0.08 0.02 IVS 0.26 -0.01 - 0.49 0.07 0.06 0.12 -0.12 - 0.35 0.02 0.32 LVT < -0.01 -0.27 - 0.27 < 0.01 0.98 0.01 -0.23 - 0.25 < 0.01 0.93 LA 0.38 0.12 - 0.58 0.14 0.01 0.22 -0.03 - 0.44 0.05 0.08 LVM 0.39 0.15 - 0.60 0.16 < 0.01 0.26 0.02 - 0.47 0.07 0.03 LVMI 0.39 0.13 - 0.60 0.15 < 0.01 0.36 0.13 - 0.56 0.13 < 0.01 ECG abnormalities 0.33 0.11 - 0.52 0.11 < 0.01 0.33 0.13 - 0.51 0.11 < 0.01 RVDD: right ventricular diastolic diameter; LVEDD = left ventricular end diastolic diameter; LVESD = left ventricular end sistolic diameter; IVS = interventricular septum at end diastole; LVT: diastolic left ventricular posterior wall thickness; LA: diastolic diameter of the left atrium; EJ: ejection fraction; LVMI: left ventricular mass index. Data was obtained by Pearson correlation.

Fig. 4 - Correlation curves of serum markers and left ventricular mass index. Correlation between CRP serum levels (left panel) or ADA serum activity (right panel) and LVMI are shown. Results are displayed in Table IV.

389 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

Fig. 5 - Serum markers and cardiothoracic index (CTI). Values of serum CRP levels (left panel) and serum ADA activity (right panel) are compared between patients with CTI less than 50% and patients with CTI higher than 50%. Observe that in both cases the levels of serum markers are significantly (* p < 0.05) elevated in patients with CTI > 50%.

50% (64.65 ± 4.319 nmol/mL) (Fig. 5) and in patients with ventricular Similarly, it has been found that CRP is significantly higher in patients repolarization disturbances (72.70 ± 9.46 nmol/mL), when compared with chagasic cardiomyopathy than in healthy subjects or asymptomatic with patients with cardiothoracic index < 50% (42.69 ± 2.43 nmol/mL) chagasic subjects10,26. and in patients without repolarization disturbances (47.28 ± 2.4 nmol/ mL), respectively. However, CRP is a nonspecific marker of inflammation that noticeably rises in advanced stages of heart disease, disregarding Given the fact that results for repolarization disorders could just the etiology. This was demonstrated by BRAVO et al. (2010)5, who reflect the phase of the disease, and since control and phase I patients reported that CRP levels are elevated in patients with decompensated did not display this abnormality, we decided to compare ADA activity in heart failure. They found no statistically significant differences between phases II and III patients, confirming that ADA activity is significantly patients with serum antibodies for T. cruzi and seronegative patients, higher in patients with impaired ventricular repolarization (with disorders: notwithstanding, they found that CRP levels were significantly higher 65.88 ± 7.26 nmol/mL; without disorders: 48.61 ± 4.51 nmol/mL, p < in patients in class IV of New York Heart Association functional 0.05). classification (NYHA IV) when compared with patients in NYHA III, indicating that the CRP serum levels are associated with the severity No significant differences in ADA serum activity in patients with a of the cardiac pathology. medical history of hypertension compared to patients with no history were observed (patients with history: 52.60 ± 4.30 nmol/mL, n = 22; In the present paper, CRP levels were significantly correlated with patients without history: 49.21 ± 2.90 nmol/mL); similarly in patients echocardiographic parameters of cardiac remodeling and ejection with diastolic blood pressure values ≥ 90 mmHg (53.17 ± 5.16 nmol/mL; fraction. In this regard, it has been demonstrated that patients with acute n = 21) when compared with patients with diastolic blood pressure values myocardial infarction and higher plasma CRP levels are more prone < 90 mmHg (49.08 ± 2.75 nmol/mL; n = 67) at physical examination. to developing left ventricular dysfunction and remodeling12,27, and to Finally, serum ADA activity was positively correlated with serum CRP have alterations in left ventricular geometry in patients with essential levels (Pearson’s r: 0.24, 95%CI 0.01-0.44, r2 0.06 and p < 0.05) (Table 4). hypertension31.

DISCUSSION We also observed that serum levels of CRP were correlated with electrocardiographic disturbances; in this respect, it has been observed CRP, among other systemic inflammatory mediators, has been that high serum levels of CRP are significantly associated with the widely accepted as a potent risk indicator, independently predicting occurrence of ventricular tachycardia, and/or atrial or ventricular future cardiovascular events. The impact of CRP on cardiovascular fibrillation in patients with ischemia3,8. outcome has been corroborated by a large number of observational studies and meta-analyses. These studies show that an elevated CRP The other biochemical marker used in the present study was ADA. has a clear prognostic value for major cardiovascular events and We have found that its serum activity had a similar behavior to CRP, mortality, whereas the lowering of CRP is associated with a reduction including a linear correlation between them. In addition, serum activity in cardiovascular risk4. was significantly higher in seropositive patients and there was a linear trend to increase with the clinical phase of the disease. These results are In the present paper, we confirmed that CRP is a sensitive marker different from those reported by previous studies in patients with Chagas for the evolution of Chagas disease, especially at later stages related to disease6,28,29. Although one could argue that the differences observed the presence of heart failure (phase III). In this sense, it has been found in the present study, with respect to the previous reports are due to the that serum CRP levels only increase in the most advanced phase of the sample type and the absence of healthy controls to compare the values disease, indicating that CRP serum levels could be of prognostic value obtained in chagasic patients; it is more prudent to analyze the results in assessing Chagas disease progression2,18,21. in an appropriate pathogenic context.

390 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

It has been clearly shown that ADA is a marker of hypoxia and Além disso, PCR e ADA foram correlacionados positivamente com inflammation. During hypoxia, ADA expression is increased due to a parâmetros ecocardiográficos de remodelamento cardíaco e alterações compensatory mechanism as a result of elevated levels of adenosine11. eletrocardiográficas, e negativamente com a fração de ejeção. PCR e Plasma adenosine levels’ increase in patients with ischemic and non- ADA foram mais elevadas em pacientes com índice cardiotorácico ischemic heart failure, and the extent of this increment correlates with the ≥ 50%, enquanto que a ADA foi maior em pacientes com alterações severity of the disease13,14, demonstrating the indisputable fact that during da repolarização ventricular. Finalmente, os níveis de PCR foram heart failure there is hypoxia, that therefore stimulates ADA expression. correlacionados positivamente com a atividade da ADA. Conclusão: TORRELLAS et al. (2010)31 demonstrated that serum ADA activity ADA e PCR são marcadores prognósticos de disfunção e remodelamento increase in patients with acute myocardial infarction and in the present cardíaco na Doença de Chagas, e devem ser incluídos na avaliação e paper we have also demonstrated that serum ADA activity is associated acompanhamento dos pacientes. with repolarization disturbances. ACKNOWLEDGMENTS On the other hand, ADA (as a marker of inflammation) has been implicated as a result of the inflammation-induced hypoxia and with the This study was funded by the National Fund for Science and change in protein expression product of its RNA editing activity33, which Technology (FONACIT) under the Ministry of Popular Power for Science may affect the inflammatory and immune response through modulation and Technology (Venezuela), Project No 2007001425. of protein synthesis33, 34. Moreover, ecto-ADA, an isoenzyme anchored to the surface of dendritic cells through A2B adenosine receptor, binds AUTHOR CONTRIBUTIONS to the CD26 protein expressed on the surface of T cells as part of the immunological synapse and provides a co-stimulatory signal that I. D. Bravo-Tobar was responsible for sample collection, experimental increases activation of T cells and their polarization to a Th1 phenotype23. procedures and writing the manuscript; C. Nello-Pérez was responsible for sample collection, experimental procedures and collaborated in Also ADA, like CRP, was correlated with echocardiographic study design; A. Fernández was responsible for sample collection and parameters of cardiac remodeling. This finding could be related to collaborated in study design; N. Mogollón was responsible for sample ADA overexpression, which increases adenosine catabolism preventing collection and experimental procedures; M.C. Pérez was responsible its inhibitory effect on promoting synthesis of collagen and proteins in for experimental procedures; J. Verde was responsible for experimental fibroblasts and cardiomyocytes22. procedures; J.L. Concepción was responsible for experimental procedures and collaborated in study design; C. Rodríguez-Bonfante collaborated Finally, our results suggest that inflammation increases as Chagas in study design; R. Bonfante-Cabarcas was responsible for the study disease reaches advanced phases, which is related to the CRP blood levels design, and collaborated in the experimental procedures and writing and cardiac dysfunction. This creates a theoretical support to claim that the manuscript. ADA activity is increased in Chagas disease and should increase even more as far as the disease worsens, which is reflected in our results. Even REFERENCES more, we showed that serum ADA activity correlates with serum levels of CRP, corroborating the idea that ADA is also a marker of inflammation 1. Alvarado-Tapias E, Miranda-Pacheco R, Rodríguez-Bonfante C, Velásquez G, Loyo J, Gil- and impaired cardiac function related to hypoxia. Oviedo M, et al. Electrocardiography repolarization abnormalities are characteristic signs of acute chagasic cardiomyopathy. Invest Clin. 2012;53:378-94.

RESUMO 2. Aparecida da Silva C, Fattori A, Sousa AL, Mazon SB, Monte Alegre S, Almeida EA, et al. Determining the C-reactive protein level in patients with different clinical forms Atividade da adenosina deaminase e níveis de proteina C reativa of Chagas disease. Rev Esp Cardiol. 2010;63:1096-9. sérica como marcadores de gravidade na doença de Chagas 3. Biasucci LM, Giubilato G, Biondi-Zoccai G, Sanna T, Liuzzo G, Piro M, et al. C reactive protein is associated with malignant ventricular arrhythmias in patients with ischaemia Introdução e objetivo. A Doença de Chagas é um problema de with implantable cardioverter-defibrillator. Heart. 2006;92:1147-8. saúde pública mundial. A disponibilidade de ferramentas diagnósticas para prever o desenvolvimento de miocardiopatia chagásica crônica é 4. Bisoendial RJ, Boekholdt SM, Vergeer M, Stroes ES, Kastelein JJ. C-reactive protein is fundamental para reduzir a morbidade e a mortalidade. Aqui estudamos a mediator of cardiovascular disease. Eur Heart J. 2010;31:2087-91. o valor prognóstico da atividade sérica da adenosina deaminase (ADA) 5. Bravo Tobar I, Parra F, Nello Pérez C, Rodríguez-Bonfante C, Useche F, Bonfante- e dos níveis de proteína C reativa (PCR) em indivíduos chagásicos. Cabarcas R. Prevalence of Trypanosoma cruzi antibodies and inflammatory markers Métodos: 110 indivíduos: 28 saudáveis e 82 pacientes chagásicos foram in uncompensated heart failure. Rev Soc Bras Med Trop. 2011;44:691-6. divididos de acordo com a gravidade da doença em fase I (n = 35), II (n = 29) e III (n = 18). Para cada indivíduo foram feitos uma história 6. Budni P, Pedrosa RC, Dalmarco EM, Dalmarco JB, Frode TS, Wilhelm Filho D. Carvedilol enhances the antioxidant effect of vitamins E and C in chronic Chagas heart disease. médica, eletrocardiograma, radiografia de tórax e ecocardiografía Arq Bras Cardiol. 2013;101:304-10. transtorácica. O diagnóstico de Chagas foi confirmado por ELISA e MABA utilizando antígenos recombinantes, a atividade sérica da 7. Carrasco HA, Parada H, Guerrero L, Duque M, Durán D, Molina C. Prognostic enzima ADA foi determinada por espectrofotometria, e os níveis séricos implications of clinical, electrocardiographic and hemodynamic findings in chronic de PCR por ELISA. Resultados: os níveis de PCR e da atividade da Chagas’ disease. Int J Cardiol. 1994;43:27-38. ADA aumentaram linearmente em relação à fase da doença, sendo a PCR significativamente maior na fase III, e a ADA em todas as fases.

391 BRAVO-TOBAR, I.D.; NELLO-PÉREZ, C.; FERNÁNDEZ, A.; MOGOLLÓN, N.; PÉREZ, M.C.; VERDE, J.; CONCEPCIÓN, J.L.; RODRIGUEZ-BONFANTE, C. & BONFANTE- CABARCAS, R. - Adenosine deaminase activity and serum C-reactive protein as prognostic markers of Chagas disease severity. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 385-92, 2015.

8. Chung MK, Martin DO, Sprecher D, Wazni O, Kanderian A, Carnes CA, et al. C-reactive 22. Nagai T, Anzai T, Kaneko H, Mano Y, Anzai A, Maekawa Y, et al. C-reactive protein protein elevation in patients with atrial arrhythmias: inflammatory mechanisms and overexpression exacerbates pressure overload-induced cardiac remodeling through persistence of atrial fibrillation. Circulation. 2001;104:2886-91. enhanced inflammatory response. Hypertension. 2011;57:208-15.

9. Cunha-Neto E, Nogueira LG, Teixeira PC, Ramasawmy R, Drigo SA, Goldberg AC, et 23. Pérez-Aguilar MC, Goncalves L, Ibarra A, Bonfante-Cabarcas R. Adenosin deaminasa al. Immunological and non-immunological effects of cytokines and chemokines in como molécula coestimuladora y marcador de inmunidad celular. Invest Clin. the pathogenesis of chronic Chagas disease cardiomyopathy. Mem Inst Oswaldo 2010;51:561-71. Cruz. 2009;104(Suppl 1):252-8. 24. Rabinovici R, Kabir K, Chen M, Su Y, Zhang D, Luo X, et al. ADAR1 is involved in the 10. Cutrullis RA, Petray PB, Schapachnik E, Sánchez R, Postan M, González MN, et al. development of microvascular lung injury. Circ Res. 2001;88:1066-71. Elevated serum levels of macrophage migration inhibitory factor are associated with progressive chronic cardiomyopathy in patients with Chagas disease. PLOS ONE. 25. Rojas ME, Várquez P, Villarreal MF, Velandia C, Vergara L, Morán-Borges YH, et al. 2013;8:e57181. Estudio seroepidemiológico y entomológico sobre la enfermedad de Chagas en un área infestada por Triatoma maculata (Erichson 1848) en el centro-occidente de 11. Eltzschig HK, Faigle M, Knapp S, Karhausen J, Ibla J, Rosenberger P, et al. Endothelial Venezuela. Cad Saude Publica. 2008;24:2323-33. catabolism of extracellular adenosine during hypoxia: the role of surface adenosine deaminase and CD26. Blood. 2006;108:1602-10. 26. Saravia SG, Haberland A, Bartel S, Araujo R, Valda G, Reynaga DD, et al. Cardiac troponin T measured with a highly sensitive assay for diagnosis and monitoring of 12. Fertin M, Hennache B, Hamon M, Ennezat PV, Biausque F, Elkohen M, et al. Usefulness heart injury in chronic Chagas disease. Arch Pathol Lab Med. 2011;135:243-8. of serial assessment of B-type natriuretic peptide, troponin I, and C-reactive protein to predict left ventricular remodeling after acute myocardial infarction (from the 27. Schoos MM, Munthe-Fog L, Skjoedt MO, Ripa RS, Lønborg J, Kastrup J, et al. REVE-2 study). Am J Cardiol. 2010;106:1410-6. Association between lectin complement pathway initiators, C-reactive protein and left ventricular remodeling in myocardial infarction-a magnetic resonance study. Mol 13. Franceschi F, Deharo JC, Giorgi R, By Y, Monserrat C, Condo J, et al. Peripheral plasma Immunol. 2013;54:408-14. adenosine release in patients with chronic heart failure. Heart. 2009;95:651-5. 28. Souza V do C, Schlemmer KB, Noal CB, Jaques JA, Zimmermann CE, Leal CA, et 14. Funaya H, Kitakaze M, Node K, Minamino T, Komamura K, Hori M. Plasma adenosine al. E-NTPDase and E-ADA activities are altered in lymphocytes of patients with levels increase in patients with chronic heart failure. Circulation. 1997;95:1363-5. indeterminate form of Chagas’ disease. Parasitol Int. 2012;61:690-6.

15. Giusti G, Galanti B. Colorimetric method: adenosine deaminase. In: Bergmeyer HU, 29. Souza V do C , Schlemmer KB, Noal CB, Jaques JA, Bagatini MD, Pimentel VC, et al. editor. Methods of enzymatic analysis. 3rd ed. Weinheim: Verlag Chemie; 1984. p. Purinergic system ecto-enzymes participate in the thromboregulation of patients with 315-23. indeterminate form of Chagas disease. Purinergic Signal. 2012;8:753-62.

16. Labrador-Hernández M, Jiménez L, Leon G, López R, Mendoza W, Bonfante-Rodriguez 30. Takahashi T, Anzai T, Kaneko H, Mano Y, Anzai A, Nagai T, et al. Increased C-reactive C, et al. A decreased expression and functionality of muscarinic cholinergic receptor protein expression exacerbates left ventricular dysfunction and remodeling after in acute Chagas myocarditis. World J Cardiovasc Dis. 2014;4:305-15. myocardial infarction. Am J Physiol Heart Circ Physiol. 2010;299:H1795-804.

17. Linden J. New insights into the regulation of inflammation by adenosine. J Clin Invest. 31. Torrellas Y; Pérez-Aguilar MC, Ramos B; Useche AF; Ibarra A; Bonfante-Cabarcas R, et 2006;116:1835-7. al. Increased adenosine deaminase serum activity in patients with acute myocardial infarction. Rev Latinoam Hipertens. 2010;5:38-42. 18. López L, Arai K, Giménez E, Jiménez M, Pascuzo C, Rodríguez-Bonfante C, et al. C-reactive protein and interleukin-6 serum levels increase as Chagas disease 32. Vilchez D, Pérez-Aguilar MC, Saba S, Bonfante-Cabarcas R. Los niveles séricos de progresses towards cardiac failure. Rev Esp Cardiol. 2006;59:50-6. adenosin deaminasa y ácido úrico se correlacionan en pacientes gestantes con trastornos hipertensivos. Rev Chil Obstet Ginecol. 2009;74:217-24. 19. Machado FS, Tyler KM, Brant F, Esper L, Teixeira MM, Tanowitz HB. Pathogenesis of Chagas disease: time to move on. Front Biosci (Elite Ed). 2012;4:1743-58. 33. Yang JH, Luo X, Nie Y, Su Y, Zhao Q, Kabir K, et al. Widespread inosine-containing mRNA in lymphocytes regulated by ADAR1 in response to inflammation. 20. McIntosh VJ, Lasley RD. Adenosine receptor-mediated cardioprotection: are all 4 subtypes Immunology. 2003;109:15-23. required or redundant? J Cardiovasc Pharmacol Ther. 2012;17:21-33. 34. Yang JH, Nie Y, Zhao Q, Su Y, Pypaert M, Su H, et al. Intracellular localization of 21. Melo Coutinho CM, Cavalcanti GH, Bonaldo MC, Mortensen RF, Araújo-Jorge TC. differentially regulated RNA-specific adenosine deaminase isoforms in inflammation. Trypanosoma cruzi: detection of a surface antigen cross-reactive to human C-reactive J Biol Chem. 2003;278:45833-42. protein. Exp Parasitol. 1998;90:143-53. Received: 7 August 2014 Accepted: 24 February 2015

392 Rev. Inst. Med. Trop. Sao Paulo 57(5):393-396, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500004

ISOLATION AND MOLECULAR IDENTIFICATION OF POTENTIALLY PATHOGENIC Escherichia coli AND Campylobacter jejuni IN FERAL PIGEONS FROM AN URBAN AREA IN THE CITY OF LIMA, PERU

Moisés CABALLERO(1), Isabel RIVERA(1), Luis M. JARA(1), Francisco M. ULLOA-STANOJLOVIC(2) & Carlos SHIVA(1)

SUMMARY

Feral pigeons (Columbia livia) live in close contact with humans and other animals. They can transmit potentially pathogenic and zoonotic agents. The objective of this study was to isolate and detect strains of diarrheagenic Escherichia coli and Campylobacter jejuni of urban feral pigeons from an area of Lima, Peru. Fresh dropping samples from urban parks were collected for microbiological isolation of E. coli strains in selective agar, and Campylobacter by filtration method. Molecular identification of diarrheagenic pathotypes of E.coli and Campylobacter jejuni was performed by PCR. Twenty-two parks were sampled and 16 colonies of Campylobacter spp. were isolated. The 100% of isolates were identified as Campylobacter jejuni. Furthermore, 102 colonies of E. coli were isolated and the 5.88% resulted as Enteropathogenic (EPEC) type and 0.98% as Shiga toxin-producing E. coli (STEC). The urban feral pigeons of Lima in Peru can act as a reservoir or carriers of zoonotic potentially pathogenic enteric agents.

KEYWORDS: Escherichia coli; Campylobacter jejuni; Diarrhea; Zoonoses; PCR.

INTRODUCTION groups, the fecal-oral route being the main route of transmission3,6. Even more, Campylobacter has been isolated from river and waste water, The feral pigeons (Columbia livia) live in urban and rural areas, chickens and pets32. In Lima, C. jejuni was reported as responsible in close contact with humans and other animals. In recent years, the for the 13.3% of the acute human diarrhea diagnosed in local hospital population growth of feral pigeons has increased their interest in public centers25. health, because it could represent a reservoir of transmissible pathogens by air and through contaminated food or water29. There are no studies about the prevalence of zoonotic diarrheagenic agents in urban birds in the city of Lima, Peru. Their population has Among the zoonoses that could be transmitted by pigeons, the increased in recent years and the close contact with people in public places, most important are chlamydiosis, cryptococcosis, aspergillosis and especially with children, requires knowledge of the epidemiological status enterobacteriosis, which include pathogenic Escherichia coli and species of potential pathogenic E. coli and Campylobacter in feral pigeons. of Campylobacter, Salmonella and Listeria1. Five main pathotypes of Given this context, the objective of this study was to isolate and identify diarrheagenic E. coli have been described, enterotoxigenic (ETEC), the presence of Campylobacter jejuni and diarrheagenic E. coli in enteropathogenic (EPEC), enteroaggregative (EAEC), enteroinvasive feral pigeons from an urban area in the city of Lima, Peru, through the (EIEC) and the zoonotic enterohemorrhagic (EHEC or STEC), which microbiological isolation and molecular identification by a conventional produce a Shiga-like toxin that leads to hemolytic uremic syndrome33. Polymerase Chain Reaction (PCR) technique. Some studies show that enterohemorrhagic serotype O157:H7 of E. coli can be present in feral pigeons15,28. Moreover, in Peru there have been MATERIALS AND METHODS reported outbreaks of human enterohaemorrhagic colibacilosis from unknown sources of infection13, although prevalence of STEC in children Sampling: droppings samples, from healthy adult feral pigeons, were is up to 9% while EPEC is higher21. collected in parks (22) of a midwest area of the city of Lima (Pueblo Libre), Peru, in the summer (December to April) of 2012. Sterile plastics Thermotolerant Campylobacter species have become important, with food were extended on the ground of each park, and a swab of fresh especially as agents of infectious diarrhea, with even more cases per droppings from each pigeon (about 30 animals per park) was obtained. year than salmonellosis and shigellosis11,33. Campylobacter jejuni and Swabs were placed in a Stuart transport medium and then were stored Campylobacter coli are the most frequent cause of diarrhea in childhood at 4 °C for 24 hours.

(1) Universidad Peruana Cayetano Heredia, Facultad de Veterinaria y Zootecnia , Lima, Perú. (2) Universidade de São Paulo, Faculdade de Veterinária e Zootecnia, São Paulo, SP, Brasil. Correspondence to: Luis M. Jara, Laboratorio de Biología Molecular, Facultad de Veterinaria y Zootecnia, Universidad Peruana Cayetano Heredia. Av. Honorio Delgado 430, San Martín de Porres, Lima, Perú. E-mail: [email protected] CABALLERO, M.; RIVERA, I.; JARA, L.M.; ULLOA-STANOJLOVIC, F.M. & SHIVA, C. - Isolation and molecular identification of potentially pathogenic Escherichia coli and Campylobacter jejuni in feral pigeons from an urban area in the city of Lima, Peru. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 393-6, 2015.

Microbiological and molecular identification: samples for E. Campylobacter were positive in PCR identification asC. jejuni (Fig. 1). coli isolation were seeded and cultured in MacConkey agar by the Likewise, 110 colonies of E. coli were isolated from McConkey agar, streaking culture technique and incubated at 37 °C for 24 hours in of which only 102 were confirmed by biochemical tests. The 6.86% of aerobiosis. Samples for Campylobacter were suspended in 1 mL of the E. coli strains amplified had one or more virulent genes, of which saline solution and inoculated into a cellulose filter (0.45 µm) on blood 5.88% belonged to the EPEC group and 0.98% to the STEC group agar and then incubated for 72 hours at 42 °C under microaerophilic (Table 1, Fig. 2). conditions22. According to biochemical patterns and modified Gram staining with fuchsin, E. coli and Campylobacter were presumptive DISCUSSION identified respectively34. The extraction of genomic DNA of each colony was performed by the kit Wizard Genomic DNA Purification for Gram- This study represents the first report of potentially pathogenic agents negative bacteria, according to the supplier’s instructions (Promega, isolated from urban feral pigeons in Lima, Peru. The results indicate USA). that these birds, settled in different parks, can serve as a reservoir of zoonotic C. jejuni and STEC, as well as EPEC. Although the isolation For the molecular identification of diarrheagenic E. coli pathotypes, and molecular identification methodology was similar to previous studies, a multiplex PCR performed with previously described primers of and there were no differences among parks tested, the prevalence obtained intimin (eae), Shiga toxin (stx1, stx2) and hemolysin (hlyA) was may differ by the number of samples collected and sampling areas, among used23. As well for the C. jejuni identification, the previously described other investigated factors. primers forward 5’- TGACGCTAGTGTTGTAGGAG - 3’ and reverse 5’-CCATCATCGCTAAGTGCAAC-3’ were used in a conventional The presence of Campylobacter jejuni has been documented PCR20. Diarrheagenic E. coli pathotypes were classified according to the worldwide in urban birds. In Spain this was found, with 69.1% in contrast presence of virulence factors eae for EPEC and stx1/stx2 for STEC21. to 1.1% of C. coli32. Also in Sweden, a study found 3% of prevalence The prevalence was expressed as a percentage according to the pathotype of C. jejuni19, while in Chile a 7% was found10. In Bolivia a 29% of found in the total of isolates. frequency for Campylobacter spp. was obtained and 57% was confirmed as C. jejuni2. And in the Peruvian jungle, C. jejuni was found in 8% of RESULTS the domestic chickens sampled31.

From all samples seeded on blood agar, 16 colonies were isolated The role of Campylobacter in the etiology of human enteric disease showing microscopic characteristics such as small size, pinpoint has been established in developing countries, and there is a consensus morphology, non-hemolytic, and Gram-negative “gull-wing” shaped that the environment and level of sanitary care are crucial in infections11. bacilli at Gram staining. One hundred percent of colonies suggestive of In USA, the 15% of Campylobacter infections have been due to contact with pets18, with a wide range of reservoirs among mammals and birds present in the surroundings. As reported, C. jejuni isolates from clinically

Fig. 2 - Gel electrophoresis of diarrheagenic E. coli samples from feral pigeons. Ladder 100 Fig. 1 - Gel electrophoresis of C. jejuni samples from feral pigeons. Ladder 100 bp (1); blank bp (1); positive control E. coli O157:H7 (2), negative control E. coli ATCC 25922 (3); blank (2), negative control, E. coli ATCC 25922 (3); positive control, C. jejuni No. 1503-2012 (4); (4), positive colonies EPEC (5,7-11); positive colony STEC (6). PCR products: 180 bp (stx1), positive colonies (5-21). PCR product: 402 bp16 255 bp (stx2), 384 bp (eae) and 534 bp (hylA)15

Table 1 Classification of pathogenic E. coli isolates

Virulence factors a Pathotype of E. coli No. of colonies b eae stx1 stx2 hylA + - - - EPEC 6 (5.88%) - + + - STEC 1 (0.98%) Total 7 (6.86%) a + presence of gene; - absence of gene; b From a total of 102 E. coli isolates.

394 CABALLERO, M.; RIVERA, I.; JARA, L.M.; ULLOA-STANOJLOVIC, F.M. & SHIVA, C. - Isolation and molecular identification of potentially pathogenic Escherichia coli and Campylobacter jejuni in feral pigeons from an urban area in the city of Lima, Peru. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 393-6, 2015.

healthy homing pigeons can invade human enterocytes in vitro30. In some RESUMO prevalence studies about human diarrhea in Peru, Campylobacter has been isolated more frequently from children. In the north of Lima, a study Isolamento e detecção de Escherichia coli e Campylobacter jejuni showed that 10% of patients with diarrhea were carriers of the bacteria, C. potencialmente patogênicos em pombos selvagens de uma área coli (5%), followed by C. jejuni (2.9%) and C. lari (2.1%) being the most urbana na cidade de Lima, Perú frequently observed among children under the age of 55. Furthermore, in clinical samples from some hospitals in Lima, 37 positive cases for Os pombos selvagens (Columbia livia) vivem em estreito contato Campylobacter spp. were obtained from children under one year-old14. com os seres humanos e outros animais. Podem transmitir agentes However, a previous study indicated that exposure to the domestic poultry potencialmente patogênicos e zoonóticos. Os objetivos deste estudo feces was the predominant risk factor for diarrhea in children12. foram isolar e detectar cepas de Escherichia coli diarreiogênica e Campylobacter jejuni de pombos selvagens urbanos de uma área de The presence of pathogenic E. coli in urban feral pigeons has been Lima, Peru. Amostras de fezes frescas foram coletadas em parques reported mainly in developed countries as USA where 7.9% of the urbanos para o isolamento microbiológico para cepas de E. coli em ágar isolates corresponded to the STEC group24; whereas in the present study seletivo e Campylobacter por método de filtração. Identificação molecular less than 1% was obtained. Other studies in Brazil showed that EPEC de patótipos diarreiogênicos de E. coli e Campylobacter jejuni foi and ETEC were present in around 12.1% of feral pigeon droppings29. In realizado por PCR. Vinte e dois parques foram amostrados e 16 colônias Finland, the EPEC group presented a prevalence of 7%16, similar to the de Campylobacter spp. foram isolados. O 100% dos isolados foram results of the present study where EPEC represented 5.88% of the total identificados como Campylobacter jejuni. Além disso, 102 colônias de isolations. Recently, in Spain they reported the EPEC group (6%) from E. coli foram isoladas e 5,88% resultaram como tipo enteropatogênico urban pigeons, but no STEC was found, in contrast with our study where (EPEC) e 0,98% como produtora de toxina Shiga (STEC). Os pombos STEC was isolated27. According to a study in Lima, where 113 isolates selvagens urbanos de Lima no Peru podem atuar como reservatório ou of E. coli were collected from human diarrheic feces, 13.3% carried the ser portador de agentes zoonóticos entéricos potencialmente patogênicos. eae gene (EPEC group); in addition, strains of ETEC, STEC, EAEC and EIEC21 were found. Conversely, the implication of EPEC and STEC ACKNOWLEDGEMENTS groups in neonatal diarrhea has been demonstrated in livestock, STEC being of zoonotic importance. In addition, it has been suggested that The authors would like to thank BSc. Maribel Riveros (Laboratorio saprophytic E. coli strains, in exchanging genetic material from different de Enfermedades Entéricas, Instituto de Medicina Tropical “Alexander sources, could become pathogenic if they acquire genetic sequences for von Humboldt”, Universidad Peruana Cayetano Heredia) for providing specific virulence factors17. Thus, it is suggested that intestinal isolates a reference strain of Campylobacter jejuni, and Dr. Lorena Mori from healthy birds could cause disease in susceptible hosts, depending (Laboratorio de Microbiología, Facultad de Veterinaria y Zootecnia, on the combination of the virulence factors that occur4. Universidad Peruana Cayetano Heredia), for providing Escherichia coli serotype O157: H7 DNA. It is known that direct and indirect contact with animals and food products may be of importance in the transmission of human STEC REFERENCES infections, especially of serotype O157:H7, which has been isolated from chickens and wild birds7,9. However, this study could not demonstrate the 1. Abulreesh HH. Free living rock pigeon (Columba livia) as an environmental reservoir presence of E. coli STEC with more virulence genes than eae or hylA, of enteric bacterial pathogens resistant to antimicrobial drugs in Saudi Arabia. Curr Res Bacteriol. 2011;4:28-33. which would have suggested a zoonotic enterohemorrhagic serotype. On the other hand, contamination of the environment is an important factor 2. Bautista-Mollo GW, Barra-Clavijo R, Aruquipa-Castro RM, Acarapi-Villanueva GA, to consider with respect to the exposition to STEC in farm animals, Aroja-Santos M, Balboa-Silva P. Pesquisa de Campylobacter spp. en heces de palomas which would keep the epidemiological cycle of pathogenic strains26. It is y gallinas. Scientifica. 2009;7:26-8. also known that the water that is used to irrigate many urban parks does 3. Bellido-Blasco J, González-Cano J, Galiano-Arlandis J, Herrero-Carot C, Tirado-Balaguer not receive an adequate treatment, if they receive it at all, and serves as M, Arnedo-Pena A, et al. Factores de riesgo de los casos esporádicos de diarrea por drinking water for animals, which could sustain the persistence of many Campylobacter, Salmonella y rotavirus en niños preescolares. An Pediatr (Barc). enteropathogens in urban birds and its presence on human diarrhea, as 2007;66:367-74. has been suggested in a epidemiological study in a collective community in Israel8. 4. Carranza C, León R, Falcón N, Neumann A, Kromm C. Caracterización y distribución de cepas de Escherichia coli potencialmente patógenas aisladas de pollos broiler de explotaciones avícolas en el Perú. Rev Investig Vet Perú. 2012;23:209-19. The results of this study show, for the first time, the epidemiological status of diarrheagenic and zoonotic bacteria in urban feral pigeons of 5. Castillo M, Gómez F, Laos M, Salinas M. Campylobacter spp. en pacientes con cuadro Lima, Peru. Further studies exploring previous exposure to birds or animal diarreico que acudieron a hospitales de la ciudad de Ica, Perú. Marzo-mayo 1999. feces, antibiotic resistance profile in birds strains, and genotyping and Rev Peru Med Exp Salud Pública. 2003;20:S6. phylogeny analysis between strains of human and animal source may 6. Coker A, Isokpehi RD, Thomas BN, Amisu KO, Obi CL. Human campylobacteriosis in contribute to fulfill the lack of epidemiological data in the country, and developing countries. Emerg Infect Dis. 2002;8:237-44. alert the national health authorities for the need of establishing preventive and control measures in order to reduce the possible causes of potential 7. Doyle MP, Schoeni JL. Isolation of Escherichia coli O157:H7 from retail fresh meats zoonoses. and poultry. Appl Environ Microbiol. 1987;53:2394-6.

395 CABALLERO, M.; RIVERA, I.; JARA, L.M.; ULLOA-STANOJLOVIC, F.M. & SHIVA, C. - Isolation and molecular identification of potentially pathogenic Escherichia coli and Campylobacter jejuni in feral pigeons from an urban area in the city of Lima, Peru. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 393-6, 2015.

8. Fattal B, Wax Y, Davies M, Shuval HI. Health risks associated with wastewater irrigation: 22. Patiño L. Estudio comparativo entre la microscopía convencional y el método de cultivo an epidemiological study. Am J Public Health. 1986;76:977-9. con microfiltros para la identificación del Campylobacter sp. en muestras fecales de pacientes del HNGAI durante el 2° semestre del 2002. [Tesis Especialidad en 9. Ferens WA, Hovde CJ. Escherichia coli O157:H7: animal reservoir and sources of human Patología Clínica]. Lima: Facultad de Medicina, Universidad Nacional Mayor de infection. Foodborne Pathog Dis. 2011;8:465-87. San Marcos; 2002.

10. Fernández H, Gesche W, Montefusco A, Schlatter R. Wild birds as reservoir of 23. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli thermophilic enteropathogenic Campylobacter species in southern Chile. Mem Inst by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, Oswaldo Cruz. 1996;91:699-700. rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598-602.

11. Fernández H. Campylobacter y campylobacteriosis: una mirada desde America del Sur. 24. Pedersen K, Clark L, Andelt WF, Salman MD. Prevalence of Shiga toxin-producing Rev Peru Med Exp Salud Publica. 2011;28:121-7. Escherichia coli and Salmonella entérica in rock pigeons captured in Fort Collins, Colorado. J Wildl Dis. 2006;42:46-55. 12. Grados O, Bravo N, Black R, Butzlers J. Diarrea pediátrica por Campylobacter debida a la exposición doméstica a pollos vivos en Lima, Perú. Bol Of Sanit Panam. 25. Perales M, Camiña M, Quiñones C. Infección por Campylobacter y Shigella como causa 1989;106:205-13. de diarrea aguda acuosa en niños menores de dos años en el distrito de La Victoria, Lima-Perú. Rev Peru Med Exp Salud Publica. 2002;19:186-92. 13. Huapaya B, Huguet J, Suárez V, Torres Y, Montoya Y, Salazar E, et al. Primer aislamiento de Escherichia coli O157:H7 enterohemorrágica en el Perú. Rev Peru Med Exp Salud 26. Rivera FP, Sotelo E, Morales I, Menacho F, Medina AM, Evaristo R, et al. Short Publica. 2001;18:38-9. communication: detection of Shiga toxin-producing Escherichia coli (STEC) in healthy cattle and pigs in Lima, Perú. J Dairy Sci. 2012;95:1166-9. 14. Hurtado L, Rojas R. Incidencia de Campylobacter sp. en pacientes de ambulatorios menores de cinco años con diarrea aguda en dos hospitales de Lima: octubre 27. Sacristán C, Esperón F, Herrera-León S, Iglesias I, Neves E, Nogal V, et al. Virulence 2005-enero 2006. [tesis de Químico Farmacéutico]. Lima: Facultad de Farmacia y genes, antibiotic resistance and integrons in Escherichia coli strains isolated from Bioquímica, Universidad Nacional Mayor De San Marcos; 2008. synanthropic birds from Spain. Avian Pathol. 2014;43:172-5.

15. Jeffrey JS, Atwill ER, Hunter A. Prevalence of Campylobacter and Salmonella at a squab 28. Santaniello A, Gargiulo A, Borrelli L, Dipineto L, Cuomo A, Sensale M, et al. Survey of (young pigeon) processing plant. Poult Sci. 2001;80:151-5. Shiga toxin-producing Escherichia coli O157:H7 in urban pigeons (Columba livia) in the city of Napoli, Italy. Ital J Anim Sci. 2007;6:313-6. 16. Kobayashi H, Pohjanvirta T, Pelkonen S. Prevalence and characteristics of intimin- and Shiga toxin-producing Escherichia coli from gulls, pigeons and broilers in Finland. 29. Silva V, Nicoli JR, Nascimento TC, Diniz CG. Diarrheagenic Escherichia coli strains J Vet Med Sci. 2002;64:1071-3. recovered from urban pigeons (Columba livia) in Brazil and their antimicrobial susceptibility patterns. Curr Microbiol. 2009;59:302-8. 17. Leimbach A, Hacker J, Dobrindt U. E. coli as an all-rounder: the thin line between commensalism and pathogenicity. Curr Top Microbiol Immunol. 2013;358:3-32. 30. Teske L, Ryll M, Rubbenstroth D, Hänel I, Hartmann M, Kreienbrock L, et al. Epidemiological investigations on the possible risk of distribution of zoonotic bacteria 18. Lenz J, Joffe D, Kauffman M, Zhang Y, LeJeune J. Perceptions, practices, and through apparently healthy homing pigeons. Avian Pathol. 2013;42:397-407. consequences associated with foodborne pathogens and the feeding of raw meat to dogs. Can Vet J. 2009;50:637-43. 31. Tresierra-Ayala A, Bendayan M, Bernuy A, Pereyra G, Espinoza F. Campylobacters termotolerantes en aves de corral de la ciudad de Iquitos. Folia Amazon. 1995;7:187- 19. Lillehaug A, Monceyron-Jonassen C, Bergsjø B, Hofshagen M, Tharaldsen J, Nesse LL, 94. et al. Screening of feral pigeon (Colomba livia), Mallard (Anas platyrhynchos) and Graylag Goose (Anser anser) populations for Campylobacter spp., Salmonella spp., 32. Vázquez B, Esperón F, Neves E, López J, Ballesteros C, Muñoz MJ. Screening for several avian influenza virus and avian paramyxovirus. Acta Vet Scand. 2005;46:193-202. potential pathogens in feral pigeons (Columba livia) in Madrid. Acta Vet Scand. 2010;52:45. 20. NG L-K, Kingombe CI, Yan W, Taylor DE, Hiratsuka K, Malik N, et al. Specific detection and confirmation of Campylobacter jejuni by DNA hybridization and PCR. Appl 33. Wasteson Y. Zoonotic Escherichia coli. Acta Vet Scand Suppl. 2001;95:79-84. Environ Microbiol. 1997;63:4558-63. 34. Winn W, Allen S, Janda W, Koneman E, Procop G, Schreckenberg P, et al. Koneman: 21. Ochoa T, Contreras C, Mosquito S. Alcances sobre la situación epidemiológica de las E. diagnóstico microbiológico, texto y atlas en color. 6ta ed. Buenos Aires: Médica coli diarreogénicas aisladas de niños peruanos. Can Pediatr. 2010;34:133-8. Panamericana; 2008.

Received: 15 October 2014 Accepted: 7 January 2015

396 Rev. Inst. Med. Trop. Sao Paulo 57(5):397-405, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500005

CHEMICAL CHARACTERIZATION AND EVALUATION OF ANTIBACTERIAL, ANTIFUNGAL, ANTIMYCOBACTERIAL, AND CYTOTOXIC ACTIVITIES OF Talinum paniculatum

Luis F.C. DOS REIS(1), Cláudio D. CERDEIRA(2), Bruno F. DE PAULA(1), Jeferson J. da SILVA(2), Luiz F.L. COELHO(2), Marcelo A. SILVA(1), Vanessa B.B. MARQUES(3), Jorge K. CHAVASCO(2) & Geraldo ALVES-DA-SILVA(1)

SUMMARY

In this study, the bioactivity of Talinum paniculatum was evaluated, a plant widely used in folk medicine. The extract from the T. paniculatum leaves (LE) was obtained by percolation with ethanol-water and then subjecting it to liquid-liquid partitions, yielding hexane (HX), ethyl acetate (EtOAc), butanol (BuOH), and aqueous (Aq) fractions. Screening for antimicrobial activity of the LE and its fractions was evaluated in vitro through broth microdilution method, against thirteen pathogenic and non-pathogenic

microorganisms, and the antimycobacterial activity was performed through agar diffusion assay. The cytotoxic concentrations (CC90) for LE, HX, and EtOAc were obtained on BHK-21 cells by using MTT reduction assay. The LE showed activity against Serratia marcescens and Staphylococcus aureus, with Minimum Inhibitory Concentration (MIC) values of 250 and 500 µg/mL, respectively. Furthermore, HX demonstrated outstanding activity against Micrococcus luteus and Candida albicans with a MIC of 31.2 µg/mL in both cases. The MIC for EtOAc also was 31.2 µg/mL against Escherichia coli. Conversely, BuOH and Aq were inactive against all tested microorganisms and LE proved inactive against Mycobacterium tuberculosis and Mycobacterium bovis as well. Campesterol, stigmasterol, and sitosterol were the proposed structures as main compounds present in the EF and HX/EtOAc fractions, evidenced by mass spectrometry. Therefore, LE, HX, and EtOAc from T. paniculatum showed potential as possible sources of antimicrobial

compounds, mainly HX, for presenting low toxicity on BHK-21 cells with excellent Selectivity Index (SI = CC90/MIC) of 17.72 against C. albicans.

KEYWORDS: Talinum paniculatum; Antimicrobial activity; C. albicans; Cytotoxicity; Mass spectrometry.

INTRODUCTION tuberculosis (TB), has shown resistance to first-and second-line anti-TB drugs, and globally, TB is one of the leading causes of mortality from In recent years, the necessity of research for new antimicrobial agents infectious diseases13, with an urgent need for a new, affordable, and more has increased due to the global emergence and spread of antimicrobial- effective TB treatment. resistant microorganisms. The discovery of antimicrobial agents to treat infections involving resistant microorganisms is highly desirable, Plants are among the possible sources of new compounds for drug however, it is also a challenging task29. Indeed, although there are parallel discovery. They have been used for therapeutic purposes since ancient endeavors to solve the global public health threats represented by both times, and nowadays, plants play a crucial role in research for new antimicrobial resistance and lack of development of new antimicrobials, therapeutic alternatives in medical practice, either by being useful the urgency for more effective results is still demanded for16,22. as herbal medicine or as sources of new bioactive substances with antimicrobial action for fighting infections. In addition, in discovering As examples of the serious problem represented by the antimicrobial drugs from natural sources, they may also provide lead compounds resistance, Staphylococcus aureus is the main cause of death in hospitals for rational chemical synthesis and structure–activity relationship in the United States of America, in part because of multi-resistance to studies16,18,25. antimicrobials agents3. Bacteria such as Pseudomonas aeruginosa and Escherichia coli, and fungi such as Candida albicans have also acquired In this context, Brazilian biodiversity has great potential to be resistance to antimicrobials agents, consequently, infectious diseases explored, of which is part Talinum paniculatum (Jacq.) Gaertner caused by these microorganisms are responsible by high mortality [synonyms: Talinum patens (L.) Willd, Talinaceae Family], popularly rates3,15. Moreover, Mycobacterium tuberculosis, the causative agent of known in Brazil as “Erva-gorda” and “Língua-de-vaca”, and in other

(1) Universidade Federal de Alfenas, Medical Plants Laboratory, Alfenas, MG, Brasil. (2) Universiade Federal de Alfenas, Biomedical Science Institute, Microbiology and Immunology Department, Alfenas, MG, Brasil. (3) Universidade Federal de Alfenas, Toxicants and Drug Analysis Laboratory(LATF), Alfenas, MG, Brasil. Correspondence to: Cláudio Daniel Cerdeira, Universidade Federal de Alfenas, Departamento de Microbiologia e Imunologia, Instituto de Ciências Biomédicas, R. Gabriel Monteiro da Silva 700, 37130-000 Alfenas, MG, Brasil. Fone: +55 (35) 8881-2245. E-mail: [email protected] DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

countries as “Java ginseng” and “Jewels of opar”. Originally from Candida albicans (ATCC 10231) and Saccharomyces cerevisiae (ATCC tropical America, T. paniculatum is widely spread throughout all Brazilian 2601). The Gram-positive bacteria included Bacillus subtilis (ATCC territory. Morphologically, the whole plant can reach up to 60 cm and its 6633), Bacillus cereus (ATCC 11778), Micrococcus luteus (ATCC 9341), leaves are opposite, petiolate, fleshy, succulent, and with smooth-edged. Enterococcus faecalis (ATCC 51299), and Staphylococcus aureus (ATCC The leaves from T. paniculatum are often used as a green leafy vegetable 6538). The Gram-negative bacteria included Escherichia coli (ATCC for human consumption20. 25922), Serratia marcescens (LMI-UNIFAL), Pseudomonas aeruginosa (ATCC 27853), Proteus mirabilis (ATCC 25922), Salmonella typhimurium T. paniculatum is also used in folk medicine to treat ulcers, as an (ATCC 14028), and Enterobacter aerogenes (LMI-UNIFAL). The emollient in gastrointestinal problems treatment, and used typically against mycobacteria included Mycobacterium bovis (BCG strain, ATCC 27289) a broad spectrum of wounds and skin infections4. According to YULIA and Mycobacterium tuberculosis (H37Ra strain, ATCC 27294). et al. (2006)36 and PANIZZA (1998)24, T. paniculatum has secondary metabolites such as tannins, steroids, and triterpenes. Pharmacological Broth microdilution method: minimum inhibitory concentration studies have demonstrated estrogenic34 and antinociceptive28 activities (MIC) of the LE from T. paniculatum and fractions were determined of T. paniculatum. through broth microdilution against bacteria and fungi, according to methodologies established in M7A6 (CLSI, 2003) and M27A3 (CLSI, The limited repertoire of antimicrobials to treat infections caused 2008) documents7,8. Tests were performed on 96-well microplates. At first, by mycobacteria, bacteria, and fungi has generated a search for new the turbidity of microbial suspensions in sodium chloride 0.9%, cultured substances; for that reason, the objective of this study was to evaluate overnight at 35 °C for 18 hours, were adjusted according to a McFarland the antimicrobial activity of the crude extract from T. paniculatum leaves standard (0.5 tube). Next, 100 µL of Mueller Hinton broth (MHB) was and its fractions against microorganisms of medical and environmental added per well and, after that, 100 µL of either LE or the tested fractions relevance. Additionally, we performed a toxicity test for T. paniculatum (HX, BuOH, EtOAc or Aq) were added. Serial dilutions were made with on BHK-21 cells and an analysis of the phytoconstituents from its leaves, the final concentrations of the LE or fractions ranging from 4000 to 15.6 focusing in the phytosterol compounds. µg/mL. Finally, 10 µL of microorganism was added to each well. The reading was performed visually as previously determined (CLSI, 2003)7, METHODS wherein the presence of turbidity in the wells after incubation for 24 hours

at 37 °C was considered indicative of bacterial growth. The MIC100 was Plant material: the T. paniculatum leaves were collected near the established as the lowest concentration of the extract or fraction in which town of Fama, state of Minas Gerais, Brazil (21º 24’ 53.4” S; 45º 52’ no turbidity had occurred. The growth control was composed of 100 µL 15.8’’ W), in the mornings of June, 2012. The botanical identification of MHB and 10 mL of inoculum. The extract control was composed of of the species T. paniculatum (Talinaceae) was performed using proven 100 µL of MHB and 100 µL of the LE or fraction and the sterility control pharmaco-botanical methods. A sample of plant was stored in the UALF contained only 100 µL of MHB. Chlorhexidine 0.12% also was used as Herbarium at the Federal University of Alfenas (UNIFAL-MG), under a positive control. the specimen number 2338. Antimycobacterial activity: the LE, at a concentration of 50 mg/mL, Obtaining the hydro-alcoholic leaf extract and fractions from T. was evaluated against both the M. bovis and M. tuberculosis through paniculatum: the leaf extract (LE) from T. paniculatum was obtained the agar diffusion assay, according to M24A2 (CLSI, 2008) document through the exhaustive extraction method known as simple percolation. and CHAVASCO et al. (2014)5. Regarding controls, Rifampicin 30 µg The process started by adding the extracting liquid to 200 g of leaf was used as a positive control and distilled water as a negative control. powder, and letting it seep for two hours outside the percolator. Once the two hours had passed, the percolator (alcohol: water 7:3 v/v) was Agar diffusion assay: screening by agar diffusion assay for packed with the mixture. The flow rate of the percolate was 1.0 mL/min/ antimicrobial activity of the LE and fractions (HX and EtOAc) was kg. After extraction, the fluid extracted was placed in a rotary evaporator performed according to methodology previously proposed5. Initially, under reduced pressure, at a temperature of 45 oC. The extract was then suspensions of overnight culture of microbial strains were prepared in lyophilized to completely remove water and obtain the dry extract (17.0% sodium chloride 0.9% with a turbidity corresponding to a 0.5 tube of of yield from the initial content of the leaves from T. paniculatum). To a Mac-Farland scale and inoculated on the surface of culture medium obtain the fractions, the dried extract was subjected to a liquid-liquid Mueller-Hinton Agar. Then, 40 µL of the LE (40 mg/mL) or fraction partition with hexane (1:1, v/v [x4]), ethyl acetate (1:1, v/v [6X]), and (10 mg/mL) were placed in wells of 4 mm of diameter confectioned n-butanol (1:1, v/v [6X]), yielding hexane (HX), ethyl acetate (EtOAc), previously on agar. Next, the plates were incubated at 37 °C for 18 and butanol (BuOH) fractions, as well as a residue termed aqueous hours. At the end of the incubation period, the antimicrobial activity fraction, which SILVA et al. (2004) have previously described32. was evaluated by measuring the growth inhibition zones. Chlorhexidine solution (0.12%) as a positive control and distilled water as a negative In vitro assessment of antimicrobial activity control were utilized. All tests were performed in triplicate.

Microbial strains: the type-strains of microorganisms used were from Screening of cytotoxic activity: cytotoxicity of the leaf extract the American Type Culture Collection (ATCC), and the Microbiology and and HX/EtOAc fractions from T. paniculatum was evaluated using the Immunology Laboratory (LMI) at UNIFAL-MG. These microorganisms MTT (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetra-zolium bromide) are representative of the main groups of mycobacteria, bacteria, and fungi, reduction assay. In the 96-well microplates, 1.0 x 104 BHK-21 cells (cell and display medical and environmental importance. The fungi included lineage from baby hamster kidney) were added to wells containing 0.1 DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

mL of the L-15 medium with 1% fetal bovine serum. Then, the plates leaf extract (LE) from T. paniculatum and fractions against thirteen were incubated for 72 hours in an atmosphere containing 5% CO2 and at medically relevant microorganisms and the data from evaluation of 37 °C. After incubation and removal of the medium, decreasing dilutions antimycobacterial activity against M. tuberculosis and M. bovis is of the extract and fractions, ranging from 1,200 to 9,375 µg/mL plus the presented in Table 1. The LE was active against S. marcescens (Gram- L-15 medium were added and the plates incubated again under the same negative) and S. aureus (Gram-positive), and the hexane (HX) and ethyl conditions. For control, only the medium was added to the wells with acetate (EtOAc) fractions showed considerable inhibitory activity, with cells. After that, 10 µL of MTT were added to the wells, and the plates MIC values -ranging from 31.2 to 500 µg/mL against some Gram- were then incubated for four hours to incorporate the reagent. Finally, positive and Gram-negative bacteria and against the yeast C. albicans. 100 µL of DMSO were added per well for solubilization of formazan The butanol (BuOH) and aqueous (Aq) fractions were inactive against and then the absorbance was read at 570 nm to determine the cytotoxic all tested microorganisms. concentration for 50% (CC50) and 90% of the cells (CC90).

Data from Table 1 also shows cytotoxicity (CC50 and CC90) for LE, Determining chemical compounds through mass spectrometry HX, and EtOAc on BHK-21 cells and the Selectivity Index (SI). Data from (MS): after detecting compounds such as tannin, saponin, and agar diffusion assay are presented in Table 2. The LE showed inhibition phytosteroid, by preliminary phytochemical screenings, we proceeded zone significantly higher than chlorexidine 0.12% against B. subtilis and to structural elucidation of representative molecules from these groups B. cereus (p < 0.05). The activity of the LE against S. aureus and M. luteus, via mass spectrometry. The analyses of the crude extract (LE), and was equivalent to chlorhexidine 0.12%. The percent activity (%) and the the hexane and ethyl acetate fractions were performed using the MS microbial susceptibility index (MSI, %) are presented in Figures 1 and 2. technique. The samples were directly injected into mass spectrometer Shimadzu LCMS8030. The selected fragmentation energy was -20 e V. The analysis by mass spectrometry was conducted to scan all Primary scans of LE, HX and EtOAc were made and subsequent second compounds in the LE, HX, and EtOAc (presented as supplementary data, order fragmentation of selected peaks in order to identify the secondary Figs. from 4 to 6). The main peaks observed were 401, 413, and 415 metabolites. m/z. These peaks correspond to phytosterols found in T. paniculatum. Therefore, in order to identify these compounds, a second order Data analysis: the experiments were performed in triplicate and the fragmentation of the peaks equivalent to 401, 413, and 415 m/z was mean is presented. CC50 and CC90 were calculated by linear regression, performed (also presented on supplementary data, Figs. from 7 to 9). with a dose-effect curve of cells treated with LE, HX, or EtOAc. The By interpreting the second order mass spectra, it was possible to absorbance reduction at 50% and 90% were compared to a control, with propose the structures depicted in Figure 3 (below). For the 401 m/z untreated cells. The selectivity index (SI) was calculated according to peak, the main second order fragments were 207, 147, and 121 m/z.

PROTOPOPOVA et al. (2005), which equals the ratio between CC90 The phytosterol compound Campesterol has a molecular mass of 401 27 and MIC100 .All data from antimicrobial activity by agar diffusion were Da and the fragments found can be suggested by its structure. The presented as mean of the triplicate obtained from experiments and were compound with 413 m/z was associated to stigmasterol (M+1), which has assessed by Analysis of Variance (ANOVA) and Scott-Knott post hoc a molecular mass of 412 Da, and the second order peaks corresponding testing for multiple comparisons of means (differences were considered to the fragments of 207 and m/z of 269 m/z. The fragmentation of the to be significant at p < 0.05). The software used was the Sisvar Version compound with 415 m/z gave peaks of 355, 223, and 267 m/z and complies 5.3 (DEX-UFLA). Besides agar diffusion and MIC values, quantitative with the phytosterol known as sitosterol. evaluation of antimicrobial activity was performed by percent activity values, which reveal the antimicrobial potential of a particular extract or DISCUSSION fraction with a MIC up to 500 µg/mL, and the microbial susceptibility index (MSI), which is used to compare the relative susceptibility among The therapeutic use of plants in traditional medicine, based on the evaluated microorganisms against the extract and fractions with MIC herbal drugs, plays an essential role in several countries. Additionally, up to 500 µg/mL2. the bioactivity of plants has been attributed to the presence of molecules belonging to selected groups of plant metabolites, most of which are Percent activity (%) and Microbial Susceptibility Index (MSI) were from the secondary metabolism. Accordingly, plants are also potential calculated as follows: sources of drug candidates.

No. of susceptible microorganisms In a preliminary phytochemical screening, leaf extract (LE) from T. to a specific extract or fraction paniculatum was positive for pharmacologically active groups as steroids, Activity (%) =× 100 Total no. of tested microorganisms saponins, and tannins; the ethyl acetate (EtOAc) fraction for steroids, triterpenes, and saponins; and the hexane (HX) fraction for steroids and No. of extracts and fractions effective triterpenes. The results directed the research for representatives of these against each microorganisms phytochemical classes by using mass spectrometry (MS), which is an MSI =× 100 instrumental technique of great range and importance in the analysis Total no. of extracts and fractions of natural compounds, providing more complete information on the species chemical composition26. In our study, campesterol, stigmasterol, RESULTS and sitosterol were proposed as major compounds in the LE, HX, and EtOAc from T. paniculatum (Fig. 3); similar results were reported by The minimum inhibitory concentration (MIC) values of the RAMOS et al. (2010)28, who identified the phytosterols campesterol,

399 DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

Table 1

Minimum inhibitory concentration (MIC) values of the LE and fractions from Talinum paniculatum, cytotoxic activity values (CC90 and CC50), and Selectivity Index (SI) against the evaluated microorganisms

Leaf extract Fractions LE HX EtOAc BuOH Aq Microorganisms MIC MIC MIC MIC MIC SI SI SI SI SI (µg/mL) (µg/mL) (µg/mL) (µg/mL) (µg/mL) Gram positive B. cereus N NA 250 2.21 500 0.61 N NA N NA B. subtilis N NA 250 2.21 500 0.61 N NA N NA M. luteus N NA 31.2 17.72 500 0.61 N NA N NA E. faecalis N NA N NA N NA N NA N NA S. aureus 500 2.76 250 2.21 250 1.2 N NA N NA Gram-negative E. aerogenes N NA 500 1.11 70 4.33 N NA N NA E. coli N NA 500 1.11 31.2 9.71 N NA N NA S. marcescens 250 5.52 250 2.21 250 1.22 N NA N NA P. aeruginosa N NA 250 2.21 500 0.61 N NA N NA P. mirabilis N NA 500 1.11 500 0.61 N NA N NA S. typhimurium N NA N NA N NA N NA N NA Fungi C. albicans N NA 31.2 17.72 130 2.33 N NA N NA S. cerevisiae N NA N NA N NA N NA N NA Mycobacteria M. bovis N NA ---- NA ---- NA ---- NA ---- NA M. tuberculosis N NA ---- NA ---- NA ---- NA ---- NA Cytotoxicity

CC90 (µg/mL) 1380 553 303 ------

CC50 (µg/mL 460 230 170 ------

Subtitle: SI = CC90/MIC100; NA: Not applicable; N: Lack of inhibition of microbial growth at the maximum concentration of the extract/fraction used in the experiment; ----: Not Evaluated; LE: Hydroalcoholic leaf extract; HX: Hexane fraction; EtOAc: Ethyl acetate fraction; BuOH: Butanol fraction; Aq: Aqueous fraction.

β-sitosterol, and stigmasterol. were considered inactive.

Currently, given the presence of antimicrobial-resistant The active fractions from T. paniculatum, related to antimicrobial microorganisms and consequently the necessity for antimicrobials with activity, HX and EtOAc, concentrate nonpolar compounds, such as original action, screening of plants as an approach to antimicrobial phytosterols, as demonstrated in this study, and by RAMOS et al., discovery can help in the search of new compounds. AWOUAFACK 201028 and THANAMOOL et al., 201334. The antimicrobial effect of et al. (2013), among other authors1, have reported that plant extracts such compounds has been cited in literature10,12. The actions of nonpolar or fractions assessed by using broth microdilution have promising compounds are the result of mechanisms involving an alteration in the inhibitory potential whether they demonstrate antimicrobial activity at fungal or bacterial cell membrane, leading to a loss of permeability concentrations up to 100 µg/mL and moderate inhibitory activity between and to accumulation of toxic substances, which disrupt the cell 100 and 625 µg/mL. Thus, the LE from T. paniculatum showed moderate metabolism and activate the cytolytic pathways31. The tannins found activity (250 and 500 µg/mL, Table 1), and HX and EtOAc fractions during the preliminary screening have been associated with disruption (HX showed MIC value of 31.2 µg/mL and EtOAc of 31.2 and 70 µg/ of membranes, in addition to chelation or precipitation of essential mL, Table 1) were considered promising sources in the search for new substances to the microorganisms, such as proteins30. Interestingly, substances with antimicrobial action. The butanol and aqueous fractions whereas the HX and EtOAc fractions showed antimicrobial activity and DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

Table 2 Mean of the growth inhibition zone (diameter in mm) of the LE, HX, and EtOAc from Talinum paniculatum

Leaf extract Fractions Positive control Negative control Chlorhexidine Rifampicin Microorganisms LE HX EtOAc distilled water 0.12% 30 µg Mean (mm) Gram positive B. cereus 27.00e 3.00b 7.00b 12.00c NA 0.00a B. subtilis 24.00e 7.00b 7.00b 16.00d NA 0.00a M. luteus 17.00d 5.00b 2.00b 18.00d NA 0.00a E. faecalis 0.00a 0.00a 0.00a 14.00c NA 0.00a S. aureus 17.00d 2.00b 8.00b 16.00d NA 0.00a Mycobacteria M. bovis 0.00a ------NA 26.00 0.00a M. tuberculosis 0.00a ------NA 26.00 0.00a Subtitle: LE: Hydroalcoholic leaf extract; HX: Hexane fraction; EtOAc: Ethyl acetate fraction; Means followed by different letters show difference from each other according to Scott & Knott test (p<0.05); Tests by agar diffusion performed with LE at a concentration of 50 mg/mL against Mycobacteria and at a concentration of 40 mg/mL against Gram positive bacteria; Fractions (HX or EtOAc) were tested at a concentration of 10 mg/mL; NA: Not applicable; ----: Not Evaluated.

Fig. 1 - Percent activity of the LE and fractions from Talinum paniculatum which showed MIC lower than 500 µg/ML. Fig. 2 - Microbial susceptibility index (MSI, %) for microorganisms against LE and fractions phytosterols in their chemical composition, butanol and aqueous fractions from Talinum paniculatum which showed MIC lower than 500 µg/mL. were inactive and phytosterols were not detected. extract or fraction in particular, and it takes into account the number of Regarding the evaluation of antimicrobial activity by using agar susceptible microorganisms, whereas MSI (Fig. 2) compare the relative diffusion, the HX and EtOAc fractions showed weak activity at high susceptibility among the microorganisms, with values ranging from ‘0’ concentrations against some Gram-positive microorganisms (Table 2), (resistant to all extracts/fractions evaluated) to ‘100’ (susceptible to all and no activity against all evaluated Gram-negative microorganisms extracts/fractions evaluated). Figures 1 and 2 indicate that HX and EtOAc (data not shown). Parallel, these fractions exhibited excellent inhibitory fractions were considered the most active, both displaying activity against activity at low concentrations through broth microdilution (Table 1). 67% of the evaluated microorganisms, and for the MSI, S. aureus and S. This can be explained, at least in part, by the fact that these fractions marcescens were considered the most susceptible microorganisms, being are less polar, restricting their diffusions throughout the agar (more inhibited by 60% of the tested extract/fractions. polar), differently from the broth microdilution method, which allows direct contact between microorganism and the fraction. This restriction From toxicity data (CC90 and MIC100) values for LE, HX, and imposed by the agar diffusion assay precludes its use in antimicrobial EtOAc, the selectivity index (SI) for each microorganism was obtained. evaluation from nonpolar fractions. Considering this important factor, The HX against M. luteus and C. albicans had a excellent SI of 17.72, broth microdilution assay would be more appropriate. making it suitable for secondary screening studies aiming the isolation of compounds with promising antimicrobial activity according to The percent activity (Fig. 1) shows the antimicrobial potency of an KLEYMANN et al. (2004)17, since selective toxicity on microbial cells

401 DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

1. H3C and low toxicity on BHK-21 cells were observed. Furthermore, EtOAc CH3 against E. aerogenes (SI = 4.33), E. coli (SI = 9.71), and C. albicans (SI H3C H C CH 3 CH3 3 = 2.33), and LE against S. marcescens (SI = 5.52) and S. aureus (SI = Campesterol CH3 2.76) also exhibited good SI results. H3C CH3 CH3 C D 2 CH3 B Infectious diseases remain the leading cause of morbidity and A 2 1 + D 37 HO C mortality all over the world . Reinforcing this serious issue, the M+ = 207 increasing emergence of multidrug-resistant microorganisms and their

CH3 CH3 dissemination have caused a disturbance because of high morbidity + + CH CH B and mortality rates associated with infectious diseases caused by 1 A CH3 1 HO them. Multidrug-resistant microorganisms are also one of the greatest B 1 A + M - H2O = 147 problems in hospital environment, where frequent and indiscriminate CH2 HO use of antibiotics occurs and hence contributed to it3. Meanwhile, few CH3 antimicrobial agents have been launched on the market, aggravating this + 1 CH2 public health issue. Consequently, the discovery of new antimicrobials to treat infections caused by multidrug resistant microorganisms is M - H O = 121 2 highly desirable and a challenging task22.

2. H3C The LE, HX and EtOAc fractions from T. paniculatum showed CH3

H3C significant inhibitory activity in vitro against microorganisms of great CH3 H3C medical importance. Among these, C. albicans, a fungus that causes

Estigmasterol CH3 H3C H3C opportunistic infections and it is often associated to nosocomial 15 10 CH3 CD H3C infections . DALLEAU et al. (2008) observed in vitro activity of different terpenes reducing the biofilm formation in the Candida A B + D HC species. In our study, HX fraction (high terpene content) from T. HO M+ = 207 paniculatum showed significant inhibitory activity against C. albicans

+ + (31.2 µg/mL). CH3 CH CH2 CH3 CH3

CH3 C D CH3 C D Multidrug-resistant S. aureus is one of the most common causes of nosocomial infections, representing a public health concern. In recent A B A B HO years, it has been performed a screening of plants as possible sources new compounds to treat diseases caused by this microorganism21,35. M - H2O - CH3 = 269 GALLUCCI et al. (2010) reported in vitro inhibitory effect of terpenes against methicillin resistant Staphylococcus aureus (MRSA) and against 3. H3C 12 CH3 the formation of biofilms . Similarly, we observed inhibitory activity H3C CH3 Sitosterol against S. aureus for both HX and EtOAc fractions from T. paniculatum, H3C which presented terpenes and phytosteroids as major components. H3C M + H = 415 CH3 H3C

CH3 H3C CH3 C D Species belonging to the genus Staphylococcus are known as the CH3 C D B most common causes of a variety of skin infections in humans (e.g. B + A HC erysipelas, cellulitis, impetigo, and eczema) and also were associated M = 355 HO with wound contamination23. As shown here, the good activity of the H3C CH3 LE (MIC value of 500 µg/mL) and fractions (MIC values of 250 µg/mL)

+ from T. paniculatum against S. aureus may establish, at least in part, a CH H3C CH3 link between the use of T. paniculatum leaves for the topical treatment CH3 H3C 4 CH3 C D of skin infections and wounds, as foreseen in previous studies , and in + D HC M = 223 the results from our study. However, it is noteworthy that additional A B studies regarding the safety and efficacy of T. paniculatum must be performed and, outside of the scope of this work, justify, advise, or M - CH3 - H2O = 267 confirm the popular use of this plant. 1. – Campesterol: (3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5,6-dimetileptan-2-il]-10,13- dimetil-2,3,4,7,8,9,11,12,14,15,16,17-dodecaidro-1H-ciclopenta[a]fenantren-3-ol; 2. – Estigmasterol: (3S,8S,9S,10R,13R,14S,17R)-17-[(E,2R,5S)-5-etil-6-metilept-3-en-2-il]- Featuring similar clinical and epidemiological importance than 10,13-dimetil-2,3,4,7,8,9,11,12,14,15,16,17-dodecaidro-1H-ciclopenta[a]fenantren-3-ol; S. aureus and C. albicans, the bacteria E. coli, S. marcescens, P. 3. – Sitosterol: 17-(5-Etil-6-metileptan-2-il)-10,13-dimetil-2,3,4,7,8,9,11,12,14,15,16,17- aeruginosa, and P. mirabilis are usually found in the human microbiome dodecaidro-1H-ciclopenta[a]fenantren-3-ol. and, under certain predisposing factors, they are responsible for a range of infections. Due to the intense acquisition and dissemination Fig. 3 - Chemical structures of compounds with m/z 401 (Campesterol), m/z 413 of genes related to multidrug resistance, infectious diseases caused by (Stigmasterol), and m/z 415 (Sitosterol) from Talinum paniculatum. these microorganisms have also received notable attention11,14. In the DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

present study, E. coli, S. marcescens, P. aeruginosa, and P. mirabilis bom índice de seletividade (IS = CC90/MIC) de 17,72 contra C. albicans. were inhibited in vitro by low concentrations of HX and EtOAc (from 31.2 to 500 µg/mL). ACKNOWLEDGEMENTS

Excellent inhibitory activity (MIC of 70 µg/mL) was also observed The authors acknowledge Dr. Marcelo Polo for the identification of for the EtOAc against E. aerogenes, an emerging opportunistic and the plant material. This research was supported by the Coordenação de nosocomial pathogen. The infectious diseases caused by Enterobacter Aperfeiçoamento de Pessoal de Nível Superior (CAPES/Brasil). aerogenes have reached considerable prevalence worldwide, becoming a public health problem, mainly because of its resistance to antimicrobial AUTHOR DISCLOSURE STATEMENT agents6,19. Additionally, E. aerogenes is also considered a food pathogen, often associated with food contamination, with serious consequences The authors declare that there are no conflicts of interest. for human health33. The LE from T. paniculatum was inactive at the concentration tested (50 mg/mL) against M. tuberculosis and M. bovis, ETHICS STATEMENT by agar diffusion assay. This study did not involve any endangered or protected species and In summary, since the crude leaf extract and fractions hexane and no specific permits were required for the described studies. Botanical ethyl acetate from T. paniculatum presented outstanding antimicrobial material from T. paniculatum was collected in a particular area, with activity, and low toxicity, they show antimicrobial potential. access permitted to researchers. Nevertheless, further studies must be performed, either aiming the isolation of compounds in search for new antimicrobials or evaluating AUTHORS’ CONTRIBUTION the safety and efficacy of T. paniculatum LE for a possible use in herbal medicine. Although T. paniculatum (crude leaf extract) showed LFCR designed the study; carried out the plant collection; prepared low MIC against S. aureus, further studies are needed to investigate a the hydroalcoholic leaf extract (LE) and fractions from T. paniculatum; possible synergism between T. paniculatum LE and antibiotics used performed mass spectrometry (MS) analysis; constructed the figures to treat resistan strains (e.g. MRSA) . from 3 to 9; helped in the antimicrobial evaluation and helped drafting the manuscript. CDC participated in the study design; evaluated RESUMO the antimicrobial activity of T. paniculatum; wrote the manuscript; constructed Tables (1 and 2) and Figures (1 and 2); performed data Caracterização química e avaliação das atividades antibacteriana, organization and data analysis (statistical analysis); conducted manuscript antifúngica, antimicobacteriana e citotóxica de Talinum revision and manuscript finalizing in its final form. BFP carried out the paniculatum plant collection; helped prepare hydro-alcoholic leaf extract and fractions and helped in the antimicrobial evaluation. JJS helped in the antimicrobial Neste estudo foi avaliada a bioatividade de Talinum paniculatum, evaluation. LFLC evaluated the cytotoxic activity of T. paniculatum. planta amplamente utilizada na medicina popular. O extrato das folhas MAP contributed with reagents/analytical tools. VBBM performed MS (EF) de T. paniculatum foi obtido por percolação com etanol-água analysis. JKC supervised antimicrobial evaluation. GAS selected the plant e, em seguida, submetido à partição líquido-líquido, obtendo-se as used in this study; came up with the study and participated in its design frações hexânica (HX), acetato-etílica (AcOEt), butanólica (BuOH) e and coordination. All the authors read and approved the final manuscript. aquosa (Aq). A triagem para a atividade antimicrobiana do EF e de suas frações foram avaliadas in vitro através do método de microdiluição em SUPPLEMENTARY DATA caldo contra treze micro-organismos patogênicos e não-patogênicos e, a atividade antimicobacteriana, foi avaliada através do teste de difusão First and second mass analyzers scan of EtOAc, HX, and EF from em ágar. As concentrações citotóxicas (CC90) do EF e das frações HX T. paniculatum (Figs. 4, 5, 6, 7, 8, and 9). e AcOEt foram obtidas sobre células da linhagem BHK-21 através do ensaio de redução do MTT. O EF mostrou atividade contra Serratia marcescens e Staphylococcus aureus, com valores de concentração inibitória mínima (CIM) de 250 e 500 µg/mL, respectivamente. Além disso, HX demonstrou excelente atividade contra Micrococcus luteus e Candida albicans com uma CIM de 31,2 µg/mL, em ambos os casos. Contra Escherichia coli, a CIM para AcOEt foi também de 31,2 µg/mL. Por outro lado, as frações BuOH e Aq foram inativas contra todos os micro-organismos testados, assim como o EF contra Mycobacterium tuberculosis e Mycobacterium bovis. Campesterol, estigmasterol e sitosterol foram as estruturas propostas como principais compostos presentes no EF e nas frações HX e AcOEt, evidenciadas através de espectrometria de massas. Portanto, o extrato da folha e as frações HX e AcOEt provenientes de T. paniculatum apresentaram potencial como possíveis fontes de compostos antimicrobianos, HX principalmente, por ter apresentado uma baixa toxicidade sobre células BHK-21 com um Fig. 4 - First mass analyzers scan of the EtOAc from Talinum paniculatum.

403 DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

Fig. 5 - First mass analyzers scan of the HX from Talinum paniculatum. Fig. 9 - Spectra obtained from compound of m/z 415 from Talinum paniculatum.

REFERENCES

1. Awouafack MD, McGaw LJ, Gottfried S, Mbouangouere R, Tane P, Spiteller M, et al. Antimicrobial activity and cytotoxicity of the ethanol extract, fractions and eight compounds isolated from Eriosema robustum (Fabaceae). BMC Complement Altern Med. 2013;13:289.

2. Bonjar GHS. New approaches in screening for antibacterials in plants. Asian J Plant Sci. 2004;3:55-60.

3. Brown ED. Is the GAIN Act a turning point in new antibiotic discovery? Can J Microbiol. 2013;59:153-6.

4. Caribe J, Campos JM. Plantas que ajudam o homem: guia prático para época. São Paulo: Cultrix/Pensamento; 1991.

Fig. 6 - First mass analyzers scan of the EF from Talinum paniculatum. 5. Chavasco JM, Prado e Feliphe BHM, Cerdeira CD, Leandro FD, Coelho LFL, da Silva JJ, et al. Evaluation of antimicrobial and cytotoxic activities of plant extracts from Southern Minas Gerais cerrado. Rev Inst Med Trop Sao Paulo. 2014;56:13-20.

6. Chen L, Chavda KD, Melano RG, Jacobs MR, Koll B, Hong T, et al. Comparative genomic analysis of KPC-encoding pKpQIL-like plasmids and their distribution in New Jersey and New York hospitals. Antimicrob Agents Chemother. 2014;58:2871-7. doi:10.1128/AAC.00120-14.

7. Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A6. 6th ed. Wayne: CLSI; 2003.

8. Clinical and Laboratory Standards Institute. Reference method for broth dilution antifungal susceptibility testing of yeasts. Approved standard M27-A3. 3rd ed. Wayne: CLSI; 2008. Fig. 7 - Spectra obtained from compound of m/z 401 from Talinum paniculatum. 9. Clinical and Laboratory Standards Institute. Susceptibility testing of mycobacteria, nocardiae, and other aerobic actinomycetes. Approved standard M24- A2. 2nd ed. Wayne: CLSI; 2008.

10. Dalleau S, Cateau E, Bergès T, Berjeaud JM, Imbert C. In vitro activity of terpenes against Candida biofilms. Int J Antimicrobial Agents. 2008;31:572-6.

11. Forsberg KJ, Reyes A, Wang B, Selleck EM, Sommer MOA, Dantas G. The shared antibiotic resistome of soil bacteria and human pathogens. Science. 2012;31:1107-11.

12. Gallucci N, Oliva M, Carezzano E, Zygadlo J, Demo M. Terpenes antimicrobial activity against slime producing and non-producing staphylococci. Mol Med Chem. 2010;21:132-6. 13. Hemaiswarya S, Kruthiventi AK, Doble M. Synergism between natural products and antibiotics against infectious diseases. Phytomedicine. 2008;15:639-52.

14. Higuchi CK, Corrêa CR, Rall VLM, Fernandes A Jr. Evaluation of the diramic system Fig. 8 - Spectra obtained from compound of m/z 413 from Talinum paniculatum. for urine cultures. Braz J Microbiol. 2006;37:221-4. DOS REIS, L.F.C.; CERDEIRA, C.D.; DE PAULA, B.F.; SILVA, J.J.; COELHO, L.F.L.; SILVA, M.A.; MARQUES, V.B.B.; CHAVASCO, J.K. & ALVES-DA-SILVA, G. - Chemical characterization and evaluation of antibacterial, antifungal, antimycobacterial, and cytotoxic activities of Talinum paniculatum. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 397-405, 2015.

15. Hofer U. Sugar-coating virulent Candida albicans. Nat Rev Microbiol. 2013;11:360. 27. Protopopova M, Hanrahan C, Nikonenko B, Samala R, Chen P, Gearhart J, et al. Identification of a new antitubercular drug candidate, SQ 109, from a combinatorial 16. Hong-Fang J, Xue-Juan L, Hong-Yu Z. Natural products and drug discovery. Can library of 1,2-ethylenediamines. J Antimicrob Chemother. 2005;56:968-74. thousands of years of ancient medical knowledge lead us to new and powerful drug combinations in the fight against cancer and dementia? EMBO Rep. 2009;10:194-200. 28. Ramos MPO, Silva GDF, Duarte LP, Miranda RRS, Souza GHB, Belinelo VJ, et al. Antinociceptive and edematogenic activity and chemical constituents of Talinum 17. Kleymann G, Werling HOA. Generally applicable, high-throughput screening- paniculatum Willd. J Chem Pharm Res. 2010;2:265-74. compatible assay to identify, evaluate, and optimize-antimicrobial agents for drug therapy. J Biomol Screen. 2004;9:578-87. 29. Ríos JL, Recio MC. Medicinal plants and antimicrobial activity. J Ethnopharmacol. 2005;100:80-4. 18. Koehn FE, Carter GT. The evolving role of natural products in drug discovery. Nat Rev Drug Discov. 2005;4:206-20. 30. Scalbert A. Antimicrobial properties of tannins. Phytochemistry. 1991;30:3875-83.

19. Martínez D, Rodulfo HE, Rodriguez L, Caña LE, Medina B, Guzman M, et al. First 31. Schenkel EP, Gosmann G, Athayde ML. Saponinas. In: Simões CM, Schenkel EP, report of metallo-β-lactamases producing Enterobacter spp. strains from Venezuela. Gosmann G, Mello JCP, Mentz LA, Petrovick PR, organizadores. Farmacognosia: Rev Inst Med Trop Sao Paulo. 2014;56:67-9. da planta ao medicamento. 3a ed. Porto Alegre: Ed. UFRGS/Ed. UFSC; 2001. p. 597-619. 20. Martins ER, Castro DM, Castellani DC, Dias JE. Plantas medicinais. Viçosa: Ed. Universidade Federal de Viçosa; 2000. 32. Silva MC, Gayer CR, Lopes CS, Calixto NO, Reis PA, Passaes CP, et al. Acute and topic anti-edematogenic fractions isolated from the seeds of Pterodon pubescens. J 21. Mattana CM, Satorres SE, Sosa A, Fusco M, Alcará LE. Antibacterial activity of Pharm Pharmacol. 2004;56:135-41. extracts of Acacia aroma against methicillin-resistant and methicillin-sensitive Staphylococcus. Braz J Microbiol. 2010;41:581-7. 33. Techathuvanan C, Reyes F, David JR, Davidson PM. Efficacy of commercial natural antimicrobials alone and in combinations against pathogenic and spoilage 22. Morse SS. Factors in the emergence of infectious diseases. Emerg Infect Dis. 1995;1:7- microorganisms. J Food Prot. 2014;77:269-75. 15. 34. Thanamool C, Papirom P, Chanlun S, Kupittayanant S. Talinum paniculatum (Jacq.) 23. Nadarajah J, Lee MJ, Louie L, Jacob L, Simor AE, Louie M, et al. Identification Gertn: a medicinal plant with potential estrogenic activity in ovariectomized rats. Int of different clonal complexes and diverse amino acid substitutions in penicillin- J Pharm Pharm Sci. 2013;5:478-85. binding protein 2 (PBP2) associated with borderline oxacillin resistance in Canadian Staphylococcus aureus isolates. J Med Microbiol. 2006;55:1675-83. 35. Vilar JB, Ferreira FL, Ferri PH, Guillo LA, Chen Chen L. Assessment of the mutagenic, antimutagenic and cytotoxic activities of ethanolic extract of araticum 24. Panizza S. Plantas que curam: cheiro de mato. 15. ed. São Paulo: IBRASA; 2008. (Annona crassiflora Mart. 1841) by micronucleus test in mice. Braz J Biol. 2008;68:141-7. 25. Patwardhan B, Vaidya ADB. Natural products drug discovery: accelerating the clinical candidate development using reverse pharmacology approaches. Indian J Exp Biol. 36. World Heatlh Organization. Report on infectious diseases. Geneva:WHO; 2012. 2010;48:220-7. 37. Yulia, Wientarsih I, Razier-A N. The study of phytochemistry of Java ginseng compare 26. Pereira RJ, Cardoso MGJ. Metabólitos secundários vegetais e benefícios antioxidantes. to Korean ginseng. J Agric Rural Dev Trop Subtrop. 2006;(Suppl. 88):45-9. J Biotec Biodivers. 2012;3:146-52. Received: 25 August 2014 Accepted: 21 January 2015

405 LIBRARY OF THE SÃO PAULO INSTITUTE OF TROPICAL MEDICINE

Website: http://www.imt.usp.br/sobre-o-imtsp/biblioteca Address: Biblioteca do Instituto de Medicina Tropical de São Paulo da Universidade de São Paulo Av. Dr. Enéas de Carvalho Aguiar, 470. 05403-000 - São Paulo - SP - Brazil. Telephone: 5511 3061-7003

The Library of the São Paulo Institute of Tropical Medicine (IMTSP Library) was created on January 15, 1959 in order to serve all those who are interested in tropical diseases.

The IMTSP Library has a collection consisting of books, theses, annals of congresses, journals, and reference works.

The collection of the Library can be searched through the USP Bibliographic Database – Dedalus at the URL http://200.144.190.234/F Rev. Inst. Med. Trop. Sao Paulo 57(4):407-411, July-August, 2015 http://dx.doi.org/10.1590/S0036-46652015000500006

MORBIDITY AND MORTALITY DUE TO AIDS: A STUDY OF BURDEN OF DISEASE AT A MUNICIPAL LEVEL

Jane DA SILVA(1,2), Victoria RAMOS(2), Helena Caetano Gonçalves DA SILVA(1) & Jefferson TRAEBERT(1,2)

SUMMARY

Introduction: The purpose of measuring the burden of disease involves aggregating morbidity and mortality components into a single indicator, the disability-adjusted life year (DALY), to measure how much and how people live and suffer the impact of a disease. Objective: To estimate the global burden of disease due to AIDS in a municipality of southern Brazil. Methods: An ecological study was conducted in 2009 to examine the incidence and AIDS-related deaths among the population residing in the city of Tubarao, Santa Catarina State, Brazil. Data from the Mortality Information System in the National Health System was used to calculate the years of life lost (YLL) due to premature mortality. The calculation was based on the difference between a standardized life expectancy and age at death, with a discount rate of 3% per year. Data from the Information System for Notifiable Diseases were used to calculate the years lived with disability (YLD). The DALY was estimated by the sum of YLL and YLD. Indicator rates were estimated per 100,000 inhabitants, distributed by age and gender. Results: A total of 131 records were examined, and a 572.5 DALYs were estimated, which generated a rate of 593.1 DALYs/100,000 inhabitants. The rate among men amounted to 780.7 DALYs/100,000, whereas among women the rate was 417.1 DALYs/100,000. The most affected age groups were 30-44 years for men and 60-69 years for women. Conclusion: The burden of disease due to AIDS in the city of Tubarao was relatively high when considering the global trend. The mortality component accounted for more than 90% of the burden of disease.

KEYWORDS: Morbidity; Mortality; AIDS; Burden of disease.

INTRODUCTION a more comprehensive indicator for measuring the burden that HIV/AIDS contributes to society, thus providing a better basis to guide fundamental With the advent of the antiretroviral therapy, there was a reduction improvements in the health system. in mortality and morbidity caused by HIV/AIDS, and the disease has become a chronic condition17. However, it remains a significant public The Santa Catarina State reported 2,298 cases of HIV among adults in health problem on a global scale1 and its mortality rates are still used to 2011. The incidence rate in 2011 was 36.4 cases per 100,000 inhabitants identify it as such10. Despite its importance, mortality rates seem limited of both sexes, and the city of Tubarao ranked 35th nationally in the number because such an indicator does not infer the reduction in quality of life of AIDS cases and 13th in the Santa Catarina State, with an incidence rate caused by HIV/AIDS. Therefore, it has been considered inappropriate of 40.1/100,000 inhabitants3. A study on the epidemiological profile of for measuring the health of a population9. patients with HIV treated in this municipality in 2010 revealed that the average age was nearly 40 years and there was predominance of men In recent decades, the burden of disease has been investigated, (57%), and in accordance with the criteria for the disease notification, which is nothing more than aggregating, in a single indicator, the data 45.2% of these patients had AIDS. In addition, 50% had detectable on mortality and morbidity generated by a disease or health condition. viral loads and 64% were on antiretroviral therapy. In that study, the This health indicator is termed disability-adjusted life years (DALY)12. incidence rate was higher among Caucasians than among other racial and One DALY represents one year of healthy life that is lost or lived with ethnic groups, and also higher among those with less education. Sexual disability. This is an indicator that seeks to measure simultaneously the contact was the main mode of transmission15. Literature data on burden impact of mortality and health problems affecting the quality of life of of disease caused by AIDS is scarce in Brazil. To date, the burden of individuals. It is defined as the sum of the number of years of life lost AIDS in the Brazilian municipalities is unknown. The aim of this study (YLL) prematurely, and the number of years lived with disability (YLD). was to estimate the burden of disease due to AIDS at a municipal level, Based on this premise, the burden of disease calculation has shown to be namely in Tubarao, Santa Catarina State, Brazil. The city of Tubarao is

(1) Universidade do Sul de Santa Catarina (UNISUL), Programa de Pós-graduação em Ciências da Saúde, Florianópolis, Santa Catarina, Brasil. (2) Universidade do Sul de Santa Catarina (UNISUL), Departamento de Medicina, Florianópolis, Santa Catarina, Brasil. Correspondence to: Jane Da SILVA, Universidade do Sul de Santa Catarina, Programa de Pós-graduação em Ciências da Saúde, Av. Pedra Branca 25, Sala 119, Bloco B, Cidade Universitária Pedra Branca, 88137-270 Palhoça, SC, Brasil. Phone: 55 48 3279-1167 or 3279-1168. E-mail: [email protected] DA SILVA, J.; RAMOS, V.; DA SILVA, H.C.G. & TRAEBERT, J. - Morbidity and mortality due to AIDS: a study of burden of disease at a municipal level. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 407-11, 2015.

located in the southern region of the Santa Catarina State, 133 km from Brazil6, i.e. < 1 year, 1-4 years, 5-14 years, 15-29 years, 30-44 years, the State capital. The estimated population was 96,529 inhabitants in 45-59 years, 60-69 years, 70-79 years, and 80 years or older. 2009. Santa Catarina is famous for its ceramics and tourism, centering on thermal spas5. Ethical implications: This study used data from official health data systems available in the public domain, with no ethical breaches. METHODS RESULTS In 2009, an observational epidemiological study with an ecological design was conducted on data and notifications of deaths from AIDS. A total of 131 records regarding AIDS were analyzed in the Inclusion criteria were deaths and reported AIDS cases of individuals, municipality of Tubarao in 2009, of which 21 (16%) were deaths and both children and adults, living in the municipality of Tubarao, Santa 110 (84%) reported cases. Catarina State, in that year. The year of 2009 was chosen because, at the time of the data collection, it was the latest year for which there were Among the surveyed subjects, 468.8 YLLs were estimated, which available consolidated data on the Mortality Information System (SIM). generated a rate of 485.6 YLLs/100,000 inhabitants. The YLL found for males was 304.7, which generated 652.1 YLLs/100,000 men, whereas The survey followed the method for burden of disease study, carried out for females, the YLL found was 164.1, which generated a rate of 329.5 for Brazil as a whole6. The Mortality Information System (SIM), available YLLs /100,000 women. The mean age at notification was 38.8 years (SD at www.datasus.gov.br (retrieved on November 15th, 2012) was used to = 9.2), and the mean age at death was 43.0 years (SD = 12.4). collect data on the number of AIDS-related deaths in 2009. AIDS-related deaths (ICD 10: B20 to B24) were included as the primary or secondary Among males, the age group of 30-44 years was the most affected, cause. The Information System for Notifiable Disease (SINAN) was used with 1,393.6 YLLs/100,000 men at that age group, followed by the age to collect data of morbidity of individuals confirmed as AIDS cases in group of 45-59 years, with 887.3 YLLs/100,000 men at that age group. 2009. Operations were double-checked to avoid possible duplication of Among females, the age group of 60-69 years was the most affected, cases. Thus, each case was counted only once. Deaths from AIDS were with 1,292.46 YLLs/100,000 women at that age group, followed by the reported to the SIM, whereas AIDS cases were notified to the SINAN. age group of 45-59 years, with 635.35 YLLs/100,000 women at that age Similarly to the Study of Global Burden of Disease in Brazil, an addition of group, as shown in Figure 1. 50% incident cases was made to compensate for possible underreporting6.

Calculation of the mortality indicator - YLL: The YLL was calculated as the difference between age at death and the parameters used in the study of burden of disease in Brazil, i.e. life expectancy at birth, as in Japan, which is 80 years for men and 82.5 years for women. The use of a standardized life expectancy rate allows for international comparability. A discount rate of 3% was applied to years of life lost in the future6. Thus, future years suffered from the effect of the discount rate so that each year of healthy life lost was recorded as 97% of the previous year, and so on.

Morbidity indicator calculation - YLD: The number of years lived with disability (YLD) was estimated by multiplying the weight of the disability and its duration, using incident cases. In studies of burden of disease, the value of time lived with a non-fatal health situation or disability is called “disability weights”12. The weight of disability (0.167) 18 recommended by the World Health Organization for AIDS was used. Fig. 1 - Distribution of years of life lost (YLL) rates per 100,000 inhabitants according to The weight used was that one given to cases under treatment. All cases age and gender. Tubarão, Santa Catarina State, 2009. were regarded as “under treatment”. The mean disease duration was set at 108 months8. In total, 103.7 YLDs were estimated, which generated a rate of 107.4 YLDs/100,000 inhabitants. Among males, the number of YLDs was 60.1, Disease burden calculation - DALY: A DALY is equal to the sum of which generated a rate of 128.7 YLDs/100,000 men, whereas among YLL and YLD. The number of years of life lost (YLL), YLD and DALY females, it was 43.6 YLDs, generating a rate of 87.5 YLDs/100,000 rates were calculated per 100,000 inhabitants, for each age group/gender women. strata. For that purpose, information about residents in the municipality in 2009 was collected, estimated by gender and age group, according to Among males, the age group of 30-44 years was the most affected, the Brazilian Geography and Statistics Institute - IBGE’s preliminary followed by the age group of 45-59 years, with 316.6 and 201.1 population total estimates for intercensus years available at www.datasus. YLDs/100,000 men at those age groups, respectively. gov.br (retrieved on November 15th, 2012). Given that age information was disaggregated, the subjects were classified into nine age groups, Among females, the age group of 30-44 years was the most affected, according to the methodology used by the burden of disease study in followed by the age group of 45-59 years, with 242.6 and 75.9 YLDs/100,000

408 DA SILVA, J.; RAMOS, V.; DA SILVA, H.C.G. & TRAEBERT, J. - Morbidity and mortality due to AIDS: a study of burden of disease at a municipal level. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 407-11, 2015.

women at those age groups, respectively, as shown in Figure 2. notifications of AIDS cases in the municipality of Tubarao in 2009. The year 2009 was marked in Santa Catarina by a peak of AIDS-related mortality rate with 615 deaths and a mortality rate of 10.0/100,000 inhabitants. Men had double the mortality rate compared to women, and Tubarao was among the 11 municipalities in the State with the highest mortality rates16. Possible causes for this increased mortality include early diagnosis failures, lack of adherence to treatment, antiretroviral treatment regimens, inadequate prophylaxis, difficult access to medical care, and characteristics of opportunistic diseases in the Santa Catarina State13.

The burden of AIDS in Tubarao generated rates of 485.6 YLLs/100,000 inhabitants, 107.4 YLDs/100,000 inhabitants, and consequently, 593.1 DALYs/100,000 inhabitants. In addition to the obvious relevance of this information at the local, State and national levels, these results allow the comparison of data between countries because the study has used internationally consolidated methods for burden of disease studies.

Fig. 2 - Distribution of years lived with disability (YLD) rates per 100,000 inhabitants The burden of disease indicators are appropriate for health planning according to age and gender. Tubarão, Santa Catarina State, 2009. at a municipal level because they allow researchers to make comparisons, they provide valuable information for public health policymakers, based In total, 572.5 DALYs were estimated, which generated a rate of 593.1 not only on mortality rates but also on the impact generated by the non- DALYs/100,000 inhabitants. Among males, the number of DALYs was fatal cases. These parameters enable direct interventions to improve 364.8, which generated a rate of 780.7 DALYs/100,000 men, whereas the quality of health care for specific groups, such as individuals living among females it was 207.7 DALYs, which generated a rate of 417.1 with HIV. DALYs/100,000 women. As soon as the importance of using close-to-reality data for planning Given that the DALY is the sum of YLL and YLD, we observed health actions at a municipal level is understood, it will be possible to again that, among males, the age group of 30-44 years was the most move on to the analysis of the behavior of the used indicator. It was affected, with 1,712.9 DALYs/100,000 men at that age group, followed found that both, the YLL and YLD rates, were much higher among men by the age group of 45-59 years, with 1,088.4 DALYs/100,000 men at than women, resulting in higher levels of burden of AIDS in men. This that age group. Among females, the age group of 60-69 years was the finding is consistent with those found in other countries1,8. Moreover, data most affected, with 1,292.5 DALYs/100,000 women at that age group, from the Brazilian literature, although not so recent, indicated that the followed by the age group of 45-59 years, with 711.2 DALYs per 100,000 level of AIDS burden was higher among men than women6. Similarly, in women at that age group, as illustrated in Figure 3. 2009, data from the Santa Catarina State also indicated that the level of AIDS burden was higher among men than women7. However, due to the progressive reduction in the disease male/female incidence ratio over the last few years, it has been stated that AIDS is undergoing a feminization process4. In Tubarao, an epidemiological study conducted in 2010 showed that the infection was predominant among men (57%)15. Therefore, regional and State gender-related differences must be taken into account.

The analysis of the burden components revealed that the YLL indicator, which reflects mortality, accounted for 81.9% of DALYs. As it can be seen, AIDS-related mortality still poses a high burden to the local community. Indeed, the years lost due to premature death are quite high for the general population. Some studies show that YLL is 77.5% in Santa Catarina7, and 75.2% in the world9. Mortality rates have reduced in Brazil, especially after the introduction of the universal free distribution of antiretroviral drugs. However, mortality remains high, and Santa Catarina is one of the Brazilian States with the highest rates14. This finding shows how AIDS generates early mortality at a municipal Fig. 3 - Distribution of disability-adjusted life years (DALY) rates per 100,000 inhabitants level. These data are relevant not only for the clear perception of its high according to age and gender. Tubarão, Santa Catarina State, 2009. DALY/100,000 population dimension within the Santa Catarina State, and the country, but mainly help to boost the generation of effective control policies and preventive DISCUSSION education programs.

This study showed that there were 21 AIDS-related deaths and 110 Economic, social and cultural inequalities are everywhere in

409 DA SILVA, J.; RAMOS, V.; DA SILVA, H.C.G. & TRAEBERT, J. - Morbidity and mortality due to AIDS: a study of burden of disease at a municipal level. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 407-11, 2015.

the world. They are factors that directly interfere with the specific Brasil. Métodos: Foi desenvolvido um estudo ecológico envolvendo vulnerability of these populations to HIV/AIDS infection. A study by registros de incidência e de óbitos por Aids na população residente em SCHUELTER-TREVISOL et al. showed that AIDS prevalence was Tubarão, SC, em 2009. Para cálculo do componente de mortalidade-YLL higher among poor educated individuals in Tubarao in 201015. In this foram utilizados dados de mortalidade do Sistema de Informações de context, the education level is closely linked to vulnerability issues, Mortalidade do Sistema Único de Saúde. Calculou-se pela diferença de given that it affects the degree of information. Besides education, unsafe uma expectativa de vida padronizada e a idade do óbito, aplicada uma taxa sex and drug use must be considered, because these are frequent forms de desconto de 3% ao ano. Para cálculo do componente de morbidade- of HIV transmission in Tubarao15. Accordingly, a study that assessed YLD foram utilizados dados do Sistema de Informação de Agravos de adherence to antiretroviral therapy in Tubarao showed that the diagnosis Notificação. O DALY foi estimado pela soma do YLL e YLD. Foram of opportunistic diseases is one of the factors associated with adherence estimadas as taxas dos indicadores por 100 mil habitantes segundo sexo to treatment2. A higher adherence to treatment in advanced stages of the e faixa etária. Resultados: Foram analisados 131 registros e estimados disease is accompanied by a high risk of mortality and may represent a 572,5 DALYs, o que gerou uma taxa de 593,1 DALYs/100 mil habitantes. greater burden of disease because of the late onset of treatment. No sexo masculino a taxa foi de 780,7 DALY/100 mil homens, já nas mulheres esta taxa correspondeu a 417,1 DALYs/100 mil mulheres. As Years lived with disability, represented by the YLD component that faixas etárias mais acometidas foram de 30 a 44 anos no sexo masculino determines indirectly the loss of quality of life, although having the lowest e de 60 a 69 anos no sexo feminino. Conclusão: O impacto da doença rate in the burden of disease cannot be overlooked. This is particularly causada pela Aids no município de Tubarão mostrou-se elevado quando important because the age group of 30-44 years was the most affected considerada a tendência global. O componente de mortalidade contribuiu both in men and women, when people are living the most productive years com mais de 90% do indicador de impacto da doença. of their lives. Living with AIDS disabilities in this stage of life can lead to losses in the medium and long run considering both, the individual ACKNOWLEDGEMENTS and the society. Review strategies for prevention and searching to adapt conditions of people in that situation, mainly targeting the younger age This study was partially subsidized by the Unisul Research Support groups, may lead to better adaptability and improve quality of life. Program (PUIP), University of Southern Santa Catarina, to which the authors express their gratitude. Although this study was restricted to a particular municipality, it used a method that has been stimulated in epidemiological research worldwide. REFERENCES This is particularly relevant because it allows for multiple comparisons, both globally and between communities. While serving as the basis for 1. Bermudez-Tamayo C, Martin JJM, Ruiz-Pérez I, Lima AOL. Factors associated with future longitudinal analyses, it constitutes a unique opportunity given that improvement in disability-adjusted life years in patients with HIV/AIDS. BMC Public Health. 2008;8:362. the studies on burden of disease reflect a summary of the population’s 11 health , with special importance in the case of AIDS. 2. Blatt CR, Citadin CB, Souza FG, Mello RG, Galato D. Avaliação da adesão aos anti- retrovirais em um município no sul do Brasil. Rev Soc Bras Med Trop. 2009;42:131-6. One limitation of this type of study is the fact that there is the possibility of underreporting of AIDS cases and deaths. Moreover, given that this is 3. Brasil. Ministério da Saúde. Boletim epidemiológico HIV-AIDS: 52ª semana epidemiológica; ano I, n1, dezembro de 2012. Brasília: Ministério da Saúde; 2012. an ecological study, the interpretation of results should be limited to the [cited 2014 Aug 9]. Available from:

In conclusion, studies on AIDS-related burden at a municipal level 4. Brasil. Ministério da Saúde. Plano integrado de enfrentamento da feminilização da can be an important tool for health planning. In the municipality of epidemia de AIDS e outras DST. Brasília: Ministério da Saúde; 2007. [cited 2013 Dec 5]. Available from: trend. The YLL mortality component accounted for more than 90% of the indicator, which should be considered carefully, because of the burden 5. Brasil. Secretaria de Apoio às Micro e Pequenas Empresas de Santa Catarina. Santa that it represents for the community. With regard to the YLD disability Catarina em numeros: Tubarão/Sebrae/SC. Florianopolis: Sebrae/SC; 2013. [cited component, although it has indicated a lower burden than YLL, it should 2014 Aug 10]. Available from: be taken into account in planning public health policies, given that the most affected age group was also the most productive one. 6. Fundação Oswaldo Cruz. Escola Nacional de Saúde Pública. Estimativa de doença no Brasil. Rio de Janeiro: FIOCRUZ; 2002. [cited 2013 Sep 14]. Available from:

7. Gonçalves e Silva HC, Silva J, Traebert J. Burden of AIDS in a Brazilian State. J Infect Morbidade e mortalidade por AIDS: estudo sobre o impacto da Public Health. 2014;7:308-13. doença em nível municipal 8. Guibu IA, Barros MBA, Donalísio MR, Tayra A, Alves MCGP. Survival of AIDS patients Introdução: A proposta de mensuração do impacto da doença in the Southeast and South of Brazil: analysis of the 1998-1999 cohort. Cad Saude implica a integração em um mesmo indicador, o DALY, de componentes Publica. 2011;27(Suppl 1):s79-92. de morbidade e mortalidade, para medir quanto e como as populações 9. McKenna MT, Michaud CM, Murray CJL, Marks JS. Assessing the burden of disease in vivem e sofrem o impacto de determinada doença. Objetivo: Estimar the United States using disability-adjusted life years. Am J Prev Med. 2005;28:415- o impacto da doença causada pela Aids em um município do sul do 23.

410 DA SILVA, J.; RAMOS, V.; DA SILVA, H.C.G. & TRAEBERT, J. - Morbidity and mortality due to AIDS: a study of burden of disease at a municipal level. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 407-11, 2015.

10. Melse JM, Essink-Bot ML, Kramers PG, Hoeymans N. A national burden of disease 15. Schuelter-Trevisol F, Pucci P, Justino AZ, Pucci N, Silva ACB. Perfil epidemiológico dos calculation: Dutch disability-adjusted life years. Dutch Burden of Disease Group. pacientes com HIV no sul do Estado de Santa Catarina, Brasil, em 2010. Epidemiol Am J Public Health. 2000;90:1241-7. Serv Saúde. 2013;22:87-94.

11. Murray CJ, Vos T, Lozano R, Naghavi M, Flaxman AD, Michaud C, et al. Disability- 16. Silva IB, Gandin NI. O perfil epidemiológico da AIDS. Florianópolis: Secretaria de adjusted life years (DALYs) for 291 diseases and injuries in 21 regions, 1990- Estado da Saúde, Diretoria de Vigilância Epidemiológica. 2010. [cited 2014 Jun 28]. 2010: a systematic analysis for the global burden of disease study 2010. Lancet. Available from:

12. Murray CJ. Quantifying the burden of disease: the technical basis for disability-adjusted 17. Torres TS, Cardoso WS, Velasque LS, Martins LMS, Oliveira MS, Veloso VG, et al. life years. Bull World Health Organ. 1994;72:429-45. Aging with HIV: an overview of an urban cohort in Rio de Janeiro (Brazil) across decades of life. Braz J Infect Dis. 2013;3:324-31. 13. Oliveira OV. Situação epidemiológica da Aids em Santa Catarina. Florianópolis: Boletim Epidemiológico DST/AIDS; 2001. [cited 2014 Aug 11]. Available from: for disease and conditions. [cited 2013 Aug 18]. Available from: 14. Reis AC, Santos EM, Cruz MM. A mortalidade por Aids no Brasil: um estudo exploratório de sua evolução temporal. Epidemiol Serv Saúde. 2007;16:195-205. Received: 17 April 2014 Accepted: 5 January 2015

411 Rev. Inst. Med. Trop. Sao Paulo 57(5):412, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500007

CORRESPONDENCE

PATHOGENIC FUNGI IN BIRD EXCRETA: A FORGOTTEN PUBLIC HEALTH PROBLEM

October 31, 2014

Dear editor,

The recent report on “fungi in bird excreta” is very interesting1. MENDES et al. found many contaminated fungi in the samples, and mentioned for the requirement for public health concern preventive measures, such as “proper cleaning of cages1”. In fact, the concern of fungi contamination in bird excreta should be raised. It is usually forgotten. In uncaged bird, the contamination might be more problematic since it is not possible to effectively clean. In our experience, the examination of bird excreta from public yard, showed that up to 9.09% of the samples were contaminated with pathogenic fungi. To set a system to control bird excreta and surveillance of pathogen contamination in excreta should be an important topic for any community.

Beuy JOOB (1) Viroj WIWANITKIT (2) (1) Sanitation 1 Medical Academic Center, Bangkok Thailand (2) Visiting professor, Hainan Medical University, China Correspondence to: Beuy Joob Sanitation 1 Medical Academic Center, Bangkok Thailand E-mail: [email protected]

REFERENCES

1. Mendes JF, Albano AP, Coimbra MA, Ferreira GF, Gonçalves CL, Nascente P da S, et al. Fungi isolated from the excreta of wild birds in screening centers in Pelotas, RS, Brazil. Rev Inst Med Trop Sao Paulo. 2014;56:525-8.

2. Soogarun S, Wiwanitkit V, Palasuwan A, Pradniwat P, Suwansaksri J, Lertlum T, et al. Detection of Cryptococcus neoformans in bird excreta. Southeast Asian J Trop Med Public Health. 2006;37:768-70. Rev. Inst. Med. Trop. Sao Paulo 57(5):413-419, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500008

RELATED FACTORS FOR COLONIZATION BY Candida SPECIES IN THE ORAL CAVITY OF HIV-INFECTED INDIVIDUALS

Ralciane de Paula MENEZES(1,5), Aércio Sebastião BORGES(2,3), Lúcio Borges de ARAUJO(4), Reginaldo dos Santos PEDROSO(1,5) & Denise Von Dolinger de Brito RÖDER(1,6)

SUMMARY

The colonization of the oral cavity is a prerequisite to the development of oropharyngeal candidiasis. Aims: The aims of this study were: to evaluate colonization and quantify Candida spp. in the oral cavity; to determine the predisposing factors for colonization; and to correlate the levels of CD4+ cells and viral load with the yeast count of colony forming units per milliliter (CFU/mL) in HIV-positive individuals treated at a University Hospital. Saliva samples were collected from 147 HIV patients and were plated on Sabouraud Dextrose Agar (SDA) and chromogenic agar, and incubated at 30 ºC for 72 h. Colonies with similar morphology in both media were counted and the result expressed in CFU/mL. Results: Of the 147 HIV patients, 89 had positive cultures for Candida spp., with a total of 111 isolates, of which C. albicans was the most frequent species (67.6%), and the mean of colonies counted was 8.8 × 10³ CFU/mL. The main predisposing factors for oral colonization by Candida spp. were the use of antibiotics and oral prostheses. The use of reverse transcriptase inhibitors appears to have a greater protective effect for colonization. A low CD4+ T lymphocyte count is associated with a higher density of yeast in the saliva of HIV patients.

KEYWORDS: Candida, HIV; Candidiasis; Oral; Colonization.

INTRODUCTION a prerequisite for the development of the disease. Before the onset of symptoms of infection, there is usually an intense colonization by Acquired Immunodeficiency Syndrome (AIDS) is characterized by Candida spp.8,33. Other factors that favor the colonization of the oral an impaired immune system, resulting in a continuing decrease in the cavity by Candida species include: smoking, diabetes mellitus, oral number of CD4+ T lymphocytes. As a result of this, several opportunistic prostheses, extreme age, antibiotics, decreased salivary flow, food habits, infections may be present in an individual infected with HIV, including and nutritional status10,24,29. cryptococcosis, histoplasmosis, pneumocystosis and candidiasis5,12,24. In oral fungal microbiota, and in other mucosal microbiota of the Oropharyngeal candidiasis is the most common fungal infection body, Candida species have been observed to be prevalent, with C. in individuals with Human Immunodeficiency Virus (HIV), and 90% albicans being the species most often isolated. Meanwhile, in recent of them develop this infection at least once during the course of the years, there has been an increase in isolation of other species including C. disease3,21. parapsilosis, C. tropicalis, C. glabrata, C. krusei and C. dubliniensis19,24,31.

The introduction of highly active antiretroviral therapy (HAART) An important marker for the carrier state or infection is the count in the treatment of HIV infection causes a reduction in the occurrence of colony-forming units (CFUs) of yeast in the oral cavity. Individuals of opportunistic infections. However, oropharyngeal candidiasis is still who are only carriers of Candida spp. have a colony count of < 1000 common among individuals with late diagnosis and those that do not CFU/mL of saliva, whereas individuals who have infection present with respond successfully to treatment24,31. Currently, six classes of antiretroviral a colony count exceeding 4000 CFU/mL9,15. drugs are available in Brazil: nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, The aims of this study were: to evaluate colonization and quantify integrase inhibitors, fusion inhibitors, and co-receptors4. Candida spp. in the oral cavity of HIV-positive individuals treated at a University Hospital; to determine the predisposing factors for Colonization of the oral cavity does not always culminate in colonization; and to investigate the correlation between the levels of oropharyngeal candidiasis. However, such colonization can be considered CD4+ cells and viral load with the yeast count.

(1) Universidade Federal de Uberlândia (UFU), Faculdade de Medicina Uberlândia, Programa de Pós Graduação em Ciências da Saúde, Uberlândia, MG, Brasil. (2) Universidade Federal de Uberlândia (UFU), Faculdade de Medicina, Uberlândia, MG, Brasil. (3) Universidade Federal de Uberlândia (UFU), Hospital de Clínicas de Uberlândia, Uberlândia, MG, Brasil. (4) Universidade Federal de Uberlândia (UFU), Faculdade de Matemática, Uberlândia, MG, Brasil. (5) Universidade Federal de Uberlândia (UFU), Escola Técnica de Saúde, Uberlândia, MG, Brasil. (6) Universidade Federal de Uberlândia (UFU), Instituto de Ciências Biomédicas, Uberlândia, MG, Brasil. Correspondence to: Ralciane de Paula Menezes, Av. Prof. José Inácio de Souza s/no, Bloco 6X, 1º Andar, Campus Umuarama, 38400-902 Uberlândia, MG, Brasil. Tel.: +55 34 3218 2446. Fax: +55 34 3218 2410. E-mail: [email protected] MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

PATIENTS AND METHODS Statistical analysis: patients included in the study were divided into two groups based on the results of the saliva sample culture: (1) This study was classified as cross-sectional, which verified the colonized and (2) non-colonized. All patients who yielded at least one presence of Candida spp. only at the time of saliva collection without colony of Candida spp. in the culture were included in the first group monitoring the patient after sampling. (Group 1). Group 2 included all individuals with negative culture for Candida species. Research subjects and sample collection: saliva samples were collected from 147 seropositive HIV individuals in the Outpatient Clinic Qualitative variables associated with either Group 1 or 2 were of Infectious Diseases of the Clinical Hospital of the Federal University investigated using p-values and the odds ratio (OR)-values. For analysis of Uberlandia, Uberlandia, Minas Gerais State, Brazil. of differences in qualitative variables between the two groups of patients, the Mann-Whitney test was used. Comparison of the average CFU/mL During routine consultations in the Infectious Diseases Clinic, with the range of CD4+ T lymphocytes and of viral load was performed patients received guidelines about the study and were invited to participate using the Kruskal-Wallis test. Non-parametric tests were applied for the in the research. This study was approved by the Ethical Committee for analysis of quantitative variables without normal probability distributions. Human Research of the Federal University of Uberlandia, protocol All tests were applied using a significance level of 5%. 368/11.

Demographic and clinical data for each individual research participant was obtained using a questionnaire, prior to collection of the saliva sample. Medical records were reviewed to obtain data such as age; form of HIV infection; time of diagnosis; use of antifungal agents and/or antibiotics within 30 days and/or seven days prior to collection of the saliva sample; antiretroviral therapy used; values of CD4+ cells; viral load (these values were measured up to two weeks prior to saliva collection); history of oral candidiasis; use of oral prostheses; and smoking status.

After that, patients were requested to collect approximately 2 mL of unstimulated saliva in sterilized tubs. When collecting the saliva sample, Fig. 1 - Agarose gel electrophoresis of specific primer for Candida albicans (Aa) and Candida no patients had clinically active oral candidiasis. dubliniensis (Bb). Aa: A) Molecular weight, B) C. albicans ATCC90028, 1-11) study samples. Bb: A) molecular weight, B) C. albicans ATCC90028, C) C. dubliniensis INCQS 40172, D) Sample processing, quantification and identification of yeasts: negative control, 1-2) study samples. the saliva sample was homogenized with sterile glass beads, and serial decimal dilutions were made (10-1 to 10-3) in sterile saline solution (0.9%). RESULTS Then, aliquots of 10 µL of pure saliva and of the dilutions were added to plates containing Sabouraud Dextrose Agar (SDA) (Sigma, Rockville, Of the 147 patients included in this study, 84 were male and 63 were USA) containing chloramphenicol (100 mg/L), and similarly to other female. Age ranged from 17-73, with a mean age of 44.7 and a median of plates containing Chromogenic Agar (Conda, Madrid, Spain). The plates 44. Of the 147 patients, 101 (68.7%) acquired HIV by heterosexual contact, were incubated at 30 °C for 72 h. Colonies with similar morphology in 19 (12.9%) by homosexual contact, one (0.7 b%) congenitally, one (0.7%) both media were counted and the result was expressed in colony-forming by a work-related accident, one (0.7%) through a blood transfusion, and units per milliliter of saliva (CFU/mL). 24 patients (16.3%) were unable to inform how they were infected. The mean time for diagnosis of HIV infection was 8.4 years. Within this study Individual colonies from each sample were identified using the group, 13 patients (8.8%) did not use any antiretroviral therapy at the time of classical methodology and the Auxacolor2® system (Bio-Rad, Marnes- collection of saliva sample; 68 (46.3%) used reverse transcriptase inhibitors, la-Coquette, France), and thereafter stored in BHI-glycerol at −20 ºC, 61 (41.5%) used a protease inhibitor associated with a transcriptase and in sterile distilled water kept at room temperature22,30. inhibitor, and five (3.4%) combined the use of protease inhibitors with antiretroviral transcriptase and integrase inhibitors. The samples identified as C. albicans were submitted to molecular testing by polymerase chain reaction (PCR) for confirmation of the Candida spp. was isolated in 60.5% (89) of the patients, with a total species or alternatively identification of C. dubliniensis. The DNA used of 111 isolates, and C. albicans was the most frequent species (67.6%). in the PCR reactions was obtained according to the proposed by LUO & Candida non-Candida species accounted for 32.4% of the total isolates MITCHELL (2002) modified20. Three CFU previously grown in SDA for (Table 1). Among the 89 patients with a positive Candida species culture, 24 h were transferred to 50 µL of sterile distilled water and 2 µL of this 69 (77.5%) were colonized by only one species of Candida, and 20 cellular suspension were directly used in PCR. Specific primers were used (22.5%) had a combination of two or more species (Table 1). for C. albicans (forward: 3’TTT ATC AAC TTG TCA CAC CAG A5’, reverse: 5’ATC CCG CCT TAC CAC TAC CG3’) and C. dubliniensis: The mean count of colonies per milliliter of saliva was 8.8 × 10³ (forward: 3’AAA TGG GTT TGG TGC CAA ATT A5’, reverse: 5’GTT CFU/mL, and the median was 8 × 10² CFU/mL (ranging from 10² to 5 GGC ATT GGC AAT AGC TCT A3’)13. × 105 CFU/mL).

414 MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

Table 1 Distribution and frequency of association of Candida species isolated from the oral cavity of HIV patients treated at the Outpatient Clinic of Infectious Diseases of the Clinical Hospital of the Federal University of Uberlandia, Minas Gerais, Brazil, in t2012

Frequency of Percentage Frequency of Species Association of different species Percentage (%) isolates (%) isolates C. albicans 75 67.6 C. albicans + C. parapsilosis 6 30 C. parapsilosis 10 9.0 C. albicans + C. tropicalis 5 25 C. tropicalis 8 7.2 C. albicans + C. glabrata 2 10 C. glabrata 5 4.5 C. albicans + C. krusei 2 10 C. krusei 4 3.6 C. albicans + C. kefyr 1 5 C. dubliniensis 3 2.7 C. dubliniensis + C. lusitaniae 1 5 C. kefyr 2 1.8 C. albicans + C. dubliniensis 1 5 C. famata 1 0.9 C. albicans + C. parapsilosis + C. tropicalis 1 5 C. guilliermondii 1 0.9 C. albicans + C. glabrata + C. tropicalis 1 5 C. lusitaniae 1 0.9 C. peliculosa 1 0.9 111 100 20 100

Predisposing factors for colonization of the oral cavity by Candida Comparing the mean of the CFU/mL in saliva for the different ranges species are listed in Table 2. There was a significant statistical difference of CD4+ T lymphocytes, it was observed that those within the range of between colonized and non-colonized individuals with respect to the use 0–200 CD4+ cells/mm³ tended to have a greater CFU/mL than those of antibiotics (p = 0.0254, OR = 3.2) and the use of dental prostheses patients with CD4+ cells > 350 cells/mm³ (p = 0.0001) (Table 4). This (p = 0.0173, OR = 2.46). However, use of HAART (p = 0.5671), use statistical difference was not observed when comparing the mean CFU/ of antifungal agents (p = 0.7102), smoking (p = 0.3868), gender (p = mL between the different ranges of viral load (Table 4). 0.4215), age (p = 0.2529), CD4+ cell count (p = 0.5234), viral load (p = 0.2954), history of candidiasis (p = 0.8628), and time of HIV diagnosis DISCUSSION (p = 0.2758) did not differ significantly between colonized and non- colonized patients. Persistent colonization of the oral cavity by Candida spp. can be considered a predisposing factor for the development of oropharyngeal By analyzing the relationship between HAART (which includes candidiasis11,16. In HIV patients, this has been given considerable different classes of antiretroviral drugs) and oral colonization by Candida attention due to the high incidence of oropharyngeal candidiasis and a spp., it was found that individuals who used a combination of reverse high density of yeast in the oral cavity may be an important marker for transcriptase inhibitors and protease inhibitors were more likely to be disease progression1,3. colonized than those using reverse transcriptase inhibitors alone (p = 0.0315). When comparing other therapeutic regimens among themselves The frequency of HIV-positive individuals colonized by Candida and with those individuals who were not receiving HAART at the time of spp. (as well as the species present) varies between different regions of collection, no statistical differences were observed (p > 0.05). Compared the planet as a result of geographical, climatic and ethnic differences6,23. with the other therapeutic schemes, and those who did not use HAART, In this study, 60.5% of saliva samples were positive for Candida species. no statistical difference was observed (p > 0.05). Studies show that in Brazil the rate of colonization has ranged from 58 to 62% in patients with HIV6,21. However, in countries such as Mexico, The mean count of CD4+ cells was 551 cells/mm³, and the median Turkey, Argentina and USA, higher rates have been reported11,24,27,28. was 557 cells/mm³ (range, 3–1619 cells/mm³). There were 25 (17%) patients who had < 200 CD4+ cells/mm³ at the time of collection of the The predominant species found in this study was C. albicans (67.6%), saliva; 108 (73.4%) patients had an undetectable viral load (< 50 copies/ corroborating the findings of similar studies in Sao Paulo, Argentina and mL), whereas 13 (8.8%) had a viral load of > 20,000 copies/mL. Nigeria, which yielded a frequency of C. albicans of 51.5%, 58.9% and 45%, respectively21,24,26. Candida non-albicans species accounted for Comparing the CD4+ cell count and the viral load of patients who 32.4% of the total isolates: C. parapsilosis, (followed by C. tropicalis), had at least one isolate of Candida spp. in the oral cavity with those who was the most common. This frequency is higher than that reported by had a negative culture, a very close p-value of 0.05 yielded in the range LI et al. in China23 (19.8%) and by WINGETER et al. in southern Brazil of 0–200 cells/mm³ in the case of CD4+ (p = 0.0546) (Table 3). The viral (7%)34. However, this increased percentage of Candida non-albicans load did not differ significantly between colonized and non-colonized species, besides having a major effect on clinical procedures, confirms individuals (Table 3). a trend observed in other similar studies11,25.

415 MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

Table 2 Clinical characteristics and rate of Candida oral colonization in 147 patients with HIV treated at the Outpatient Clinic of Infectious Diseases of the Clinical Hospital of the Federal University of Uberlandia, Minas Gerais, Brazil, in 2012

Factors predisposing Colonized (89) Non-colonized (58) p-value OR Use of antibiotics 24 (27%) 6 (10.3%) 0.0254 3.2000 Use of antifungal 5 (5.6%) 5 (8.6%) 0.7102 0.6310 Smoker 0.3868 Yes 27 (30.3%) 13 (22.4%) 1.5074 No 62 (69.7%) 45 (77.6%) 0.6634 Use of dental prostheses 0.0173 Yes 45 (50.6%) 17 (29.3%) 2.4666 No 44 (49.4%) 41 (70.7%) 0.4054 Use of HAART 80 (89.9%) 54 (93.1%) 0.5671 1.5146 Sex 0.4215 Female 41 (46%) 22 (37.9%) 1.3977 Male 48 (54%) 36 (62.1%) 0.7154 Age 45.6 43.5 0.2529 CD4+ 544 ± 331 562 ± 319 0.5234 Viral load 20215.7 ± 88698 5387.2 ± 21473.9 0.2954 Historical of oral candidiasis Yes 27 (30.4%) 16 (27.6%) 0.8628 1.1431 No 62 (69.6%) 42 (72.4%) 0.8748

Table 3 Frequency of HIV-positive individuals colonized and not colonized by Candida spp. according to the CD4+ T lymphocyte cell count and viral load of patients treated at the Outpatient Clinic of Infectious Diseases of the Clinical Hospital of the Federal University of Uberlandia, Minas Gerais, Brazil, in 2012

Colonized (89) Not colonized (58) CD4 (cells/mm³) p-value No. of individuals Average (CD4) No. of individuals Average (CD4) 0-200 17 (19.1%) 123.7 8 (13.8%) 70.3 0.0546 201-350 9 (10.1%) 273.2 11 (19%) 271.3 1.0000 >350 63 (70.8%) 694.6 39 (67.2%) 743.5 0.1164 Total 89 (100%) 544.1 58 (100%) 561.1 0.5234 Viral load (CFU/mL) No. of individuals Average (viral load) No. of individuals Average (viral load) <50 62 (69.6%) – 46 (79.3%) – 1.0000 51-20000 18 (20.2%) 4317.8 8 (13.8%) 6047.5 0.4899 >20000 9 (10.2%) 191274.8 4 (6.9%) 66021.7 0.1474

Colonization by more than one Candida species has been reported was higher than that previously observed in Sao Paulo (Brazil) and in the previously11,23,24. In our study, 22.5% of patients were colonized by at south of India (5.2 × 10² CFU/mL and 3 × 10² CFU/mL, respectively). least two species, and association was predominantly between C. albicans However, the technique used for collecting that material was a swab and C. parapsilosis (six of 20). Other studies have showed predominant of the oral cavity and rinse in sterile phosphate-buffered saline, association between C. albicans and C. glabrata11,21,23,24. respectively17,21. There is no consensus on the cut-off level of CFU/mL differentiating individuals colonized by yeast or having oropharyngeal Analysis of the concentration of yeast in saliva (8.8 × 103 CFU/mL) candidiasis, yeast count > 4 × 10³ CFU/mL can be considered a sign of

416 MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

Table 4 with protease inhibitors was related to a greater frequency of colonized Relationship between number of CD4+ cells and concentration of yeasts (CFU/ individuals compared with individuals whose HAART therapy included mL) and viral load and concentration of yeasts in the saliva of HIV-positive only a combination of reverse transcriptase inhibitors. YANG et patients treated at the Outpatient Clinic of Infectious Diseases of the Clinical al.36, observed a significant reduction in the rate of oral colonization, Hospital of the Federal University of Uberlandia, in 2012 among those individuals included in their studies, that was related to the use of HAART therapy without, however, relating the class of CD4+ Colonized CFU/mL p-value drugs used. (cells/mm³) (average) 0-200a 17 7.4 × 10³ ab0.2631 A reduced frequency of individuals with HIV colonized by Candida spp. has also been reported by WU et al.35, who demonstrated a reduction b ac 201-350 9 5.5 × 10³ 0.0001 of oral colonization by Candida yeasts among individuals who used >350c 63 9.7 × 10³ bc0.0948 transcriptase inhibitors only. Possible mechanisms for the influence of HAART on oral colonization by Candida spp. are unknown. However, Viral load an explanation for the relationship between the use of protease inhibitors (copies/mL) and an increased incidence of oral colonization by Candida species may <50d 62 9.8 × 10³ de0.2259 be the greater immunological impairment and longer HIV infection 51-20000e 18 3.6 × 10³ df:0.4549 period of individuals using protease inhibitors at the time of saliva sample collection, since the use of this class of antiretrovirals is only f ef >20000 9 8.0 × 10³ 0.1270 recommended when the combination of other classes of antiretrovirals Total 89 8.8 × 10³ has been ineffective in combating viral replication and, consequently, Note: a, b, c: variation ranges of CD4 cells used as a reference at the Outpatient controlling HIV infection. Nevertheless, other studies may seek to Clinic of Infectious Diseases of the Clinical Hospital of the Federal University of confirm these findings, and thus contribute to elucidating the possible Uberlândia, to begin, maintain or change antiretroviral therapy until the conclu- mechanisms that interfere with the proliferation of microorganisms and sion of this study ab, ac, bc: results from the statistical comparison between the their adherence to the surface of the oral cavity. mean of CFU/mL of three tracks CD4+ T lymphocytes. d, e, f: variation ranges of viral load. ab, ac, bc: result of statistical comparison between the mean CFU/ Previous studies have sought to investigate the relationship between mL of three tracks viral load. oral cavity colonization by Candida species with counts of CD4+ cells and viral load21,24,27. oral candidiasis9,15. The discrepancy in the average CFU/mL between studies may be explained by the different methodology used for When comparing the load of yeast present in the saliva of individuals collection of the saliva sample, as some techniques are more sensitive colonized by Candida spp. with CD4+ T lymphocyte count and viral load, than others11. it was observed that patients with a lower count of CD4+ cells showed a higher CFU/mL of saliva. This suggests that a low CD4+ cell count may Ways of reducing colonization may contribute to a decreased incidence be associated with a higher number of yeast in the saliva of individuals and severity of oral candidiasis or even to a decreased risk of candidemia, with HIV. This relationship may be explained by the hypothesis that HIV hence the importance of identifying the individual’s characteristics and infection may not only compromise the oral mucosal immunity but also habits that are associated with high oral cavity colonization by Candida stimulate the expression of virulence factors in the yeasts, since it has spp., together with any potential modifications to these characteristics been observed, in vitro, that HIV stimulates the secretion of a proteolitic and habits. The use of antibiotics and dental prostheses were considered enzyme by C. albicans32. However, when the same comparison was made predisposing factors for colonization of the oral cavity by Candida species in relation to the viral load of the subjects studied, this was not found to (and probably for the development of oral candidiasis). A similar study in have a statistically significant difference, maybe because the number of Taiwan also observed the relationship between these two factors and oral subjects studied was insufficient to demonstrate the relationship. To the colonization by Candida spp35. This relationship is explained by the fact best of our knowledge, there are no studies in the literature that have set that prolonged administration of antibiotics can cause an imbalance in the out to examine the relationship of the concentration of yeasts in saliva oral microbiota, thus allowing the proliferation of other microorganisms to the CD4+ cell count and the viral load. present there, including Candida species7. However, the use of an oral prosthesis is an important factor in colonization because of the trauma In conclusion, it was observed that despite C. albicans being the that the mucosa may suffer if it is not adjusted correctly, and/or due to most frequent species, the Candida non-albicans species represented a poor hygiene, that also may occur14. significant percentage of isolates. In addition, the yeast count in the saliva of patients was greater than that observed in previous studies. The use of In the present study, the frequency of individuals colonized or not by antibiotics and oral prostheses are directly related to oral colonization by Candida spp. was not related to the use of HAART therapy, confirming Candida spp. However, the use of HAART had no statistically significant the results obtained in similar studies11,18,27. However, ARRIBAS et influence in reducing the colonization of the site in question, but use of al.2, LI et al.23 and YANG et al.36 observed a significant reduction in the antiretroviral class of reverse transcriptase inhibitors alone appears to the rate of oral colonization in individuals who were using HAART. have a greater protective effect against colonization. Finally, a low CD4+ When we analyzed the relationship of a range of therapeutic regimens T lymphocyte count seemed to be associated with a higher number of involving a number of classes of antiretroviral drugs, it was observed yeast being present in the saliva of HIV patients. that the schema that included reverse transcriptase inhibitors combined

417 MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

RESUMO 5. Brooks GF, Carroll KC, Butel JS, Morse SA, Mietzner TA. AIDS and lentivirus. In: Weitz M, Lebowitz H. Medical microbiology. 25th ed. New York: McGraw-Hill; 2010. p. 609-22. Fatores relacionados a colonização da cavidade bucal de indivíduos portadores do HIV por espécies de Candida 6. Campisi G, Pizzo G, Milici ME, Mancuso S, Margiotta V. Candidal carriage in the oral cavity of human immunodeficiency virus-infected subjects. Oral Surg Oral Med Oral A colonização da cavidade oral pode ser considerada um pré- Pathol Oral Radiol Endod. 2002;93:281-6. requisito para o desenvolvimento de candidíase orofaríngea. Os objetivos 7. Cisterna R, Ezpeleta G, Telleria O, Spanish Candidemia Surveillance Group. Nationwide deste estudo foram: avaliar e quantificar espécies de Candida isoladas sentinel surveillance of bloodstream Candida infections in 40 tertiary care hospitals da cavidade oral, para determinar os fatores predisponentes para a in Spain. J Clin Microbiol. 2010;48:4200-6. colonização, e correlacionar os níveis de células CD4+ e carga viral em indivíduos HIV-positivos atendidos em um hospital universitário. 8. Collins CD, Cookinham S, Smith J. Management of oropharyngeal candidiasis with Foram coletadas amostras de saliva de 147 pacientes portadores do localized oral miconazole therapy: efficacy, safety, and patient acceptability. Patient Prefer Adherence. 2011;5:369-74. HIV, as quais foram semeadas em Ágar Sabouraud Dextrose (ASD) e ágar cromogênico e incubadas a 30 °C por 72 horas. As colônias com 9. da Costa KR, Ferreira JC, Komesu MC, Candido RC. Candida albicans and Candida morfologia semelhante em ambos os meios foram contadas e o resultado tropicalis in oral candidosis: quantitative analysis, exoenzyme activity, and antifungal expresso em unidade formadora de colônias por mililitro (UFC/mL). drug sensitivity. Mycopathologia. 2009;167:73-9. Dos 147 pacientes HIV positivos, 89 apresentaram culturas positivas 10. Ellepola AN, Khan ZU, Joseph B, Chandy R, Philip L. Prevalence of Candida dubliniensis para Candida spp., totalizando 111 isolados, e C. albicans foi a espécie among oral Candida isolates in patients attending the Kuwait University Dental Clinic. mais frequente (67,6%). A contagem média de colônias foi de 8.8 × 10³ Med Princ Pract. 2011;20:271-6. UFC/mL. Os principais fatores predisponentes para colonização oral por Candida spp. foram a utilização de antibióticos e de próteses orais. 11. Erköse G, Erturan Z. Oral Candida colonization of human immunodeficiency virus O uso de antirretroviral da classe de inibidores da transcriptase reversa infected subjects in Turkey and its relation with viral load and CD4+ T-lymphocyte count. Mycoses. 2007;50:485-90. pareceu ter maior efeito protetor para a colonização. Baixa contagem de linfócitos T CD4+ está relacionada com maior densidade de leveduras 12. Esebelahie NO, Enweani IB, Omoregie R. Candida colonisation in asymptomatic na saliva de indivíduos HIV positivos. HIV patients attending a tertiary hospital in Benin City, Nigeria. Libyan J Med. 2013;8:20322. ACKNOWLEDGEMENTS 13. Estrada-Barraza D, Dávalos-Martínez A, Flores-Padilla L, Mendoza-De Elias R, Sánchez- Vargas LO. Comparación entre métodos convencionales, ChromAgar Candida y el The authors are grateful to CAPES (Coordenação de Aperfeiçoamento método de la PCR para la identificación de especies de Candida en aislamientos de Pessoal de Nível Superior) for the scholarship for R.P. Menezes. clínicos. Rev Iberoam Micol. 2011;28:36-42. Thanks are given to the students Bruna Nogueira da Silva and Thais Chimatti Felix for helping with the collection of saliva samples and 14. Falcão AFP, Santos LB, Sampaio NM. Candidíase associada a próteses dentárias. Sitientibus(Feira de Santana). 2004;30:135-46. identification of the isolates, and to Rodrigo Augusto Machado de Moraes for the revision of the text. The authors would also like to thank 15. Farah CS, Ashman RB, Challacombe SJ. Oral candidoses. Clin Dermatol. 2000;18:553- the INCQS (Instituto Nacional de Controle de Qualidade em Saúde) for 62. providing the reference strains included in the study. 16. Fong IW, Laurel M, Burford-Mason A. Asymptomatic oral carriage of Candida albicans in patients with HIV infection. Clin Invest Med. 1997; 20:85-93. CONFLICTS OF INTEREST 17. Girish Kumar CP, Menon T, Rajasekaran S, Sekar B, Prabu D. Carriage of Candida species The authors declare that there are no conflicts of interest. in oral cavities of HIV infected patients in South India. Mycoses. 2009; 52:44-8.

REFERENCES 18. Gottfredsson M, Cox GM, Indridason OS, De Almeida GM, Heald AE, Perfect JR. Association of plasma levels of human immunodeficiency virus type 1 RNA and oropharyngeal Candida colonization. J Infect Dis. 1999;180:534-7. 1. Al-Abeid HM, Abu-Elteen KH, Elkarmi AZ, Hamad MA. Isolation and characterization of Candida spp. in Jordanian cancer patients: prevalence, pathogenic determinants, 19. Gutiérrez J, Morales P, Gonzáles MA, Quindós G. Candida dubliniensis, a new fungal and antifungal sensitivity. Jpn J Infect Dis. 2004;57:279-84. pathogen. J Basic Microbiol. 2002;42:207-27.

2. Arribas JR, Hernández-Albujar S, González-García JJ, Peña JM, Gonzalez A, Cañedo T, 20. Luo G, Mitchell TG. Rapid identification of pathogenic fungi directly from cultures by et al. Impact of protease inhibitor therapy on HIV-related oropharyngeal candidiasis. using multiplex PCR. J Clin Microbiol. 2002;40:2860-5. AIDS. 2000;14:979-85. 21. Junqueira JC, Vilela SF, Rossoni RD, Barbosa JO, Costa AC, Rasteiro VM, et al. Oral 3. Badiee P, Alborzi A, Davarpanah MA, Shakiba E. Distributions and antifungal colonization by yeasts in HIV-positive patients in Brazil. Rev Inst Med Trop Sao susceptibility of Candida species from mucosal sites in HIV positive patients. Arch Paulo. 2012;54:17-24. Iran Med. 2010;13:282-7. 22. Lacaz CS, Porto E, Martins JEC. Tratado de micologia médica. São Paulo: Sarvier; 2002. 4. Brasil. Ministério da Saúde. Departamento de DST, Aids e Hepatites Virais. Antirretrovirais utilizados. Brasília: Ministério da Saúde; 2013. [cited 2013 Sep 12]. Available from: 23. Li YY, Chen WY, Li X, Li HB, Wang L, He L, et al. Asymptomatic oral yeast carriage http://www.aids.gov.br/pagina/quais-sao-os-antirretrovirais and antifungal susceptibility profile of HIV-infected patients in Kunming, Yunnan Province of China. BMC Infect Dis. 2013;13:13-46.

418 MENEZES, R.P.; BORGES, A.S.; ARAÚJO, L.B.; PEDROSO, R.S. & RÖDER, D.V.D.B. - Related factors for colonization by Candida species in the oral cavity of HIV-infected individuals. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 413-9, 2015.

24. Luque AG, Biasoli MS, Tosello ME, Binolfi A, Lupo S, Magaró HM. Oral yeast carriage 31. Sullivan DJ, Westerneng TJ, Haynes KA, Bennett DE, Coleman DC. Candida dubliniensis in HIV-infected and non-infected populations in Rosario, Argentina. Mycoses. 2008; sp. nov: phenotypic and molecular characterization of a novel species associated with 52:53-9. oral candidosis in HIV infected individuals. Microbiology. 1995;141:1507-21.

25. Macêdo DPC, Farias AMA, Lima Neto RG, Silva VKA, Leal AFG, Neves RP. Infecções 32. Tosun I, Aydin F, Kaklikkaya N, Erturk M. Induction of secretory aspartyl proteinase of oportunistas por leveduras e perfil enzimático dos agentes etiológicos. Rev Soc Bras Candida albicans by HIV-1 but not HIV-2 or some other microorganisms associated Med Trop. 2009;42:188-91. with vaginal environment. Mycopathologia. 2005;159:213-8.

26. Nweze EI, Ogbonnaya UL. Oral Candida isolates among HIV-infected subjects in Nigeria. 33. Vargas KG, Joly S. Carriage frequency, intensity of carriage, and strains of oral yeast J Microbiol Immunol Infect. 2011;44:172-7. species vary in the progresssion to oral candidiasis in human immunodeficiency virus-positive individuals. J Clin Microbiol. 2002;40:341–50. 27. Patel PK, Erlandsen JE, Kirkpatrick WR, Berg D, Westbrook SD, Louden C, et al. The changing epidemiology of oropharyngeal candidiasis in patients with HIV/ 34. Wingeter MA, Guilhermetti E, Shinobu CS, Takaki I, Svidzinski TI. Identificação AIDS in the era of antiretroviral therapy. AIDS Res Treat. 2012;2012:262471. doi: microbiológica e sensibilidade in vitro de Candida isoladas da cavidade oral de 10.1155/2012/262471. indivíduos HIV positivos. Rev Soc Bras Med Trop. 2007;40:272-6.

28. Sánchez-Vargas LO, Ortiz-López NG, Villar M, Moragues MD, Aguirre JM, Cashat-Cruz 35. Wu CJ, Lee HC, Yang YL, Chang CM, Chen HT, Lin CC, et al. Oropharyngeal yeast M, et al. Oral Candida isolates colonizing or infecting human immunodeficiency colonization in HIV-infected outpatients in southern Taiwan: CD4 count, efavirenz virus-infected and healthy persons in Mexico. J Clin Microbiol. 2005;43:4159-62. therapy and intravenous drug use matter. Clin Microbiol Infect. 2012;18:485-90.

29. Schelenz S, Abdallah S, Gray G, Stubbings H, Gow I, Baker P, et al. Epidemiology of 36. Yang YL, Hung CC, Wang AH, Tseng FC, Leaw SN, Tseng YT, et al. Oropharyngeal oral yeast colonization and infection in patients with hematological malignancies, colonization of HIV-infected outpatients in Taiwan by yeast pathogens. J Clin head neck and solid tumors. J Oral Pathol Med. 2011;40:83-9. Microbiol. 2010;48:2609-12.

30. Silva JO, Costa PP, Reche SHC. Manutenção de leveduras por congelamento a -20°C. Received: 1 September 2014 Rev Bras Anal Clín. 2008;40:73-4. Accepted: 3 February 2015

419 Revista do Instituto de Medicina Tropical de São Paulo on line.

Publications from 1984 to the present data are now available on: http://www.scielo.br/rimtsp PAST ISSUES FROM 1959 ON (PDF) www.imt.usp.br/portal/

SciELO – The Scientific Electronic Library OnLine - SciELO is an electronic virtual covering a selected collection of Brazilian scientific journals. The library is an integral part of a project being developed by FAPESP – Fundação de Amparo à Pesquisa do Estado de São Paulo, in partnership with BIREME – the Latin American and Caribbean Center on Health Sciences Information. SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a search by word of serial titles, publisher names, city of publication and subject. The interface also provides access to the full text of articles via author index or subject index or a search form on article elements such as author names, words from title, subject and words from full text.

FAPESP/BIREME Project on Scientific Electronic Publications Latin American and Caribbean Center on Health Sciences Information Rua Botucatu 862 – 04023-901 São Paulo, SP – Brazil Tel. (011) 5576-9863 [email protected] Rev. Inst. Med. Trop. Sao Paulo 57(5):421-426, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500009

THE RELEVANCE OF NUTRITIONAL STATUS AND HISTOPATHOLOGICAL FINDINGS ON THE INFECTIOUS PROCESS OF BALB/C MICE INOCULATED WITH Lacazia loboi

Adriana Sierra Assencio Almeida BARBOSA(1), Suzana Madeira DIÓRIO(2), Silvia Cristina Barboza PEDRINI(3), Adauto José Ferreira NUNES(4), Andréa de Faria Fernandes BELONE(4), Sônia Maria Uso Ruiz SILVA(2), Beatriz Gomes Carreira SARTORI(1), Sueli Aparecida CALVI(5), Fátima Regina VILANI-MORENO(1) & Paulo Câmara Marques PEREIRA(5)

SUMMARY

The aim of this study was to evaluate the effects of the protein-calorie malnutrition in BALB/c isogenic mice infected with Lacazia loboi, employing nutritional and histopathological parameters. Four groups were composed: G1: inoculated with restricted diet, G2: not inoculated with restricted diet, G3: inoculated with regular diet, G4: not inoculated with regular diet. Once malnutrition had been imposed, the animals were inoculated intradermally in the footpad and after four months, were sacrificed for the excision of the footpad, liver and spleen. The infection did not exert great influence on the body weight of the mice. The weight of the liver and spleen showed reduction in the undernourished groups when compared to the nourished groups. The macroscopic lesions, viability index and total number of fungi found in the footpads of the infected mice were increased in G3 when compared to G1. Regarding the histopathological analysis of the footpad, a global cellularity increase in the composition of the granuloma was observed in G3 when compared to G1, with large numbers of macrophages and multinucleated giant cells, discrete numbers of lymphocytes were present in G3 and an increase was observed in G1. The results suggest that there is considerable interaction between Jorge Lobo’s disease and nutrition.

KEYWORDS: Jorge Lobo’s disease; Lacazia loboi; Malnutrition; Mice; Histopathology.

INTRODUCTION as a public health problem is not known, because Jorge Lobo’s disease is not a disease of compulsory notification. The interaction between nutrition and infection has been considered one of the major problems for the development and survival of This mycosis is more common in males due to their occupational humans11,21. There are many studies evaluating the effect of malnutrition activities, and is generally manifested in people aged between twenty on mice infected with Toxoplasma gondii, Schistosoma mansoni, and forty-one, coinciding with their work-related activities, when they Leishmania chagasi, Staphylococcus aureus and Mycobacterium are naturally exposed to the pathogen27,29. tuberculosis6,9,10,15,16,24, however, there aren’t studies relating nutritional aspects to the Jorge Lobo’s disease so far. Histopathologically, this mycosis is characterized by an intense and diffuse histiocytic reaction, often with fibrosis, restricted to the dermis, Jorge Lobo’s disease, also known as lobomycosis or lacaziosis, is a consisting of large numbers of multinucleated giant cells (MGC), both chronic, granulomatous, cutaneous-subcutaneous, fungal infection caused foreign body-type and Langhans-type, and numerous fungi mainly inside by the fungus Lacazia loboi (L. loboi) and is characterized by isolated these cells. Plasma cells, neutrophils and a small number of lymphocytes or multiple coalescing lesions that can occur clinically in a localized or are also presented12,17,26. disseminated form13,18,34. An immunohistochemical study conducted by VILANI-MORENO In 2007, a study by BRITO et al.3 related 318 diagnosed cases of et al.28 showed that inflammatory cell infiltrates presented the following such disease in Brazil, predominantly in the Amazon region, with a total frequency order: macrophages CD68+ > T lymphocytes CD3+ (T of 490 cases estimated worldwide3. In 2010, a study by WOODS et al.34 lymphocytes CD4+ > T lymphocytes CD8+) > Natural Killer cells CD57+ described 249 patients who were attended to the Department of Sanitary > Plasma cells CD79+ > B lymphocytes CD20+. According to the authors, Dermatology, Rio Branco, Acre, Brazil, between 1998 and 200834. The the large amount of fungi in the lesions, the disorganized granuloma and number of patients is relatively small, but the real situation of the disease the changes in the profile of the Th2 cell cytokine pattern, suggest that

(1) Instituto Lauro de Souza Lima, Biology Technical Team, Bauru, SP, Brasil. (2) Instituto Lauro de Souza Lima, Microbiology Technical Team, Bauru, SP, Brasil. (3) Instituto Lauro de Souza Lima, Animal House, Bauru, SP, Brasil. (4) Instituto Lauro de Souza Lima, Pathology Technical Team, Bauru, SP, Brasil. (5) Universidade Estadual Paulista (UNESP), Department of Tropical Diseases and Image Diagnosis, Botucatu Medical School, Botucatu, SP, Brasil. Fátima Regina Vilani-Moreno and Paulo Câmara Marques Pereira are joint senior contributors. Correspondence to: Adriana Sierra Assencio Almeida Barbosa, Biology Technical Team, Instituto Lauro de Souza Lima. Rod. Comte. João Ribeiro de Barros, Km 225/226, 17034-971 Bauru, São Paulo, Brasil. Phone: +551431035912 and +5514997255496. E-mail: [email protected] BARBOSA, A.S.A.A.; DIÓRIO, S.M.; PEDRINI, S.C.B.; NUNES, A.J.F.; BELONE, A.F.F.; SILVA, S.M.U.R.; SARTORI, B.G.C.; CALVI, S.A.; VILANI-MORENO, F.R. & PEREIRA, P.C.M. - The relevance of nutritional status and histopathological findings on the infectious process of BALB/c mice inoculated with Lacazia loboi. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 421-6, 2015. patients showing immunoregulatory disorders with the mycosis might animals were weighed; the animals in groups G1 and G2 were submitted, be responsible for the lack of containment of the pathogen. for 20 days, to a restricted diet with a daily offer of 80% of the quantities ingested by groups G3 and G4. The dietary restriction was conducted in The fungus L. loboi has not been grown in artificial culture media order to achieve a weight loss of about 20%. Twenty days after receiving so far; however, MADEIRA et al.14 developed an experimental model a normal diet or dietary restriction, the animals were infected. After for the study of Jorge Lobo’s disease, by inoculating the fungi obtained the inoculation, the animals of groups G1 and G2 remained on dietary from patient’s skin lesions, intradermally, into the footpads of BALB/c restriction until the period they had to be sacrificed, at the final moment. strain mice. These authors found that eight months post-inoculation, All groups of animals were weighed monthly. The food and animals the footpad of the mice showed macroscopic lesions and histological were weighed on a digital scale with 0.25g to 5,000g precision (model changes, similar to those found in human disease, with a large number AS5500C Marconi, Piracicaba, SP, Brazil). of viable fungi. Euthanasia of the animals: Four months after the inoculation (period A more recent study has shown the experimental reproduction of necessary for the appearance of the macroscopic lesions in the footpads, Jorge Lobo’s disease in BALB/c mice inoculated with fungi obtained according to BELONE et al.2), the animals were euthanized using carbon from previously infected mice presenting macroscopic lesions. Hence, dioxide (CO2). The liver and spleen were excised and weighed on a digital BALB/c mice is considered an excellent mouse strain for the maintenance scale with 0.01g to 210g precision (model Metler Toledo AB204, Barueri, of L. loboi in the laboratory2. SP, Brazil) and the material underwent histopathological evaluation. The footpads were excised to determine the viability index and the total Considering this, as there had been no other studies on the role of number of fungi, and also to perform the histopathology. nutritional status in Jorge Lobo’s disease, the aim of the present study was to evaluate the effects of the protein-calorie malnutrition (PCM) in Histological sections of organs and footpads: The footpads and BALB/c isogenic mice infected with L. loboi, by determining the weight organs were fixed in 10% buffered formalin for 24 hours, and then of their bodies and organs, the viability index and the total number of prepared to be embedded in paraffin, according to the usual technique. fungi in the footpad, and also the histopathological analysis of organs Histological sections of 4 µm thick were stained with Hematoxylin-Eosin and footpad. (HE) and Gomori’s methenamine silver (GMS)8.

MATERIALS AND METHODS Histopathological evaluation: The slides of the HE-stained organs underwent histopathological evaluation and the GMS-stained slides were Experimental groups: A total of 60 isogenic 12-week-old male examined for the presence of fungi in the organs. The HE-stained footpad BALB/c mice were kept at the Lauro Souza Lima Institute. All animals slides were used to examine the characteristics of dermal inflammatory were housed in plastic cages (five mice per cage) with white wood chips infiltrate as well as cell elements: macrophages, lymphocytes, neutrophils, for bedding and access to commercial food Nuvilab CR-1 (Nuvital, plasma cells and MGC were quantified on a semi-quantitative 0-4 + scale Colombo, PR, Brazil), which is specifically made for the feeding of where: 0 = absent, 1 = minimal, 2 = mild, 3 = moderate, 4 = intense17,30. laboratory rodents, drinking water, under controlled lighting (12-h The GMS-stained slides were examined for the presence of fungi in the day/12-h night cycle) and temperature (22 ± 2 ºC) conditions. The footpads, and the findings were semi-quantified on a 0 - 4 + scale as animals were distributed into four groups: (G1) 15 mice inoculated with described above. the fungus and under dietary restriction, (G2) 15 mice not inoculated with the fungus and under dietary restriction, (G3) 15 mice inoculated Statistical Analysis: All data were analyzed with the SAS for with the fungus and on a normal diet and (G4) 15 mice not inoculated Windows software, version 9.2. The Tukey test was performed for the with the fungus and on normal diet. The research project was approved analysis of the following variables: body weight, liver, spleen and fungi by the Ethics Committee on Animal Experiments of the Botucatu School viability index. Poisson or negative binomial distributions were used for of Medicine, UNESP. the analysis of the number of fungi, followed by the Likelihood-ratio test. In all cases, the significance level was set at 5%. Fungal suspension: L. loboi was obtained from the footpads of BALB/c mice previously inoculated for maintenance of the strain2. The RESULTS animals were sacrificed and the footpads were removed and macerated in 0.9% sterile saline. The fungal suspension (pool) obtained was evaluated Regarding animal weight, at the first moment, no significant with respect to the number of fungi and its viability was determined by differences were observed among the studied groups. Then, the animals vital staining with fluorescein diacetate-ethidium bromide, as described in groups G1 and G2 were submitted to dietary restriction, while the 31 for L. loboi by VILANI-MORENO & OPROMOLLA . The strain used animals in groups G3 and G4 received a normal diet. At the time of in our experiments was molecularly characterized according to VILELA inoculation, a significant decrease was observed in the weight of the et al.32. animals in groups G1 and G2 and a significant increase in weight was observed in the animals from groups G3 and G4, when compared to the Inoculation: Mice were inoculated intradermally in both hind initial conditions of each group (p < 0.05). After the 4-month period, there footpads with 0.03 mL of fungal suspension containing 1.4 x 106 fungi, were no significant differences in the weight of the animals from groups with inoculum concentration of 4.8 x 107/mL and viability index of 38%. G1 and G2. There was a significant increase, however, in the weight of the animals from groups G3 and G4, when compared to the moment of Diet and weight of the animals: Before the start of the study, all inoculation of each group (p < 0.05) (Table 1).

422 BARBOSA, A.S.A.A.; DIÓRIO, S.M.; PEDRINI, S.C.B.; NUNES, A.J.F.; BELONE, A.F.F.; SILVA, S.M.U.R.; SARTORI, B.G.C.; CALVI, S.A.; VILANI-MORENO, F.R. & PEREIRA, P.C.M. - The relevance of nutritional status and histopathological findings on the infectious process of BALB/c mice inoculated with Lacazia loboi. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 421-6, 2015.

Table 1 Body, liver and spleen weights, in grams, of BALB/c mice according to the study groups and the moments of determination

Body Weight Organ Weight Groups Initial Inoculation Final Liver Spleen x– s2 x– s2 x– s2 x– s2 x– s2 G1 25.75 1.33 aA 21.37 1.18 bA 21.57 1.09 bA 1.08 0.18 A 0.07 0.02 A G2 26.13 2.37 aA 21.28 1.89 bA 21.03 2.14 bA 1.09 0.21 A 0.05 0.01 A G3 26.36 1.71 aA 27.83 1.72 bB 32.47 1.91 cB 1.76 0.30 B 0.14 0.03 B G4 24.38 0.97 aA 27.63 1.63 bB 32.58 1.63 cB 1.60 0.15 B 0.12 0.02 B Initial: before the animals were subjected to a diet restriction. Inoculation: the animals intradermally inoculated both footpads with L. loboi. Final: four months after the inoculation. (G1) mice inoculated with the fungus and under dietary restriction, (G2) mice not inoculated with the fungus and under dietary restriction, (G3) mice inoculated with the fungus and on a normal diet and (G4) mice not inoculated with the fungus and on a normal diet. x–: means and s2: standard deviations. Means and standard deviations followed by the same lower-case letter (line) showed no significant difference by the Tukey test at a level of 5%. Means followed by the same capital letter (column) showed no significant difference by the Tukey test at a level of 5%. Initial body weights: G1=G2=G3=G4. Inoculation body weights: G1, G2 < G3, G4. Final body weights: G1, G2 < G3, G4. Liver weight: G1, G2 < G3, G4. Spleen weight: G1, G2 < G3, G4.

There has been a significant interaction between the effect of the diet and the studied groups, as the weight of the liver and spleen of the malnourished groups G1 and G2 showed significantly lower values when compared to the groups with no dietary restrictions G3 and G4 (p < 0.05) (Table 1).

The histopathological analysis of the liver and spleen showed no differences among the studied groups. In accordance with the weight of the organs, histological sections of the liver revealed atrophic hepatocyte trabeculae in the malnourished groups (G1 and G2), while in both groups inoculated with the fungus L. loboi (G1 and G3), the liver showed vacuolar degeneration and more intense nuclear reactivity when compared to the non-inoculated groups. Histological sections of the spleen revealed only sinusoidal congestion in all groups. The study of fungi, through histopathological analysis, revealed that GMS-stained sections of the liver and spleen, in the inoculated groups (G1 and G3), showed no dissemination of fungi to these organs. Fig. 1 - Macroscopic aspect of the footpad of mice inoculated with Lacazia loboi, four The footpads of the animals of the two groups (G1 and G3) showed months after inoculation. A: G1; B: G3. Histological aspect with presence of macrophages, macroscopic lesions, which in general were higher in group G3 multinucleated giant cells and numerous fungi (HE, 20x). C: G1; D: G3. (G1) mice inoculated (inoculated) when compared to group G1 (Fig. 1A and 1B). with the fungus and under dietary restriction, (G3) mice inoculated with the fungus and on normal diet. The total number of fungi recovered from the footpads of the infected animals (G1 and G3) was 1.95 x 106/mL in G1 and 3.22 x 106/mL in in moderate numbers (3+), also disperse in the infiltrate or aggregated G3 (p < 0.05). The viability index of L. loboi was higher in G3 animals forming microabscesses. Scattered areas with more lymphocytes or (41.8%) when compared to G1 animals (32.2%) (p < 0.05). neutrophils were observed, although the neutrophils were always present in greater numbers (Fig. 1D and Fig. 2). The histopathological study of the footpads of the mice inoculated with L. loboi, G1 and G3, irrespective of the PCM, showed similar In group G1, the inflammatory infiltrate was less intense in comparison morphological patterns. We observed the presence of inflammatory to that of group G3. However, these animals showed an increase in the infiltrate predominantly composed by macrophages (4+) and MGC, number of lymphocytes (3+), while their number of neutrophils did not both foreign body-type and Langhans-type, and numerous fungi mainly change (3+). Cell distribution was similar in both groups G1 and G3, inside these cells, many of them with morphological characteristics of and rare plasma cells were observed (Fig. 1C and Fig. 2). viability (Fig. 1C and 1D). DISCUSSION In group G3, lymphocytes were present in discrete numbers (2+) and were dispersed between macrophages or forming small clumps Jorge Lobo’s disease is a rare mycosis that occurs predominantly around blood vessels, macrophages and MGC. Neutrophils were present in the Brazilian Amazon region. Unknown factors are related to the

423 BARBOSA, A.S.A.A.; DIÓRIO, S.M.; PEDRINI, S.C.B.; NUNES, A.J.F.; BELONE, A.F.F.; SILVA, S.M.U.R.; SARTORI, B.G.C.; CALVI, S.A.; VILANI-MORENO, F.R. & PEREIRA, P.C.M. - The relevance of nutritional status and histopathological findings on the infectious process of BALB/c mice inoculated with Lacazia loboi. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 421-6, 2015.

The study of COUTO et al.5, about changes on the liver function in mice with schistosomiasis associated with malnutrition showed that both infection and/or malnutrition interfered in the levels of hepatic biochemical indicators, but the most important changes in liver function occurred during the intense inflammatory process caused by schistosomiasis, leading to increased liver enzymes.

Regarding the histopathological study of the liver, studies performed by OLIVEIRA et al.16 and COUTINHO et al.4 showed that malnutrition affects several regenerative mechanisms, such as decreased fibroblast proliferation, and synthesis of collagen and albumin. They also showed that the nutritional status of the host plays an important role in changing the connective tissues in murine hepatic schistosomiasis. Fig. 2 - Frequency of cells in histological section of the footpad of BALB/c mice according to the study group. G1: mice inoculated with the fungus and under dietary restriction; G3: mice Another important aspect to be highlighted is the appearance of inoculated with the fungus and on normal diet; CGM: multinucleated giant cells. macroscopic lesions on the footpad that were smaller in malnourished animals (G1) when compared to the nourished group (G3). A less predisposition or protection from the development of the disease in intense inflammatory reaction was also observed in the nourished group. affected individuals12,28. In addition, there are no studies available The viability index and total number of fungi found in the footpads of evaluating the nutritional changes related to this mycosis. the inoculated mice showed an increase in the nourished mice when compared to the malnourished mice. As there are no other studies linking The experimental model of malnutrition used in the present study, in malnutrition and Jorge Lobo’s disease, the comparisons of our results are which mice previously underwent PCM and subsequently were inoculated restricted to the inoculated mice with no dietary restriction. with the pathogen, has been successfully used in several other studies with the following pathogens: Toxoplasma gondii, Staphylococcus aureus Studies by MADEIRA et al.14 with BALB/c mice, and VILANI- and Mycobacterium tuberculosis6,9,10,24. MORENO & OPROMOLLA31 in cutaneous lesions of humans, showed viability indexes similar to those found in our study. Also, a research In experimental studies of PCM, body weight is one of the most conducted by BELONE et al.2 with mice inoculated with L. loboi showed widely used indicators for evaluation of the nutritional status33. The results that the number of fungi recovered at four months after inoculation was revealed that the infection by L. loboi did not have great influence in the similar to ours. body weight of the mice that received a normal diet when compared to the control group. Thus, both infected groups (G1and G3) presented similar Regarding the histopathological analysis of footpads, increased global behavior compared to their respective control groups, accordingly to the cellularity in the composition of granuloma in the nourished group was results described earlier6,9,10,16,24. observed in comparison to that of the malnourished group, in addition to the proportional increase of lymphocytes in the malnourished group. According to ABREU et al.1, PCM is the cause of several clinical Studies with malnourished mice inoculated with Staphylococcus aureus6 manifestations, but the most apparent changes are those that occur in and Mycobacterium tuberculosis9,10 showed a decrease in the number measurements and mass, much of the body as a whole or in specific of peripheral blood lymphocytes, suggesting that these cells may be organs such as the liver and spleen. migrating to the site of infection, similar to the results found in our study.

The liver and spleen have a significant role in both the nutritional These findings are important and lead to the hypothesis that and infectious processes. In PCM, histological changes, as well as the malnutrition in Jorge Lobo’s disease can cause certain resistance to weight of these organs may reflect nutritional changes5,16. In the present fungal growth, characterized by the lower viability index, total number study, the weight of the liver and spleen of the malnourished group of fungi and reduced size of footpads found in the malnourished group. showed a significantly reduction when compared to groups without This fact is unexpected because malnutrition has been most commonly food restriction, as described earlier in the literature related to other associated with increased susceptibility to infectious agents11,21. However, pathologies4,5,25. this finding could be explained by the competition for nutrients between the host and the pathogen, as described in other studies22,23. In this study, the histopathological analysis of the spleen showed only sinusoidal congestion in all groups. The analysis of the liver showed that Similar results were reported by FRANÇA et al.6 in an experimental the inoculated groups (G1 and G3) presented vacuolar degeneration and study with BALB/c mice inoculated with Staphylococcus aureus using the more intense nuclear reactivity. The most relevant difference found was same model of malnutrition as ours. This study showed that malnourished related to the weight of the organs between the nourished (G3 and G4) and mice had a smaller amount of bacteria in the lungs compared to the malnourished groups (G1 and G2), characterized by atrophic hepatocyte nourished mice. trabeculae in the malnourished groups. Due to the fact that malnutrition is a chronic condition and the fungi which causes Jorge Lobo’s disease The study of OARADA et al.20 with BALB/c mice inoculated with does not spread to other organs, histological GMS-stained sections did Paracoccidioides brasiliensis (P. brasiliensis) using diet of 1.5% casein not reveal the presence of fungi in the liver and spleen. showed higher antifungal activity in the liver and spleen when compared

424 BARBOSA, A.S.A.A.; DIÓRIO, S.M.; PEDRINI, S.C.B.; NUNES, A.J.F.; BELONE, A.F.F.; SILVA, S.M.U.R.; SARTORI, B.G.C.; CALVI, S.A.; VILANI-MORENO, F.R. & PEREIRA, P.C.M. - The relevance of nutritional status and histopathological findings on the infectious process of BALB/c mice inoculated with Lacazia loboi. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 421-6, 2015. with the 20% casein diet, suggesting that protein restriction led to 3. Brito AC, Quaresma JAC. Lacaziose (doença de Jorge Lobo): revisão e atualização. An increased host resistance to P. brasiliensis. In another study, OARADA Bras Dermatol. 2007;82:461-74. 19 et al. found a greater number of fungi in the liver and spleen when 4. Coutinho EM, Silva FL, Barros AF, Araújo RE, Oliveira SA, Luna CF, et al. Repeated using a diet of 54% protein, when compared to a 5 and 20% casein infections with Schistosoma mansoni and liver fibrosis in undernourished mice. Acta diet. According to the authors, the results suggest that a higher protein Trop. 2007;101:15-24. diet reduces host resistance to P. brasiliensis. It’s an interesting finding since P. brasiliensis and L. loboi have many similarities. A survey of the 5. Couto JLA, Vieira RCS, Barbosa JM, Machado SS, Ferreira HS. Alterações da função 7 hepática de camundongos desnutridos e infectados pelo Schistosoma mansoni. Rev phylogenetic analysis of L. loboi held by HERR et al. suggested that Soc Bras Med Trop. 2008;41:390-3. L. loboi is a dimorphic fungus, taxonomically related to P. brasiliensis and that they belong to the Onygenales order, Ajellomycetaceae family, 6. França TGD, Ishikawa LLW, Zorzella-Pezavento SFG, Chiuso-Minicucci F, Guerino which could explain the similarity of results in our study. CPF, Cunha MLRS, et al. Immunization protected well nourished mice but not undernourished ones from lung injury in Methicillin-resistant Staphylococcus aureus (MRSA) infection. BMC Microbiol. 2009;9:240-7. When all the results are analyzed in conjunction, one important conclusion is that there is an interaction between Jorge Lobo’s disease 7. Herr RA, Tarcha EJ, Taborda PR, Taylor JW, Ajello L, Mendoza L. Phylogenetic analysis and nutrition, and as most patients have low socioeconomic conditions of Lacazia loboi places this previously uncharacterized pathogen within the dimorphic and are likely to present nutritional deficiency, new studies are needed to Onygenales. J Clin Microbiol. 2001;39:309-14. clarify the mechanisms involved in this interaction, especially considering 8. Grocott RG. A stain for fungi in tissue sections and smears using Gomori´s methenamine- that in humans the disease may develop in localized and disseminated silver nitrate technic. Am J Clin Pathol. 1995;25:975-9. clinical forms. 9. Ishikawa LLW, Rosa LC, França TGD, Peres RS, Chiuso-Minicucci F, Zorzella-Pezavento RESUMO SFG, et al. Is the BCG vaccine safe for undernourished individuals? Clin Dev Immunol. 2012;2012:673186.

A relevância do estado nutricional e alterações histopatológicas 10. Ishikawa LLW, França TGD, Chiuso-Minicucci F, Zorzella-Pezavento SFG, Marra NM, no processo infeccioso de camundongos BALB/c inoculados com Pereira PCM, et al. Dietary restriction abrogates antibody production induced by a Lacazia loboi DNA vaccine encoding the mycobacterial 65 kDa heat shock protein. Genet Vaccines Ther. 2009;7:11. O objetivo do estudo foi avaliar os efeitos da desnutrição 11. Kau AL, Ahern PP, Griffin NW, Goodman AL, Gordon JI. Human nutrition, the gut protéico-calórica em camundongos isogênicos da linhagem BALB/c microbiome, and immune system: envisioning the future. Nature. 2011;474(7351):327- inoculados com Lacazia loboi, empregando parâmetros nutricionais 36. e histopatológicos. Foram constituídos quatro grupos: G1- inoculados com restrição dietética; G2- não inoculados com restrição dietética; 12. Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Melo NT. Tratado de micologia G3- inoculados sem restrição dietética; G4- não inoculados sem restrição médica Lacaz. 9th ed. São Paulo: Sarvier; 2002. dietética. Após instalada a desnutrição, os animais foram inoculados via 13. Lacaz CS, Baruzzi RG, Rosa MCB. Doença de Jorge Lobo. São Paulo: Ed. USP-IPSIS; intradérmica no coxim plantar e após quatro meses foram sacrificados 1986. para remoção do coxim plantar, fígado e baço. A infecção não exerceu grande influência no peso corporal dos camundongos. O peso do fígado 14. Madeira S, Opromolla DVA, Belone AFF. Inoculation of BALB/C mice with Lacazia e baço apresentou redução nos grupos desnutridos em comparação loboi. Rev Inst Med Trop Sao Paulo. 2000;42:239-43. aos grupos nutridos. A lesão macroscópica, a viabilidade e o número 15. Malafaia G, Serafim TD, Silva ME, Pedrosa ML, Rezende AS. Protein-energy malnutrition total de fungos dos coxins plantares dos camundongos inoculados decreases immune response to vaccine in BALB/c mice. Parasite Immunol. revelaram aumento no G3 quando comparado com o G1. Em relação 2009;31:41-9. à análise histopatológica dos coxins plantares observou-se aumento da celularidade global na composição do granuloma no G3 em relação ao 16. Oliveira SA, Silva LM, Barbosa Junior AA, Ribeiro-Dos-Santos R, Coutinho EM, Andrade ZA, et al. Decreased humoral and pathologic responses in undernourished G1, com grande número de macrófagos e células gigantes multinucleadas, mice infected with Schistosoma mansoni. Parasitol Res. 2004;93:30-5. discretos números de linfócitos estavam presentes em G3 e aumentados no G1. Os resultados sugerem que existe grande interação entre nutrição 17. Opromolla DVA, Belone AFF, Taborda PRO, Taborda VBA. Correlação clínico patológica e doença de Jorge Lobo. em 40 casos novos de blastomicose. An Bras Dermatol. 2000;75:425-34.

18. Opromolla DVA, Taborda PR, Taborda VBA, Viana S, Furtado JF. Lobomicose: relato CONFLICT OF INTEREST de 40 casos novos. An Bras Dermatol. 1999;74:135-41.

The authors declare that there are no conflicts of interest. 19. Oarada M, Igarashi M, Tsuzuki T, Kamei K, Hirasaka K, Nikawa T, et al. Effects of a high-protein diet on host resistance to Paracoccidioides brasiliensis in mice. Biosci REFERENCES Biotechnol Biochem. 2010;74:620-6.

20. Oarada M, Kamei K, Gonoi T, Tsuzuki T, Toyotome T, Hirasaka K, et al. Beneficial 1. Abreu MAMM, Weckx LLM, Hirata CHW. Histological and ultrastructural aspects of effects of a low-protein diet on host resistance to Paracoccidioides brasiliensis in the tongue in undernourished rats. Rev Bras Otorrinolaringol. 2006;72:523-7. mice. Nutrition. 2009;25:954-63.

2. Belone AFF, Madeira S, Rosa PS, Opromolla DVA. Experimental reproduction of the Jorge Lobo’s disease in BALB/c mice inoculated with Lacazia loboi obtained from a previously infected mouse. Mycopathologia. 2002;155:191-4.

425 BARBOSA, A.S.A.A.; DIÓRIO, S.M.; PEDRINI, S.C.B.; NUNES, A.J.F.; BELONE, A.F.F.; SILVA, S.M.U.R.; SARTORI, B.G.C.; CALVI, S.A.; VILANI-MORENO, F.R. & PEREIRA, P.C.M. - The relevance of nutritional status and histopathological findings on the infectious process of BALB/c mice inoculated with Lacazia loboi. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 421-6, 2015.

21. Pereira PCM. Interação entre infecção, nutrição e imunidade na medicina tropical. In: 29. Vilani-Moreno FR, Silva LM, Opromolla DV. Evaluation of the phagocytic activity of Cimerman S, Cimerman B, editores. Medicina tropical. São Paulo: Atheneu; 2003. peripheral blood monocytes of patients with Jorge Lobo’s disease. Rev Soc Bras Med p. 655-60. Trop. 2004;37:165-8.

22. Prentice AM, McDermid J. The host-pathogen battle for micro-nutrients. Annu Rev Nutr. 30. Vilani-Moreno FR, Fecchio D, Mattos MCI, Moscardi-Bacchi M, Defaveri J, Franco 2008. doi: 10.1146/annurev.nutr.28.061807.1555.27 M. Study of pulmonary experimental paracoccidioidomycosis by analysis of bronchoalveolar lavage cells: resistant vc. susceptible mice. Mycopathologia. 23. Potrykus J, Ballou ER, Childers DS, Brown AJP. Conflicting interests in the pathogen–host 1998;141:79-91. tug of war: fungal micronutrient scavenging versus mammalian nutritional immunity. PLOS Pathog. 2014;10:e1003910. 31. Vilani-Moreno FR, Opromolla DVA. Determinação da viabilidade do Paracoccidioides loboi em biópsias de pacientes portadores de doença de Jorge Lobo. An Bras Dermatol. 24. Ribeiro DA, Pereira PCM, Machado JM, Silva SB, Pessoa AWP, Salvador DMF. Does 1997;72:433-7. toxoplasmosis cause DNA damage? An evaluation in isogenic mice under normal diet or dietary restriction. Mutat Res. 2004;559:169-76. 32. Vilela R, Mendoza L, Rosa PS, Belone AFF, Madeira S, Opromolla DVA, et al. Molecular model for studying the uncultivated fungal pathogen Lacazia loboi. J Clin Microbiol. 25. Serafim TD, Malafaia G, Silva ME, Pedrosa ML, Rezende SA. Immune response to 2005;43:3657-61. Leishmania (Leishmania) chagasi infection is reduced in malnourished BALB/c mice. Mem Inst Oswaldo Cruz. 2010;105:811-7. 33. Waitzberg DL, Lotierzo PHP, Silva AJD, Schronts E, Cerra F. Imunonutrição. In: Waitzberg DL, editor. Nutrição oral, enteral e parenteral na prática clínica. 3rd. ed. São Paulo: 26. Talhari C, Oliveira CB, Santos MNS, Ferreira LC, Talhari S. Disseminated lobomycosis. Atheneu; 2000. p. 1-38. Int J Dermatol. 2008;47:582-3. 34. Woods WJ, Belone AFF, Carneiro LB, Rosa PS. Ten years experience with Jorge Lobo´s 27. Vilani-Moreno FR, Mozer E, Sene AMG, Perasçoli MO, Pereira TC, Miras MG, et al. In disease in the state of Acre, Amazon region, Brazil. Rev Inst Med Trop Sao Paulo. vitro and in situ activation of the complement system by the fungus Lacazia loboi. 2010;52:273-8. Rev Inst Med Trop Sao Paulo. 2007;49:97-101. Received: 16 September 2014 28. Vilani-Moreno FR, Belone AFF, Soares CT, Opromolla DVA. Immunohistochemical Accepted: 2 February 2015 characterization of the cellular infiltrate in Jorge Lobo’s disease. Rev Iberoam Micol. 2005;22:44-9.

426 Rev. Inst. Med. Trop. Sao Paulo 57(5):427-430, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500010

BRIEF COMMUNICATION

IMMUNODIAGNOSIS OF HUMAN STRONGYLOIDIASIS: USE OF SIX DIFFERENT ANTIGENIC FRACTIONS FROM Strongyloides venezuelensis PARASITIC FEMALES

Marcelo Andreetta CORRAL(1,2), Fabiana Martins de PAULA(1,2), Maiara GOTTARDI(1,2), Dirce Mary Correia Lima MEISEL(1,2), Vera Lucia Pagliusi CASTILHO(3), Elenice Messias do Nascimento GONÇALVES(3), Pedro Paulo CHIEFFI(1,4) & Ronaldo Cesar Borges GRYSCHEK(1,2)

SUMMARY

The aim of this study was to evaluate six different antigenic fractions from Strongyloides venezuelensis parasitic females for the immunodiagnosis of human strongyloidiasis. Soluble and membrane fractions from S. venezuelensis parasitic females were prepared in phosphate-buffered saline (SSF and SMF, respectively), Tris-HCl (TSF and TMF, respectively), and an alkaline buffer (ASF and AMF, respectively). Serum samples obtained from patients with strongyloidiasis or, other parasitic diseases, and healthy individuals were analyzed by enzyme-linked immunosorbent assay (ELISA). Soluble fractions SSF, TSF, and ASF showed 85.0%, 75.0%, and 80.0% sensitivity and 93.1%, 93.1%, and 87.5% specificity, respectively. Membrane fractions SMF, TMF, and AMF showed 80.0%, 75.0%, and 85.0% sensitivity, and 95.8%, 90.3%, and 91.7% specificity, respectively. In conclusion, the present results suggest that the fractions obtained from parasitic females, especially the SSF and SMF, could be used as alternative antigen sources in the serodiagnosis of human strongyloidiasis.

KEYWORDS: Strongyloidiasis; Serodiagnosis; Heterologous antigens; Strongyloides venezuelensis; Parasitic females.

Human strongyloidiasis is often caused by the nematode as they are found in the intestinal mucosa of the host and might elicit Strongyloides stercoralis. This parasite is found worldwide but is mainly an immune response5,6. The aim of our study was to evaluate different located in tropical and subtropical regions17. In humans, S. stercoralis antigenic fractions from S. venezuelensis parasitic females for their can cause an asymptomatic chronic gastrointestinal infection. However, application in the immunodiagnosis of human strongyloidiasis. in immunocompromised individuals this parasite can cause a fatal hyperinfection syndrome or disseminated strongyloidiasis14. Antigenic fractions from S. venezuelensis parasitic females were evaluated by samples of immunocompetent individuals. Serum samples A definitive diagnosis of strongyloidiasis is made through the were obtained from individuals at the Hospital das Clínicas of the detection of larvae in feces; however, parasitological methods have low Faculdade de Medicina at the Universidade de São Paulo (HCFMUSP). sensitivity because of the irregular and intermittent release of larvae Of these, 20 patients were harboring S. stercoralis larvae. Thirty-two into feces10. Immunological methods have been widely used in the patients were infected with other parasites: hookworm (n = 4); Ascaris diagnosis of human strongyloidiasis because of their high sensitivity3. lumbricoides (n = 2); Blastocystis spp. (n = 3); Enterobius vermicularis A major limitation of these methods is that it can be difficult to obtain (n = 1); Endolimax nana (n = 3); Giardia intestinalis (n = 3); Hymenolepis sufficient quantities of S. stercoralis larvae for fractionation and analysis. nana (n = 1); Schistosoma mansoni (n = 9); hookworm and H. nana If alternative antigens were available, including those from heterologous (n = 1); S. mansoni, A. lumbricoides, Entamoeba coli, Blastocystis spp., species such as Strongyloides venezuelensis, more satisfactory results for and E. nana (n = 1); G. intestinalis and E. nana (n = 1); A. lumbricoides the immunodiagnosis of human strongyloidiasis might be possible2,4,7. and Blastocystis spp (n = 1); E. nana, S. mansoni, and Blastocystis spp (n = 1); hookworm, Escherichia coli, Entamoeba dispar/histolytica, Antigenic preparations from S. venezuelensis filariform larvae are and Schistosoma mansoni (n = 1). The remaining 40 samples were most often used in the standardization and application of immunological from seemingly healthy volunteers based on their clinical observation, techniques4,7. Considering the life cycle of Strongyloides spp., it is without evidence of contact with S. stercoralis or previous history of necessary to study other antigenic sources, such as female parasites, strongyloidiasis, and negative in all parasitological diagnostic methods.

(1) Universidade de São Paulo, Instituto de Medicina Tropical de São Paulo, São Paulo, SP, Brasil. (2) Universidade de São Paulo, Faculdade de Medicina, Hospital das Clínicas, Departamento de Moléstias Infecciosas e Parasitárias (LIM/06) São Paulo, SP, Brasil. (3) Universidade de São Paulo, Faculdade de Medicina, Seção de Parasitologia da Divisão de Laboratório Central do Hospital das Clínicas, São Paulo, SP, Brasil. (4) Santa Casa de Misericórdia de São Paulo, Faculdade de Ciências Médicas, São Paulo, SP, Brasil. Correspondence to: Ronaldo Cesar Borges Gryschek, Universidade de São Paulo, Faculdade de Medicina, Hospital das Clínicas, Instituto de Medicina Tropical, Laboratório de Investigação Médica (LIM06). Av. Dr. Enéas de Carvalho Aguiar 470, 05403-000 São Paulo, SP, Brasil. Tel: +55 11 3061 8220. E-mail: [email protected] CORRAL, M.A.; PAULA, F.M.; GOTTARDI, M.; MEISEL, D.M.C.L.; CASTILHO, V.L.P.; GONÇALVES, E.M.N.; CHIEFFI, P.P. & GRYSCHEK, R.C.B. – Immunodiagnosis of human strongyloidiasis: use of six different antigenic fractions from Strongyloides venezuelensis parasitic females. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 427-30, 2015.

For each group, one stool sample was analyzed by the techniques reactions were stopped by adding 2 N H2SO4. The optical density (OD) described by LUTZ12 and RUGAI et al.19 and an agar plate culture was determined at 492 nm using an ELISA reader (Thermo Fischer method18. The study received approval (protocol 266.046) from the Scientific, Waltham, MA, USA). Research Ethics Committee of the Universidade de São Paulo (Sao Paulo, Brazil). Statistical analyses were performed using GraphPad Prism version 5.0 (Graph Pad Software Inc. San Diego, USA). The ELISA index (EI) S. venezuelensis parasitic females were obtained from Wistar rats was calculated according to the following formula: EI = OD/cutoff. An EI (Rattus norvegicus) that were experimentally infected using protocol value greater than one for a sample was considered positive. Tests were CPE-IMT 2011/126. To recover parasitic females, rats were euthanized evaluated by calculating sensitivity, specificity, accuracy, kappa index on day 14 post-infection. The small intestines were then removed as (k), and likelihood ratio (LR). Any p-value below 0.05 was considered described by NAKAI & AMARANTE15. Briefly, the intestine was statistically significant. longitudinally sectioned and placed on a sedimentation chalice in contact with saline solution for four h at 37 ºC; the females were then counted To our knowledge, the present study is the first to use different and stored at -20 ºC until use. antigenic fractions from S. venezuelensis parasitic females for the immunodiagnosis of human strongyloidiasis. We used six antigenic For antigenic extraction, approximately 5,000 parasitic females fractions from parasitic females; three fractions were soluble and three (F) were incubated with three different extraction buffers: 10 mM were membrane-derived. The concentration of proteins from SSF, TSF, phosphate-buffered saline (PBS, pH 7.2), 25 mM Tris-HCl (pH 7.5), and ASF were 0.174, 0.174 and 0.708 mg/mL, respectively. Membrane or 0.15 M NaOH. All the extraction buffers were supplemented with fractions showed protein concentration of 0.631 (SMF), 0.300 (TMF), protease inhibitors (Sigma-Aldrich, St. Louis, MO, USA). Each and 0.261 mg/mL (AMF). Although differences were observed in protein extraction buffer was used to generate soluble (S) and membrane (M) concentration, there was no change in the pattern of electrophoretic antigenic fractions. For the soluble fractions, parasitic females were migration for the six fractions investigated, presenting bands of 25 and added to PBS (S), Tris-HCl (T), or NaOH (A) and disrupted in an ice 150 kDa, and almost all samples presenting a band of approximately bath using a tissue homogenizer. The suspensions were centrifuged at 23 kDa (Fig. 1). 12,400 × g for 30 min at 4 ºC and supernatants collected. The soluble fractions in PBS, Tris-HCl, and NaOH were designated SSF, TSF, and ASF, respectively. For membrane fractions, SSF and ASF pellets were resuspended in 1% sodium dodecyl sulfate (SDS), boiled for five min at 100 ºC, and centrifuged (12,400 × g, 30 min, 4 ºC); subsequently, the supernatants were collected. These membrane fractions were designated SMF and AMF. The TSF pellets were resuspended in 7 M urea, 2 M thiourea, and 2% CHAPS ([(3-cholamidopropyl) dimethyl-ammonio]-1- propanesulfonate); then, they were disrupted in an ice bath using a tissue homogenizer. The samples were centrifuged (12,400 × g, 30 min, 4 ºC) and supernatants were collected; these fractions were designated TMF. All fractions were analyzed for protein content according to the method of LOWRY et al.11, subdivided into aliquots, and stored at -20 ºC until use. Fractions were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by LAEMMLI9 under reducing conditions. Each of the antigenic fractions (SSF, TSF, ASF, SMF, TMF, and AMF) was electrophoresed using a 12% acrylamide separation gel. The gels were then analyzed using PlusOne Coomassie table PhastGel Blue R-350 (GE HealthCare Bio-Sciences AB, Piscataway, NJ, USA).

Enzyme-linked immunosorbent assays (ELISAs) were performed 2 according to CORRAL et al. , with some modifications. Briefly, the wells Fig. 1 - Electrophoretic profiles of soluble (SSF, TSF, and ASF) and membrane (SMF, of polystyrene microplates (Corning-Costar, New York, NY, USA) were TMF, and AMF) fractions from Strongyloides venezuelensis parasitic females, obtained coated with SSF, TSF, ASF, SMF, TMF, or AMF (5 μg/mL) in carbonate- using 12% SDS-PAGE and Coomassie blue staining. MW, molecular weight standard in bicarbonate buffer (0.06 mM, pH 9.6) and incubated overnight at 4 °C. kilodaltons (kDa). After incubation, plates were washed (3 × 5 min) with PBS containing 0.05% (v/v) Tween 20 (PBS-T), and blocked with PBS-T supplemented The diagnostic parameters and efficiency of ELISA for the six with 3% (w/v) nonfat milk (PBS-TM) for 45 min at 37 °C. Serum samples antigenic fractions are shown in Fig. 2. Among the soluble fractions, were diluted 1:400 and 1:200 in PBS-TM for the soluble and membrane SSF had the highest value of sensitivity and specificity (85% and 93.1%, fractions, respectively. Fc-specific goat anti-human IgG conjugated to respectively). The value of sensitivity and specificity for the membrane peroxidase (Sigma-Aldrich, St. Louis, MO, USA) was diluted 1:30,000 fraction SMF were also high, at 80% and 95.8%, respectively. The k in PBS-TM. Color was developed by adding enzyme substrate (4 mM values ranged from 0.619 to 0.753 for the soluble fractions, and 0.630 orthophenylenediamine, 0.03% H2O2, 0.1 M citrate phosphate buffer, to 0.772 for the membrane fractions. Of the six fractions tested, those pH 5.5) and incubated at room temperature for 15 min in the dark. The obtained using PBS provided optimal diagnostic parameters. An LR

428 CORRAL, M.A.; PAULA, F.M.; GOTTARDI, M.; MEISEL, D.M.C.L.; CASTILHO, V.L.P.; GONÇALVES, E.M.N.; CHIEFFI, P.P. & GRYSCHEK, R.C.B. – Immunodiagnosis of human strongyloidiasis: use of six different antigenic fractions from Strongyloides venezuelensis parasitic females. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 427-30, 2015.

Fig. 2 - ROC curve indicating the optimum point of reaction (cut-off), sensitivity (Se), specificity (Sp), diagnostic efficiency (DE), kappa indexk ( ), likelihood ratio (LR), and area under curve (AUC) for IgG detection in serum samples using soluble (SSF, TSF, and ASF) and membrane (SMF, TMF, and AMF) fractions from Strongyloides venezuelensis parasitic females. greater than 10 indicates high performance with respect to the detection been proposed. Therefore, female parasites represent a viable antigenic of specific IgG antibodies in patients with strongyloidiasis7. In this study, source; however, its use as a source of antigens remains uncommon. the antigenic fractions obtained with PBS had high LRs (12.2-19.2), GONÇALVES et al.5,6, who used an alkaline extract similar to ASF from indicating that these preparations had high ability to discriminate between S. venezuelensis parasitic females, reported similar results with respect strongyloidiasis patients and controls. to sensitivity and specificity as seen in the present study. Other antigenic fractions from the female parasite were not investigated by these authors. Differences among values for diagnosis were observed; it may be due In our current study, we have shown that different antigenic extracts from to changes in the action of buffers used for the production of antigenic female parasites can be used in the diagnosis of human strongyloidiasis. fractions, which can facilitate the antigen-antibody interaction. In general, there are major concerns regarding the antigenic preparations used in The increasing use of recombinant antigens for the serological serological tests, especially regarding the evaluation of buffers used for diagnosis of human strongyloidiasis has shown some promise1,8. However, the extraction of proteins, which is fundamental to obtaining antigens4. there are some limitations regarding resources in areas that are endemic Cross-reactivity was observed for the six antigenic fractions with the for this helminthiasis. This lack of resources makes the application of following parasites: hookworms (1/4 in SSF and TMF), Schistosoma these methodologies problematic in most regions. If a laboratory has mansoni (2/9 in TSF and TMF), A. lumbricoides (1/2 in ASF), G. adequate infrastructure and reagents for the production of recombinant intestinalis (1/3 in AMF), Blastocystis spp (1/3 in ASF), and poly- antigens, then this technique could be viable. Nevertheless, in countries infection with hookworms and H. nana (1/1 in SSF, ASF, and AMF). where the conditions are limited, the antigenic extracts preparations should be based on protocol, lower cost, and with good sensitivity and The various forms of the S. venezuelensis filarial larvae during the specificity results. Thus, the use of S. venezuelensis parasitic females, parasite life cycle can be easily obtained in murine models13. The use especially soluble and membrane fractions extracted with PBS, could of parasitic females has not been widely explored, possibly because provide an alternative source of antigens for the immunodiagnosis of of the difficulties involved in obtaining sufficient numbers for antigen human strongyloidiasis. production. However, specific proteins are present in parasitic females, and these proteins present new possibilities for antigen production16. RESUMO Recently, GONÇALVES et al.5,6 showed that antigens from S. venezuelensis parasitic females could be used in the immunodiagnosis Imunodiagnóstico da estrongiloidíase humana: o uso de seis of human strongyloidiasis. diferentes frações antigênicas de fêmeas parasitas de Strongyloides venezuelensis This study is the first to report the use of membrane antigens from S. venezuelensis parasites females. Our results showed high specificity of the O objetivo deste estudo foi avaliar seis frações antigênicas diferentes membrane antigens compared with those in soluble preparations. The use de fêmeas parasitas de Strongyloides venezuelensis para o diagnóstico of membrane fractions from S. venezuelensis infective larvae has shown sorológico da estrongiloidíase humana. As frações solúveis e de promising results for the immunodiagnosis of human strongyloidiasis2. membrana de fêmeas parasitas de S. venezuelensis foram preparadas em solução salina tamponada (SSF e SMF, respectivamente), Tris-HCl (TSF e It is difficult to obtain specific antigenic fractions for the immune TMF, respectivamente) e tampão alcalino (ASF e AMF, respectivamente). diagnosis of strongyloidiasis, and a reliable diagnostic test is urgently As amostras de soro obtidas de pacientes com estrongiloidíase, com required. To produce antigens for the diagnosis of human strongyloidiasis, outras parasitoses e indivíduos saudáveis, foram analisadas pelo ensaio the use of heterologous species maintained in experimental models has imunoenzimático (ELISA). As frações solúveis SSF, TSF e ASF

429 CORRAL, M.A.; PAULA, F.M.; GOTTARDI, M.; MEISEL, D.M.C.L.; CASTILHO, V.L.P.; GONÇALVES, E.M.N.; CHIEFFI, P.P. & GRYSCHEK, R.C.B. – Immunodiagnosis of human strongyloidiasis: use of six different antigenic fractions from Strongyloides venezuelensis parasitic females. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 427-30, 2015.

apresentaram sensibilidade de 85,0%, 75,0%, e 80,0% e especificidade 7. Gonzaga HT, Vila-Verde C, Nunes DS, Ribeiro VS, Cunha-Júnior JP, Costa-Cruz JM. de 93,1%, 93,1% e 87,5%, respectivamente. As frações de membrana, Ion-exchange protocol to obtain antigenic fractions with potential for serodiagnosis of strongyloidiasis. Parasitology. 2013;140:69-75. SMF, TMF e AMF demonstraram sensibilidade de 80,0%, 75,0%, e 85,0%, e especificidade de 95,8%, 90,3% e 91,7%, respectivamente. 8. Krolewiecki AJ, Ramanathan R, Fink V, McAuliffe I, Cajal SP, Won K, et al. Improved Em conclusão os presentes resultados sugerem que as frações obtidas diagnosis of Strongyloides stercoralis using recombinant antigen-based serologies in a a partir de fêmeas parasitas, especialmente o SSF e SMF, podem ser community-wide study in northern Argentina. Clin Vaccine Immunol. 2010;17:1624- utilizadas como fonte alternativa de antígenos no imunodiagnóstico da 30. estrongiloidiase humana. 9. Laemmli UK. Cleavage of structural proteins during assembly of head of bacteriophage T4. Nature. 1970;227:680-5. ACKNOWLEDGMENTS 10. Levenhagen MA, Costa-Cruz JM. Update on immunologic and molecular diagnosis This research was supported by the Fundação de Amparo à Pesquisa of human strongyloidiasis. Acta Trop. 2014;135:33-43. do Estado de São Paulo (FAPESP 2013/04236-9), Brazil. 11. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-75. REFERENCES 12. Lutz A. O Schistosoma mansoni e a schistosomose segundo observações feitas no 1. Bisoffi Z, Buonfrate D, Sequi M, Mejia R, Cimino RO, Krolewiecki AJ, et al. Brasil. Mem Inst Oswaldo Cruz. 1919;11:121-5. Diagnostic accuracy of five serologic tests for Strongyloides stercoralis infection. PLoS Negl Trop Dis. 2014;8:e2640. 13. Machado ER, Ueta MT, Gonçalves-Pires MR, De Oliveira JB, Faccioli LH, Costa- Cruz JM. Strongyloides venezuelensis alkaline extract for the diagnosis of human 2. Corral MA, Paula FM, Gottardi M, Meisel DMCL, Chieffi PP, Gryschek strongyloidiasis by enzyme linked immunosorbent assay. Mem Inst Oswaldo Cruz. RC. Membrane fractions from Strongyloides venezuelensis for using in the 2003;98:849-51. immunodiagnosis of human strongyloidiasis. Rev Inst Med Trop Sao Paulo. 2015;57:77-80. 14. Marcos LA, Terashima A, Canales M, Gotuzzo E. Update on strongyloidiasis in the immunocompromised host. Curr Infect Dis Rep. 2011;13:35-46. 3. Costa-Cruz JM, Bullamah CB, Gonçalves-Pires MR, Campos DM, Vieira MA. Cryo-microtome sections of coproculture larvae of Strongyloides stercoralis 15. Nakai ES, Amarante AFT. Infecção experimental de camundongos (Mus musculus) and Strongyloides ratti as antigen sources for the immunodiagnosis of human e ratos (Rattus norvegicus) com Strongyloides venezuelensis. Rev Bras Parasitol Vet. strongyloidiasis. Rev Inst Med Trop Sao Paulo. 1997;39:313-7. 2001;10:1-6.

4. Feliciano ND, Gonzaga HT, Fatima Goncalves-Pires MR, Ribeiro Gonçalves 16. Northern C, Grove DI. Strongyloides-stercoralis: antigenic analysis of infective larvae AL, Rodrigues RM, Ueta MT, et al. Hydrophobic fractions from Strongyloides and adult worms. Int J Parasitol. 1990;20:381-7. venezuelensis for use in the human immunodiagnosis of strongyloidiasis. Diagn Microbiol Infect Dis. 2010;67:153-61. 17. Paula FM, Costa-Cruz JM. Epidemiological aspects of strongyloidiasis in Brazil. Parasitology. 2011;138:1331-40. 5. Gonçalves AL, Nunes DS, Gonçalves-Pires MR, Ueta MT, Costa-Cruz JM. Use of larval, parasitic female and egg antigens from Strongyloides venezuelensis to 18. Paula FM, Gottardi M, Corral MA, Chieffi PP, Gryschek RC. Is the agar plate detect parasite-specific IgG and immune complexes in immunodiagnosis of human culture a good tool for the diagnosis of Strongyloides stercoralis in candidates for strongyloidiasis. Parasitology. 2012;139:956-61. transplantation? Rev Inst Med Trop Sao Paulo. 2013;55:291.

6. Gonçalves AL, Silva CV, Ueta MT, Costa-Cruz JM. Antigen, antibody and immune 19. Rugai E, Mattos T, Brisola AP. Nova técnica para isolar larvas de nematóides das complex detection in serum samples from rats experimentally infected with fezes: modificações do método de Baermann. Rev Inst Adolfo Lutz. 1954;14:5-8. Strongyloides venezuelensis. Exp Parasitol. 2012;130:205-8. Received: 16 March 2015 Accepted: 19 June 2015

430 Rev. Inst. Med. Trop. Sao Paulo 57(5):431-433, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500011

BRIEF COMMUNICATION

PREVALENCE OF CHAGAS DISEASE IN A RURAL AREA IN THE STATE OF CEARA, BRAZIL

Erlane Chaves FREITAS(1), Maria de Fátima OLIVEIRA(2), Mônica Coelho ANDRADE(2), Arduina Sofia Ortet de Barros VASCONCELOS(2), José Damião da SILVA FILHO(2), Darlan da Silva CÂNDIDO(2), Laíse dos Santos PEREIRA(2), João Paulo Ramalho CORREIA(2), José Napoleão Monte da CRUZ(3) & Luciano Pamplona de Góes CAVALCANTI(1,4)

SUMMARY

Chagas disease is caused by Trypanosoma cruzi and affects about two to three million people in Brazil, still figuring as an important public health problem. A study was conducted in a rural area of the municipality of Limoeiro do Norte - CE, northeastern Brazil, aiming to determine the prevalence of T. cruzi infection. Of the inhabitants, 52% were examined, among whom 2.6% (4/154) were seropositive in at least two serological tests. All seropositive individuals were older than 50 years, farmers, with a low education and a family income of less than three minimum wages. Active surveillance may be an alternative for early detection of this disease.

KEYWORDS: Chagas disease; Epidemiology; Health survey.

In Brazil, there are about two to three million people infected with straight line. The municipality is located in the Jaguaribe river valley, Trypanosoma cruzi, generating a high social, pension and healthcare northeastern Brazil (5° 08 ‘44’ and 38° 05 ‘53 “)11. The locality of Sape impact, and also the need for continuous surveillance7,15. was chosen randomly among those that had a greater number of insects captured between the years of 2006-2009 in the city of Limoeiro do The prevalence of Chagas disease in the state of Ceara (CE), Brazil, Norte17. The census type sample was possible due to the reduced number according to the National serological survey that was conducted between of inhabitants of the locality, in addition to the fact that it meets the goal 1975 and 1980, was 0.84%. However, the results for Ceara presented of providing early diagnosis to individuals in the region. This location limitations, such as the long-term storage of samples, a fact that may was chosen due to the presence of infected triatomines, captured in have affected the validity of this finding4. The municipality of Limoeiro routine surveillance activities of the municipality and because Limoeiro do Norte - CE stood out by its high prevalence of Chagas disease, mainly do Norte is located between the areas of highest disease prevalence, between last century’s 50s and 70s. Serological studies performed in according to other studies1,17,18. Then, all 115 residences and its 296 humans until 1967 in Ceara brought up an infection prevalence of 14.8%, inhabitants were visited, informed about the objectives of the project for the whole state. In the same period, the prevalence in Limoeiro do and invited to participate. Socioeconomic data were collected using a Norte was 16.7%. In the next decade, from 1970 to 1974, the prevalence structured questionnaire and 154 people who agreed to participate had of human T. cruzi infection was 4.6%1. In addition to the high levels of blood samples taken. human infection, entomological studies showed triatomine infection rates of 14% in 1955-19761 and 5% in the period 2009-201118. The Enzyme-Linked Immunosorbent Assay (ELISA) method was used, according to the Wama Diagnostica® kit for Chagas Disease Epidemiological studies are important to spread information about (Brussels, Belgium) in the Laboratory for Research in Chagas disease the disease among populations in risk areas12. Therefore, this study aimed (LPDC) of the Federal University of Ceara, in Fortaleza. Serum to investigate the seroepidemiological situation of CD in a rural location samples that resulted reagent, or inconclusive in serology for anti-T. in Limoeiro do Norte, Ceara, Brazil, in order to provide early diagnosis cruzi antibodies by ELISA were forwarded to the Public Health Central and evaluate the profile of this population. Laboratory of Ceara (LACEN-CE) to be analyzed by three methods: indirect immunofluorescence (IIF), indirect hemagglutination (HAI) This cross-sectional study was conducted between February and and ELISA. According to the Brazilian Consensus on Chagas disease, September, 2011, in a rural area in the municipality of Limoeiro serum reagent individuals in at least two serological tests with different do Norte, which is 162 km away from the Capital, Fortaleza, in a methodological principles were considered positive14.

(1) Universidade Federal do Ceará, Departamento de Patologia e Medicina Legal, Fortaleza, CE, Brasil. (2) Universidade Federal do Ceará, Faculdade de Farmácia, Departamento de Análises Clínicas e Toxicológicas, Fortaleza, CE, Brasil. (3) Laboratório Central de Saúde Pública do Ceará, Fortaleza, CE, Brasil. (4) Universidade Federal do Ceará, Faculdade de Medicina, Departamento de Saúde Comunitária, Fortaleza, CE, Brasil. Correspondence to: Luciano Pamplona de Góes Cavalcanti, Departamento de Saúde Comunitária, Universidade Federal do Ceará, Faculdade de Medicina. R. Prof. Costa Mendes 1608, 5º andar, 60430-140 Fortaleza, CE, Brasil. Tel.: +55 85 99878969; Fax +55 85 33668050. E-mail: [email protected] FREITAS, E.C.; OLIVEIRA, M.F.; ANDRADE, M.C.; VASCONCELOS, A.S.O.B.; SILVA FILHO, J.D.; CÂNDIDO, D.S.; PEREIRA, L.S.; CORREIA, J.P.R.; CRUZ, J.N.M. & CAVALCANTI, L.P.G. - Prevalence of Chagas disease in a rural area in the state of Ceara, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 431-3, 2015.

Table 1 Seropositivity for anti-Trypanosoma cruzi antibodies by age group and sex among residents of a rural area in the municipality of Limoeiro do Norte – CE, 2011

Age Group Women Men Total (years) Exa Pos % Pos Exa Pos % Pos Exa Pos % Pos 0 - 9 4 0 - 4 0 - 8 0 - 10 - 19 11 0 - 13 0 - 24 0 - 20 - 29 16 0 - 10 0 - 26 0 - 30 - 39 20 0 - 9 0 - 29 0 - 40 - 49 10 0 - 8 0 - 18 0 - 50 - 59 16 3 18.8 7 0 - 23 3 13.0 60 - 69 11 0 - 7 0 - 18 0 - ≥ 70 4 0 - 4 1 25.0 8 1 12.5 Total 92 3 3.3 62 1 1.6 154 4 2.6 Exa: examined, Pos: positive.

The study was approved by the Research Ethics Committee of the Given the underreporting of individuals in the chronic phase of CD Federal University of Ceara (UFC COMEPE) with number 255/11. (FSMs) and the lack of studies that portray the current epidemiology of the disease, it is necessary to conduct further investigations in order to The index of Chagasic infection obtained, 2.6% (4/154) (Table 1), scale the disease status in endemic areas aiming to guide the maintenance was considered high, even though, it is about two times lower than that of actions for disease control and to provide diagnosis and adequate estimated for the whole municipality in the late 1970s1. treatment, when still benefic2,5,10.

In the present study, all positive participants were farmers, living During the period 2006-2009, approximately 40% of the insects in brick masonry houses, had a family income of up to three minimum captured in Limoeiro do Norte were in the intradomicile area. Also, a wages and primary education, thus consistent with the profile described noteworthy fact is that most of the captured specimens were nymphs, in the literature6,8. pointing to the domiciliation of the vector17. Furthermore, in the southeastern region of Ceara, Limoeiro do Norte showed the highest Vectorial transmission must probably have been the route of rate of natural infection among triatomines captured in the period from transmission responsible for the diagnosed cases, since positive 2009 to 201118. Besides, despite the reduction in mortality due to Chagas individuals for serum IgG anti-Trypanosoma cruzi did not mention disease in Brazil, in the period 1999-2007, the Northeast region stood out having a mother with CD or having donated or received blood prior as the only one to experience an increase in mortality, calling attention to the study. to the need for strengthening of control measures and improvement of care services to patients currently infected13. All positive individuals were older than 50 years, which shows the aging of the CD population also found in other studies3,9. Moreover, only With the decentralization of the endemic diseases control in the two infected children were detected in the recent national survey that municipalities in 1999, and the competition with other endemic diseases evaluated more than 9,000 children up to the age of five in the state of such as dengue, the disintegration of some programs for the control of Ceara16. Both results may indicate the effectiveness of vectorial control Chagas disease occurred. Thus, it is important to conduct sample surveys and improvement of housing conditions in these areas3,9. However, a to characterize the potential of transmission and to implement relevant recent entomological survey showed persistence of favorable conditions and timely control measures in areas such as Limoeiro do Norte, where for the maintenance of Chagasic endemy in Limoeiro do Norte – CE17,18. there is no current active entomological surveillance but have evidence of the presence of vectors. Even with the clear reduction of vectorial transmission in Brazil, there is still evidence of isolated cases16 and the prevalence of infection RESUMO of some vector species is considered high in the area under study17,18. In addition, the decentralization of monitoring and control may have Prevalência da doença de Chagas em área rural no estado do weakened the actions over other priorities such as dengue. Ceará, Brasil

The active case surveillance (the search for chronic cases in endemic A doença de Chagas é causada pelo Trypanosoma cruzi e atinge and high risk transmission areas) may be an alternative for early detection, cerca de dois a três milhões de pessoas no Brasil, permanecendo since the control actions prioritize combating transmission and not the como importante problema de saúde pública. Foi realizado um estudo investigation of existing disease cases. em área rural do município de Limoeiro do Norte - CE, nordeste do

432 FREITAS, E.C.; OLIVEIRA, M.F.; ANDRADE, M.C.; VASCONCELOS, A.S.O.B.; SILVA FILHO, J.D.; CÂNDIDO, D.S.; PEREIRA, L.S.; CORREIA, J.P.R.; CRUZ, J.N.M. & CAVALCANTI, L.P.G. - Prevalence of Chagas disease in a rural area in the state of Ceara, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 431-3, 2015.

Brasil, com o objetivo de conhecer a prevalência da infecção chagásica. 9. Diotaiuti L, Faria-Filho OF, Carneiro FC, Dias JC, Pires HH, Schofield CJ. Aspectos Foram examinados 52% dos habitantes, dentre os quais 2,6% (4/154) operacionais do controle de Triatoma brasiliensis. Cad Saude Publica. 2000;16(Supl 2):61-7. apresentaram sorologia reagente em pelo menos dois testes sorológicos. Todos os positivos tinham idade superior a 50 anos, eram agricultores, 10. Fabbro D, Velazquez E, Bizai ML, Denner S, Olivera V, Arias E, et al. Evaluation of com baixa escolaridade e renda familiar inferior a três salários mínimos. the ELISA-F29 test as an early marker of therapeutic efficacy in adults with chronic A busca ativa pode ser uma alternativa para o diagnóstico precoce dessa Chagas disease. Rev Inst Med trop Sao Paulo. 2013;55:167-72. doença. 11. IPECE. Instituto de Pesquisa e Estratégia Econômica do Ceará. Governo do Estado do Ceará. Perfil básico municipal 2013. Limoeiro do Norte: IPECE; 2013. [cited 2014 REFERENCES Mar 16]. Available from: 1. Alencar JE. História natural da doença de Chagas no estado do Ceará. Fortaleza: Imprensa Universidade da UFC;1987. 12. Martinez-Tovar JG, Rebollar-Telléz EA, Salas IF. Seroprevalence of T. cruzi infection in blood donors and Chagas cardiomyopathy in patients from the coal mining region 2. Andrade MC, Oliveira MF, Nagao-Dias AT, Coêlho ICB, Cândido DS, Freitas EC, of Coahuila, Mexico. Rev Inst Med Trop Sao Paulo. 2014;56:169-74. et al. Clinical and serological evolution in chronic Chagas disease patients in a 4-year pharmacotherapy follow-up: a preliminary study. Rev Soc Bras Med Trop. 13. Martins-Melo FR, Alencar CH, Ramos AN Jr, Heukelbach J. Epidemiology of 2013;46:776-8. mortality related to Chagas’ disease in Brazil, 1999-2007. PLoS Negl Trop Dis. 2012;6:e1508. 3. Borges-Pereira J, Sarquis O, Zauza PL, Britto C, Lima MM. Epidemiologia da doença de Chagas em quatro localidades rurais de Jaguaruana, estado do Ceará. 14. Ministério da Saúde. Secretaria de Vigilância em Saúde. Consenso brasileiro em Soroprevalência da infecção, parasitemia e aspectos clínicos. Rev Soc Bras Med doença de Chagas. Rev Soc Bras Med Trop. 2005;38(Supl 3):1-29. Trop. 2008;41:345-51. 15. Oliveira MF, Nagao-Dias AT, Pontes VMO, Souza Júnior AS, Coelho HLL, Coelho 4. Camargo ME, Silva GR, Castilho EA, Silveira AC. Inquérito sorológico da ICB. Tratamento etiológico da doença de Chagas no Brasil. Rev Patol Trop. prevalência da infecção chagásica no Brasil, 1975-1980. Rev Inst Med Trop Sao 2008;37:209-28. Paulo. 1984;26:192-204. 16. Ostermayer AL, Passos ADC, Silveira AC, Ferreria AW, Macedo V, Prata, A. O 5. Cançado JR. Long term evaluation of etiological treatment of Chagas disease with inquérito nacional de soroprevalência de avaliação do controle da doença de Chagas benzonidazole. Rev Inst Med Trop Sao Paulo. 2002;44:29-37. no Brasil (2001-2008). Rev Soc Bras Med Trop. 2011;44(Supl 2):108-21.

6. Carvalho RB, Silva HC, Couto MVG, Conceição FB, Ribeiro Junior G, Bastos, 17. Vasconcelos ASOB, Freitas EC, Andrade MC, Lima MM, Pereira LS, Gomes KCMS, CJC. Perfil biossocial dos indivíduos portadores de doença de Chagas atendidos no et al. Doença de Chagas: situação vetorial no município de Limoeiro do Norte – CE, ambulatório de infectologia do hospital Couto Maia, Salvador, Bahia. Rev Baiana no período de 2006 a 2009. Rev Inst Adolfo Lutz. 2013;72:295-301. Saude Publica. 2013;37(Supl 1):133-43. 18. Vasconcelos ASOB. Índice de infestação e infecção de triatomíneos por Trypanosoma 7. Dias JCP. Globalização, iniqüidade e doença de Chagas. Cad Saude Publica. cruzi na região sudeste do estado do Ceará. [Dissertação]. Fortaleza: Universidade 2007;23(Supl 1):S13-S22. Federal do Ceará, Pós-Graduação em Ciências Farmacêuticas, 2013.

8. Dias JCP. O controle da doença de Chagas no Brasil. In: Silveira AC, Segura E, Received: 11 June 2014 Guillén G, Russomando G, Schenone M, Dias JCR, et al., organizadores. O controle Accepted: 12 January 2015 da doença de Chagas nos países do cone sul da América: história de uma iniciativa internacional 1991-2001. Brasília: Organização Pan-Americana de Saúde; 2002. p. 145-250.

433 LIBRARY OF THE SÃO PAULO INSTITUTE OF TROPICAL MEDICINE

Website: http://www.imt.usp.br/sobre-o-imtsp/biblioteca Address: Biblioteca do Instituto de Medicina Tropical de São Paulo da Universidade de São Paulo Av. Dr. Enéas de Carvalho Aguiar, 470. 05403-000 - São Paulo - SP - Brazil. Telephone: 5511 3061-7003

The Library of the São Paulo Institute of Tropical Medicine (IMTSP Library) was created on January 15, 1959 in order to serve all those who are interested in tropical diseases.

The IMTSP Library has a collection consisting of books, theses, annals of congresses, journals, and reference works.

The collection of the Library can be searched through the USP Bibliographic Database – Dedalus at the URL http://200.144.190.234/F Rev. Inst. Med. Trop. Sao Paulo 57(5):435-438, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500012

BRIEF COMMUNICATION

GEOGRAPHICAL EXPANSION OF CANINE VISCERAL LEISHMANIASIS IN RIO DE JANEIRO STATE, BRAZIL

Denise Amaro da SILVA(1,3), Maria de Fátima MADEIRA(2) & Fabiano Borges FIGUEIREDO(3)

SUMMARY

Visceral Leishmaniasis (VL) is a vector-borne disease that affects humans, and domestic and wild animals. It is caused by the protozoan Leishmania (Leishmania) infantum (syn = Leishmania chagasi). The domestic dog (Canis familiaris) is considered the main reservoir of the etiologic agent of VL in domestic and peridomestic environments. In the past three years, although control actions involving domestic dogs are routinely performed in endemic areas of the Rio de Janeiro State, new cases of canine visceral leishmaniasis (CVL) have been reported in several municipalities. The objective of this short communication was to describe the geographical expansion of CVL in the Rio de Janeiro State, Brazil, through its reports in the scientific literature and studies performed by our group. From 2010 to 2013, autochthonous and allochthonous cases of CVL were reported in the municipalities of Mangaratiba, Marica, Niteroi, Barra Mansa, Cachoeiras de Macacu, Volta Redonda, Resende and Rio de Janeiro. These reports demonstrate that CVL is in intense geographical expansion around the state; therefore, a joint effort by public agencies, veterinarians and researchers is needed in order to minimize and/or even prevent the dispersion of this disease.

KEYWORDS: Canine visceral leishmaniasis; Geographical expansion; Rio de Janeiro.

Visceral Leishmaniasis (VL) is a disease that affects humans, and Formerly, the use of the enzyme-linked immunosorbent assay domestic and wild animals. It is caused by the protozoan Leishmania (ELISA) was recommended for the screening of CVL and indirect (Leishmania) infantum (syn = Leishmania chagasi). In Brazil, the main immunofluorescence assay (IFA) was used as a confirmatory test for vector responsible for its transmission is the female phlebotomine sand its diagnosis3. As of 2011, after conducting a multicenter study for the flyLutzomyia longipalpis13, but Lutzomyia cruzi has also been regarded assessment of serological tests, rapid chromatographic immunoassay as its vector in the Mato Grosso do Sul State26. based on dual-path platform (DPP) was introduced for disease screening and ELISA was used as confirmatory test22. Positive results The domestic dog (Canis familiaris) is considered the main reservoir of serological tests are used as a criterion for indication of euthanasia of the etiologic agent of VL10 because of its high susceptibility to infection in dogs. and greater proximity to humans, in addition to its high skin parasitism, which contributes to the maintenance and expansion of the transmission Significant changes in the transmission pattern of VL have been cycle in domestic and peridomestic environments1,3. verified lately; while it was initially found mostly in rural and wild environments, nowadays it is predominant in urban centers3,11,30. This In Brazil, VL is an endemic zoonosis currently present in 21 of process of urbanization has taken place gradually over the past thirty 27 states of the country, with higher concentration in the northeastern years, since the first large urban epidemics were recorded in Teresina, region24,31. Piaui State7 and São Luiz, Maranhão State27. Later, outbreaks of the disease were described in Rio de Janeiro, Rio de Janeiro State16 and Belo The National Program for VL Control3 adopts the euthanasia of Horizonte, Minas Gerais State14, as well as in Três Lagoas and Campo serum reactive canine in its control strategies. However, some authors Grande, Mato Grosso do Sul State19 and Palmas, Tocantins State3. argue that euthanasia of seropositive dogs is not an effective measure to control VL6,21. Historically, canine cases of VL often precede spatial and temporal

(1) Fundação Oswaldo Cruz, Instituto Nacional de Doenças Infecciosas Evandro Chagas,Pós-Graduação Stricto-sensu, Av. Brasil 4365, 21040-360 Manguinhos, Rio de Janeiro, RJ, Brasil. Phone: +55 21 3865-9536/3865-9553. (2) Fundação Oswaldo Cruz, Instituto Nacional de Doenças Infecciosas Evandro Chagas, Laboratório de Vigilância em Leishmaniose, Rio de Janeiro, RJ, Brasil. (3) Fundação Oswaldo Cruz, Instituto Nacional de Doenças Infecciosas, Laboratório de Pesquisa Clínica em Dermatozoonose em Animais Domésticos, Rio de Janeiro,RJ, Brasil. Correspondence to: Fabiano Borges Figueiredo. E-mail: [email protected] SILVA, D.A.; MADEIRA, M.F. & FIGUEIREDO, F.B. - Geographical expansion of canine visceral leishmaniasis in Rio de Janeiro State, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 435-8, 2015.

human cases, as it has occurred in the Ceará State9 and in Belo Horizonte, unplanned urban occupation associated with precarious sanitation Minas Gerais State2. In the Rio Grande do Sul State, the first canine cases and housing, are also elements that favor the adaptation of vectors to were registered in the municipality of São Borja in 2008 and the first anthropogenically modified environments20. With the expansion of human case occurred in 200924. motorway networks and popularization of travel, the transit of people and their pets have increased, thus increasing the risk of dispersion of certain This short communication aims to describe the geographical zoonoses, including VL5. In this context, some owners move their animals expansion of CVL in Rio de Janeiro State, Brazil, through its reports in to non-endemic areas in order to avoid their euthanasia, endangering not the scientific literature and studies performed by our group. only the human population, but also the canine population12.

In Rio de Janeiro State, a human case of VL was reported for the In recent years, two cases of CVL originated in areas of intense first time in 1977, in a neighborhood of the west zone of the city of Rio transmission of VL were described in unaffected areas. The first case de Janeiro, and since then, canine cases have been frequently reported in was reported by SILVA et al.28 in Cachoeiras de Macacu, and originated the same region15. The focus of VL reported in the municipality of Rio in the municipality of Pedreiras, Maranhao State. The second case was de Janeiro, in that year, involving human and canine infection, was the described by VASCONCELOS et al.29 in the municipality of Resende, most southern focus in Brazil associated with the presence of Lutzomyia and originated in the north mesoregion of Minas Gerais State. The transit longipalpis and canine infection17,18. of these animals may have contributed to the introduction of the disease in these regions, the etiological agent being found in those new places; In 1980, the Brazilian Ministry of Health officially established a suitable environment and specific vectors. the canine survey in areas with human cases of the disease, such as Realengo, Bangu and Serra do Lameirao - Senador Camara. In 1982- The identification of allochthonous cases in unaffected areas does 83, further investigations were carried out after reports of new human not mean that human cases might occur; nevertheless, the occurrence of cases in Campo Grande and Jacarepagua, which are areas where cases an event of CVL is an alert to conduct surveillance activities in order to of tegumentary leishmaniasis were also reported. Currently, canine prevent the dispersion of the disease and prepare health services and the studies take place mainly in neighborhoods located in the west zone of local population to cope with the problem. the city15,18. Also, whenever there is a suspected or confirmed case in a new region, entomological and serological surveys are conducted so that It is believed that this geographical expansion of CVL, not only in the action can be taken3. Rio de Janeiro State, but also in other Brazilian states, can be attributed to numerous factors, such as difficulties in eliminating the reservoirs; Despite the control performed in endemic areas of the city of Rio epidemiological diversity of affected regions; high financial and social de Janeiro, a worrisome persistence of VL-seropositive dogs has been costs of control; adaptive capacity; and insufficient measures adopted observed15. In 2010, a case of CVL was described in the south zone of the for vector control as well as for the control of other suspected vectors city11. CAMPOS et al.4 reported the first case of CVL in the municipality involved in the cycle. of Volta Redonda and predicted the expansion of this parasitosis in non- endemic areas, as it had already been verified in Marica8. This short communication demonstrates the need for a joint effort by the public agencies responsible for the control of visceral leishmaniasis, In 2011 and 2012, new cases of CVL were reported in the researchers and private veterinarians with the aim of deploying a set of municipalities of Mangaratiba, Marica, Niteroi, Volta Redonda and actions, besides those already performed and described by the control Rio de Janeiro22. The neighborhood of Caju, located in the port area, program, to minimize and/or even prevent the dispersion of this disease. was classified as the first urban focus with active transmission of CVL in the city of Rio de Janeiro, after confirmation of 25 cases23. After the RESUMO identification of canine cases, three human cases were reported: two autochthonous cases, one in Volta Redonda25 and another (fatal) in Barra Expansão geográfica da leishmaniose visceral canina no estado do Mansa, in addition to a third case of indeterminate autochthony in the Rio de Janeiro, Brasil city of Rio de Janeiro22. A Leishmaniose Visceral (LV) é uma doença de transmissão vetorial The hypothesis that canine cases of VL precede human cases, que acomete seres humanos, animais domésticos e silvestres causada concomitantly with the presence of the vector L. longipalpis, suitable pelo protozoário Leishmania (Leishmania) infantum (syn = Leishmania environments, and the geographical expansion of canine cases in Rio de chagasi). O cão doméstico (Canis familiaris) é considerado principal Janeiro State, has put epidemiological surveillance authorities on alert. reservatório do agente etiológico da LV no ambiente domiciliar e peridomiciliar. Nos últimos anos, apesar de ações de controle envolvendo Unlike what happens in endemic regions, the introduction of CVL in o cão doméstico serem rotineiramente realizados em áreas endêmicas municipalities considered unaffected may result in sudden expansion of do município do Rio de Janeiro, tem sido verificado novos casos de the disease due to lack of knowledge on the following: actual dispersion leishmaniose visceral canina (LVC) em diversos municípios do estado. of the disease, dynamic of transmission in these areas, sandfly fauna, O objetivo dessa comunicação curta foi descrever a expansão geográfica wild reservoirs, and canine population exposed to the parasite for the da LVC no estado do Rio de Janeiro, Brazil, através de relatos na first time12. literatura científica e estudos realizados pelo nosso grupo de pesquisa. No período de 2010 a 2013 casos de LVC autóctones e alóctones foram Factors such as environmental degradation, migration flows and notificados nos municípios de Mangaratiba, Maricá, Niterói, Barra

436 SILVA, D.A.; MADEIRA, M.F. & FIGUEIREDO, F.B. - Geographical expansion of canine visceral leishmaniasis in Rio de Janeiro State, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 435-8, 2015.

Mansa, Cachoeiras de Macacu, Volta Redonda, Resende e Rio de Janeiro. 14. Luz ZMP, Pimenta DN, Cabral ALLV, Fiúza VOP, Rabello A. Urbanização das Esses relatos demonstram que a LVC está em franca expansão geográfica leishmanioses e a baixa resolutividade diagnóstica em municípios da região metropolitana de Belo Horizonte. Rev Soc Bras Med Trop. 2001;34:249-54. no estado, sendo necessária ação conjunta dos órgãos públicos, médicos veterinários e pesquisadores no intuito de minimizar e/ou até mesmo 15. Marzochi MC, Fagundes A, Andrade MV, Souza MB, Madeira MF, Mouta-Confort evitar a expansão da doença. E, et al. Visceral leishmaniasis in Rio de Janeiro, Brazil: eco-epidemiological aspects and control. Rev Soc Bras Med Trop. 2009;42:570-80. ACKNOWLEDGMENT 16. Marzochi MC, Marzochi KB, Carvalho RW. Visceral leishmaniasis in Rio de Janeiro. Parasitol Today. 1994;10:37-40. The studies were supported by the Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ). Estudo de Doenças 17. Marzochi MCA, Coutinho SG, Sabroza PC, Souza MA, Souza PP, Toledo LM. Negligenciadas e Reemergentes and the Conselho Nacional de Pesquisa Leishmaniose visceral canina no Rio de Janeiro - Brasil. Cad Saude Publica. e Desenvolvimento (CNPq). Fabiano Borges Figueiredo holds a grant 1985;1:432-46. from CNPq for productivity in research. 18. Marzochi MCA, Sabroza PC, Toledo LM, Marzochi KBF, Tramontano NC, Rangel- Filho FB. Leishmaniose visceral na cidade do Rio de Janeiro - Brasil. Cad Saude REFERENCES Publica. 1985;1:5-17.

1. Ashford RW. Leishmaniasis reservoirs and their significance in control. Clin Dermatol. 19. Mestre GLC, Fontes CJF. A expansão da epidemia da leishmaniose visceral no estado 1996;14:523-32. de Mato Grosso, 1998-2005. Rev Soc Bras Med Trop. 2007;40:42-8.

2. Bevilacqua PD, Paixão HH, Modena CM, Castro MCPS. Urbanização da leishmaniose 20. Monteiro EM, da Silva JC, da Costa RT, Costa DC, Barata RA, de Paula EV, et al. visceral em Belo Horizonte. Arq Bras Med Vet Zootec. 2001;53:1-8. Visceral leishmaniasis: a study on phlebotomine sand flies and canine infection in Montes Claros, State of Minas Gerais. Rev Soc Bras Med Trop. 2005;38:147-52. 3. Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de Vigilância Epidemiológica. Manual de vigilância e controle da leishmaniose visceral. 21. Moreira ED Jr, Mendes de Souza VM, Sreenivasan M, Nascimento EG, Pontes de Brasília: Ministério da Saúde; 2006. Carvalho L. Assessment of an optimized dog-culling program in the dynamics of canine Leishmania transmission. Vet Parasitol. 2004;122:245-52. 4. Campos MP, Silva DA, Madeira MF, Velho AAJ, Figueiredo FB. First autochthonous case of canine visceral leishmaniasis in Volta Redonda, Rio de Janeiro, Brazil. Rev 22. Rio de Janeiro (Estado). Prefeitura da Cidade do Rio De Janeiro. Subsecretaria Bras Parasitol Vet. 2013;22:424-6. de Vigilância em Saúde. Superintendência de Vigilância Epidemiológica e Ambiental. Coordenação de Vigilância Epidemiologica. Divisão de Transmissíveis 5. Carranza-Tamayo CO, Carvalho MSL, Bredt A, Bofil MIR, Rodrigues RMB, Silva e Imunopreviníveis. Gerencia de doenças Transmitidas por Vetores e Zoonoses. Nota AD, et al. Autochthonous visceral leishmaniasis in Brasilia, Federal District, Brazil. técnica n.º 5/2012/GDTVZ/DTI/CVE/SVEA/SVS-SESRJ Intensificação da Vigilância Rev Soc Bras Med Trop. 2010;43:396-9. para Leishmaniose Visceral no Estado do Rio de Janeiro. 2012.

6. Costa CH. How effective is dog culling in controlling zoonotic visceral leishmaniasis? 23. Rio de Janeiro (Estado). Prefeitura da Cidade do Rio de Janeiro. Secretaria Municipal A critical evaluation of the science, politics and ethics behind this public health policy. de Saúde e Defesa Civil. Subsecretaria de Vigilância, Fiscalização Sanitária e Controle Rev Soc Bras Med Trop. 2011;44:232-42. de Zoonoses. Superintendência de Vigilância e Fiscalização Sanitária em Zoonoses. Nota técnica n.º 01/2011/s/SUBVISA/SVFSZ. Orientações sobre vigilância, 7. Costa CHN, Pereira HF, Araújo MV. Epidemia de leishmaniose visceral no estado prevenção e controle da Leishmaniose Visceral (LV) em caninos, no município do do Piauí, Brasil, 1980-1986. Rev Saude Publica. 1990;24:361-72. Rio de Janeiro (MRJ), em virtude da confirmação de transmissão canina da doença, no bairro do Caju – Área Programática 1.0. 2011. 8. De Paula CC, Figueiredo FB, Menezes RC, Mouta-Confort E, Bogio A, Madeira MF. Leishmaniose visceral canina em Maricá, estado do Rio de Janeiro: relato do 24. Rio Grande do Sul (Estado). Nota técnica conjunta da Secretaria de Vigilância em primeiro caso autóctone. Rev Soc Bras Med Trop. 2009;42:77-8. Saúde do Ministério da Saúde e da Secretaria de Estado da Saúde do Rio Grande do Sul sobre a situação da Leishmaniose Visceral na fronteira do Estado do Rio Grande 9. Deane LM. Leishmaniose visceral no Brasil; estudos sobre reservatórios e do Sul com a Argentina. 2010. transmissores realizados no Estado do Ceará. [Tese]. São Paulo: Universidade de São Paulo; 1956. 25. Sangenis LHC, Lima SRA, Mello CX, Cardoso DT, Mello JN, Espirito Santo MCC, et al. Expansion of visceral leishmaniasis in the State of Rio de Janeiro, Brazil: report 10. Deane LM, Deane MP. Observações preliminares sobre a importância comprovativa of the first autochthonous case in the municipality of Volta Redonda and the difficulty do homem, do cão e da raposa (Lycalopex vetulus) como reservatórios da Leishmania of diagnosis. Rev Inst Med Trop Sao Paulo. 2014;56:271-4. donovani, em área endêmica de calazar, no Ceará. O Hospital. 1955;48:61-76. 26. Santos SO, Arias J, Ribeiro AA, Hoffmann MP, Freitas RA, Malacco MAF. 11. Figueiredo FB, Barbosa Filho CJ, Schubach EY, Pereira SA, Nascimento LD, Incrimination of Lutzomyia cruzi as a vector of American visceral leishmaniasis. Madeira MF. Relato de caso autóctone de leishmaniose visceral canina na zona sul Med Vet Entomol. 1998;12:315-7. do município do Rio de Janeiro. Rev Soc Bras Med Trop. 2010;43:98-9. 27. Silva AR, Viana GMC, Varonil C, Pires B, Nascimento MDSD, Costa JML. 12. Figueiredo FB, Lima Júnior FEF, Tomio JE, Indá FMC, Corrêa GLB, Madeira MF. Leishmaniose visceral (calazar) na Ilha de São Luís, Maranhão, Brasil: evolução e Leishmaniose visceral canina: dois casos autóctones no município de Florianópolis, perspectivas. Rev Soc Bras Med Trop. 1997;30:359-68. estado de Santa Catarina. Acta Scient Vet. 2012;40:1026-9. 28. Silva DA, Perié CSFS, Mendes Junior AAV, Madeira MF, Figueiredo FB. 13. Lainson R, Rangel EF. Lutzomyia longipalpis and the eco-epidemiology of American Leishmaniose visceral canina em Cachoeiras de Macacu, Rio de Janeiro: relato de visceral leishmaniasis, with particular reference to Brazil: a review. Mem Inst Oswaldo caso. Clin Vet. 2011;95:64-8. Cruz. 2005;100:811-27.

437 SILVA, D.A.; MADEIRA, M.F. & FIGUEIREDO, F.B. - Geographical expansion of canine visceral leishmaniasis in Rio de Janeiro State, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 435-8, 2015.

29. Vasconcelos TCB, Alves FJ, Mendes Junior AAV, Madeira MF, Figueiredo FB. 31. World Health Organization. Control of the leishmaniasis. Geneva: WHO; 2010. (Tech. Leishmaniose visceral canina: caso alóctone no município de Resende, estado do Rep. Ser. 949) Rio de Janeiro, Brasil. Rev Bras Ci Vet. 2013;20:80-3. Received: 16 September 2014 30. Werneck GL. Visceral leishmaniasis in Brazil: rationale and concerns related to Accepted: 22 January 2015 reservoir control. Rev Saude Publica. 2014;48:851-5.

438 Rev. Inst. Med. Trop. Sao Paulo 57(5):439-442, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500013

BRIEF COMMUNICATION

Toxoplasma-SPECIFIC IgG SUBCLASS ANTIBODY RESPONSE IN CEREBROSPINAL FLUID SAMPLES FROM PATIENTS WITH CEREBRAL TOXOPLASMOSIS

Fernanda S. NASCIMENTO(1), Lisandra A. SUZUKI(1), Nilson BRANCO(2), Regina M.B. FRANCO(2), Paula D. ANDRADE(3), Sandra C.B. COSTA(3), Marcelo N. PEDRO(3) & Cláudio L. ROSSI(1)

SUMMARY

Cerebral toxoplasmosis can be highly debilitating and occasionally fatal in persons with immune system deficiencies. In this study, we evaluated the Toxoplasma gondii-specific IgG subclass antibody response in 19 cerebrospinal fluid (CSF) samples from patients with cerebral toxoplasmosis who had a positive IgG anti-T. gondii ELISA standardized with a cyst antigen preparation. There were no significant differences between the rates of positivity and the antibody concentrations (arithmetic means of the ELISA absorbances,

MEA) for IgG1 and IgG2, but the rates of positivity and MEA values for these two IgG subclasses were significantly higher than

those for IgG3 and IgG4. The marked IgG2 response in CSF from patients with cerebral toxoplasmosis merits further investigation.

KEYWORDS: Cerebral toxoplasmosis; Cerebrospinal fluid; IgG subclasses.

INTRODUCTION MATERIAL AND METHODS

Human infection with Toxoplasma gondii is usually asymptomatic or Patients and samples: Toxoplasma-specific IgG subclasses were is associated with mild, non-specific clinical symptoms in the majority evaluated in CSF samples from 19 patients with cerebral toxoplasmosis of immunocompetent persons. However, toxoplasmosis can be highly who were positive for anti-T. gondii IgG in CSF by ELISA, using the debilitating and occasionally fatal in persons with immune system cyst antigen preparation described below. All patients had clinical and deficiencies and in congenitally infected infants13,25,30. neuroimaging findings compatible with cerebral toxoplasmosis and the brain lesions and symptoms improved after anti-parasitic treatment. Host resistance to T. gondii is predominantly controlled by cell- The CSF samples of ten patients had a positive nested polymerase chain mediated immunity9, although the humoral immune response may reaction using primers for the B1 gene. Twenty-five CSF samples from also play an important role7,11. In humans, the major antibody class patients with other neurological disorders [multiple sclerosis (n = 10), produced in the humoral response to T. gondii is IgG24. Studies based on neurocysticercosis (n = 5), neurosyphilis (n = 3), neurocryptococcosis immunoenzymatic techniques (ELISA, immunoblot) standardized with (n = 3) and bacterial meningitis (n = 4)] were used as controls. The CSF tachyzoite antigen preparations have shown that IgG1 is the dominant IgG samples from patients with cerebral toxoplasmosis and other neurological isotype involved in humoral response to T. gondii in humans2,7,10,12,17,18. disorders were collected for diagnostic purposes. After completion of all the solicited routine tests, the remaining volume of the CSF samples Determination of the IgG subclass antibody response to T. gondii could were used to detect Toxoplasma-specific IgG subclasses. All patients contribute to our understanding of the pathogenesis of toxoplasmosis, were attended to the university hospital of the State University of as well as its diagnosis18. The cyst stage represents a lifetime risk for Campinas (UNICAMP), Campinas, Sao Paulo, Brazil. This study was the reactivation of Toxoplasma infection in immunocompromised approved by the Ethics Committee of the Faculty of Medical Sciences, individuals13,16. The aim of this study was to evaluate the Toxoplasma- UNICAMP, in accordance with the resolutions of the Brazilian National specific IgG subclass antibody response in cerebrospinal fluid Ethics Committee. (CSF) samples from patients with cerebral toxoplasmosis who had a positive IgG anti-T. gondii ELISA standardized with a cyst antigen Antigen preparation: cysts from the P strain of T. gondii19 were preparation. purified using the procedure described by KASPER (1989) from brains

(1) Universidade Estadual de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Patologia Clínica, Campinas, SP, Brasil. (2) Universidade Estadual de Campinas (UNICAMP), Instituto de Biologia, Departamento de Biologia Animal, Campinas, SP, Brasil. (3) Universidade Estadual de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Medicina Interna, Campinas, SP, Brasil. Correspondence to: Prof. Dr. Cláudio Lúcio Rossi, Universidade Estadual de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Patologia Clínica, R. Tessália Vieira de Camargo 126, Cidade Universitária Zeferino Vaz, 13083-887 Campinas, SP, Brasil. Tel: +55 19 3521 9454. E-mail: [email protected] NASCIMENTO, F.S.; SUZUKI, L.A.; BRANCO, N.; FRANCO, R.M.B.; ANDRADE, P.D.; COSTA, S.C.B.; PEDRO, M.N. & ROSSI, C.L. - Toxoplasma-specific IgG subclass antibody response in cerebrospinal fluid samples from patients with cerebral toxoplasmosis. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 439-42, 2015.

of chronically infected female Swiss mice. After purification, the cysts with cerebral toxoplasmosis. There were no significant differences were washed three times by centrifugation in 0.15 M phosphate-buffered between the rates of positivity and the MEA values for IgG1 and IgG2, saline, pH 7.2 (PBS) and the final pellet was resuspended in this same but the rates of positivity and MEA values for these two IgG subclasses solution and sonicated for 3 min (1 min sonication/1 min pause) in an ice were significantly higher than those for IgG3 and IgG4 (p = 0.0042 and p water bath using a Branson sonicator (model SX-30) at a power setting < 0.0001, respectively). The IgG3 and IgG4 ELISAs showed the same rate of 2 with a 20% pulse duty cycle. After sonication, enzyme inhibitors of positivity, but the MEA of the IgG3-ELISA was significantly higher

(phenylmethylsulfonyl fluoride - PMSF and leupeptin) were added to than that of the IgG4 ELISA (p < 0.0001). the sonicated material to final concentrations of 2.5µ M and 5 mM, respectively. After stirring for two h in an ice water bath, the material Table 1 was centrifuged (10,000 x g, 4 °C, 30 min) and the supernatant was Toxoplasma IgG subclass antibody responses in cerebrospinal fluid (CSF) separated and stored in aliquots at -20 °C. This protocol was approved by samples from patients with cerebral toxoplasmosis an institutional Committee for Ethics in Animal Use (CEUA/UNICAMP, protocol no. 3025-1). Rate of positivity (%) MEA IgG subclass p = 0.0042* p < 0.0001** ELISAs: serial dilution experiments were performed to determine IgG 84.2 (a) 0.163 (c) optimal concentrations of reagents (antigen, monoclonal antibodies and 1 conjugate) to be used in the ELISAs. The wells of polystyrene microtiter IgG2 73.7 (a) 0.264 (c) plates (Greiner Bio-One, Kremsmünster, Austria) were coated with IgG 36.8 (b) 0.074 (d) antigen preparation (1 µg protein/mL in 0.1 M carbonate/bicarbonate 3 IgG 36.8 (b) 0.041 (e) buffer, pH 9.5) by incubating for one h at room temperature (RT) and 4 16 h at 4 oC. After incubation, the wells were washed three times with MEA = mean of the ELISA absorbances; *Cochran’s Q test; **Repeated measures PBS containing 0.1% Tween 20 (PBS-T) and, after that, 100 µL of ANOVA and profile test. Values followed by the same letter are not significantly PBS-T containing 0.1% bovine serum albumin were added to the wells. different. After 30 min incubation at RT, the wells were washed twice with PBS-T and 100 µL of each CSF sample diluted 1:5 with PBS-T were added Infection with T. gondii is controlled primarily by cell-mediated in duplicate to the wells for one h at RT. Subsequently, the wells were immunity9. Some studies have also shown that the humoral immune washed three times with PBS-T and 100 µL of monoclonal anti-human response may protect against the parasite7,11. Several studies using

IgG1, anti-human IgG2, anti-human IgG3 or anti-human IgG4 (Sigma, immunological techniques standardized with tachyzoite antigen

St. Louis, MO, USA) diluted 1:750 in PBS-T were added to each well preparations have shown that IgG1 is the dominant IgG subclass involved and the plates were incubated for one h at RT. After washing the wells in the humoral response to T. gondii in humans2,7,10,12,17,18. three times with PBS-T, 100 µL of conjugate (peroxidase-labeled sheep anti-mouse IgG; Sigma) diluted 1:1000 in PBS-T were added to the wells The rupture of Toxoplasma cysts in the brain may cause disease and the plates were incubated for one h at RT. After incubation and three reactivation and severe encephalitis in immunocompromised hosts13,16. washes with PBS-T, 100 µL of substrate (0.42 mM tetramethylbenzidine However, there is only limited data on the utility of detecting Toxoplasma- and 1.42 mM H2O2 in 0.1 M sodium acetate/acetic acid buffer, pH specific antibodies in CSF samples from patients with cerebral 5.5) were added to the wells. Ten minutes after substrate addition, the toxoplasmosis. POTASMAN et al. (1988) showed that production of reactions were stopped by adding 50 µL of 2 N H2SO4 to each well and anti-T. gondii IgG antibodies in the central nervous system may be the resulting absorbances were read at 450 nm in a Multiskan ELISA diagnostic of toxoplasmic encephalitis. CHANDRAMUKHI (2004), reader (Labsystems, Helsinki, Finland). Positive and negative controls using a commercial ELISA kit (Omega Diagnostics, UK), detected were included in each plate. Each CSF sample was tested in duplicate Toxoplasma-specific IgG antibodies in 92% of CSF samples from and the mean absorbance determined. The final absorbance for each autopsies of proven cases of cerebral toxoplasmosis, indicating that the CSF sample was determined by subtracting the mean absorbance of detection of specific antibodies in CSF can be a useful adjunct to clinical two antigen controls in the corresponding plate. The cut-off value for and neuroimaging findings for the diagnosis of this neuroinfection. each assay was determined by a receiver operating characteristic (ROC) MEIRA et al. (2011) showed that the detection of Toxoplasma-specific curve15, using the ELISA results obtained with CSF samples from patients IgG antibodies in CSF samples by immunoenzymatic techniques with cerebral toxoplasmosis and other neurological disorders. standardized with T. gondii excreted/secreted antigens (ESA), in association with clinical, serological and radiological information, Data analysis: the rates of positivity and arithmetic means of the can be useful for diagnosing cerebral toxoplasmosis, particularly in ELISA absorbances (MEA) for each subclass were compared using the patients with active disease. As shown here, there were no significant Cochran Q test4,14 and repeated measures ANOVA with transformation differences between the frequency and concentration of Toxoplasma- 5,29 by ranks and profile test , respectively, with p < 0.05 indicating specific IgG1 and IgG2 antibodies in CSF samples from patients with significance. The statistical analyses were done using SAS (Statistical cerebral toxoplasmosis based on an ELISA standardized with an antigen Analysis System) for Windows version 9.2 (SAS Inc., Cary, NC, USA). preparation from T. gondii cysts.

RESULTS AND DISCUSSION Protein antigens elicit mainly IgG1 and IgG3 antibodies, while in 1,27 adults polysaccharide antigens preferentially induce antibodies of IgG2 . Table 1 shows the rates of positivity of the ELISAs for the detection of The Toxoplasma tachyzoite-bradyzoite differentiation is associated with IgG subclasses, as well as the MEA values for CSF samples from patients morphological and molecular changes, including the expression of stage-

440 NASCIMENTO, F.S.; SUZUKI, L.A.; BRANCO, N.; FRANCO, R.M.B.; ANDRADE, P.D.; COSTA, S.C.B.; PEDRO, M.N. & ROSSI, C.L. - Toxoplasma-specific IgG subclass antibody response in cerebrospinal fluid samples from patients with cerebral toxoplasmosis. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 439-42, 2015.

specific proteins such as surface antigens or enzymes and alterations in REFERENCES parasite metabolism that are probably needed for parasite adaptation 6,21 to environmental changes . Two major changes in the sugar content 1. Barrett DJ, Ayoub EM. IgG2 subclass restriction of antibody to pneumococcal occur during cyst formation, namely, the synthesis of large amounts of polysaccharides. Clin Exp Immunol.1986;63:127-34. polysaccharide that is stored as amylopectin granules in the bradyzoite 2. Cañedo-Solares I, Galván-Ramírez M de L, Luna-Pastén H, Rodríguez Pérez LR, 6,28 cytoplasm and the presence of lectin-binding sugars in the cyst wall . Ortiz-Alegría LB, Rico-Torres CP, et al. Congenital toxoplasmosis: specific IgG The presence of polysaccharides (carbohydrates) in the cyst antigen subclasses in mother/newborn pairs. Pediatr Infect Dis J. 2008;27:469-74. preparation used in our ELISA could account for the high frequency of IgG detected here. 3. Chandramukhi A. Diagnosis of neurotoxoplasmosis by antibody detection in 2 cerebrospinal (CSF) fluid using Latex Agglutination Test and ELISA. J Commun Dis. 2004;36:153-8. Some studies have suggested that Toxoplasma-specific IgG subclasses may be markers of congenital and cerebral toxoplasmosis or clinical 4. Conover WJ. Practical nonparametric statistics. New York: John Wiley & Sons Inc; outcome2,7,8,23. In a study using an ELISA standardized with tachyzoite 1971. antigens and serum samples from mother/newborn pairs with maternal 5. Conover WJ, Iman RL. Rank transformations as a bridge between parametric and exposure to T. gondii, CAÑEDO-SOLARES et al. (2008) showed that nonparametric statistics. Am Stat. 1981;35:124-9. IgG1 in the mothers and IgG3 in the newborns were related to offspring clinical problems; IgG2 and IgG3 in babies were markers of vertical 6. Coppin A, Dzierszinski F, Legrand S, Mortuaire M, Ferguson D, Tomavo S. Developmentally regulated biosynthesis of carbohydrate and storage polysaccharide transmission, whereas IgG4 in mothers or children was associated with clinical problems. DE SOUZA-E-SILVA et al. (2013), in a study during differentiation and tissue cyst formation in Toxoplasma gondii. Biochimie. 2003;85:353-61. designated to evaluate the association between clinical signs of congenital toxoplasmosis and IgG subclasses, showed that the detection of anti- 7. Correa D, Cañedo-Solares I, Ortiz-Alegria LB, Caballero-Ortega H, Rico-Torres CP. rMIC3 IgG2 and IgG4 was associated with the presence of retinochoroidal Congenital and acquired toxoplasmosis: diversity and role of antibodies in different lesions and intracranial calcifications. MEIRA et al. (2013) showed compartments of the host. Parasite Immunol. 2007;29:651-60. that the detection of IgG specific for T. gondii ESA in serum and/or 4 8. de Souza-e-Silva CH, Vasconcelos-Santos DV, de Andrade GQ, Carellos EV, de Castro CSF supported the diagnosis of cerebral toxoplasmosis in HIV-infected Romanelli RM, de Resende LM, et al. Association between IgG subclasses against patients. Toxoplasma gondii and clinical signs in newborns with congenital toxoplasmosis. Pediatr Infect Dis J. 2013;32:13-6.

Our results confirmed the predominance of IgG1 antibodies in the immune response to T. gondii. However, IgG antibodies were found at 9. Denkers EY, Gazzinelli RT. Regulation and function of T-cell-mediated immunity 2 during Toxoplasma gondii infection. Clin Microbiol Rev. 1998;11:569-88. a frequency and concentration similar to IgG1 antibodies in CSF samples from patients with cerebral toxoplasmosis. The marked IgG2 response 10. Derouin F, Sulcebe G, Ballet JJ. Sequential determination of IgG subclasses and IgA in CSF from patients with cerebral toxoplasmosis reported here merits specific antibodies in primary and reactivating toxoplasmosis. Biomed Pharmacother. further investigation. 1987;41:429-33.

11. Dupont CD, Christian DA, Hunter CA. Immune response and immunopathology RESUMO during toxoplasmosis. Semin Immunopathol. 2012;34:793-813.

Resposta de anticorpos específicos das subclasses da IgG para 12. Ee TY, Singh M, Yap EH. The determination of anti-Toxoplasma gondii antibodies in Toxoplasma em amostras de líquido cefalorraquidiano de different IgG subclasses of human sera by the enzyme-linked immunosorbent assay pacientes com toxoplasmose cerebral (ELISA). Southeast Asian J Trop Med Public Health. 1989;20:71-9. 13. Feustel SM, Meissner M, Liesenfeld O. Toxoplasma gondii and the blood-brain A toxoplasmose cerebral pode ser altamente debilitante e barrier. Virulence. 2012;3:182-92. ocasionalmente fatal em pessoas com deficiências do sistema imune. Nesse estudo, nós avaliamos a resposta de anticorpos das subclasses da IgG para 14. Fleiss JL. Statistical methods for rates and proportions. 2nd ed. New York: John Wiley o Toxoplasma gondii em 19 amostras de líquido cefalorraquidiano (LCR) & Sons; 1981. de pacientes com toxoplasmose cerebral que apresentavam uma reação 15. Fletcher RW, Fletcher SW. Clinical epidemiology: the essentials. 4th ed. Philadelphia: IgG anti-T. gondii positiva com ELISA padronizada com uma preparação Lippincott Williams & Wilkins; 2005. antigênica de cistos. Não foram encontradas diferenças significativas entre as taxas de positividade e as concentrações de anticorpos (média 16. Frenkel JK, Escajadillo A. Cyst rupture as a pathogenic mechanism of toxoplasmic aritmética das absorbâncias das reações ELISA, MEA) para IgG1 e IgG2, encephalitis. Am J Trop Med Hyg. 1987;36:517-22. mas as taxas de positividade e valores MEA para estas duas subclasses de 17. Giraldo M, Cannizzaro H, Ferguson MA, Almeida IC, Gazzinelli RT. Fractionation IgG foram significativamente superiores aos da IgG3 e IgG4. A resposta of membrane components from tachyzoite forms of Toxoplasma gondii: differential marcante de anticorpos IgG2 em LCR de pacientes com toxoplasmose recognition by immunoglobulin M (IgM) and IgG present in sera from patients with cerebral merece investigação adicional. acute or chronic toxoplasmosis. J Clin Microbiol. 2000;38:1453-60.

18. Huskinson J, Stepick-Biek PN, Araujo FG, Thulliez P, Suzuki Y, Remington JS. FINANCIAL SUPPORT Toxoplasma antigens recognized by immunoglobulin G subclasses during acute and chronic infection. J Clin Microbiol. 1989;27:2031-8. This work was supported by the university’s Fund for the Support of Teaching, Research and Extension (FAEPEX/UNICAMP).

441 NASCIMENTO, F.S.; SUZUKI, L.A.; BRANCO, N.; FRANCO, R.M.B.; ANDRADE, P.D.; COSTA, S.C.B.; PEDRO, M.N. & ROSSI, C.L. - Toxoplasma-specific IgG subclass antibody response in cerebrospinal fluid samples from patients with cerebral toxoplasmosis. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 439-42, 2015.

19. Jamra LM, Vieira M de P. Isolamento do Toxoplasma gondii de exsudato peritoneal 25. Montoya JG, Liesenfeld O. Toxoplasmosis. Lancet. 2004;363(9425):1965-76. e órgãos de camundongos com infecção experimental. Rev Inst Med Trop Sao Paulo. 1991;33:435-41. 26. Potasman I, Resnick L, Luft BJ, Remington JS. Intrathecal production of antibodies against Toxoplasma gondii in patients with toxoplasmic encephalitis and the acquired 20. Kasper LH. Identification of stage-specific antigens of Toxoplasma gondii. Infect immunodeficiency syndrome (AIDS). Ann Intern Med. 1988;108:49-51. Immun. 1989;57:668-72. 27. Schroeder HW Jr, Cavacini L. Structure and function of immunoglobulins. J Allergy 21. Lyons RE, McLeod R, Roberts CW. Toxoplasma gondii tachyzoite-bradyzoite Clin Immunol. 2010;125(2 Suppl 2):S41-52. interconversion. Trends Parasitol. 2002;18:198-201. 28. Sullivan WJ Jr, Jeffers V. Mechanisms of Toxoplasma gondii persistence and latency. 22. Meira CS, Vidal JE, Costa-Silva TA, Frazatti-Gallina N, Pereira-Chioccola VL. FEMS Microbiol Rev. 2012;36:717-33. Immunodiagnosis in cerebrospinal fluid of cerebral toxoplasmosis and HIV-infected patients using Toxoplasma gondii excreted/secreted antigens. Diagn Microbiol Infect 29. Tabachnick BG, Fidell LS. Using multivariate statistics. 4th ed. Needham Heights: Dis. 2011;71:279-85. Allyn & Bacon; 2001.

23. Meira CS, Vidal JE, Costa-Silva TA, Motoie G, Gava R, Hiramoto RM, et al. 30. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: from animals to humans.

IgG4 specific to Toxoplasma gondii excretory/secretory antigens in serum and/or Int J Parasitol. 2000;30:1217-58. cerebrospinal fluid support the cerebral toxoplasmosis diagnosis in HIV-infected patients. J Immunol Methods. 2013;395:21-8. Received: 8 August 2014 Accepted: 5 February 2015 24. Montoya JG. Laboratory diagnosis of Toxoplasma gondii infection and toxoplasmosis. J Infect Dis. 2002;185(Suppl 1):S73-82.

442 Rev. Inst. Med. Trop. Sao Paulo 57(5):443-446, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500014

BRIEF COMMUNICATION

A NEW POSSIBILITY FOR SURVEILLANCE: DO WE IDENTIFY ALL CASES OF LEPTOSPIROSIS?

Raissa Matos FONTES(1), Luciano Pamplona de Góes CAVALCANTI(1,2), Augusto César Aragão OLIVEIRA(1), Laiane Fernanda de Melo BEZERRA(1), Almira Maria Monteiro GOMES(1), Jeová Keny Baima COLARES(1,3,4) & Danielle Malta LIMA (1,4)

SUMMARY

Leptospirosis is a febrile disease with a typically underestimated global incidence, especially in regions where dengue is endemic. Therefore, it is difficult to accurately determine the number of leptospirosis cases in these areas, which contributes to significant under-reporting this disease. In this study, we estimated the number of possible leptospirosis cases among dengue-like cases that were reported during 2008, 2010, and 2012 in the city of Fortaleza, northeast Brazil. Patients were evaluated for dengue and leptospirosis using immunoenzymatic tests for IgM antibodies that were specific to each pathogen. Among the suspected cases of dengue that resulted as negative in laboratory tests, 10.8% (2008), 19.2% (2010), and 30.8% (2012) were confirmed to be leptospirosis. Considering the cases reported by the surveillance authority as dengue that were subsequently discarded based on the laboratory test results, we estimate that the number of actual leptospirosis cases may be 26 to 49 times higher than those diagnosed and reported by the Health Services. Furthermore, we believe that approximately 20% of dengue-like cases may be leptospirosis cases in areas where the two diseases are endemic.

KEYWORDS: Leptospirosis; Dengue; Estimation techniques; Epidemiological surveillance; Sentinel surveillance.

Leptospirosis is a sudden-onset, systemic febrile infectious disease number of possible leptospirosis cases among dengue-like cases, in areas that is caused by pathogenic spirochetes that belong to the Leptospira where both diseases are endemic and a structured dengue surveillance genus. This condition is one of the most widely distributed zoonoses system is available. worldwide, and is typically endemic in tropical regions3,26. The clinical manifestations of leptospirosis vary from an undifferentiated fever In this study, we estimated the number of leptospirosis cases among syndrome to multiple organ failure and death2,3. Symptomatic patients patients with dengue-like symptoms in the city of Fortaleza, northeast exhibit various non-specific symptoms, such as fever, headache, myalgia, Brazil. This study was conducted by recruiting patients who were anorexia, nausea, vomiting, diarrhea, arthralgia, eye pain, and cough12. suspected of having dengue during 2008, 2010, and 2012. Blood samples were collected for serological analysis from patients with suspected Given this range of non-specific clinical symptoms, it is difficult dengue who were being treated at the Sao Jose Hospital of Infectious to distinguish leptospirosis from other severe febrile diseases using Diseases, and other health facilities. In each study year, active surveillance only their unique clinical and epidemiological criteria8. Therefore, was performed every month (three times per week in the afternoon) in several studies have reported challenges in the differential diagnosis the wards and outpatient clinics. All patients who exhibited more than of leptospirosis and dengue, as both have similar clinical profiles and five days of symptoms and met the definition of a suspected dengue case, seasonal onset, with predominance in the rainy season. This has led to as defined by the Ministry of Health (acute febrile illness accompanied an overestimation of the number of dengue cases in various locations, by at least two of the following symptoms: headache, retro-orbital pain, with a possible concurrent underestimation of the number of leptospirosis myalgia, arthralgia, prostration, and/or rash) were included. cases6,14,16,22,24,25. Furthermore, the lack of symptom specificity, low sensitivity of the diagnostic methods, and passive characteristics of Using the patients’ blood samples, the presence of dengue and the surveillance systems in the majority of affected countries hinder leptospirosis was evaluated using immunoenzymatic assays to detect the accurate reporting of the incidence and prevalence of human IgM antibodies that are specific for each pathogen (Panbio Dengue IgM leptospirosis1,4. Therefore, the aim of this study was to estimate the Capture ELISA® (Australia); Dengue IgM ELISA Test® Bioeasy (Brazil),

(1) Universidade Federal do Ceará, Postgraduate Program in Pathology, Fortaleza, CE, Brazil. (2) Universidade Federal do Ceará, Department of Community Health, Fortaleza, CE, Brazil. (3) Hospital São José de Doenças Infecciosas, Fortaleza, CE, Brazil. (4) Universidade de Fortaleza (UNIFOR), Postgraduate Program in Medical Sciences, CE, Brazil. Correspondence to: Danielle Malta Lima, Desembargador Floriano Benevides 221, Bairro Edson Queiroz, 60811-905 Fortaleza, CE, Brasil. Tel: +55-85 3477-3619. E-mail: [email protected] FONTES, R.M.; CAVALCANTI, L.P.G.; OLIVEIRA, A.C.A.; BEZERRA, L.F.M.; GOMES, A.M.M.; COLARES, J.K.B. & LIMA, D.M. - A new possibility for surveillance: do we identify all cases of leptospirosis?. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 443-6, 2015.

Serion ELISA classic Leptospira IgM® VIRION\SERION (Germany) they investigated were actually leptospirosis cases, indicating a high and Panbio Leptospira IgM ELISA® (Australia)). Only cases that were prevalence in a region where leptospirosis is often underestimated23. negative for dengue antibodies were subsequently tested for the presence of leptospirosis. Among the cases we analyzed, 7.7% (13/169) of patients with clinically suspected dengue were positive for leptospirosis. Several In the first study year (2008), 62 patients with clinically suspected studies have demonstrated that the differential diagnosis of dengue dengue were identified (Table 1). Among these patients, 25 (40.3%) were and leptospirosis is difficult in tropical regions where both diseases confirmed to have dengue and 37 (59.7%) were negative for dengue; the are endemic5,6,24. Furthermore, the early and accurate diagnosis of dengue-negative cases were considered to be “dengue-like” cases. Among leptospirosis is of utmost importance for effective clinical management, as the dengue-like cases, four (10.8%) cases were positive for leptospirosis. the appropriate treatments for dengue and leptospirosis are substantially In 2010, 57 patients with suspected dengue were identified, and 26 different. For example, antibiotic therapy is more effective for reducing (45.6%) patients were found to be negative for dengue, including five the duration and severity of leptospirosis when applied early in the course (19.2%) patients who were confirmed to have leptospirosis. In 2012, 50 of infection9, and delays in the prescription of antibiotic therapy may patients with suspected dengue were identified, and 13 (26.0%) patients result in progression to more severe forms19. were found to be negative for dengue, including four (30.8%) patients who were positive for leptospirosis. Therefore, among the dengue-like The difference in the number of leptospirosis cases that we estimated cases, 10.8% (2008), 19.2% (2010), and 30.8% (2012) of cases were in 2012 (compared to those in 2008 and 2010) is likely due to the lower confirmed to be leptospirosis. number of samples that were collected in 2012, and the fact that a significant dengue epidemic occurred during 2012 in Fortaleza. In the In the study period, the Health Secretary of Ceara, Fortaleza, Brazil, event of a dengue epidemic, our observed values might be overestimated, reported 39,077 (2008), 7,017 (2010), and 43,596 (2012) suspected cases given the increased sensitivity of the epidemiological surveillance of dengue (Table 1)21. However, among these cases, 4,534 (11.6%), system in capturing suspected cases. However, our findings suggest 2,235 (31.9%), and 4,629 (10.6%) cases, respectively, were discarded for that the real number of leptospirosis cases might be far greater than that dengue for showing dengue-negative laboratory results (the dengue-like detected by the Health Secretary, since during the period of study only cases)21. In addition, 4,846, 1,030, and 3,756 patients, respectively, were 65 leptospirosis cases were confirmed by the Health Service, whereas we confirmed to have dengue using only the clinical and epidemiological estimate an occurrence of 2,345 cases. This discrepancy is likely due to criteria in this period21. the health system’s ability to capture the most severe cases, resulting in an underestimation of the real incidence of the disease11. In that same period, the Health Secretary’s laboratory reported only 19 (2008), 17 (2010), and 29 (2012) confirmed cases of leptospirosis21. One of the factors that contributes to the overestimation of According to our estimated prevalence of leptospirosis among dengue- dengue cases is when this infection is confirmed just by clinical and like cases in those years, 490, 429, and 1,426 leptospirosis cases may epidemiological criteria. The use of these criteria as the only basis for not have been identified by the Health Services. Based on these numbers, dengue diagnosis may be risky and may lead to diagnostic failures, due to approximately 26 to 49 unidentified leptospirosis cases may exist for each its nonspecific symptoms, which are similar to those of other pathologies, confirmed case in Fortaleza. On average, we estimated that approximately like leptospirosis7,10,20. However, given the high number of suspected 20.3% of dengue-like cases per year may be leptospirosis cases in areas dengue cases during epidemic periods in Brazil, confirmation of a dengue where both diseases are endemic. case can be made only with clinical and epidemiological assessments. Thereby, during the study period, 9,632 dengue cases were confirmed Our data corroborate the findings of RAFIZAH et al. (2003), by the Health Services using only clinical and epidemiological criteria. who reported that 8.4% of the Malaysian fever syndrome cases that Despite the high number of cases, these patients were not included in

Table 1 Estimation of the number of leptospirosis cases in Ceara in 2008, 2010 and 2012

A: Dengue and leptospirosis in the city of Fortaleza24 2008 2010 2012 Reported cases of dengue 39,077 7,017 43,596 Confirmed cases of dengue through laboratory criteria 29,697 3,752 35,211 Confirmed cases of dengue through clinical and epidemiological criteria 4,846 1,030 3,756 Excluded cases of dengue (dengue-like cases) in the laboratory 4,534 2,235 4,629 Confirmed cases of leptospirosis 19 17 29 B: Study findings Estimated cases of under-reported leptospirosis 490 429 1.426 Estimation of under-reporting for leptospirosis cases 25, 8:1 25, 2:1 49, 2:1 Source: A: Health Secretary of the State of Ceara, 2014 (data not published); B: Study findings.

444 FONTES, R.M.; CAVALCANTI, L.P.G.; OLIVEIRA, A.C.A.; BEZERRA, L.F.M.; GOMES, A.M.M.; COLARES, J.K.B. & LIMA, D.M. - A new possibility for surveillance: do we identify all cases of leptospirosis?. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 443-6, 2015.

our estimation of unidentified leptospirosis cases, as we only included aproximadamente 20% dos casos de dengue-símile podem ser de patients with dengue-negative test results (dengue-like cases). Therefore, leptospirose, em áreas onde as duas doenças ocorram de forma endêmica. it is possible that dengue confirmed cases, with no specific laboratory testing, were leptospirosis cases, and these would further increase our ACKNOWLEDGEMENTS estimated number of unidentified cases of leptospirosis. We thank the Central Laboratory of Public Health of the Ceara It is important to emphasize that 37.3% (63/169) of our patients with Health Secretary for providing samples from patients with suspected clinically suspected dengue did not have a specific diagnosis, as they dengue during 2008. We also thank the Ceara Health Secretary of the were categorized as having neither dengue nor leptospirosis, or because State for making epidemiological data regarding dengue and leptospirosis these diseases were not detected by the methodologies adopted in this available. Finally, we thank the Laboratory of Molecular Biology study or in the routine surveillance services. Therefore, one of this study’s (University of Fortaleza) and the Sector of Parasitology (Department of limitations was the use of only serology to detect these pathologies; a Pathology and Legal Medicine, Federal University of Ceara) for providing combination of different techniques would likely increase the diagnostic the experimentation facilities. And the Nossa Senhora da Conceição sensitivity10,26. Another limitation was that we did not test dengue-positive Hospital and Sao Jose Hospital of Infectious Diseases for allowing us patients for leptospirosis, which may have resulted in the exclusion of to conduct the study during 2010 and 2012. cases with co-infection. CONFLICTS OF INTEREST Several studies have demonstrated that it is difficult to differentially diagnose dengue from other pathologies (e.g., hantavirus, rubella, The authors declare that there are no conflicts of interest related to hepatitis, influenza A infection, or melioidosis), which may account this study. for some of the cases of fever symptoms that were not diagnosed as leptospirosis in this study17,18,25. Those studies’ findings highlight the FINANCIAL SUPPORT importance of using surveillance protocols for fever syndromes, and the implementation of these systems in Brazil may facilitate the early The Cearense Foundation for the Support of Scientific and detection of new diseases with similar clinical characteristics, such as Technological Development (FUNCAP), the National Council for chikungunya fever. Scientific and Technological Development (CNPq), and the Coordination for the Improvement of Higher Education Personnel (CAPES), Brazil. Gaining a more realistic view of leptospirosis cases is important and essential to adopt adequate control measures for the reservoirs and REFERENCES provide support for preventive measures. In addition, the adoption of a specific treatment in the leptospirosis cases can directly reduce morbidity 1. Abela-Ridder B, Sikkema R, Hartskeerl RA. Estimating the burden of human and mortality risks associated with the disease. It would be important leptospirosis. Int J Antimicrob Agents. 2010;36(Suppl 1):S5-7. to implement measures that allow performing tests in a percentage of 2. Adler B, de la Peña Moctezuma A. Leptospira and leptospirosis. Vet Microbiol. the negative samples for dengue, as a form of sentinel surveillance for 2010;140:287-96. leptospirosis cases. 3. Bharti AR, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, et al. Leptospirosis: a RESUMO zoonotic disease of global importance. Lancet Infect Dis. 2003;3:757-71. 4. Bounlu K, Insisiengmay S, Vanthanouvong K, Saykham, Widjaja S, Iinima K, et al. Uma nova possibilidade de vigilância: identificamos todos os casos Acute jaundice in Vientiane, Lao People’s Democratic Republic. Clin Infect Dis. de leptospirose? 1998;27:717-21.

A leptospirose é doença febril tipicamente subestimada em todo o 5. Brown MG, Vickers IE, Salas RA, Smikle MF. Leptospirosis in suspected cases of dengue in Jamaica, 2002- 2007. Trop Doct. 2010;40:92-4. mundo, principalmente em áreas que a dengue se apresenta de forma endêmica. Desta forma, há limitações importantes na compreensão do 6. Bruce MG, Sanders EJ, Leake JAD, Zaidel O, Bragg SL, Aye T, et al. Leptospirosis número de casos de leptospirose nessas áreas, o que proporciona maior among patients presenting with dengue-like illness in Puerto Rico. Acta Trop. subnotificação. Neste estudo, apresentamos estimativa de possíveis 2005;96:36-46. casos de leptospirose a partir de casos de dengue-símile na cidade de 7. Castro-Jorge LA, Machado PR, Fávero CA, Borges MC, Passos LM, de Oliveira RM, Fortaleza, nordeste do Brasil, durante os anos de 2008, 2010 e 2012. Os et al. Clinical evaluation of the NS1 antigen-capture ELISA for early diagnosis of pacientes foram investigados para dengue e leptospirose utilizando testes dengue virus infection in Brazil. J Med Virol. 2010;82:1400-5. imunoezimáticos para detecção do anticorpo, da classe IgM, específicos para cada patologia. Entre os casos suspeitos de dengue, mas que não 8. Daher EF, Abreu KLS, Silva Jr GB. Insuficiência renal aguda associada à leptospirose. apresentaram resultado laboratorial positivo, 10,8%; 19,2% e 30,8% J Bras Nefrol. 2010;32:408-15. foram confirmados como leptospirose nos anos de 2008, 2010 e 2012; 9. Ellis T, Imrie A, Katz AR, Effler PV. Underrecognition of leptospirosis during a dengue respectivamente. Considerando os casos notificados pela vigilância fever outbreak in Hawaii, 2001–2002. Vector Borne Zoonotic Dis. 2008;8:541-7. de dengue e que foram, posteriormente, descartados, baseados nos resultados dos testes laboratoriais, estimamos que o número atual de 10. Guzmán MG, Halstead SB, Artsob H, Buchy P, Farrar J, Gubler DJ, et al. Dengue: casos de leptospirose pode ser de 26 a 49 vezes mais do que o detectado a continuing global threat. Nat Rev Microbiol. 2010;8(12 Suppl):S7-16. e notificado pelos serviços de saúde. Além disso, acreditamos que

445 FONTES, R.M.; CAVALCANTI, L.P.G.; OLIVEIRA, A.C.A.; BEZERRA, L.F.M.; GOMES, A.M.M.; COLARES, J.K.B. & LIMA, D.M. - A new possibility for surveillance: do we identify all cases of leptospirosis?. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 443-6, 2015.

11. Hartskeerl RA, Collares-Pereira M, Ellis WA. Emergence, control and re-emerging 20. Ministério da Saúde. Dengue: diagnóstico e manejo clínico - adulto e criança. 4th leptospirosis: dynamics of infection in the changing world. Clin Microbiol Infect. ed. Brasília: Ministério da Saúde; 2013. [cited 2014 Mar 18]. Available from: http:// 2011;17:494-501. www.prefeitura.sp.gov.br/cidade/secretarias/upload/chamadas/dengue_manejo_ clinico_4ed_1389634872.pdf. 12. Kalayanarooj S, Vaughn DW, Nimmannitya S, Green S, Suntayakorn S, Kunentrasai N, et al. Early clinical and laboratory indicators of acute dengue illness. J Infect Dis. 21. Ministério da Saúde. Datasus. Sistema de Informação de Agravos de Notificação - 1997;176:313-21. SINAN. [cited 2014 April 11]. Available from: http://dtr2004.saude.gov.br/sinanweb/

13. Kee SH, Kim IS, Choi MS, Chang WH. Detection of leptospiral DNA by PCR. J 22. Oliveira ACA, Fontes RM, Praciano CC, Araújo FMC, Cavalcanti LPG, Colares JKB, Clin Microbiol. 1994;32:1035-9. et al. Recognition of leptospirosis in dengue-suspected cases during dengue outbreak in Ceará State, Brazil. Afr J Microbiol Res. 2014;8:1789-92. 14. Ko Ai, Galvão Reis M, Ribeiro Dourado CM, Johnson WD Jr, Riley LW. Urban epidemic of severe leptospirosis in Brazil. Lancet. 1999;354:820-5. 23. Rafizah AAN, Aziah BD, Azwany YN, Imran MK, Rusli AM, Nazri SM, et al. A hospital-based study on seroprevalence of leptospirosis among febrile cases in 15. Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV. Rapid detection northeastern Malaysia. Int J Infect Dis. 2013;17:394-7. and typing of dengue viruses from clinical samples by using reverse transcriptase- polymerase chain reaction. J Clin Microbiol. 1992;30:545-51. 24. Sanders EJ, Rigau-Pérez JG, Smits HL, Deseda CC, Vorndam VA, Aye T, et al. Increase of leptospirosis in dengue-negative patients after a hurricane in Puerto Rico in 1966. 16. Levett PN. Leptospirosis: re-emerging or re-discovered disease? J Med Microbiol. Am J Trop Med Hyg. 1999;61:399-404. 1999;48:417-8. 25. Souza AI, Nogueira JMR, Pereira MM. Anticorpos anti-Leptospira em pacientes de 17. Lima DM, Sabino-Santos Junior G, Oliveira ACA, Fontes RM, Colares JKB, Araújo Mato Grosso do Sul com suspeita clínica de dengue ou hepatite viral. Rev Soc Bras FMC, et al. Hantavirus infection in suspected dengue cases from State of Ceará, Med Trop. 2007;40:431-5. Brazil. Rev Soc Bras Med Trop. 2011;44:795-6. 26. World Health Organization. Human leptospirosis: guidance for diagnosis, surveillance 18. Macedo RN, Rocha FA, Rolim DB, Vilar DC, Araújo FM, Vieira NN, et al. Severe and control. Geneva: WHO; 2003. [cited 2014 April 1]. Available from: http://www. coinfection of melioidosis and dengue fever in Northeastern Brazil: first case report. who.int/csr/don/en/WHO_CDS_CSR_EPH_2002.23.pdf. Rev Soc Bras Med Trop. 2012;45:132-3. Received: 30 October 2014 19. Ministério da Saúde. Doenças infecciosas e parasitárias: guia de bolso. 8th ed. Brasília: Accepted: 23 February 2015 Ministério da Saúde; 2010. [cited 2014 Mar 15]. Available from: http://ftp.medicina. ufmg.br/ped/Arquivos/2014/Doencasinfecciosaseparasitarias_12_08_2014.pdf.

446 Rev. Inst. Med. Trop. Sao Paulo 57(5):447-450, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500015

CASE REPORT

FIRST CASE OF HUMAN INFECTION BY Bertiella studeri (Blanchard, 1891) Stunkard,1940 (Cestoda; Anoplocephalidae) IN BRAZIL

Valeriana Valadares LOPES(1), Hudson Andrade dos SANTOS(2), Amália Verônica Mendes da SILVA(3), Gilberto FONTES(1), Gabriela Lisboa VIEIRA(1), Arilton Carlos FERREIRA(1) & Eduardo Sergio da SILVA(1)

SUMMARY

Cestodes of the Bertiella genus are parasites of non-human primates found in Africa, Asia, Oceania and the Americas. Species Bertiella studeri and Bertiella mucronata could, accidentally, infect human beings. The infection occurs from ingestion of mites from the Oribatida order containing cysticercoid larvae of the parasite. The objective of this report is to register the first case of human infection by Bertiella studeri in Brazil. Proglottids of the parasite, found in the stool sample of a two-and-a-half-year-old child, were fixed, stained and microscopically observed to evaluate its morphological characteristics. Eggs obtained from the proglottids were also studied. The gravid proglottids examined matched the description of the genus Bertiella. The eggs presented a round shape, with the average diameter of 43.7 µm, clearly showing the typical pyriform apparatus of B. studeri. The authors concluded that the child was infected with Bertiella studeri, based on Stunkard’s (1940) description of the species. This is the fifth case of human Bertiellosis described in Brazil through morphometric analysis of the parasite, the third in Minas Gerais State and the first diagnosed case of Bertiella studeri in Brazil.

KEYWORDS: Bertiella; Human bertiellosis; Helminth; Zoonosis.

INTRODUCTION in an eight-year-old-female patient from Mauritius, parasitized by Bertiella studeri. Since the initial records, over 50 cases of Bertiella Bertiella sp. is a cestode from the Anoplocephalidae family, common sp. in humans have been reported around the world21. In Brazil, up to parasites in non-human primates, rodents and Australian marsupials, now, only four human cases were detected based on morphological and being the only representatives of the family with human infection case morphometric egg analysis3,16,17,19. reports1,8,13,15. Among the 29 species of this genus listed by SCHMIDT (1986)18, two, Bertiella studeri (Blanchard, 1891) and Bertiella mucronata The objective of this paper is to report a case of human bertiellosis (Meyner, 1895) are the major causes of human bertiellosis, mainly in in Brazil originated in Perdigao, a city located in the Midwest region of infants7. Cestodes of the genus Bertiella are heteroxenic parasites found Minas Gerais State. in the small intestine of mammals, especially non-human primates. Their invertebrate hosts are mites of the Oribatida order7,11,22. DENEGRI (1993)6 CASE REPORT showed several oribatid mites that can act as intermediate hosts of 14 genera and 27 species of anoplocephalid tapeworms. The patient was a Brazilian two and a half year old female, born and raised in the city of Perdigao, located in the midwest region Human infection by Bertiella sp. is usually asymptomatic. However of Minas Gerais State. The patient’s prior history includes living gastrointestinal disturbances, diarrhea, abdominal pain, anorexia, on a farm inhabited by non-human primates. Since January 2011, weight loss, vomit and constipation have been reported7. As this clinical the child started to present sporadic episodes of abdominal pain. presentation is common in numerous gastrointestinal pathologies, the A few months later, her parents noticed spontaneous elimination bertiellosis diagnose is confirmed by parasitological stool examination7,9. of proglottids in the feces. Fragments of the adult worm and stool samples were collected and parasitological examinations were BLANCHARD (1913)2 described the first case of human bertiellosis carried out.

(1) Universidade Federal de São João del-Rei, Campus Centro-Oeste, CCO/UFSJ, Divinópolis, MG, Brasil. E-mails: [email protected], [email protected], [email protected], [email protected], [email protected] (2) Universidade Federal de Minas Gerais, Laboratório de Helmintologia Veterinária do Departamento de Parasitologia, ICB/UFMG, Belo Horizonte, MG, Brasil. E-mail: [email protected] (3) Universidade FUMEC, Faculdade de Ciências Humanas, Sociais e Saúde, Belo Horizonte, MG, Brasil. E-mail: [email protected] Correspondence to: Gilberto Fontes. E-mail: [email protected] LOPES, V.V.; SANTOS, H.A.; SILVA, A.V.M.; FONTES, G.; VIEIRA, G.L.; FERREIRA, A.C. & SILVA, E.S. - First case of human infection by Bertiella studeri (Blanchard, 1891) Stunkard, 1940 (Cestoda: Anoplocephalidae) in Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 447-50, 2015.

MATERIALS AND METHODS as Bertiella genus. Eggs observed by microscopic examination show spherical shape and an external rough membrane measuring 42 to 47.3 Stool samples were collected and fixed in a 10% formalin solution for µm in diameter (average of 43.77 µm). The average dimension of the parasitological exams. Cestodes fragments and proglottids found in the hexacant embryo with the pyriform apparatus was 24.5 µm and the feces were separated and washed in a 0.85% saline solution. Subsequently, measurement of just the hexacant embryo was 15.75 µm (Fig. 2). Based the proglottids were pressed between two slides to flatten them uniformly, on the morphometry of the eggs and the pyriform apparatus10,15, the fixed in FAA (formalin-acetic acid-alcohol) solution, stained with authors identified the species as Bertiella studeri. alum acetocarmine solution, dehydrated in a crescent series of ethanol, diafanized in Faia’s creosote and mounted in Canada balsam between a On the parasitological stool exams, the authors found only Bertiella microscope slide and cover slip. The fecal samples were processed by sp. eggs. No other helminth or protozoan infections were detected. KATO-KATZ12 and LUTZ (1919)14 methods for parasitological exams. Micrometric studies were performed and microphotographs were taken DISCUSSION using an optical microscope (Leika) equipped with a digital camera (AxioCam ERc 5s, Carl Zeiss). Measurements were made using an The first report of human bertiellosis in Brazil was identified as image analysis software (Axio Vision version 4.8, Carl Zeiss Vision). Bertiella mucronata in an adult patient in the city of Sao Paulo, Sao Paulo State17. COSTA et al. (1967)3 reported the second case of B. mucronata RESULTS in an individual from the city of Formiga, Minas Gerais State. The third human infection by Bertiella sp. was diagnosed in a two-year-old Three 1 cm segments with 15 imbricated proglottids measuring infant from Goiania, Goias State16. SILVA et al. (2011)19 reported the 0.8 cm in length and 1.0 cm in width were examined (Fig. 1A). After fourth case of Bertiella sp. infection in an eight-year-old resident of the staining progottid fragments, unilateral, irregularly alternated, genital municipality of Caete, Minas Gerais State. This current report is the third pores located between the anterior and posterior margin of each proglottid case of human bertiellosis in Minas Gerais State, and the fifth case in were observed (Fig. 1B). Similar structures to the muscular part of the Brazil. cirrus pouch and masses of eggs can be observed in Fig. 1C. The proper bertiellosis diagnosis in humans is made by observing Based on morphological features, the proglottids have been identified the morphological characteristics of the progottids and the scolex.

Fig. 1 - Bertiella sp. proglottids. A) Proglottids fixed segments in FAA; B) Proglottids stained with alum acetocarmine solution (muscular part of the cirrus pouch); C) Proglottids showing eggs and genital pores.

Fig. 2 - Bertiella sp. eggs showing the pyriform apparatus. A) Eggs recovered from the patient’s stool (200X); B) Eggs liberated from gravid proglottids (400X); C) Eggs washed with lactophenol of Amann (1000X).

448 LOPES, V.V.; SANTOS, H.A.; SILVA, A.V.M.; FONTES, G.; VIEIRA, G.L.; FERREIRA, A.C. & SILVA, E.S. - First case of human infection by Bertiella studeri (Blanchard, 1891) Stunkard, 1940 (Cestoda: Anoplocephalidae) in Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 447-50, 2015.

In addition, the morphometric parameters of the eggs must be que a criança estava infectada com Bertiella studeri, de acordo com analyzed10,15,20. a descrição da espécie por Stunkard (1940). Este é o quinto caso de Bertiellose humana descrita no Brasil por meio de análises morfométricas The authors defined the species as being Bertiella studeri by do parasito, o terceiro em Minas Gerais e o primeiro caso de diagnóstico considering the morphological description of the proglottids and por Bertiella studeri no Brasil. morphometry of the eggs. To their knowledge, this is the first case of B. studeri human infection reported in Brazil. ACKNOWLEDGEMENTS

This species is the main etiological agent of human bertiellosis in the The authors are grateful to Eliana Maria Mauricio da Rocha for world, except in South America, where infections were diagnosed to be the critical reading of the manuscript, and English review, and Flávia caused by Bertiella sp. or by the species B. mucronata. Mauricio da Rocha Fontes for the English review.

The symptoms reported by the child’s guardians are compatible with REFERENCES human bertiellosis. Following diagnosis, the patient was medicated orally with praziquantel (10 mg/Kg) in a single dose. After treatment, no further 1. Achir I, Zait H, Hamrioui B. Infection humaine due à Bertiella sp (Cestode: elimination of proglottids occurred and the symptoms disappeared. Anoplocephalidae) observée en Algérie chez un étudiant originaire du Yémen. Bull Soc Pathol Exot. 2008;101:107-8.

Probably, the infection described here was acquired by accidental 2. Blanchard R. Bertiella satyri de l’Orang-outang, est aussi parasite de l’homme. Bull ingestion of Oribatid mites, harbouring cysticercoid larva, present in Acad Méd (Paris). 1913;89:186-296. the soil or contaminated food. This process was also described in the MALIK et al. (2013)15 study. 3. Costa HM, Corrêa L, Brener Z. Novo caso humano de parasitismo por Bertiella mucronata (Meyner, 1895) Stiles & Hassal, 1902 (Cestoda-Anoplocephalidae). Rev Inst Med Trop Sao Paulo. 1967;9:95-7. DENEGRI (1985)4 has predicted that the introduction of monkeys, in places where Bertiella is endemic and there is close contact of monkeys 4. Denegri GM. Consideraciones sobre sistemática y distribución geográfica del género and humans are the cause of parasite spreading. He also suggested that Bertiella Stiles & Hassall, 1902 (Cestoda-Anoplocephalidae) en el hombre y en an epidemiological inquiry should be performed in humans to ascertain primates no humanos. Neotrópica. 1985;31:55-63. the true prevalence of this parasitosis. It is difficult to control and prevent 5. Denegri GM. Desarrollo experimental de Bertiella mucronata Meyner, 1895 (Cestoda- this zoonosis since the intermediate hosts are cosmopolitan with a large Anoplocephalidae) de origen humano en su huésped intermediario. Zbl Vet Med. distribution5,6. 1985;32:498-504.

According to LOZANO et al. (2010)13 several cases of human 6. Denegri GM. Review of oribatid mites as intermediate hosts of tapeworms of the Anoplocephalidae. Exp Appl Acariol. 1993;17:567-80. bertiellosis in non-endemic countries are currently reported. This reinforces the importance of correctly identifying the parasite in order 7. Denegri GM, Perez-Serrano J. Bertiellosis in man: a review of cases. Rev Inst Med to prevent misdiagnosis with other cestode infections. Trop Sao Paulo. 1997;39:123-7.

This report contributes to alerting the public health authorities of this 8. Denegri GM, Bernadina W, Perez-Serrano J, Rodriguez-Caabeiro F. Anoplocephalidae cestodes of veterinary and medical significance: a review. Folia Parasitol. 1998;45:1-8. helmintic zoonosis occurrence in humans. 9. El-Dib NA, Al-Ruffaii A, El-Badry A, Al-Zoheiry AA, Abdell-Aal AA. Human RESUMO infection with Bertiella species in Saudi Arabia. Saudi Pharm J. 2004;12:168-9.

Primeiro caso de infecção humana por Bertiella studeri 10. Galán-Puchades MT, Fuentes MV, Simarro PP, Mas-Coma S. Human Bertiella studeri in Equatorial Guinea. Trans R Soc Trop Med Hyg. 1997;91:680. (Blanchard, 1891) Stunkard,1940 (Cestoda; Anoplocephalidae) no Brasil 11. Gómez-Puerta LA, López-Urbina MT, González AE. Ocurrence of tapeworm Bertiella mucronata (Cestoda: Anoplocephalidae) in the Titi monkey Callicebus oenanthe from Os cestódeos do gênero Bertiella são parasitos de primatas não Peru: new definitive host and geographical record. Vet Parasitol. 2009;163:161-3. humanos, os quais são encontrados na África, Ásia, Austrália, Oceania 12. Katz N, Chaves A, Pellegrino J. A simple device for quantitative stool thick smear e Américas. As espécies Bertiella studeri e Bertiella mucronata podem, technique in schistosomiasis mansoni. Rev Inst Med Trop Sao Paulo. 1972;14:397- eventualmente, vir a infectar os seres humanos e a infecção acontece pela 400. ingestão acidental de ácaros da ordem Oribatida infectados com larvas cisticercóides do parasito. O objetivo deste estudo foi relatar o primeiro 13. Lozano M del C, García-Martos P, García-Tapia A, Fernández C. Bertiella caso humano por Bertiella studeri no Brasil. Proglotes do parasito, studeri infection in a girl from Equatorial Guinea. Enferm Infecc Microbiol Clin. 2010;28:652-3. encontrado na amostra de fezes de uma criança com idade de 2,5 anos, foram fixados, corados e observados ao microscópio para avaliar as 14. Lutz AO. Schistosomum mansoni e a shistomatose segundo observações, feitas no suas características morfológicas. Ovos, obtidos a partir dos proglotes Brasil. Mem Inst Oswaldo Cruz. 1919;11:121-44. também foram estudados. As proglotes grávidas examinadas estavam de acordo com a descrição do gênero Bertiella. Os ovos apresentam 15. Malik S, Srivastava VK, Samantaray JC. Human bertiellosis from North India. Indian J Pediatr. 2013;80:258-60. forma arredondada com diâmetro médio de 43,7 µm, demonstrando claramente aparelho piriforme típico de B. studeri. Os autores concluíram

449 LOPES, V.V.; SANTOS, H.A.; SILVA, A.V.M.; FONTES, G.; VIEIRA, G.L.; FERREIRA, A.C. & SILVA, E.S. - First case of human infection by Bertiella studeri (Blanchard, 1891) Stunkard, 1940 (Cestoda: Anoplocephalidae) in Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 447-50, 2015.

16. Paçô JM, Campos DMB, Araújo JLB. Human bertiellosis in Goiás, Brazil: a case 20. Stunkard HW. The morphology and life history of the cestode, Bertiella studeri. Am report on human infection by Bertiella sp. (Cestoda: Anoplocephalidae). Rev Inst J Trop Med Hyg. 1940;20:305-33. Med Trop Sao Paulo. 2003;45:159-61. 21. Sun X, Fang Q, Chen XZ, Hu SF, Xia H, Wang XM. Bertiella studeri infection, 17. Pessoa SB. Sobre um caso de parasitismo humano por cestoide anoplocephalideo do China. Emerg Infect Dis. 2006;12:176-7. gênero Bertiella. Bol Soc Med Cirurg. 1930;14:158-62. 22. Xuan LT, Anantaphruti MT, Tuan PA, Tu LX, Hien TV. The first human infection with 18. Schmidt GD.Handbook of tapeworm identification. Boca Raton: CRC Press;1986. Bertiella studeri in Vietnam. Southeast Asian J Trop Med Public Health. 2003;34:298- 300. 19. Silva, AVM, Arruda FCS, Costa GA, Santos HA. Bertielose humana: segundo relato em Minas Gerais, Brasil. Rev Patol Trop. 2011;40:185-9. Received: 06 October 2014 Accepted: 05 February 2015

450 Rev. Inst. Med. Trop. Sao Paulo 57(5):451-454, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500016

CASE REPORT

FIRST REPORT OF CUTANEOUS LEISHMANIASIS CAUSED BY Leishmania (Leishmania) infantum chagasi IN AN URBAN AREA OF RIO DE JANEIRO, BRAZIL

Marcelo Rosandiski LYRA(1), Maria Inês Fernandes PIMENTEL(1), Maria de Fátima MADEIRA(1), Liliane de Fátima ANTONIO(1), Janine Pontes de Miranda LYRA(1), Aline FAGUNDES(1) & Armando de Oliveira SCHUBACH(1,2)

SUMMARY

American tegumentary leishmaniasis (ATL) is an infectious disease caused by protozoa of the genus Leishmania, and transmitted by sandflies. In the state of Rio de Janeiro, almost all of the cases of American tegumentary leishmaniasis (ATL) are caused by Leishmania (Viannia) braziliensis, while cases of visceral leishmaniasis (VL) are caused by Leishmania (Leishmania) infantum chagasi. The resurgence of autochthonous VL cases in Rio de Janeiro is related to the geographic expansion of the vector Lutzomyia longipalpis and its ability to adapt to urban areas. We report the first case of leishmaniasis with exclusively cutaneous manifestations caused by L. (L.) infantum chagasi in an urban area of Rio de Janeiro. An eighty-one-year-old woman presented three pleomorphic skin lesions that were not associated with systemic symptoms or visceromegalies. Multilocus enzyme electrophoresis identified L. (L.) infantum chagasi, but direct smear and PCR of bone narrow were negative for Leishmania sp. (suggesting exclusively cutaneous involvement). We discuss the different dermatological presentations of viscerotropic leishmaniasis of the New and Old World, and the clinical and epidemiological importance of the case. Etiologic diagnosis of ATL based upon exclusive clinical criteria may lead to incorrect conclusions. We should be aware of the constant changes in epidemiological patterns related to leishmaniases.

KEYWORDS: Cutaneous leishmaniasis; Leishmania (Leishmania) infantum chagasi.

INTRODUCTION leishmaniasis with exclusively cutaneous manifestations caused by L. (L.) infantum chagasi in an urban area of Rio de Janeiro, discussing its clinical Leishmaniases are antropozoonoses caused by protozoa of the genus importance and possible epidemiological consequences. Leishmania and comprise a complex of diseases with varied clinical spectrum and epidemiological diversity, whose transmission occurs during CASE REPORT blood feeding of infected female sandflies21. In the state of Rio de Janeiro, almost all of the cases of American tegumentary leishmaniasis (ATL) are An eighty-one-year-old woman, from Rio de Janeiro, residing for the caused by Leishmania (Viannia) braziliensis3, while visceral leishmaniasis previous two years in a nursing home in Caju neighborhood, reported the (VL) is caused by Leishmania (L.) infantum chagasi. The resurgence of appearance of skin lesions about seven months earlier. She had cardiac autochthonous VL cases in the state of Rio de Janeiro since 2010 is related disease and chronic renal failure (CRF) and was referred to the Laboratory to the geographic expansion of the vector Lutzomyia longipalpis and to of Leishmaniases Surveillance of the Evandro Chagas National Institute its ability to adapt to urban areas7,12. In the city of Rio de Janeiro, dogs of Infectious Diseases, of the Oswaldo Cruz Foundation. Dermatological are the main reservoir of L. (L.) infantum chagasi. Canine enzooties have examination revealed the presence of three pleomorphic lesions that preceded the occurrence of human cases, and infection in dogs has been measured between 3 and 4 cm in diameter and were located in the frontal more prevalent than in humans8,13. The patient we describe lived in Caju and left malar regions of the face, and in the right elbow (Fig. 1 and 2). The neighborhood, located near downtown, in an area without forest remnants. lesions were not associated with systemic symptoms such as fever, weight The emergence of VL in the urban area of Rio de Janeiro is highly relevant, loss or poor general condition. The patient had no lymphadenopathy since it represents an important public health problem. While in Central or visceromegalies. Laboratory tests were within normal range, except America cutaneous manifestations of L. (L) infantum chagasi are quite for increased urea (135 mg/dL) and creatinine (2.65 mg/dL) due to common, in Brazil they are extremely rare. We report the first case of pre-existing CRF. Electrocardiogram showed cardiac arrhythmia and

(1) Laboratório de Pesquisa Clínica e Vigilância em Leishmanioses (LapClin VigiLeish), Instituto Nacional de Infectologia Evandro Chagas (INI)/ Fundação Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, Brasil. (2) Pesquisador Nível 1D do Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). Correspondence to: Liliane de Fátima Antonio. Laboratório de Pesquisa Clínica e Vigilância em Leishmanioses (LapClin VigiLeish), Instituto Nacional de Infectologia Evandro Chagas (INI)/ FIOCRUZ, Av. Brasil 4365, Manguinhos, 21040-360 Rio de Janeiro, RJ, Brasil. Tel.: +55.21.80228384; +55.21.38659541. E-mail: [email protected], [email protected] LYRA, M.R.; PIMENTEL, M.I.F.; MADEIRA, M.F.; ANTONIO, L.F.; LYRA, J.P.M.; FAGUNDES, A. & SCHUBACH, A.O. - First report of cutaneous leishmaniasis caused by Leishmania (Leishmania) infantum chagasi in an urban area of Rio de Janeiro, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 451-4, 2015.

Fig. 1 - A) Ulcerative and vegetating lesion in the left infra-orbital region. B) Infiltrative exulcerated plaque in the frontal region.

Fig. 2 - Round ulcer with infiltrated borders in the right elbow. enlargement of the corrected QT space (QTc) (0.50 seconds). Abdominal ultrasound did not reveal the presence of hepatomegaly or splenomegaly. Fig. 3 - Multilocus enzyme electrophoresis representative gel showing the patterns observed Histopathology, direct smear, culture in McNeal, Novy, Nicolle (NNN) for the nucleoside hydrolase (NH) system. Lane 1: Leishmania (Leishmania) amazonensis medium, and polymerase chain reaction (PCR) performed on cutaneous reference strain (IFLA/BR/1967/PH8); Lane 2: Leishmania (Viannia) guyanensis reference lesions fragments confirmed the clinical diagnosis of ATL. Montenegro strain (MHOM/BR/1975/M4147); Lane 3: Leishmania (Viannia) braziliensis reference strain skin test and enzyme-linked immunosorbent assay (ELISA) serology (MHOM/BR/1975/M2903); Lanes 4 and 6: Leishmania (Leishmania) infantum chagasi reference strain (MHOM/BR/1974/PP75); Lanes 5 and 7: sample isolated from patient’s for leishmaniasis resulted positive. Since no previous cases of ATL were cutaneous lesion that showed similar profiles with Leishmania (Leishmania) infantum known in this neighborhood, and a recent case of VL had been described chagasi reference strain. in this location18, we performed the multilocus enzyme electrophoresis assay as previously described5, and the identification of L. (L.) infantum chagasi was confirmed (Fig. 3). Culture and PCR of a bone marrow braziliensis were previously described in the state of Rio de Janeiro: one sample were negative for parasite isolation or Leishmania DNA detection. in the city of Paraty, in 2007, caused by Leishmania (L.). amazonensis1; Since the patient presented a history of heart disease and chronic renal and another caused by L. donovani chagasi (now known as Leishmania failure, we discarded the use of meglumine antimoniate. The patient (L.) infantum chagasi) in a rural area of the city of Rio de Janeiro in received liposomal amphotericin B 4 mg/kg/day with a cumulative dose 198615. In addition, a case of co-infection in which the patient showed of 1.25 g. During hospitalization, the patient did not present any systemic VL caused by L. donovani and ATL caused by L. braziliensis braziliensis manifestations compatible to VL. Two months post-treatment, the facial (now known as L. (V.) braziliensis) was described16. lesions had healed and the lesion of the arm was partially epithelialized. In the case reported here, the identification of the parasite isolated DISCUSSION through culture of a cutaneous fragment was performed by multilocus enzyme electrophoresis, considered the gold standard method for the Only two cases of ATL caused by species other than L. (V.) characterization of Leishmania species. Moreover, the failure to detect

452 LYRA, M.R.; PIMENTEL, M.I.F.; MADEIRA, M.F.; ANTONIO, L.F.; LYRA, J.P.M.; FAGUNDES, A. & SCHUBACH, A.O. - First report of cutaneous leishmaniasis caused by Leishmania (Leishmania) infantum chagasi in an urban area of Rio de Janeiro, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 451-4, 2015.

parasite or Leishmania DNA in a bone narrow sample suggests exclusive RESUMO cutaneous involvement. Primeiro relato da leishmaniose cutânea causada por Leishmania In a series of 18 patients with VL in northeastern Brazil, 40% were (Leishmania) infantum chagasi em uma área urbana do Rio de positive for L. (L) infantum chagasi in the culture of fragments of skin Janeiro, Brasil lesions or unimpaired skin20. Cases related to L. (L.) donovani with dermatological compromise in Africa and in the Indian subcontinent A leishmaniose tegumentar americana (LTA) é uma doença are generally associated with post kala-azar dermal leishmaniasis. In infecciosa causada por protozoários do gênero Leishmania, transmitida these cases, cutaneous lesions (macules, papules, nodules, or plaques), por flebotomíneos. No estado do Rio de Janeiro, quase todos os casos without a tendency to ulcerate, arise on the skin after the end of the de LTA são causados por Leishmania (Viannia) braziliensis, enquanto treatment for VL19. In Brazil, this presentation is rare and is usually a leishmaniose visceral (LV) é causada por Leishmania (Leishmania) related to HIV-coinfection4. In Europe, rare cases of cutaneous10 or infantum chagasi. O ressurgimento de casos autóctones de LV no Rio mucocutaneous11 leishmaniasis caused by L. (L.) infantum have been de Janeiro está relacionado com a expansão geográfica dos vetores reported, and these cases seem to be related to specific zymodemes9. Lutzomyia longipalpis e à sua capacidade de se adaptar às áreas Alternatively, the exclusively cutaneous involvement by L. donovani urbanas. Relatamos o primeiro caso de leishmaniose com manifestações chagasi is described in Central America. However, no genetic exclusivamente cutâneas causadas por L. (L.) infantum chagasi em differences between Leishmania (L.) chagasi strains causing VL and CL uma área urbana do Rio de Janeiro. Mulher de 81 anos apresentou três were observed in Honduras14 and Nicaragua2. Cutaneous leishmaniasis lesões cutâneas pleomórficas não associadas a sintomas sistêmicos ou caused by Leishmania (L.) chagasi in patients from Central America visceromegalias. A eletroforese de enzimas multilocus obtida a partir tends to have an atypical presentation: the lesions are papulonodular, da lesão cutânea identificou L. (L.) infantum chagasi, por outro lado o surrounded by areas of hypochromia; they predominate in the cephalic exame direto e o PCR da medula óssea foram negativos para Leishmania segment and do not ulcerate2,14. In these countries, children under five sp. (sugerindo acometimento exclusivamente cutâneo). Discutimos as years of age present visceral forms mostly, while the cutaneous forms diferentes apresentações dermatológicos da leishmaniose visceral do prevail in older children and young adults. Novo e Velho Mundo, assim como a importância clínica e epidemiológica deste caso. O diagnóstico etiológico da LTA com base apenas em critérios In Venezuela, patients affected by L. colombiensis present VL as clínicos pode levar a conclusões incorretas. Devemos estar conscientes much as CL17. The clinical presentation results from a complex interaction das constantes mudanças nos padrões epidemiológicos relacionados à among the Leishmania species with host immunity. leishmaniose.

In Brazil, cases of CL caused by L. (L) infantum chagasi are so ACKNOWLEDGMENTS rare that it is not possible to certify the age range that can influence the clinical expression of the disease. In this report, the benign manifestation This work received support from INI/FIOCRUZ and the National of the disease suggests a partially effective immunity that is not related Council of Scientific and Technicological Development Brazil (CNPq). to previous infection with L. (L) infantum chagasi in childhood, since our patient was not coming from an LV endemic area and only resided REFERENCES in Caju neighborhood for two years. 1. Azeredo-Coutinho RB, Conceição-Silva F, Schubach A, Cupolillo E, Quintella LP, The case reported that exclusive cutaneous form caused by L. Madeira MF, et al. First report of diffuse cutaneous leishmaniasis and Leishmania amazonensis infection in Rio de Janeiro State, Brazil. Trans R Soc Trop Med Hyg. (L) infantum chagasi may not represent an isolated case. Recently, 2007;101:735-7. two cases of ATL with cutaneous manifestations arising from a community located in the same region were taken into account by the 2. Belli A, García D, Palacios X, Rodriguez B, Valle S, Videa E, et al. Widespread atypical Brazilian system for notifiable diseases, SINANNET6. Although the cutaneous Leishmaniasis caused by Leishmania (L.) chagasi in Nicaragua. Am J characterization of the involved Leishmania species was not possible Trop Med Hyg. 1999;61:380-5. in those cases, dermotropic strains of L. (L) infantum chagasi could 3. Brasil. Ministério da Saúde. Manual de vigilância da leishmaniose tegumentar cutânea. be involved. In this area, no previous ATL cases have been reported, 3a ed. Brasília: Ministério da Saúde; 2010. and neither the presence of Lutzomyia intermedia, the main vector of Leishmania (V.) braziliensis in the state of Rio de Janeiro, was observed. 4. Carnaúba D Jr, Konishi CT, Petri V, Martinez IC, Shimizu L, Pereira-Chioccola VL. On the other hand, the presence of Lutzomyia longipalpis, the principal Atypical disseminated leishmaniasis similar to post-kala-azar dermal leishmaniasis in a Brazilian AIDS patient infected with Leishmania (Leishmania) infantum chagasi: vector of L. (L) chagasi infantum in Brazil, has been demonstrated. a case report. Int J Infect Dis. 2009;13:e504-7. Etiologic diagnosis of ATL based upon exclusive clinical criteria may lead to incorrect conclusions. We should be aware of the constant 5. Cupolillo E, Gimaldi G Jr, Momen H. A general classification of New World Leishmania changes in epidemiological patterns related to the leishmaniases. We using numerical zymotaxonomy. Am J Trop Med Hyg. 1994;50:296-311. therefore suggest that multilocus enzyme electrophoresis of isolated 6. DATASUS. Leishmaniose tegumentar americana: casos confirmados notificados no parasites and/or PCR of tissue fragments should be performed in order sistema de informação de agravos de notificação. Brasília: Ministério da Saúde/ to identify the involved species in futures suspected cases of ATL in SINAN; 2014. [cited 2014 April 10]. Available from: http://dtr2004.saude.gov.br/ the Caju neighborhood. sinanweb/tabnet/tabnet?sinannet/lta/bases/ltabrnet.def

453 LYRA, M.R.; PIMENTEL, M.I.F.; MADEIRA, M.F.; ANTONIO, L.F.; LYRA, J.P.M.; FAGUNDES, A. & SCHUBACH, A.O. - First report of cutaneous leishmaniasis caused by Leishmania (Leishmania) infantum chagasi in an urban area of Rio de Janeiro, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 451-4, 2015.

7. de Andrade AR, da Silva BA, Cristaldo G, de Andrade SM, Filho AC, Ribeiro A, et al. 15. Oliveira-Neto MP, Grimaldi G Jr, Momen H, Pacheco RS, Marzochi MCA, McMahon Spatial distribution and environmental factors associated to phlebotomine fauna in a Pratt D. Active cutaneous leishmaniasis in Brazil, induced by Leishmania donovani border area of transmission of visceral leishmaniasis in Mato Grosso do Sul, Brazil. chagasi. Mem Inst Oswaldo Cruz. 1986;81:303-9. Parasit Vectors. 2014;7:260. 16. Oliveira Neto MP, Marzochi MC, Grimaldi G Jr, Pacheco RS, Toledo LM, Momen H. 8. Figueiredo FB, Barbosa Filho CJ, Schubach EY, Pereira SA, Nascimento LD, Madeira Concurrent human infection with Leishmania donovani and Leishmania braziliensis M de F. Relato de caso autóctone de leishmaniose visceral canina na zona sul do braziliensis. Ann Trop Med Parasitol. 1986;80:587-92. município do Rio de Janeiro. Rev Soc Bras Med Trop. 2010;43:98-9. 17. Rodriguez-Bonfante C, Bonfante-Garrido R, Grimaldi G Jr, Momen H, Cupolillo E. 9. Gradoni L, Gramiccia M. Leishmania infantum tropism: strain genotype or host immune Genotypically distinct Leishmania colombiensis isolates from Venezuela cause both status? Parasitol Today. 1994;10:264-7. cutaneous and visceral leishmaniasis in humans. Infect Genet Evol. 2003;3:119-24.

10. Lenvers P, Marty P, Peyron F. Ulcération chroníque du visage: penser à une leishmaniose 18. Silva GA, Bocheat TO, Ferry FR, Pinto JF, Azevedo MC, Carvalho R de S, et al. First cutanée métropolitaine due à Leishmania infantum. Ann Dermatol Venerol. case of autochthonous human visceral leishmaniasis in the urban Center of Rio de 2013;140:704-7. Janeiro: case report. Rev Inst Med Trop Sao Paulo. 2014;56:81-4.

11. Lopes L, Vasconcelos P, Borges-Costa J, Soares-Almeida L, Campino L, Filipe P. An 19. Singh S, Sharma U, Mishra J. Post-kala-azar dermal leishmaniasis: recent developments. atypical case of cutaneous leishmaniasis caused by Leishmania infantum in Portugal. Int J Dermatol. 2011;50:1099-108. Dermatol Online J. 2013;19:20407. 20. Vasconcelos I de A, Sousa A de Q, Vasconcelos AW, Diógenes MJ, Momen H, Grimaldi 12. Martins-Melo FR, Lima M da S, Ramos AN Jr, Alencar CH, Heukelbach J. Mortality G Jr, et al. Parisitisme cutan par Leishmania (Leishmania) chagasi au cours de la and case fatality due to visceral leishmaniasis in Brazil: a nationwide analysis of leishmaniose viscerale Sud-Américaine. Bull Soc Pathol Exot. 1993;86:101-5. epidemiology, trendsand spatial patterns. Plos One. 2014;9:e93770. 21. World Health Organization. Leishmaniasis. Geneva: WHO; 2013. [cited 2013 May 10]. 13. Marzochi MCA, Fagundes A, Andrade MV, Souza MB, Madeira M de F, Mouta-Confort Available from: http://www.who.int/leishmaniasis/en/ E, et al. Visceral leishmaniasis in Rio de Janeiro, Brazil: eco-epidemiological aspects and control. Rev Soc Bras Med Trop. 2009;42:570-80. Received: 04 November 2014 Accepted: 14 January 2015 14. Noyes H, Chance M, Ponce C, Ponce E, Maingon R. Leishmania chagasi: genotypically similar parasites from Honduras cause both visceral and cutaneous leishmaniasis in humans. Exp Parasitol. 1997;85:264-73.

454 Rev. Inst. Med. Trop. Sao Paulo 57(5):455-457, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500017

CASE REPORT

PROTECTIVE LEVELS OF VARICELLA-ZOSTER ANTIBODY DID NOT EFFECTIVELY PREVENT CHICKENPOX IN AN X-LINKED AGAMMAGLOBULINEMIA PATIENT

Fernanda Aimée NOBRE(1), Isabela Garrido da Silva GONZALEZ(1), Maria Isabel de MORAES-PINTO(1) & Beatriz Tavares COSTA-CARVALHO(1)

SUMMARY

We describe the case of an eight-year-old boy with X-linked agammaglobulinemia who developed mild varicella despite regular intravenous immunoglobulin (IVIG) therapy. He maintained protective antibody levels against varicella and the previous batches of IVIG that he received had adequate varicella-specific IgG levels. The case illustrates that IVIG may not prevent VZV infection.

KEYWORDS Chickenpox; Immunoglobulin; Intravenous; Agammaglobulinemia; Immunodeficiency disorders.

INTRODUCTION immunoglobulin therapy did not effectively prevent chickenpox.

Patients who have immunodeficiency disorders rely on CASE REPORT immunoglobulin prophylaxis to prevent common infectious diseases. Intravenous immunoglobulin (IVIG) products are prepared from pools of An eight-year-old boy was diagnosed with XLA at the age of four, plasma collected from a large number of healthy donors and, therefore, and presented 0.5% of B lymphocytes and serum IgG, IgA and IgM contain antibodies against many infectious agents preventing a variety of levels of 149 mg/dL, 1 mg/dL and 11 mg/dL, respectively. T lymphocyte bacterial and viral infections, such as varicella, in patients with impaired numbers were normal. He started treatment with IVIG (600 mg/kg, every antibody production1,4,12. four weeks) with excellent compliance and good outcome, keeping IgG levels over 600 mg/dL. X-linked agammaglobulinemia (XLA) is a hereditary immunodeficiency, characterized by absence of mature B cells, resulting He was admitted to our clinic with a one-day history of skin lesions in very low levels of all immunoglobulin isotypes. The mainstay of on trunk and abdomen that had started 19 days after his last IVIG infusion therapy for these patients is immunoglobulin replacement9,13,16. and was diagnosed with a mild varicella (less than 50 lesions at various stages - red papules, vesicles and broken vesicles leaving a crust). There Varicella is a disease caused by the primary infection with the was no history of fever or other symptoms. He was treated with oral varicella-zoster virus (VZV). Clinical manifestations of the disease acyclovir for five days and received an extra dose of standard IVIG. He depend on age, immune and vaccination status, and type of exposure 2. recovered without any complication. As a result of immunization, in some countries, chickenpox is no longer a common illness11. In Brazil, however, this disease is still endemic. Total serum IgG levels, varicella-zoster IgG levels, and avidity, assessed on day 1 of varicella, are presented in Table 1. VZV antibodies The majority of primary VZV infections involve uncomplicated and VZV IgG avidity were also assessed from serum samples collected chickenpox. However, in newborns and inadequately protected five, ten, sixteen and twenty months before varicella (Table 1). Varicella- immunosuppressed patients, exposure to VZV can lead to severe specific IgG levels from the batch of IVIG that was administered to illness2,11,17. the patient for the last three months before varicella were determined (Table 1). In this study, we report a case of chickenpox in a child with XLA who is being treated with regular intravenous immunoglobulin. Although the At the time of varicella infection, the patient’s CD4+ and CD8+ patient developed a mild disease, this case shows that regular intravenous T lymphocyte counts were 2388 cells/mm3 and 1293 cells/mm3,

(1) Universidade Federal de São Paulo, Departmento de Pediatria, São Paulo, SP, Brasil. E-mails: [email protected]; [email protected]; [email protected]; [email protected] Correspondence to: Fernanda Aimée Nobre, Departmento de Pediatria, Universidade Federal de São Paulo, Rua dos Otonis 725, 04025-002 São Paulo, SP, Brasil. Tel: +55 11 5084-0285; Fax: +55 11 56787090. E-mail: [email protected] NOBRE, F.A.; GONZALEZ, I.G.S.; MORAES-PINTO, M.I. & COSTA-CARVALHO, B.T. - Protective levels of varicella-zoster antibody did not effectively prevent chickenpox in an X-linked agammaglobulinemia patient. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 455-7, 2015.

Table 1 (a) Varicella-specific IgG levels and its avidity, and total IgG levels obtained from the serum of the patient. (b) Varicella-specific IgG levels from the batch of IVIG that patient received over the last three months before VZV infection. Samples were tested for varicella-specific IgG levels by ELISA5,14

Varicella-specific IgG titer Varicella-specific IgG IgG (mg/dL) (IU/mL) avidity (%) Day 1 of varicella(a) 2.03 70.3 718 Five months before varicella(a) 1.2 62.4 Ten months before varicella(a) 0.48 72.3 Sixteen months before varicella(a) 0.79 66.9 Twenty months before varicella(a) 0.87 70.9 IVIG(b) 12.4 -- Protective IgG levels are considered when higher than 0.1 IU/mL8,9. respectively. Fifteen days after infection, both CD4+ and CD8+ T cells high levels of VZV specific IgG, despite the changing epidemiology expressed CD25 upon in vitro stimulation with VZV specific antigens18 of varicella due to vaccine introduction11,12. A study published in 2000 (Fig. 1). showed that patients receiving monthly IVIG at 400 mg/kg may be protected against varicella and probably do not require varicella-zoster DISCUSSION immune globulin (VZIG) if the last dose of IVIG was given three weeks or less before exposure8. That is in agreement with the fact that antibodies The aim of IVIG replacement therapy in hypogammaglobulinemic for some virus and bacteria in IVIG preparations seems to have a half- patients is to protect them from potentially preventable infections. life longer than 20 days10.

However, it is well known that many factors may have an impact on In 2009, we had two other patients, one with common variable the quality and quantity of antibodies in IVIG preparations, and there immunodeficiency (CVI) and another with XLA who also presented with are differences in immunoglobulin content from brand to brand as well mild varicella while on regular IVIG replacement therapy, similar to the as from batch to batch1,3,4,6,11,12. patient in this case. In this current report, we showed that the previous- batches of IVIG that the patient received had adequate varicella-specific Assessment of current IVIG preparations showed that they contain IgG levels and our patient maintained protective antibody levels against

Fig. 1 - CD25 expression on CD4+ and CD8+ T lymphocytes after incubation with VZV specific antigens. The final value of positive cells was obtained by subtracting the percentage of cells stimulated with cell supernatant of non-VZV-infected cells (negative control) from the percentage of cells from the culture in presence of the stimulus (VZV antigen). Adapted from VIANA et al., 201018.

456 NOBRE, F.A.; GONZALEZ, I.G.S.; MORAES-PINTO, M.I. & COSTA-CARVALHO, B.T. - Protective levels of varicella-zoster antibody did not effectively prevent chickenpox in an X-linked agammaglobulinemia patient. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 455-7, 2015.

varicella during the previous months (Table 1). 2. American Academy of Pediatrics. Varicella-zoster infections. In: Pickering LK, Baker CJ, Kimberlin DW, Long SS, editors. Red Book: 2012 report of the Committee on Infectious Diseases. 29th ed. Elk Grove Village: American Academy of Pediatrics; Specific antibody levels have been correlated with protection 2012. p. 774-89. against several diseases. Antibody levels that correlate with protection are generally derived from studies with healthy population wherein 3. Audet S, Virata-Theimer ML, Beeler JA, Scott DE, Frazier DJ, Mikolajczyk MG, et al. observations have been shown that individuals with a certain level of Measles-virus-neutralizing antibodies in intravenous immunoglobulins. J Infect Dis. antibody are always or nearly always protected from disease15. However, 2006;194:781-9. these protective levels are usually determined after active immunization. 4. Berger M. Principles of and advances in immunoglobulin replacement therapy for primary There has been no study that has defined what level of varicella-specific immunodeficiency. Immunol Allergy Clin North Am. 2008;28:413-37. antibody provides adequate protection in passive prophylaxis usage. What would be the protective antibody levels for a patient who does not 5. De Ory F, Echevarría JM, Kafatos G, Anastassopoulou C, Andrews N, Backhouse produce antibodies? J, et al. European seroepidemiology network 2: standardization of assays for seroepidemiology of varicella zoster virus. J Clin Virol. 2006;36:111-8.

Humoral immunity is very important for VZV neutralization of the 6. Gelfand EW. Differences between IGIV products:impact on clinical outcome. Int cell-free virus and cellular immunity is essential for limiting the extent Immunopharmacol. 2006;6:592-9. of primary infection with VZV2,7. XLA patients have normal T cells function and these cells from our patient responded to VZV (Fig. 1) 7. Gershon AA, Gershon MD, Breuer J, Levin MJ, Oaklnder AL, Griffiths PD. Advances in the understanding of the pathogenesis and epidemiology of herpes zoster. J Clin which could explain his favorable evolution. However, certain groups of Virol. 2010;48(Suppl 1):S2-7. patients, such as those with impaired T cell-mediated immunity or with antibody deficiency but taking immunosuppressive drugs can develop 8. Keller MA, Stiehm ER. Passive immunity in prevention and treatment of infectious severe complications7 and must be protected. diseases. Clin Microbiol Rev. 2000;13:602-14.

9. Maarschalk-Ellerbroek LJ, Hoepelman IM, Ellerbroek PM. Immunoglobulin treatment Although the efficacy of IVIG in the prevention of several diseases in primary antibody deficiency. Int J Antimicrob Agents. 2011;37:396-404. is well established1,4, we have to be aware that this therapy cannot be totally effective for some diseases in certain situations. Maybe IVIG is 10. Mankarious S, Lee M, Fischer S, Pyun KH, Ochs HD, Oxelius VA, et al. The half-lives effective in modifying varicella infection but not in preventing the disease. of IgG subclasses and specific antibodies in patients with primary immunodeficiency who are receiving intravenously administered immunoglobulin. J Lab Clin Med. 1988;112:634-40. RESUMO 11. Maranich AM, Rajnik M. Varicella-specific immunoglobulin G titers in commercial Nível sérico adequado de anticorpo contra o vírus da varicela- intravenous immunoglobulin preparations. Pediatrics. 2009;124:e484-8. zoster não foi suficiente para prevenir a infecção em criança com agamaglobulinemia ligada ao X 12. Nobre FA, Gonzalez IGS, Simão RM, Moraes-Pinto MI, Costa-Carvalho BT. Antibody levels to tetanus, diphtheria, measles and varicella in patients with primary immunodeficiency undergoing intravenous immunoglobulin therapy: a prospective Relatamos o caso de uma criança com agamaglobulinemia ligada ao study. BMC Immunol. 2014;15:26. X, sexo masculino, oito anos de idade, que desenvolveu quadro de varicela leve, apesar do tratamento regular com imunoglobulina intravenosa 13. Notarangelo LD. Primary immunodeficiencies. J Allergy Clin Immunol. 2010;125(2 (IVIG). O paciente mantinha níveis adequados de imunoglobulina (IgG) Suppl 2):S182-94. contra varicela, assim como, os últimos lotes de IVIG por ele recebido 14. Ono E, Lafer MM, Weckx LY, Granato C, de Moraes-Pinto MI. A simple and cheaper in também apresentavam níveis adequados do anticorpo específico. O caso house varicella zoster virus antibody indirect ELISA. Rev Inst Med Trop Sao Paulo. ilustra que o tratamento regular com IVIG não é suficiente para prevenir 2004;46:165-8. a infecção pelo vírus da varicela-zoster. 15. Pichichero ME. Booster vaccinations: can immunologic memory outpace disease pathogenesis? Pediatrics. 2009;124:1633-41. CONFLICT OF INTEREST 16. Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, et al. Clinical, None declared. immunological, and molecular analysis in a large cohort of patients with X-linked agammaglobulinemia: an Italian multicenter study. Clin Immunol. 2002;104:221-30. FUNDING 17. Sartori AMC. A review of the varicella vaccine in immunocompromised individuals. Int J Infect Dis. 2004;8:259-70. None. 18. Viana PO, Ono E, Miyamoto M, Salomao R, Costa-Carvalho BT, Weckx LY, et al. Humoral ETHICAL APPROVAL and cellular immune responses to measles and tetanus: the importance of elapsed time since last exposure and the nature of the antigen. J Clin Immunol. 2010;30:574-82.

Not required. Received: 4 November 2014 Accepted: 27 January 2015 REFERENCES

1. Albin S, Cunningham-Rundles C. An update on the use of immunoglobulin for the treatment of immunodeficiency disorders. Immunotherapy. 2014;6:1113-26.

457 Rev. Inst. Med. Trop. Sao Paulo 57(5):458-460, September-October, 2015 http://dx.doi.org/10.1590/S0036-46652015000500018

LETTER TO THE EDITOR

DIVERSITY AND INFECTIVITY POTENTIAL OF EMERGING FUNGI IN AN AREA OF BABAÇU TREES IN THE STATE OF MARANHÃO, BRAZIL

Dear Sir, Of the 20 samples taken from the soil, we obtained 13 isolates of fungi, whose macro and micromorphological characteristics of the The babaçu coconut breakers are often affected by diseases that colonies allowed the diagnosis of Aspergillus niger, Penicillium sp., seem having obvious relationship between their type of occupation and and Scedosporium sp., besides others, Fusarium sp. not being found. development of fungal infection2,4. In coconut shells Aspergillus niger and Penicillium sp. were found; in almond coconut, Aspergillus niger, A. versicolor, A. flavus,and We studied human mycoses in conjunctiva, nails (onycholytic lesions) Penicillium sp. were obtained. On palm leaves we identified Aspergillus and skin lesions in 100 babaçu coconut breakers of Esperantinópolis, niger and Penicillium sp. (Table 1). Twenty-five nail samples that showed Maranhão (Fig. 1), and studied the ground near the babaçu palms, suggestive alterations of onycholytic lesions1 (Fig. 3) were harvested; coconut shells and palm leaves (Fig. 2), for taxonomic classification eleven positive cultures for yeast, Neosartorya spinosa, and Trichophyton of fungi by direct mycological and microscopic examination. We also sp. Rhizopus sp. and Curvularia sp. (Fig. 4) were isolated. Seventy-two performed direct examination with KOH for human mycoses. After the fungal isolates were obtained from the conjunctiva, the most common growth of colonies, these were analyzed by light microscopy using blue were filamentous fungi from 58 (80.57%) breakers and 14 samples lactophenol dye. Colonies of interest were subcultured in tubes of 16 x (19.43%) were found corresponding to Candida sp., and the Fusarium 150, containing Sabouraud agar medium and subsequently was prepared spp. occurred in only one sample (Fig. 5 and Table 2)3. microcultivation for taxonomic identification. The study was approved by the Ethics Committee in Research of the University Hospital of UFMA. All individuals involved in this study were babaçu coconut breakers.

Table 1 Distribution and taxonomic classification of fungi isolated from soil near the babaçu palms, babaçu coconut shells, babaçu leaves cachopa and babaçu palm concavity

Variables n % Fungi Isolation from Soil Aspergillus niger 7 53.8 Aspergillus nidulans 1 7.7 Penicillium sp. 2 15.4 Scedosporium sp. 2 15.4 Syncephalastrum sp. 1 7.7 Fungi Isolation from coconut shell Aspergillus niger 2 50.0 Penicillium sp. 2 50.0

Fig. 1 - Coconut breaker from Esperantinópolis, Maranhão (MA), Brazil. Fungi isolation from coconut Aspergillus niger 8 66.7 Aspergillus versicolor 2 16.7 Aspergillus flavus 1 8.3 Penicillium sp. 1 8.3 Fungi isolation from palm leaf Aspergillus niger 6 85.7

Fig. 2 - Babaçu palm coconut (leaf, bark and soil). Penicillium sp. 1 14.3 NASCIMENTO, M.D.S.B.; LEITÃO, V.M.S.; SILVA, M.A.C.N.; NASCIMENTO, A.C.B.; BEZERRA, G.F.B. & VIANA, G.M.C. - Diversity and infectivity potential of emerging fungi in an area of babaçu trees in the state of Maranhão, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 458-60, 2015.

There was a greater isolation of fungi in the study group compared to the control group (Table 3). Regarding the fungi isolated from the conjunctiva, there was agreement with the literature. The treatment used in most cases was drops based on topical antibiotics and corticosteroids, which may predispose to further infection3.

The lack of knowledge on Fusarium in soil, palm bark, almond, palm leaves, and babaçu coconuts, albeit in a preliminary way, has established a plant model for studies of biological control of Fusarium sp. However, in the onycholytic lesions we found the genres Neosartorya

Table 2 Distribution and taxonomic classification of fungi isolated from the nail and ocular conjunctiva of babaçu coconut breakers

Variables n % Fig. 3 - Onycholytic lesions in a babaçu coconut breaker. Fungi isolation from nails Yeasts 4 36.4 Neosartorya spinosa 2 18.2 Tricophyton sp. 2 18.2 Rhizopus sp. 2 18.2 Curvularia sp. 1 9.0 Fungi isolation from ocular conjunctiva Aspergillus sp. 24 33.33 Aspergillus niger 11 15.27 Candida sp. 11 15.27 Penicillium 07 9.72 Fig. 4 - Curvularia sp. isolated from samples of nails from babaçu coconut breakers. Syncephalastrum sp. 03 4.16 Nigrospora sp. 03 4.16 Malassezia sp. 03 4.16 Sporothrix sp. 02 2.77 Cladosporium sp. 02 2.77 Aspergillus versicolor 01 1.38 Aspergillus flavus 01 1.38 Aspergillus nidulans 01 1.38 Cladophialophora sp. 01 1.38 Trichophyton sp. 01 1.38 Fusarium sp. 01 1.38 Fig. 5 - Fusarium sp. isolated from the conjunctiva of babaçu coconut breakers.

Table 3 Frequency of fungal isolates in a sample from ocular conjunctiva and its relationship to the activity performed

Fungi Professional Activity Yeast Penicillium sp Other Fungi Total F % F % F % F % Coconut breakers 11 15.27 7 9.72 54 75 72 100 Control group 8 66.7 1 8.3 3 25 12 100 X2= 15.819; p = 0.0004; Degrees of Freedom = 2.

459 NASCIMENTO, M.D.S.B.; LEITÃO, V.M.S.; SILVA, M.A.C.N.; NASCIMENTO, A.C.B.; BEZERRA, G.F.B. & VIANA, G.M.C. - Diversity and infectivity potential of emerging fungi in an area of babaçu trees in the state of Maranhão, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 57(5): 458-60, 2015.

spinosa, Rhizopus sp., and Curvularia sp. showing that other emerging (5) Universidade Estadual do Maranhão, Centro de Estudos and opportunistic filamentous fungi may be isolated. The fungi found Superiores de Caxias. in this study were present in the environment. As the coconut breakers Correspondence to: Profª. Drª. Maria do Desterro Soares suffer constant injuries resulting from their work, the fungi penetrate by Brandão Nascimento. Depto de Patologia/NIBA/UFMA. Av. dos percutaneous inoculation1. Portugueses 1966, Prédio do CCBS, Bloco 3, Sala 3A, Núcleo de Imunologia, Cidade Universitária do Bacanga, Universidade Federal In conclusion, exposure to geophilic fungi and fitopathogens linked do Maranhão. 65080-040 São Luís, MA, Brasil. to the work of babaçu coconuts extraction has been recorded as mycoses Tel.: +55 98 3272‑8535; which require clinical and laboratory diagnosis that will result in Fax: +55 98 3272-8535. E-mail: E-mail:[email protected] preventive measures, thus justifying the economic and social importance Supported by: Foundation for Research and Scientific and of this work activity. Technological Development of the State of Maranhão (FAPEMA). Notice PPSUS 2004 Maria do Desterro Soares Brandão NASCIMENTO(1,5) Process No. 4.01-1408-05 Valéria Maria Sousa LEITÃO(2) Marcos Antonio Custódio Neto da SILVA(3) REFERENCES Anna Cyntia Brandão NASCIMENTO(4) Geusa Felipa de Barros BEZERRA(1) 1. Araújo AJG, Bastos OMP, Souza MAJ, Oliveira JC. Onicomicoses por fungos Graça Maria de Castro VIANA(1) emergentes: análise clínica, diagnóstico laboratorial e revisão. An Bras Dermatol. 2003;78:445-55.

(1) Universidade Federal do Maranhão, Departamento de 2. Bueno CJ, Ambrósio MMQ, Souza NL. Produção e avaliação da sobrevivência Patologia, São Luís, Maranhão, Brasil. de estruturas de resistência de fungos fitopatogênicos habitantes do solo. Summa E-mails: [email protected]; [email protected]; Phytopathol. 2007;33:47-55. [email protected] 3. Höfling-Lima AL, Forseto A, Duprat JP, Andrade A, Souza LB, Godoy P, et al. Estudo (2) Universidade de São Paulo, Depto. Ginecologia, São Paulo, laboratorial das micoses oculares e fatores associados às ceratites. Arq Bras Oftalmol. SP, Brasil. E-mail: [email protected] 2005;68:21-7. (3) Universidade Federal do Maranhão, São Luís, Maranhão, Brasil. E-mail: [email protected] 4. Santos AF, Bezerra JL, Tessmann DJ, Poltronieri LS. Ocorrência de Curvularia (4) Universidade Federal do Maranhão, Hospital Universitário. senegalensis em pupunheira e palmeira real no Brasil. Fitopatol Bras. 2003;28:204. E-mail: [email protected]

460