Phosphorylation and Mechanistic Regulation of a Novel Ikk

PHOSPHORYLATION AND MECHANISTIC REGULATION OF A NOVEL IKK

SUBSTRATE, ITCH

JESSICA MARIE PEREZ

Submitted in partial fulfillment of the requirements

for the degree of Doctor of Philosophy

Dissertation Advisor: Dr. Derek W. Abbott

Department of Pathology

CASE WESTERN RESERVE UNIVERSITY

January 2018 CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Jessica Marie Perez candidate for the Doctor of Philosophy degree*.

(signed) Dr. George Dubyak (chair of the committee)

Dr. Pamela Wearsch

Dr. Theresa Pizarro

Dr. Clive Hamlin

Dr. Brian Cobb

Dr. Derek Abbott

(date) October 2, 2017

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents

List of Tables ...... v

List of Figures ...... vi

Acknowledgements ...... viii

List of Abbreviations ...... ix

Abstract ...... xi

Chapter 1: Introduction ...... 1

1.1 Introduction ...... 1

1.2 Sarcoidosis pathophysiology and treatment ...... 1

1.3 Blau Syndrome is a NOD2-associated disorder ...... 4

1.4 NOD2 signaling ...... 5

1.6 Hypothesis and approach ...... 9

1.7 Dissertation Rationale ...... 13

1.7 Specific questions addressed ...... 14

1.8 Works cited in this chapter ...... 17

Chapter 2: ITCH ...... 25

2.1 Introduction: C2-WW-HECT (CWH) family of E3 ubiquitin ligases . 25

2.1.1 C2 domains ...... 27

2.1.2 WW domains ...... 27

2.1.3 HECT domains ...... 27

2.2 Ubiquitin and ubiquitination ...... 28

2.3 ITCH as an attenuator of inflammatory signaling ...... 30

2.4 Human/mouse ITCH deficiency ...... 31

2.5 Rationale to study IKK-mediated phosphorylation of ITCH ...... 33

2.6 Works cited in this chapter ...... 34

Chapter 3: IκB Kinases phosphorylate ITCH ...... 40

3.1 Introduction ...... 42

3.2 Materials and methods ...... 44

3.2.1 Cell culture, transient transfection, immunoprecipitation, and Western blotting ...... 44

3.2.2 In vitro kinase assay ...... 46

3.2.3 Mass spectrometry ...... 46

3.2.4 In vitro ubiquitin ligase assay ...... 46

3.2.5 Luciferase assays ...... 46

3.2.6 Lentiviral shRNA and retroviral RNAi-Resistant ITCH reconstitution/CRISPR NEMO−/− Cells ...... 47

3.2.7 qRT-PCR ...... 48

3.2.8 Mice and histology scoring ...... 48

3.2.9 Graphs and statistical analyses ...... 49

3.2.10 Structural and sequence analyses ...... 49

3.3 Results and discussion ...... 49

3.3.1 IKKs phosphorylate the HECT E3 ubiquitin ligase ITCH on Serine 687 ...... 49

3.3.2 Ubiquitin ligase activity and downstream signaling is modulated in an ITCH S687D phosphomimetic mutant ...... 59

3.3.3 ITCH phosphorylation causes increased TNF-induced proinflammatory cytokine release, and loss of TNF signaling delays the pulmonary inflammatory phenotype in ITCH−/− mice ...... 66

3.3.4 Conclusions ...... 70

3.5 Works cited in this chapter ...... 71

Chapter 4: Phosphorylation of E3 reduces E2-E3 binding ...... 78

4.1 Introduction ...... 79

4.2 Materials and methods ...... 81

4.2.1 Cell culture, transient transfection and immunoprecipitation/pulldown ...... 81

4.2.2 Western blotting ...... 81

4.2.3 Protein purification and SPR ...... 82

4.2.4 Lentiviral transduction, CRISPR Resistant UbcH7 Construct ..... 82

4.3 Results and discussion ...... 83

4.3.1 ITCH phosphorylation impairs UbcH7 binding ...... 83

4.3.2 Genetic deletion of UbcH7 phenocopies phosphorylation of ITCH89

4.3.3 Conclusions ...... 93

4.5 Works cited in this chapter ...... 93

Chapter 5: Conclusions and Future Directions ...... 98

5.1 Introduction: Scope of work ...... 98

5.2 Future directions ...... 99

5.2.1 In vivo reconstitution with phosphomimetic ITCH ...... 99

5.2.2 IKK and IKK-related Kinase phosphorylation of other CWD ubiquitin ligases ...... 99 iii

5.2.3 UbcH7 point mutation to chemically accommodate phosphoITCH S687 ...... 102

5.2.4 NDFIP1 recovery of phosphoITCH Ubiquitin ligase activity ..... 105

5.3 Therapeutic implications ...... 107

5.3.1 Targeting the ubiquitin system for inhibition ...... 108

5.3.2 Phosphorylation of an E3 ligase to inhibit binding of an E2 ...... 109

5.4 Closing remarks ...... 111

5.5 Works cited in this chapter ...... 112

Bibliography ...... 123

List of Tables

Table 5.1 Potential UbcH7 Mutants to accommodate binding to phosphoITCH 103

List of Figures

Figure 1.1 The IKK complex is a central innate immune signaling hub ...... 7

Figure 1.2 Approach to identify novel IKK substrates ...... 11

Figure 2.1 Domain structure of the CWD family of ubiquitin ligases ...... 26

Figure 2.2 A simplified schematic of the HECT E3 ubiquitin ligase cascade ...... 29

Figure 2.3 Overview of ubiquitin chain linkages ...... 32

Figure 3.1 Graphical Abstract ...... 41

Figure 3.2 ITCH Is a Novel Substrate of IKKs ...... 52

Figure 3.2 ITCH Is a Novel Substrate of IKKs (continued) ...... 53

Figure 3.2.1 Production of recombinant ITCH and requirement of NEMO for ITCH

phosphorylation...... 55

Figure 3.3 ITCH Is Phosphorylated on Ser 687 ...... 57

Figure 3.3 ITCH Is Phosphorylated on Ser 687 (continued) ...... 58

Figure 3.4 Ubiquitin Ligase Activity and Downstream Signaling Is Modulated in

ITCH S687D Phosphomimetic Mutant ...... 61

Figure 3.4 Ubiquitin Ligase Activity and Downstream Signaling Is Modulated in

ITCH S687D Phosphomimetic Mutant (continued) ...... 62

Figure 3.4.1 ITCH S687D has impaired ubiquitin ligase activity utilizing

endogenous ubiquitin ...... 63

Figure 3.4.2 Changes in S13 and the C2 domain do not affect ITCH

ubiquitination activity ...... 64

Figure 3.5 Loss of TNFR1 partially complements the inflammatory phenotype in

ITCH−/− mice ...... 68

Figure 4.1 Phosphorylation disrupts UbcH7 Binding...... 86

Figure 4.1.1 HECT domains and UbcH7 were purified for SPR ...... 88

Figure 4.2 UbcH7 deficiency phenocopies ITCH phosphorylation...... 91

Figure 5.2 F63H recovers RIP2 ubiquitination by ITCH S687D ...... 104

Figure 5.3 NDFIP1 recovers ITCH binding and ubiquitination to UbcH7 ...... 106

vii

Acknowledgements I am especially thankful to Dr. Derek Abbott. Derek’s role in my professional growth goes well beyond the bench. I thank him for his guidance, his time, his patience, and his unique brand of mentorship. I thank him for providing a lab environment that fostered intellectual freedom and learning. Finally, I appreciate the example Derek set as a well-rounded mentor. He is passionate about science and has an entrepreneurial spirit. Derek, thank you for letting me be a part of your lab. I thank the members of my thesis committee for their curiosity, their time, and their expertise. I thank Dr. George Dubyak for facilitating the graduate process for myself, and for many of my peers. Because his contributions to the biomedical scientific community continue to radiate outward in such a synergistic and positive manner, I hold him in very high regard. I sincerely thank Dr. Clive Hamlin, Dr. Xiaoxia Li, Dr. Theresa Pizarro, Dr. Pamela Wearsch, and Dr. Brian Cobb. I offer many thanks to Dr. Sam Xiao and the Xiao Lab for their expertise in recombinant protein synthesis and structural analysis. I thank Dr. Param Ramakrishnan, for his thoughtful comments at lab meeting and mentoring advice. And I thank all for sharing their lab space and reagents. To the Abbott Lab: Thank you. I have a lot to be grateful for: To Justine, for my early training; to Janice, for her endless support; to Steven, for bringing better techniques to the lab; and to Joseph, for restoring my faith in humanity. To Sylvia: Thank you for taking care of us! You all have been a joy to be around! I thank all of my classmates and the friends I’ve made along the way— some lost, most gone, but none forgotten. I thank my loving husband Mitch, for his unfaltering support and encouragement. I have been the grateful recipient of his listening ears, his thoughtful perspective, and his delicious home cooking. I have much gratitude for my new family, for believing in me and for providing me immediate tools to succeed—specifically Kira, who became the crux of my support team via mail-to-order food. I thank my parents for teaching me the value of hard work and persistence. I thank them for the sacrifices they made to give me a good life. I thank my brother for keeping me humble and being a constant reminder of what it means to have good work ethic. I thank Case Western Reserve University for providing the infrastructure for my higher learning. Many thanks to those individuals that keep us from falling through the cracks: Christine Kehoe, Susan Brill, Mary Merat, Corrie Zimmerla. Thank you all for handling the complicated details. This work would not have been possible without the following NIH financial support: NRSA (F31 GM108403-03), CMBTraining Grant (T32GM008056-32).

viii

List of Abbreviations BSA bovine serum albumin CARD Caspase activation and recruitment domains CWH C2-WW-HECT DMEM Dulbecco's Modified Eagle Medium DMSO dimethyl sulfoxide DUB Deubiquitinating enzyme E1 Ubiquitin activating enzyme E2 Ubiquitin conjugating enzyme E3 Ubiquitin protein ligase E6-AP E6 Associated Protein EDTA ethylenediaminetetraacetic acid ENaC Epithelial Na+ Channel EOS Early Onset Sarcoidosis FCS fetal calf serum GM-CSF granulocyte–macrophage colony-stimulating factor GST Glutathione S-Transferase H&E hematoxylin and eosin HECT Homologous to E6-AP C-terminus HEK 293T Human Embryonic Kidney cells expressing the large T- antigen of simian virus 40 HRP horseradish peroxidase IκB inhibitor of Nuclear Factor - kappa B IKK I kappa B Kinase IFN-γ Interferon gamma IP Immunoprecipitation IPTG isopropyl β-D-thiogalactopyranoside Kd dissociation constant MS mass spectrometry Nedd Neuronal Precursor Cell-Expressed Developmentally Downregulated NEMO NF-κB Essential Modulator (IKKγ) NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells NOD2 Nucleotide-binding oligomerization domain-containing protein 2 Ni-NTA nickel-nitrilotriacetic acid PAGE Polyacrylamide Gel Electrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PD Pull-down PDB Protein Data Bank pen-strep penicillin-streptomycin PMSF phenyl methyl sulfonyl fluoride PRR pattern recognition receptor PRR proline-rich region ix

RING Really Interesting New Gene RIPK Receptor Interacting Protein Kinase RNA ribonucleic acid RT-PCR reverse transcription polymerase chain reaction SDS sodium dodecyl sulfate SEM standard error of the mean siRNA small interfering RNA Smurf Smad ubiquitin regulatory factor SPR surface plasmon resonance Ub ubiquitin Ubc Ubiquitin conjugating enzyme (E2) WT wild-type WW domain protein–protein interaction domain containing two conserved tryptophan residues

Phosphorylation and Mechanistic Regulation of a Novel IKK Substrate, ITCH

Abstract

JESSICA MARIE PEREZ

Dynamic ubiquitination and phosphorylation are crucial in tuning immune cell homeostasis. This is most evident in genetic inflammatory disease, where a single gene, such as NOD2, can have gain or loss of function in signaling to NF-

κB. Both result in a granulomatous inflammatory disease. Polymorphisms in

NOD2 have long been implicated in Crohn’s disease, Early Onset Sarcoidosis, and Blau Syndrome. To better understand immune signaling in inflammation, we examine kinase subunits of the major innate immune signaling hub, the IκB

Kinase (IKK) Signalosome. The kinase subunits within the IKK Signalosome,

IKKα and IKKβ, relay inflammatory inputs from cytokine receptors, ER stress receptors, and pathogen recognition receptors, alike. Upon activation, IKKs not only phosphorylate members of the IκB (Inhibitor of NF-κB) family to activate Rel- homology transcription factors, but IKKs also have other protein substrates. For example, immuno-regulatory proteins such as deubiquitinases CYLD and A20 are IKK substrates whose activities are modulated by IKK phosphorylation. In an

effort to better understand the signaling contributions of IKKs, we employed a dual bioinformatic and proteomic approach. We used IKK phospho peptide array data in a bioinformatic search to find immune-regulatory proteins targeted by

IKKs. In this work, we narrow the candidate search to a family of HECT E3 ubiquitin ligases, and as the focus of this work, we identify ITCH as a novel substrate of the IKKs. Nothing was previously known about the function or consequence of IKK-phosphorylation on this HECT E3 ubiquitin ligase. Here, we discover a site of IKK phosphorylation on ITCH that lies within the enzymatic

HECT ubiquitin ligase domain of the protein. Specifically, the site of phosphorylation is within the E2:E3 interaction domain. We use this insight to examine the functional mechanism of impairment using SPR to detect differences in binding. Here, I present evidence supporting a model in which IKKs phosphorylate ITCH to impair ubiquitin ligase activity on target inflammatory cell signaling substrates by blocking E2:E3 interaction to result in a prolonged inflammatory response. Overall, the work presents further understanding of how organisms can alter attenuators of inflammation to respond to pathogen load and prolong an inflammatory response.

xii

Chapter 1: Introduction

1.1 Introduction

Underlying a healthy immune system is an intact repertoire of signaling and regulatory proteins to keep inflammation in check. The host immune response must be timely and robust to clear pathogens, but tightly regulated to limit damage to self. Polymorphisms of receptor-signaling or regulatory-attenuator molecules can contribute to the development of chronic inflammatory disease.

This chapter examines two chronic granulomatous diseases: Late Onset

Sarcoidosis (hereafter sarcoidosis) and Blau Syndrome (BS). While sarcoidosis is thought to be environmentally triggered and predisposed by genetics, Blau syndrome is more strongly linked to polymorphisms in a single gene. Both diseases, however, have disease pathogenesis that has been linked NOD2, a receptor signaling protein (1,2). A common outcome in either case is aberrant

NF-κB activation and granuloma formation in various tissues of the human body.

1.2 Sarcoidosis pathophysiology and treatment

Sarcoidosis is a multi-systemic chronic granulomatous disorder that can affect multiple tissues in the body such as spleen, bone marrow, skin, eye, liver, salivary glands, or muscle, but most commonly manifests in mediastinal lymph nodes and the lung interstitium(3). Granulomas occur in the absence of infection and are characteristically non-necrotic. Cells encompassing the granuloma include (but are not limited to) macrophages, monocytes, lymphocytes, epithelioid cells, fibroblasts, and multinucleated giant cells(4). At the center of the 1

granuloma, multinucleated giant cells are surrounded by tightly-clustered, oblong, epithelioid cells that produce large amounts of tumor necrosis factor α (TNF-α), among other cytokines.

Granulomas in lung tissue contain alveolar macrophages that spontaneously secrete TNFα, IL-1, IL-6, IL-8 chemokine CCL3, and RANTES(5,6). TNF-α and

IL-1 maintain activation of the cells that form the granuloma, while CCL3 and

RANTES draw in CD4+ T cells and monocytes. The CD4+ T cells expand oligoclonally and become Th1 effector cells. These T cells generally remain in the periphery of the granuloma, proliferate, and produce IL-2 and IFNγ(5-7). CD8+ T cells are also present, but in lower ratios than CD4+ T cells. If the inflammation from a granuloma does not spontaneously resolve, disease progresses as fibrosis. Rims of fibroblasts encapsulate the granulomas(5). Contribution of fibrosis may be further driven by Th17 T cells, which can be found in the bronchoalveolar lavage (BAL) fluid and peripheral blood of sarcoidosis patients(8). Depending on which tissues have been affected by granulomas, patients may present with enlarged, calcified lymph nodes, flattened, scaly erythematous lesions on skin, loss of vision, splenomegaly, or hepatomegaly.

Symptoms with lung involvement are shortness of breath, cough, and chest pain.

Fever, fatigue, and weight loss are also generally common(6).

Increasing evidence implicates both environmental factors and genetics in the development of sarcoidosis(1,9,10). Exposure to agents such as beryllium(6), inorganic powder used in the rubber industry(9), silica, and silica fibers(11) have been documented as trigger agents in some cases of sarcoidosis and sarcoid-

like presentation. Notably, first responders from the September 11th World Trade

Center disaster that had been working on the building debris pile have had an increased incidence in developing sarcoidosis(12). Biological agents such as pathogenic mycobacteria, commensal Propionibacterium acnes, or Rickettsia species are suspected to have a role in some cases of sarcoidosis(6).

In terms of genetic factors, one candidate gene that has been linked to and evaluated in sarcoidosis is TNF-α(10). Polymorphisms within the promoter region of this gene foster increased production of TNF-α and have been linked to individuals with sarcoidosis(13). Furthermore, sarcoid granulomas produce increased amounts of TNF-α and IL-1(14). TNF-α is also crucial for granuloma formation in the context of pathogenic infection(15,16). Thus, an abundance of

TNF-α in patients with the promoter polymorphism would be more likely promote and maintain granuloma formation even in the absence of pathogen. In patients with sarcoidosis, TNF-α-secreting macrophages can recruit more inflammatory cells, which accelerates the disease state(5). The result is a feed-forward inflammatory microenvironment that draws in and activates more T cells and monocytes. A common treatment for sarcoidosis includes a regimen of corticosteroids, which function to block the production of TNF. TNF-receptor- blocking therapies such as Infliximab have also been used to successfully treat sarcoidosis(17,18).

HLA type and polymorphism status of CCR5 and NOD2 have also been implicated in the predisposition to development of sarcoidosis(1,10). Remarkably,

NOD2 is an intracellular pattern recognition receptor (PRR) with roles in

detecting a small cell wall breakdown product, muramyl dipeptide(19). Both pathogen and commensal bacteria, alike, have cell walls that are made up of a repeat-polymer structure of peptide-sugar called peptidoglycan. Muramyl dipeptide is a breakdown product of peptidoglycan, and is thus present upon infection with intracellular mycobacteria or complications with Propionibacterium acnes, which is usually commensal(20). This is notable for 2 reasons: 1. In the setting of sarcoidosis, NOD2 polymorphisms may be contributing to a predisposed over-activation to a commensal of NOD2 signaling. 2. In comparison to the etiological unknown that is sarcoidosis, where there are multiple genes or environmental agents conferring disease susceptibility, Blau Syndrome/Early

Onset Sarcoidosis (BS/EOS) has been strongly linked to gain of function polymorphisms in NOD2.

1.3 Blau Syndrome is a NOD2-associated disorder

Familial BS and sporadic EOS (now both referred to as BS) are genetic inflammatory disorders in which patients present with a characteristic triad of symptoms early in life: arthritis, uveitis, and a papular, erythematous skin rash(21). Patients are often young at first signs of symptoms and skin rash is most frequently the first symptom to appear. BS can affect liver, brain, lung, and heart(21). Compared to the pathophysiology of the sarcoidosis granuloma, the

Blau syndrome granuloma mainly differs in the age of onset, the particularity of the tissues affected, and the apparent absence of triggering agents. The center of the granuloma is populated with some multinucleated giant cells surrounded

by a non-caseating/non-necrotic group of epithelioid cells, and peripheral recruitment and involvement of Th 1/Th 17 T cells(22). Similar cytokine production and signaling also occurs within the BS granuloma.

Depending on affected tissues and patient prognosis, treatment may include methotrexate or a TNF-blocking biological reagent such as etenercept to control inflammation(23). Signaling defects in EOS and Blau Syndrome have been traced to polymorphisms within Nucleotide-binding oligomerization domain- containing protein 2 (NOD2)(2). With regard to Crohn’s disease, BS and EOS are similar in that not all patients with the polymorphisms in NOD2 acquire BS or

EOS, and not all EOS or BS patients have polymorphic alleles. However, it is notable that genetic NOD2 mutations within the NACHT domain may promote susceptibility to later develop Sarcoidosis. Some sarcoidosis patients with aggressive lung involvement were found to possess characteristic NOD2 polymorphisms(1).

1.4 NOD2 signaling

The NOD2 intracellular pattern recognition receptor (PRR) features two N- terminal CARD domains, a central NACHT oligomerization domain, and a C- terminal MDP-sensing region made up of leucine rich repeats (LRR). Upon detection of MDP by the C-terminal LRRs(19), NOD2 opens in conformation to form a NOD2-Rip2 complex via CARD domain interaction(24,25). Inhibitor of

Apoptosis proteins (IAP), cIAP1/2 or XIAP, directly ubiquitinate RIP2(26) for recruitment and activation of the TAB2/3 TAK1 kinase complex(27). Once 5

activated, transforming growth factor β activated kinase-1 (TAK1) can promote activation of the canonical the IκB Kinase (IKK) complex(28). TAK1 is thought to prime IKKβ for autophosphorylation, and thus activation(29).

NOD2-Rip2 signaling is just one of many pathways that converge upon the IKK complex. Canonical NF-κB signaling is initiated through a gamut of intra- and extracellular signals that also converge upon the IKK complex. Other signals that converge upon the IKK complex are derived from TNF, IL-1, TLR-4, and T cell receptors (TCR) (30,31). Similar to NOD2 signaling, activated receptor complexes form as adapter proteins and E3 ligases are recruited. In particular,

E3 ligases, TRAF2, TRAF6, and Linear Ubiquitin Chain Assembly Complex

(LUBAC) form proinflammatory ubiquitin scaffold structures that promote IKK

Complex activation(32).

1.5 IκB Kinase Activation

The canonical IKK complex consists of two kinases, IKKα and IKKβ, held together by the scaffolding protein, NF-κB Essential Modulator (NEMO). NEMO’s

Ubiquitin binding domains (UBD) localize the complex to signaling scaffold centers in the cytoplasm(32). While NEMO itself lacks kinase activity, NEMO’s

UBD is required for IKKβ phosphorylation of IκBα, and thus, activation of NF-κB

(Figure 1.1). Once IKKβ is primed and activated, NEMO directs IKKβ’s kinase

Figure 1.1 The IKK complex is a central innate immune signaling hub

Shown is a simplified schematic presenting the IKK complex as the central innate immune signaling hub. A myriad of signaling pathways stimulated by cytokines, pathogen recognition receptors, stress response receptors and others all converge onto the IKK Complex. Once activated, IκBα is phosphorylated and degraded. NF-κB can then localize to the nucleus and promote transcriptional reprogramming. The focus of this work is to identify alternate novel substrates.

activity at Inhibitor of NF-κB (IκBα)(33,34). IκBα is subsequently ubiquitinated and degraded by the proteasome, allowing release of NF-κB to translocate into the nucleus where it can promote the transcription of survival and inflammatory genes.

Non-canonical NF-κB signaling is initiated by ligands that stimulate other family members of the TNF Receptor superfamily stimuli. These include receptors such as BAFF, CD40L and Lymphotoxin β. Activation of these receptors leads to NIK Kinase activation and subsequent phosphorylation of

IKKα dimers(35). As canonical signaling activates Rel-homology proteins NF-κB1 and NF-κB2, the non-canonical pathway leads to p100 processing to p52 for dimerization with RelB(36). Ultimately this type of signaling promotes the process of lymphoid organogenesis and other B cell functions.

While IKKs are most known for their roles in phosphorylation of IκBs, they can also modulate activity of other proteins, both in and out of the NF-κB transcriptional activation pathway. For example, A20 and CYLD are deubiquitinases, that are phosphorylated by IKKβ and IKKε, respectively(37,38).

Normally, A20 is a potent attenuator of NF-κB and viral proinflammatory signaling(39). CYLD also has roles in inhibiting NF-κB and MAPK signaling(40).

IKK phosphorylation blocks activity on both of these enzymes(37,38). TRAF4, an atypical TRAF family member is conversely activated by IKKα phosphorylation(41). Once phosphorylated, TRAF4 is able to inhibit NOD2 signaling(42). IKKs also phosphorylate substrates outside of NF-κB signaling. For instance, IKKβ phosphorylates Nedd4-2(43). Nedd4 ubiquitin ligase activity is

inhibited, and ultimately results in a lower expression of epithelial Na+ channel

(ENaC) on the cellular membrane(43). ENaC modulation is necessary for regulating bodily salt and water homeostasis. IKKβ phosphorylation on other

Nedd4-like E3 ligases was also shown to affect the stability of angiomotin

(AMOT) (44), a protein whose roles in angiogenesis, cell polarity and cell migration extend to effects on organ size and stem cell renewal(44).

1.6 Hypothesis and approach

IKKs may have several other undiscovered substrates capable of modulating cellular activity. Given the role of IKKs outside of NF-κB activation, we hypothesize that IKK overactivation may be directly contributing to the aggravated inflammatory lung phenotype in patients with sarcoidosis. In this study, we sought to identify a potential candidate substrate whose signaling could account for the relationship between upregulated IKKs and an aggravated lung

Sarcoidosis phenotype.

Increasing evidence implicates both genetic and environmental factors in the development of sarcoidosis. Another candidate gene that has been linked to and evaluated in this genetic granulomatous disorder is tumor necrosis factor α (TNF-

α)(33). Polymorphisms within the promoter region of this gene foster increased production of TNF-α and have been linked to individuals with sarcoidosis(34).

Furthermore, sarcoid granulomas produce increased amounts of TNF-α and IL-

1(35). TNF-α is also crucial for granuloma formation in the context of pathogenic infection(36,37). 9

In patients with sarcoidosis, TNF-α-secreting macrophages can recruit more inflammatory cells, which accelerates the disease state (38). A common treatment for sarcoidosis included a regimen of corticosteroids, which functioned to block the production of TNF. It reasons that TNF-receptor-blocking therapy such as Infliximab could also treat non-responsive cases of sarcoidosis(39,40). It follows that there is potential for a relationship between over-production of TNF-α in the Sarcoid inflammatory state, which leads to chronic IKK activation, and thus, phosphorylation of one or many unknown IKK substrates that aggravate lung inflammation.

Our approach to identify novel IKK substrates was to first determine the optimal sequence motif(45). An IKK peptide array was performed using a synthetic library of degenerate peptides (Figure 1.2). A more detailed account of this methodology is presented in Chapter 3. Briefly, a library of peptide substrates was generated to the following specifications: N-terminal hydrophobic residues, a fixed-position amino acid, a central S/T phospho-acceptor and a C-terminal biotin tag (Figure 1.2). Peptides were grouped per amino acid at each fixed position flanking the fixed phospho-acceptor. Recombinant purified kinase was incubated with each peptide group in a 32P kinase assay. Samples were arranged by group and bound to a Streptavidin capture membrane for thorough washing.

Streptavidin capture membranes were exposed to a phosphor-imaging screen and quantified. Signal intensity served to indicate kinase preference for a particular amino acid at a particular fixed position. The same process was performed with dead kinases as a control for nonspecific binding. These data

Figure 1.2 Approach to identify novel IKK substrates

A template-based library of degenerate peptides was synthesized (A. and B.) and subjected to a 32P Kinase assay (C.). Samples were arranged by group and bound to a Streptavidin capture membrane for thorough washing (B.). The 11

Streptavidin capture membrane was exposed to a phosphor-imaging screen and quantified (C.). Matrix data was then used to identify the optimal phospho-motif and produce the following: positional scanning motif scan (not shown), a custom substrate antibody, and substrate phospho-mimetic mutant constructs (D.).

were collected between Hutti et al. and Marinis et al.(37,41,46). Once phospho- motif data was acquired, we were able to input the matrix motif data into a proteomic search tool, ScanSite(47). Considering that the optimal phosphorylation motif is not a fixed sequence, but rather a motif, and also that there can be multiple sites within a protein, the number of results for peptides containing an optimal protein phospho-motif can be overwhelming. Use of the

ScanSite filter features aided in narrowing the results. We sought proteins linked to inflammation. For the work in this dissertation, a mouse polyclonal antibody was custom-generated against the phospho-motif sequence: F/Y/M-x-S-L/I/M.

1.7 Dissertation Rationale

Although the approaches for treatment are becoming more geared toward our cell and molecular understandings of sarcoidosis and its underlying genetics, the current therapeutic options for sarcoidosis and BS still have many side effects.

Long-term use of corticosteroids can lead to thinning skin, complications with glucose metabolism, massive edema, and delayed wound healing. Anti-TNF treatment has been found to cause psoriasiform eruptions and hypercoaguability/thrombogenicity(48,49). A better understanding of the mechanisms that underlie chronic inflammatory disorders is paramount to finding effective treatments with the lowest risk to benefit ratios for sarcoidosis and other genetic inflammatory diseases.

Given that IKKs become activated upon PRR, NLR, cytokine, and UPR stimulation, identifying novel IKK substrates is a key step in understanding IKK 13

contributions in inflammatory disease. Knowing the cellular processes of inflammation can reveal clinical targets for therapeutic gain. While IKKs serve as the major signaling hub for NF-κB and other Rel-homology transcription factors, their roles as kinases targeting other proteins have not been exhausted.

Delineating the network of regulatory components in NF-κB signaling is a necessary step in identifying potential pharmacological targets for BS, EOS, and

Sarcoidosis. Assessing the therapeutic implications of direct TNFR disruption could yield more specific therapeutic targets or biomarkers for a distinct subset of sarcoidosis patients.

1.7 Specific questions addressed

The purpose of my dissertation work was to investigate the immunomodulatory effects of IKK phosphorylation on ITCH, and determine the mechanism of signaling change upon phosphorylation. I specifically addressed the following questions in my studies:

Chapter 2

How might ITCH contribute to Blau Syndrome or Sarcoidosis?

Chapter 3

Is ITCH a substrate of the IKKs and IKK-Related Kinases?

Which of the IKKs and IKK-Related Kinases phosphorylate ITCH?

Is ITCH ligase activity required for phosphorylation?

Which ITCH residue is phosphorylated by IKK?

Does phosphorylation have activating or inactivating effects on ITCH?

Does deletion of TNFR1 prolong survival of ITCH-/- mice?

Does deletion of TNFR1 diminish the inflammatory phenotype in

ITCH-/- mice?

Chapter 4

What is the mechanism of phospho-ITCH inhibition?

Does phospho-ITCH bind cognate E2 enzyme UbcH7?

Which amino acids are being disrupted?

Chapter 5

Can the ITCH activator, NDFIP1, compensate for phospho-ITCH loss of

binding to UbcH7?

Can NDFIP1 recover phospho-ITCH ubiquitin ligase activity?

What are the therapeutic implications of this study?

In brief, we identified ITCH as a novel IKK substrate. Activated IKKs phosphorylate ITCH within a highly conserved residue of the HECT domain, allowing extended inflammatory state. We characterized the site of phosphorylation as regulatory, and we determined that the mechanism of

inhibition was disruption of E2-E3 binding. The phosphorylation occurs in the context of inflammation and thus promotes a prolonged inflammatory state. In

Chapter 5 I provide concluding remarks and future directions.

1.8 Works cited in this chapter

1. Sato, H., Williams, H. R., Spagnolo, P., Abdallah, A., Ahmad, T., Orchard, T.

R., Copley, S. J., Desai, S. R., Wells, A. U., du Bois, R. M., and Welsh, K. I.

(2010) CARD15/NOD2 polymorphisms are associated with severe pulmonary

sarcoidosis. The European respiratory journal 35, 324-330

2. Okafuji, I., Nishikomori, R., Kanazawa, N., Kambe, N., Fujisawa, A.,

Yamazaki, S., Saito, M., Yoshioka, T., Kawai, T., Sakai, H., Tanizaki, H., Heike,

T., Miyachi, Y., and Nakahata, T. (2009) Role of the NOD2 genotype in the

clinical phenotype of Blau syndrome and early-onset sarcoidosis. Arthritis and

rheumatism 60, 242-250

3. de Boer, S., and Wilsher, M. (2010) Review series: Aspects of interstitial lung

disease. Sarcoidosis. Chronic respiratory disease 7, 247-258

4. Soler, P., and Basset, F. (1976) Morphology and distribution of the cells of a

sarcoid granuloma: ultrastructural study of serial sections. Annals of the New

York Academy of Sciences 278, 147-160

5. Müller-Quernheim, J. (1998) Sarcoidosis: immunopathogenetic concepts and

their clinical application. European Respiratory Journal 12, 716-738

6. Robbins, S. L., Kumar, V., and Cotran, R. S. (2010) Robbins and Cotran

pathologic basis of disease, 8th ed., Saunders/Elsevier, Philadelphia, PA

7. Zissel, G., Prasse, A., and Muller-Quernheim, J. (2010) Immunologic

response of sarcoidosis. Seminars in respiratory and critical care medicine

31, 390-403 17

8. Facco, M., Cabrelle, A., Teramo, A., Olivieri, V., Gnoato, M., Teolato, S., Ave,

E., Gattazzo, C., Fadini, G. P., Calabrese, F., Semenzato, G., and Agostini, C.

(2011) Sarcoidosis is a Th1/Th17 multisystem disorder. Thorax 66, 144-150

9. Erdal, B. S., Clymer, B. D., Yildiz, V. O., Julian, M. W., and Crouser, E. D.

(2012) Unexpectedly high prevalence of sarcoidosis in a representative U.S.

Metropolitan population. Respiratory medicine 106, 893-899

10. Iannuzzi, M. C. (2007) Genetics of sarcoidosis. Seminars in respiratory and

critical care medicine 28, 15-21

11. Leli, I., Salimbene, I., Varone, F., Fuso, L., and Valente, S. (2013) Husband

and wife with sarcoidosis: possible environmental factors involved.

Multidisciplinary respiratory medicine 8, 5

12. Crowley, L. E., Herbert, R., Moline, J. M., Wallenstein, S., Shukla, G.,

Schechter, C., Skloot, G. S., Udasin, I., Luft, B. J., Harrison, D., Shapiro, M.,

Wong, K., Sacks, H. S., Landrigan, P. J., and Teirstein, A. S. (2011) "Sarcoid

like" granulomatous pulmonary disease in World Trade Center disaster

responders. American journal of industrial medicine 54, 175-184

13. Seitzer, U., Swider, C., Stuber, F., Suchnicki, K., Lange, A., Richter, E., Zabel,

P., Muller-Quernheim, J., Flad, H. D., and Gerdes, J. (1997) Tumour necrosis

factor alpha promoter gene polymorphism in sarcoidosis. Cytokine 9, 787-790

14. Agostini, C., and Semenzato, G. (1998) Cytokines in sarcoidosis. Seminars in

respiratory infections 13, 184-196

15. Kindler, V., Sappino, A. P., Grau, G. E., Piguet, P. F., and Vassalli, P. (1989)

The inducing role of tumor necrosis factor in the development of bactericidal

granulomas during BCG infection. Cell 56, 731-740

16. Amiri, P., Locksley, R. M., Parslow, T. G., Sadick, M., Rector, E., Ritter, D.,

and McKerrow, J. H. (1992) Tumour necrosis factor alpha restores

granulomas and induces parasite egg-laying in schistosome-infected SCID

mice. Nature 356, 604-607

17. Yee, A. M., and Pochapin, M. B. (2001) Treatment of complicated sarcoidosis

with infliximab anti-tumor necrosis factor-alpha therapy. Annals of internal

medicine 135, 27-31

18. Ulbricht, K. U., Stoll, M., Bierwirth, J., Witte, T., and Schmidt, R. E. (2003)

Successful tumor necrosis factor alpha blockade treatment in therapy-

resistant sarcoidosis. Arthritis and rheumatism 48, 3542-3543

19. Girardin, S. E., Boneca, I. G., Viala, J., Chamaillard, M., Labigne, A., Thomas,

G., Philpott, D. J., and Sansonetti, P. J. (2003) Nod2 is a general sensor of

peptidoglycan through muramyl dipeptide (MDP) detection. The Journal of

biological chemistry 278, 8869-8872

20. McCaskill, J. G., Chason, K. D., Hua, X., Neuringer, I. P., Ghio, A. J.,

Funkhouser, W. K., and Tilley, S. L. (2006) Pulmonary immune responses to

Propionibacterium acnes in C57BL/6 and BALB/c mice. American journal of

respiratory cell and molecular biology 35, 347-356

21. Becker, M. L., and Rose, C. D. (2005) Blau syndrome and related genetic

disorders causing childhood arthritis. Current rheumatology reports 7, 427-

433

22. Wouters, C. H., Maes, A., Foley, K. P., Bertin, J., and Rose, C. D. (2014) Blau

syndrome, the prototypic auto-inflammatory granulomatous disease. Pediatric

rheumatology online journal 12, 33

23. Nigrovic, P. Periodic fever syndromes and other autoinflammatory diseases:

An overview. in UpToDate (Post, T. ed.), UpToDate,Waltham, MA. (Accessed

on August 21, 2017). pp

24. Abbott, D. W., Wilkins, A., Asara, J. M., and Cantley, L. C. (2004) The Crohn's

disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a

novel site on NEMO. Current biology : CB 14, 2217-2227

25. Maekawa, S., Ohto, U., Shibata, T., Miyake, K., and Shimizu, T. (2016) Crystal

structure of NOD2 and its implications in human disease. Nature

communications 7, 11813

26. Krieg, A., Correa, R. G., Garrison, J. B., Le Negrate, G., Welsh, K., Huang, Z.,

Knoefel, W. T., and Reed, J. C. (2009) XIAP mediates NOD signaling via

interaction with RIP2. Proceedings of the National Academy of Sciences of

the United States of America 106, 14524-14529

27. Hasegawa, M., Fujimoto, Y., Lucas, P. C., Nakano, H., Fukase, K., Nunez, G.,

and Inohara, N. (2008) A critical role of RICK/RIP2 polyubiquitination in Nod-

induced NF-kappaB activation. The EMBO journal 27, 373-383 20

28. Adhikari, A., Xu, M., and Chen, Z. J. (2007) Ubiquitin-mediated activation of

TAK1 and IKK. Oncogene 26, 3214-3226

29. Zhang, J., Clark, K., Lawrence, T., Peggie, M. W., and Cohen, P. (2014) An

unexpected twist to the activation of IKKbeta: TAK1 primes IKKbeta for

activation by autophosphorylation. The Biochemical journal 461, 531-537

30. Verstrepen, L., Bekaert, T., Chau, T. L., Tavernier, J., Chariot, A., and Beyaert,

R. (2008) TLR-4, IL-1R and TNF-R signaling to NF-kappaB: variations on a

common theme. Cellular and molecular life sciences : CMLS 65, 2964-2978

31. Blonska, M., and Lin, X. (2011) NF-kappaB signaling pathways regulated by

CARMA family of scaffold proteins. Cell research 21, 55-70

32. Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M., Suzuki, N., Kato, R.,

Kensche, T., Uejima, T., Bloor, S., Komander, D., Randow, F., Wakatsuki, S.,

and Dikic, I. (2009) Specific recognition of linear ubiquitin chains by NEMO is

important for NF-kappaB activation. Cell 136, 1098-1109

33. Schrofelbauer, B., Polley, S., Behar, M., Ghosh, G., and Hoffmann, A. (2012)

NEMO ensures signaling specificity of the pleiotropic IKKbeta by directing its

kinase activity toward IkappaBalpha. Molecular cell 47, 111-121

34. Clark, K., Nanda, S., and Cohen, P. (2013) Molecular control of the NEMO

family of ubiquitin-binding proteins. Nature reviews. Molecular cell biology 14,

673-685

35. Qing, G., Qu, Z., and Xiao, G. (2005) Stabilization of basally translated NF-

kappaB-inducing kinase (NIK) protein functions as a molecular switch of

processing of NF-kappaB2 p100. The Journal of biological chemistry 280,

40578-40582

36. Hayden, M. S., and Ghosh, S. (2008) Shared principles in NF-kappaB

signaling. Cell 132, 344-362

37. Hutti, J. E., Turk, B. E., Asara, J. M., Ma, A., Cantley, L. C., and Abbott, D. W.

(2007) IkappaB kinase beta phosphorylates the K63 deubiquitinase A20 to

cause feedback inhibition of the NF-kappaB pathway. Molecular and cellular

biology 27, 7451-7461

38. Hutti, J. E., Shen, R. R., Abbott, D. W., Zhou, A. Y., Sprott, K. M., Asara, J. M.,

Hahn, W. C., and Cantley, L. C. (2009) Phosphorylation of the tumor

suppressor CYLD by the breast cancer oncogene IKKepsilon promotes cell

transformation. Molecular cell 34, 461-472

39. Wang, Y. Y., Li, L., Han, K. J., Zhai, Z., and Shu, H. B. (2004) A20 is a potent

inhibitor of TLR3- and Sendai virus-induced activation of NF-kappaB and

ISRE and IFN-beta promoter. FEBS letters 576, 86-90

40. Nikolaou, K., Tsagaratou, A., Eftychi, C., Kollias, G., Mosialos, G., and

Talianidis, I. (2012) Inactivation of the deubiquitinase CYLD in hepatocytes

causes apoptosis, inflammation, fibrosis, and cancer. Cancer cell 21, 738-750

41. Marinis, J. M., Hutti, J. E., Homer, C. R., Cobb, B. A., Cantley, L. C.,

McDonald, C., and Abbott, D. W. (2012) IkappaB kinase alpha 22

phosphorylation of TRAF4 downregulates innate immune signaling. Molecular

and cellular biology 32, 2479-2489

42. Marinis, J. M., Homer, C. R., McDonald, C., and Abbott, D. W. (2011) A novel

motif in the Crohn's disease susceptibility protein, NOD2, allows TRAF4 to

down-regulate innate immune responses. The Journal of biological chemistry

286, 1938-1950

43. Edinger, R. S., Lebowitz, J., Li, H., Alzamora, R., Wang, H., Johnson, J. P.,

and Hallows, K. R. (2009) Functional regulation of the epithelial Na+ channel

by IkappaB kinase-beta occurs via phosphorylation of the ubiquitin ligase

Nedd4-2. The Journal of biological chemistry 284, 150-157

44. Wang, C., An, J., Zhang, P., Xu, C., Gao, K., Wu, D., Wang, D., Yu, H., Liu, J.

O., and Yu, L. (2012) The Nedd4-like ubiquitin E3 ligases target

angiomotin/p130 to ubiquitin-dependent degradation. The Biochemical journal

444, 279-289

45. Hutti, J. E., Jarrell, E. T., Chang, J. D., Abbott, D. W., Storz, P., Toker, A.,

Cantley, L. C., and Turk, B. E. (2004) A rapid method for determining protein

kinase phosphorylation specificity. Nature methods 1, 27-29

46. Hutti, J. E., Porter, M. A., Cheely, A. W., Cantley, L. C., Wang, X., Kireev, D.,

Baldwin, A. S., and Janzen, W. P. (2012) Development of a high-throughput

assay for identifying inhibitors of TBK1 and IKKepsilon. PloS one 7, e41494

47. Obenauer, J. C., Cantley, L. C., and Yaffe, M. B. (2003) Scansite 2.0:

Proteome-wide prediction of cell signaling interactions using short sequence

motifs. Nucleic acids research 31, 3635-3641

48. Nguyen, K., Vleugels, R. A., Velez, N. F., Merola, J. F., and Qureshi, A. A.

(2013) Psoriasiform reactions to anti-tumor necrosis factor alpha therapy.

Journal of clinical rheumatology : practical reports on rheumatic &

musculoskeletal diseases 19, 377-381

49. Miyaoka, Y., Chan, A. H., Judge, L. M., Yoo, J., Huang, M., Nguyen, T. D.,

Lizarraga, P. P., So, P. L., and Conklin, B. R. (2014) Isolation of single-base

genome-edited human iPS cells without antibiotic selection. Nature methods

11, 291-293

Chapter 2: ITCH

Summary

This chapter introduces the candidate IKK substrate identified through our paired proteomic and bioinformatic approach described in Chapter 1. ITCH is classified within the C2-WW-HECT (CWH) domain-containing family of E3 ubiquitin ligases. In this review, we discuss the family’s common structural features, regulatory mechanisms, and enzymatic properties. We describe ubiquitin, and downstream signaling outcomes of ubiquitin chains. Here, ITCH is described within the context of its CWH Domain-Containing Ubiquitin ligase family members, and also as a unique protein with independent functions in the immune system. This is best illustrated by reviewing the inflammatory phenotype that occurs in ITCH deficiency. Finally, we conclude with the effects of ITCH on immune signaling pathways, and our rationale for investigating phosphorylation on this E3 ligase.

2.1 Introduction: C2-WW-HECT (CWH) family of E3 ubiquitin ligases

Members of the CWH family include: ITCH, Nedd4, WWP1, WWP2, Smurf1,

Smurf2, Nedd4-2, NedL-1 and NedL-2 (Figure 2.1). This group of enzymes is often described by their common domain structures: an N-terminal C2 domain, 2-

4 central WW domains, and a C-terminal HECT domain(1).

Figure 2.1 Domain structure of the CWD family of ubiquitin ligases

Common features of this family include an N-terminal C2 domain, 2 to 4 WW domains, and a C-terminal HECT ubiquitin ligase domain.

2.1.1 C2 domains

In general, C2 domains are protein modules that bind phosphatidyl serine in a

Ca2+-dependent manner(2). Consistently, the ITCH C2 domain is required for endosome localization(3), but the C2 domains of Nedd4 and Smurf2 are thought to serve autoinhibitory functions(4).

2.1.2 WW domains

WW domains are small modules that contain two conserved tryptophan residues flanking a consensus sequence, spaced 20-22 amino acids apart(5).

They mediate binding to proline-rich regions (PRRs) on substrates. Analysis of

WW domain recognition revealed that the CWH-WW domains had a proclivity for

P-P-x-Y-containing peptides(5). Once an interacting protein is selected, CWH ubiquitin ligases can covalently link ubiquitin to their target substrates. The HECT domain confers this ubiquitin ligase activity.

2.1.3 HECT domains

Termed HECT (Homologous to E6-AP Carboxyl-Terminus), the nomenclature of this domain references E6-AP, a mammalian protein encoded by the UBE3A gene. E6-AP is one of 28 HECT E3 ubiquitin ligases. Specifically, E6-AP gets its name from associating with E6 proteins from Human Papilloma Virus (HPV)(6).

Because high risk strains of HPV are the major causal agent of cervical cancer,

E6-AP was named after its tendency to associate with HPV E6(6). In a landmark series of papers, Scheffner, et al. showed that E6- Associated Protein formed a complex with p53 and stimulated p53 degradation to promote oncogenesis(6,7).

Other groups investigated the binding contributions of residues required for

HECT enzymatic activity(8,9). While E6AP does not possess C2 domains or WW domains, many key residues, and their contributions to interacting with E2 conjugating enzymes are conserved across most HECT domains.

2.2 Ubiquitin and ubiquitination

Ubiquitin is a 76-amino acid protein modifier that can be covalently linked to the ε carbon of lysine residues on target substrates. In general, an E1 enzyme activates the C-terminal glycine of ubiquitin. The ubiquitin is passed to an E2 conjugating enzyme, and then to an E3 ubiquitin ligase for transfer to the target lysine(10). With about 40 E2 enzymes and over 600 different E3 ubiquitin ligases, variations on this theme certainly exist, but for simplicity, we focus on the

HECT E3 ubiquitination reaction.

For the purposes of this dissertation, it is important to note that while HECT

E3 ligases provide specificity for their targets, they must still directly interact with their cognate E2 to complete the cascade ubiquitin transfer (Figure 2.2). Early studies utilizing yeast two-hybrid screening determined that, in fact, it is solely the

HECT domain that interacts with the E2 conjugating enzyme. In this study E6-AP was shown to interact with UbcH7 and UbcH8(11). Later studies would lay the groundwork for determining the energetic contributions of E6AP this binding(8).

This study also indicated E6AP interaction to be strongest with UbcH7 and

UbcH8.

Ub E1 HECT E3 Ubiquitination

Substrate Ub E2 E3

Ub E2 Substrate E3

Ub Ub Ub Ub E2 Substrate E3

Figure 2.2 A simplified schematic of the HECT E3 ubiquitin ligase cascade

Ubiquitination is a three-step, ATP-dependent process that requires 3 enzymes to ultimately form an isopeptide bond between a substrate lysine and the C-terminal glycine of Ubiquitin. HECT E3 ubiquitin ligases must directly interact with their cognate E2 conjugating enzymes.

It has been long appreciated that ubiquitin itself has 7 lysines and that those lysines can be covalently linked with more ubiquitin peptides to form chains. All lysines on ubiquitin are external. Their position makes a significant contribution to chain linkage structural characteristics(12). Most famously, ubiquitin is known for its role in the ubiquitin-proteosome system to tag proteins for degradation(13).

Nedd4/RSP5 are ubiquitin ligases that carry out such activities(14). Linkage location provides structural characteristics. Furthermore, these chain linkages can be homo-, or hetero-typic and branched or unbranched to further specify signaling outcome(10). A summary schematic is shown in Figure 2.3. For example, K27 linkages are thought to be resistant to deubiquitinase activity and can thus promote stability(15). Another example was described in a recent study where a mix of K48-K63 branched chains was shown to protect signaling scaffolds from deubiquitinase CYLD. Signaling to NF-κB was regulated in response to IL1β(13). Generally, signaling outcomes include, but are not limited to stability, degradation, translocation to lysosomes, and scaffolding/complex formation.

2.3 ITCH as an attenuator of inflammatory signaling

ITCH has been shown to catalyze K11-, K33-, K48-, and K63-linked polyubiquitin chains, however most studied substrates are ubiquitinated for degradation(16-

19). ITCH has a clear role as an attenuator of inflammation and as a contributor of signaling homeostasis. ITCH is a strong opponent of NOD2-induced NF-κB signaling. Activated RIPK2, phosphorylated at Y474, is targeted for ubiquitination

by ITCH(20,21). ITCH can ubiquitinate RIPK2 to promote p38 and JNK activation, however this activity inhibits NOD2:RIPK2-mediated NF-κB initiation(22). Alternate signaling allows other E3 ubiquitin ligases such as cIAP1, cIAP2, XIAP, to bind and poly-ubiquitinate RIPK2(23,24). RIPK2 can then recruit

NEMO for ubiquitination at lysine 285 to initiate canonical NF-κB signaling(25).

Along with downregulation of NOD2-mediated NF-κB signaling, ITCH also participates in downregulation of TNFR1-mediated NF-κB signaling(16,20,26).

ITCH is a necessary component of the TAX1BP1/A20/RNF11 ubiquitin editing complex known to inactivate RIPK1(16). Our lab has previously shown downregulation of NOD2-mediated NF-κB activation by ITCH(20). We have also recently established a framework for the mechanism in which ITCH counters cIAP ubiquitination of Rip2 to modulate NOD2-mediated NF-κB activation(27).

Other pathways down regulated by ITCH include Wnt signaling through

Disheveled 2 (DVL2), and viral signaling through MAVS(18,28). It is clear that

ITCH plays many roles in down regulation of signaling. The importance of ITCH is more evident in whole organism deficiency.

2.4 Human/mouse ITCH deficiency

A case study investigating an Old Order Amish family reported 10 children affected by odd developmental defects, failure to thrive, diarrhea, large organs, multisystem autoimmune disease, and delayed motor development. Gene mapping revealed that each individual was born with a truncating mutation of

ITCH(29). The human ITCH deficiency report described similarities in phenotype when compared to ITCH-/- mice.

31 More on Ubiquitin

• Ubiquitin is a covalent protein modification on Lysines • 76 aa. With 7 lysines, each of which can have another 76 aa molecule conjugated to it. Ubiquitin N - GG - C Lys 6 11 27 29 33 48 63

• Ubiquitination can be: Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Ub Substrate Substrate Substrate SubstrateUb Substrate

Mono- Multi- Mono- Poly- Multi- Poly- Branched Figure 2.3 Overview of ubiquitin chain linkages

Ubiquitin has 7 Lysines along the length of the peptide. Each is able to host an isopeptide linkage by another ubiquitin peptide.

In ITCH-/- mice, we observe a spontaneous mucosal-inflammatory phenotype, early mortality, and increased susceptibility to granuloma development in a sarcoid mouse model(30,31). Mice are also affected with itchy skin lesions, and spontaneously develop inflammation of the lung pleural space.

In addition to innate immune signaling pathways ITCH also has roles in adaptive immune homeostasis through its roles in T cell anergy. Elements of the

CD4+ T cell anergy repertoire include ITCH and Nedd4. By promoting degradation of PLCγ1 and PKCΘ, ITCH and Nedd4 can disrupt signaling downstream of linker for activation of T cells (LAT). LAT has downstream consequences of retracting calcium flux signaling and is required for activation of

T cells(32). Furthermore, ITCH has a role in sustaining T cell anergy by promoting degradation of JUNB(33). This activity helps sustain anergy by reducing IL-2 production in anergic T cells.

2.5 Rationale to study IKK-mediated phosphorylation of ITCH

It is evident that ITCH deficiency has the potential to disturb immune balance.

For this reason we chose to investigate the effects of IKK phosphorylation on

ITCH, a crucial component of both innate immune and adaptive immune homeostasis. Either deficiency or malfunction of ITCH could lead to rampant inflammation. Effects of IKK phosphorylation are investigated in Chapter 3.

2.6 Works cited in this chapter

1. Ingham, R. J., Gish, G., and Pawson, T. (2004) The Nedd4 family of E3

ubiquitin ligases: functional diversity within a common modular

architecture. Oncogene 23, 1972-1984

2. Nalefski, E. A., and Falke, J. J. (1996) The C2 domain calcium-binding

motif: structural and functional diversity. Protein science : a publication of

the Protein Society 5, 2375-2390

3. Angers, A., Ramjaun, A. R., and McPherson, P. S. (2004) The HECT

domain ligase itch ubiquitinates endophilin and localizes to the trans-Golgi

network and endosomal system. The Journal of biological chemistry 279,

11471-11479

4. Wiesner, S., Ogunjimi, A. A., Wang, H. R., Rotin, D., Sicheri, F., Wrana, J.

L., and Forman-Kay, J. D. (2007) Autoinhibition of the HECT-type ubiquitin

ligase Smurf2 through its C2 domain. Cell 130, 651-662

5. Otte, L., Wiedemann, U., Schlegel, B., Pires, J. R., Beyermann, M.,

Schmieder, P., Krause, G., Volkmer-Engert, R., Schneider-Mergener, J.,

and Oschkinat, H. (2003) WW domain sequence activity relationships

identified using ligand recognition propensities of 42 WW domains. Protein

science : a publication of the Protein Society 12, 491-500

6. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and

Howley, P. M. (1990) The E6 oncoprotein encoded by human

papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63,

1129-1136

7. Scheffner, M., Huibregtse, J. M., Vierstra, R. D., and Howley, P. M. (1993)

The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase

in the ubiquitination of p53. Cell 75, 495-505

8. Eletr, Z. M., and Kuhlman, B. (2007) Sequence determinants of E2-E6AP

binding affinity and specificity. Journal of molecular biology 369, 419-428

9. Huang, L., Kinnucan, E., Wang, G., Beaudenon, S., Howley, P. M.,

Huibregtse, J. M., and Pavletich, N. P. (1999) Structure of an E6AP-UbcH7

complex: insights into ubiquitination by the E2-E3 enzyme cascade.

Science 286, 1321-1326

10. Komander, D., and Rape, M. (2012) The ubiquitin code. Annual review of

biochemistry 81, 203-229

11. Kumar, S., Kao, W. H., and Howley, P. M. (1997) Physical interaction

between specific E2 and Hect E3 enzymes determines functional

cooperativity. The Journal of biological chemistry 272, 13548-13554

12. Winget, J. M., and Mayor, T. (2010) The diversity of ubiquitin recognition:

hot spots and varied specificity. Molecular cell 38, 627-635

13. Ohtake, F., Saeki, Y., Ishido, S., Kanno, J., and Tanaka, K. (2016) The

K48-K63 Branched Ubiquitin Chain Regulates NF-kappaB Signaling.

Molecular cell 64, 251-266

14. Fang, N. N., Chan, G. T., Zhu, M., Comyn, S. A., Persaud, A., Deshaies,

R. J., Rotin, D., Gsponer, J., and Mayor, T. (2014) Rsp5/Nedd4 is the main

ubiquitin ligase that targets cytosolic misfolded proteins following heat

stress. Nature cell biology 16, 1227-1237

15. Castaneda, C. A., Dixon, E. K., Walker, O., Chaturvedi, A., Nakasone, M.

A., Curtis, J. E., Reed, M. R., Krueger, S., Cropp, T. A., and Fushman, D.

(2016) Linkage via K27 Bestows Ubiquitin Chains with Unique Properties

among Polyubiquitins. Structure 24, 423-436

16. Shembade, N., Harhaj, N. S., Parvatiyar, K., Copeland, N. G., Jenkins, N.

A., Matesic, L. E., and Harhaj, E. W. (2008) The E3 ligase Itch negatively

regulates inflammatory signaling pathways by controlling the function of

the ubiquitin-editing enzyme A20. Nature immunology 9, 254-262

17. Liu, Y. C. (2007) The E3 ubiquitin ligase Itch in T cell activation,

differentiation, and tolerance. Seminars in immunology 19, 197-205

18. Wei, W., Li, M., Wang, J., Nie, F., and Li, L. (2012) The E3 ubiquitin ligase

ITCH negatively regulates canonical Wnt signaling by targeting

dishevelled protein. Molecular and cellular biology 32, 3903-3912

19. Chastagner, P., Israel, A., and Brou, C. (2006) Itch/AIP4 mediates Deltex

degradation through the formation of K29-linked polyubiquitin chains.

EMBO reports 7, 1147-1153

20. Tao, M., Scacheri, P. C., Marinis, J. M., Harhaj, E. W., Matesic, L. E., and

Abbott, D. W. (2009) ITCH K63-ubiquitinates the NOD2 binding protein, 36

RIP2, to influence inflammatory signaling pathways. Current biology : CB

19, 1255-1263

21. Tigno-Aranjuez, J. T., Asara, J. M., and Abbott, D. W. (2010) Inhibition of

RIP2's tyrosine kinase activity limits NOD2-driven cytokine responses.

Genes & development 24, 2666-2677

22. Tigno-Aranjuez, J. T., and Abbott, D. W. (2012) Ubiquitination and

phosphorylation in the regulation of NOD2 signaling and NOD2-mediated

disease. Biochimica et biophysica acta 1823, 2022-2028

23. Krieg, A., Correa, R. G., Garrison, J. B., Le Negrate, G., Welsh, K., Huang,

Z., Knoefel, W. T., and Reed, J. C. (2009) XIAP mediates NOD signaling

via interaction with RIP2. Proceedings of the National Academy of

Sciences of the United States of America 106, 14524-14529

24. Bertrand, M. J., Doiron, K., Labbe, K., Korneluk, R. G., Barker, P. A., and

Saleh, M. (2009) Cellular inhibitors of apoptosis cIAP1 and cIAP2 are

required for innate immunity signaling by the pattern recognition receptors

NOD1 and NOD2. Immunity 30, 789-801

25. Abbott, D. W., Wilkins, A., Asara, J. M., and Cantley, L. C. (2004) The

Crohn's disease protein, NOD2, requires RIP2 in order to induce

ubiquitinylation of a novel site on NEMO. Current biology : CB 14, 2217-

2227

26. Shembade, N., Ma, A., and Harhaj, E. W. (2010) Inhibition of NF-kappaB

signaling by A20 through disruption of ubiquitin enzyme complexes.

Science 327, 1135-1139

27. Tigno-Aranjuez, J. T., Bai, X., and Abbott, D. W. (2013) A discrete

ubiquitin-mediated network regulates the strength of NOD2 signaling.

Molecular and cellular biology 33, 146-158

28. You, F., Sun, H., Zhou, X., Sun, W., Liang, S., Zhai, Z., and Jiang, Z.

(2009) PCBP2 mediates degradation of the adaptor MAVS via the HECT

ubiquitin ligase AIP4. Nature immunology 10, 1300-1308

29. Lohr, N. J., Molleston, J. P., Strauss, K. A., Torres-Martinez, W., Sherman,

E. A., Squires, R. H., Rider, N. L., Chikwava, K. R., Cummings, O. W.,

Morton, D. H., and Puffenberger, E. G. (2010) Human ITCH E3 ubiquitin

ligase deficiency causes syndromic multisystem autoimmune disease.

American journal of human genetics 86, 447-453

30. McCaskill, J. G., Chason, K. D., Hua, X., Neuringer, I. P., Ghio, A. J.,

Funkhouser, W. K., and Tilley, S. L. (2006) Pulmonary immune responses

to Propionibacterium acnes in C57BL/6 and BALB/c mice. American

journal of respiratory cell and molecular biology 35, 347-356

31. Perry, W. L., Hustad, C. M., Swing, D. A., O'Sullivan, T. N., Jenkins, N. A.,

and Copeland, N. G. (1998) The itchy locus encodes a novel ubiquitin

protein ligase that is disrupted in a18H mice. Nature genetics 18, 143-146

32. Yang, B., Gay, D. L., MacLeod, M. K., Cao, X., Hala, T., Sweezer, E. M.,

Kappler, J., Marrack, P., and Oliver, P. M. (2008) Nedd4 augments the

adaptive immune response by promoting ubiquitin-mediated degradation

of Cbl-b in activated T cells. Nature immunology 9, 1356-1363

33. Gallagher, E., Gao, M., Liu, Y. C., and Karin, M. (2006) Activation of the E3

ubiquitin ligase Itch through a phosphorylation-induced conformational

change. Proceedings of the National Academy of Sciences of the United

States of America 103, 1717-1722

Chapter 3: IκB Kinases phosphorylate ITCH

The material in this chapter is adapted with permission from: Perez, J.M.,

Chirieleison, S.M., and Abbott, D.W. An IκB Kinase-Regulated Feedforward

Circuit Prolongs Inflammation. Cell Reports. 2015, 12 (4): 537–544. doi:

Press.

Summary

Loss of NF-κB signaling causes immunodeficiency, whereas inhibition of NF-

κB can be efficacious in treating chronic inflammatory disease. Inflammatory NF-

κB signaling must therefore be tightly regulated, and although many mechanisms to downregulate NF-κB have been elucidated, there have only been limited studies demonstrating positive feedforward regulation of NF-κB signaling. In this work, we use a bioinformatic and proteomic approach to discover that the IKK family of proteins can phosphorylate the E3 ubiquitin ligase ITCH, a critical downregulator of TNF-mediated NF-κB activation. Phosphorylation of ITCH by

IKKs leads to impaired ITCH E3 ubiquitin ligase activity and prolongs NF-κB signaling and pro-inflammatory cytokine release (Figure 3.1). Since genetic loss of ITCH mirrors IKK-induced ITCH phosphorylation, we further show that the

ITCH−/− mouse’s spontaneous lung inflammation and subsequent death can be delayed when TNF signaling is genetically deleted. This work identifies a new positive feedforward regulation of NF-κB activation that drives inflammatory disease.

Figure 3.1 Graphical Abstract

IKKs phosphorylate ITCH in a highly conserved region of the HECT domain. E3 ubiquitin ligase activity is impaired in IKK-phosphorylated ITCH. Impaired ITCH results in heightened TNF signaling. Activated IKKs can affect multiple pathways through inhibitory ITCH phosphorylation

3.1 Introduction

Inflammatory signaling pathways are among the most tightly regulated in the body. Inflammatory responses must be strong enough to combat pathogens, but they also must be measured to avoid unnecessary host damage. As a major driver of inflammatory signaling, NF-κB transcriptional activation is a prime example of such tight pathway regulation. Although the main products of classically activated NF-κB include potent cytokines and chemokines, the initial

NF-κB transcriptional program also is designed to limit NF-κB activity (Hayden and Ghosh, 2012). Negative feedback proteins such as IκBα and A20 are among the first NF-κB-driven genes transcribed (Krikos et al., 1992; Shembade and

Harhaj, 2012; Sun et al., 1993). However, transcriptional reprogramming takes time, and a more a rapid response is essential to properly tailor the strength and duration of inflammation (Perkins, 2006). To this end, posttranslational modifications such as phosphorylation and ubiquitination can quickly alter cellular activity for tight signaling regulation (Hunter, 2007; Tigno-Aranjuez et al., 2013).

Posttranslational modifiers, such as kinases and ubiquitin ligases, can quickly change the activity of enzymes, affect localization of proteins, alter stability in regard to degradation, and promote interaction of diverse proteins to fine-tune signaling, such that the body can eradicate an offending pathogen while also limiting host damage (Gallagher et al., 2006; Prabakaran et al., 2012).

As a central hub for the NF-κB signaling pathway, the IκB kinases (IKKs) are positioned to provide such a rapid response. Although being most famous for the phosphorylation of the IκB proteins to activate the NF-κB transcription factors

(Chen et al., 1996), they also now are recognized to be fast activators of feedback inhibition of this pathway. For example, IKKα phosphorylates TRAF4 to promote its stability and activity as an inhibitor of NOD2-mediated NF-κB (Marinis et al., 2012). IKKα also phosphorylates TAX1BP1 to recruit A20, RNF11, and

ITCH, allowing formation of a ubiquitin-remodeling complex that downregulates

TNF-mediated NF-κB activation (Shembade et al., 2008, 2011). Similarly, IKKβ phosphorylates A20 to promote downregulation of NF-κB by enhancing its deubiquitination function (Hutti et al., 2007). However, this rapid response is not limited to feedback inhibition (Liu et al., 2012). It has been shown recently that

IKKβ can phosphorylate IRF5 to induce an interferon response (Lopez-Pelaez et al., 2014; Ren et al., 2014), and it is also known that NF-κB can undergo a positive feedforward regulation through the paracrine and autocrine expression of

IL-17 and IL-6 (Ogura et al., 2008). Thus, identification of novel IKK phosphorylation sites and study of the regulation of those sites continue to help us understand inflammatory responses.

Given this, we hypothesized that there are additional IKK substrates that might prolong NF-κB signaling. We therefore developed a dual bioinformatic/proteomic approach to rapidly identify novel substrates of the IKKs.

Coupling data from peptide array analysis with a novel IKK-substrate motif antibody, we describe an approach to rapidly identify novel IKK substrates. We used this approach to identify and confirm phosphorylation of a novel IKK substrate, ITCH, a HECT E3 ubiquitin ligase. ITCH is present in endolysosomal compartments, an area shown to contain active IKK complexes, and functions

with the E2 ubiquitin ligases UbcH5, UbcH6, and UbcH7 to catalyze the formation of a wide variety of polyubiquitin chains, including K11, K29, K48, and

K63-linked polyubiquitination (Angers et al., 2004; Chastagner et al., 2006; Perry et al., 1998; Shembade et al., 2008; Tao et al., 2009; Wei et al., 2012).

Biologically, ITCH is known to downregulate a variety of inflammatory signaling pathways, including the RIG-I/MAVS pathway in antiviral signaling (You et al.,

2009), the NOD/RIP2 pathway in intracellular bacterial signaling (Tao et al.,

2009), and TNF-α-mediated NF-κB activation in inflammatory signaling

(Shembade et al., 2008). In this study, we found that IKK phosphorylation of

ITCH inhibits its ability to downregulate signaling pathways and inhibit cytokine responses. Lastly, given that TNF is a major activator of IKKs and that ITCH serves to downregulate TNF signaling, we show that genetic loss of TNFR1 attenuates the pulmonary inflammatory phenotype of the ITCH−/− mice. This paper thus identifies a novel phosphorylation-dependent signaling cascade that serves to prolong inflammatory signaling.

3.2 Materials and methods

3.2.1 Cell culture, transient transfection, immunoprecipitation, and Western blotting

HEK293T, Jurkat, and A549 cells were maintained in DMEM containing 10% fetal bovine serum with antibiotic/antimycotic solution (Invitrogen). Calcium phosphate transfections were carried out as described previously (Abbott et al.,

2004). Cell harvest and immunoprecipitations (IPs) were conducted in lysis buffer 44

(50 mM Tris [pH 7.5], 150 mM NaCl, 1% Triton X-100, 1 mM EGTA, 1 mM EDTA,

2.5 mM sodium orthophosphate, 1 mM β-glycerophosphate, 1 mM PMSF, 1 mM

Na3VO4, and 10 nM calyculin A in the presence of protease inhibitor cocktail

[Sigma]). Protein G Sepharose beads (Invitrogen) or FLAG agarose beads were added to lysates for IP. Beads were washed five times in lysis buffer and boiled in sample buffer prior to western blotting on nitrocellulose membranes (Bio-Rad), as described previously (Abbott et al., 2007). Phospho IKK substrate motif polyclonal antibody was generated against the peptide sequence F/Y/M-X-pS-

L/I/M, as described previously (Hutti et al., 2009). ITCH H110, Actin, and Omni antibodies (Santa Cruz Biotechnology); glutathione S-transferase (GST), phospho-IKKα/β, DVL2, phospho-IκBα, IκBα, and phospho-p105 antibodies (Cell

Signaling Technology); anti-hemagglutinin (HA-11; Covance); anti-Xpress antibody (Invitrogen); and anti-FLAG antibody and FLAG agarose beads (Sigma-

Aldrich) were all used according to the manufacturers’ directions. 3XFlag DVL2

(WT) was purchased from Addgene (plasmid 24802) (Narimatsu et al., 2009) and was placed in the pcDNA6His Max (Invitrogen) Omni vector using standard restriction digest. FLAG-ITCH, HA-Ubiquitin, Omni-RIP2, GST-IKKα, GST-

IKKαGST-IKKβ, GST-IKKε, GST-TBK1, and mutants were used as described previously (Hutti et al., 2007, 2009; Tao et al., 2009). Mutant constructs S687D

ITCH, S687A ITCH, and C830A ITCH were generated by QuikChange site- directed mutagenesis (Stratagene) and verified by sequence analysis.

Recombinant 6XHis-UBCH7, GST-ITCH, and GST-ITCH mutants were grown in

E. coli and purified using standard methodology. Recombinant full-length human

GST-IKKα and GST-IKKβ were purchased from Millipore. Recombinant HA-

Ubiquitin and XP-UBE1 were purchased from Boston Biochem.

3.2.2 In vitro kinase assay

Recombinant GST-ITCH or GST-C830A ITCH was added to GST-IKKα and

10 µCi [γ-32P] ATP per reaction. Reaction mix was incubated at 30°C for 30 min in kinase buffer (25 mM Tris [pH 7.5], 1 mM β-glycerophosphate, 1 mM DTT, 1 mM Na3VO4, 10 mM MgCl2, and 100 µM ATP). Boiling and SDS-PAGE were followed by autoradiography.

3.2.3 Mass spectrometry

Mass spectrometry analysis was performed by the Beth Israel Deaconess

Mass spec core facility under the direction of Dr. John Asara, as described previously (Tigno-Aranjuez et al., 2010).

3.2.4 In vitro ubiquitin ligase assay

Recombinant GST-ITCH, GST-ITCH variants, and 6XHis-UbcH7 were purified as described above, and the reaction was performed as described previously (Wilkins et al., 2004). Ube1 and HA-Ubiquitin were from Boston

Biochem. The reaction was stopped by the addition of 2× sample buffer and boiling, followed by SDS-PAGE and immunoblotting.

3.2.5 Luciferase assays

HEK293T cells were calcium phosphate-transfected with CMV-Renilla and either a TCF/LEF luciferase reporter construct (M50 Super 8× TOPFlash

[Veeman et al., 2003] or an NF-κB luciferase reporter) construct along with

varying amounts of FLAG-ITCH. M50 Super 8× TOPFlash was a gift from

Randall Moon (Addgene plasmid 12456). Cells were lysed in 1× passive lysis buffer and assayed for luciferase and Renilla activities (Promega Dual-Luciferase

Reporter Assay System). Luciferase values were normalized to Renilla and fold change was calculated relative to unstimulated cells in the absence of ITCH.

3.2.6 Lentiviral shRNA and retroviral RNAi-Resistant ITCH reconstitution/CRISPR NEMO−/− Cells

A549 cells were stably transduced with ITCH shRNA lentiviral constructs in the pLKO vector (Sigma-Aldrich). ITCH sh1 and sh2 were directed at the sequences 5′-GCAGCAGTTTAACCAGAGATT-3′ and 5′-

CCAGGAGAAGAAGGTTTAGAT-3′ within ITCH, respectively. ITCH shRNA knockdown was confirmed through western blotting after puromycin selection.

ITCH sh1-resistant FLAG-ITCH and FLAG-S687D ITCH were generated through point mutagenesis within the pBABE (hygro)-FLAG-ITCH vector (mutagenesis primers: forward, 5′-

CTTCAAGGAGCAATGCAGCAGTTCAATCAGAGATTCATTTATGG-3′; reverse,

5′-CCATAAATGAATCTCTGATTGAACTGCTGCATTGCTCCTTGAAG-3′). The sh1-resistant constructs were stably transduced in the ITCH sh1 stable cell line and selected with hygromycin. NEMO−/− CRISPR cell lines were generated via lentiviral transduction of a LentiCRISPRv2 construct (Sanjana et al., 2014) modified to contain the guide sequence 5′-GAGCGCCCTGTTCTGAAGGC-3′. lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid 52961). Cells were selected with puromycin and then cloned to select for colonies with

validated knockout. Six validated clones were pooled. Similarly, negative

CRISPR control cells were virally transduced with a LentiCRISPRv2 construct containing the irrelevant guide sequence 5′- CGCGATAGCGCGAATATATT-3′.

3.2.7 qRT-PCR

RNA was isolated with RNEasy QIAGEN kit and cDNA was generated using

QIAGEN’s Quantitect Reverse Transcription kit, according to the manufacturer’s instructions. Real-time PCR was performed with primers generated to detect human IL-6 (forward, 5′-TCCACAAGCGCCTTCGGTCC-3′; reverse, 5′-

GTGGCTGTCTGTGTGGGGCG-3′), IL-8 (forward, 5′-

CCTGATTTCTGCAGCTCTGTG-3′; reverse, 5′-CCAGACAGAGCTCTCTTCCAT-

3′), and GAPDH (forward, 5′-GACCTGACCTGCCGTCTA-3′; reverse, 5′-

GTTGCTGTAGCCAAATTCGTT-3′), using iQ SYBR Green Supermix (Bio-Rad).

The data shown are normalized to GAPDH.

3.2.8 Mice and histology scoring

ITCH−/− mice (MRC Harwell; backcrossed over ten generations onto the

C57BL/6 mice from Jackson ImmunoResearch Laboratories) were crossed with

C57BL/6 TNFR1−/− mice (Jackson ImmunoResearch Laboratories). Lung tissue was harvested from mice at 2, 4, and 6 months of age from each genotype and scored blindly by a board-certified anatomic pathologist (D.W.A.). The scoring system was based on the following parameters: arteriolar inflammation, bronchiolar inflammation, protein, pleural inflammation, and inducible bronchus- associated lymphoid tissue (iBALT), with a scoring range of 0–4 for each

parameter. Animal studies were performed within a specific-pathogen-free animal facility under IACUC-approved protocols, Case Western Reserve University.

3.2.9 Graphs and statistical analyses

GraphPad Prism software was used to create graphs and perform statistical analyses. Significance on luciferase assays and qRT-PCR was determined using a paired Student’s t test (NF-κB, n = 3; TCF/LEF, n = 4). Significance on histology scoring was determined performing multiple comparisons of one-way ANOVA.

3.2.10 Structural and sequence analyses

Clustal W2 was used for multiple sequence alignment of protein sequences obtained from NCBI Protein. PyMOL was used to highlight residue S687 within the ITCH HECT domain from NCBI Structure (Protein Data Bank [PDB]: 3TUG).

3.3 Results and discussion

3.3.1 IKKs phosphorylate the HECT E3 ubiquitin ligase ITCH on Serine 687

To identify novel substrates of IKKs using a joint proteomic/bioinformatic approach, peptide substrate array data from our previous studies (Hutti et al.,

2007, 2009; Marinis et al., 2012) was used to generate polyclonal antibodies designed against the preferred IKK phospho-peptide motif (F/Y/M-X-pS-L/I/M)

(Hutti et al., 2007, 2009). We then quantified the relative positively and negatively selected amino acid preferences from the peptide substrate array data to generate a matrix such that proteomic databases could be searched for amino acid sequences matching these phosphorylation motifs (Obenauer et al., 2003).

This paired approach allowed us to identify a large number of potential substrates via bioinformatic searches, while also allowing us to quickly screen those substrates through the use of the IKK phospho-motif antibody. In initial testing, 11 substrates were screened including the known IKK substrate TANK.

Of these initial substrates tested, positive IKK phosphorylation was identified for seven substrates. Among these seven substrates, ITCH, a WW domain- containing HECT E3 ligase family shown previously by our lab to downregulate the NOD2:RIP2 signaling pathway, was identified (Figure 3.2A).

To determine whether the IKKs directly phosphorylate ITCH, we conducted in vitro kinase assays with γ32P-labeled ATP and recombinant ITCH. 32P transfer by both IKKα and IKKβ to both ITCH and ligase-dead (C830A) ITCH was detected, indicating direct phosphorylation by IKKα and IKKβ that did not require the catalytic activity of ITCH (Figure 3.2B; generation of recombinant bacterial

ITCH and variants is shown in Figure 3.2.1A). Furthermore, co-transfection of

ITCH or C830A ITCH with IKKα also revealed phosphorylation of ITCH, but did require the C2 domain and subsequent membrane localization of ITCH (Figure

3.2C, upper blots). IKKβ and kinase inactive K44A IKKβ also were tested and showed similar results (Figure 3.2C, lower blots). Additionally, as the IKK-related kinases IKKε and TBK1 share similarities in kinase structure and preferred phosphorylation motif (Hutti et al., 2009, 2012), both of these kinases induced phosphorylation of ITCH (Figure 3.2D). Thus, all four IKKs phosphorylate ITCH.

We further investigated IKK-mediated phosphorylation of ITCH in an endogenous setting. ITCH is known to have a strong function in T cells (Jin et al.,

2013). For this reason, Jurkat T cells were treated with TNF. Samples were collected at the indicated time points and the IKK substrate antibody was used to immunoprecipitate proteins containing the phosphomotif. Probing for ITCH revealed the presence of phosphorylated ITCH that correlated both with IKK activation and with the phosphorylation of the known IKK substrates p105 and

IκBα (Figure 3.2E). Similarly, treatment of the lung epithelial cell line A549 showed TNF-inducible phosphorylation of endogenous ITCH (Figure 3.2F).

Inhibiting both IKKα and IKKβ through the CRISPR-mediated deletion of the IKK scaffolding protein, NEMO, showed a loss of TNF-induced ITCH phosphorylation

(Figure 3.2.1B). This IKK-induced phosphorylation can be detected in an endogenous setting, and, in the case of TNF, is likely mediated by the

IKKα/IKKβ/NEMO scaffolding complex.

Figure 3.2 ITCH Is a Novel Substrate of IKKs

(A) A schematic outline for finding novel IKK substrates is shown. IKK phospho- peptide array data revealed a consensus IKK phosphorylation motif. The motif generated was used for a Scansite bioinformatic search and coupled with a custom antibody generated against the phosphorylated motif; ITCH was identified as a candidate IKK substrate. (B) Recombinant ITCH was subjected to

32P in vitro kinase assay with recombinant IKKα and IKKβ in separate experiments. Both IKKα and IKKβ could phosphorylate (continued on next page) 52

Figure 3.2 ITCH Is a Novel Substrate of IKKs (continued)

ITCH. (C and D) HEK293 cells were transfected with FLAG-tagged ITCH or

C830A (catalytically inactive ITCH) and either active or kinase-inactive IKKα (C, upper blots), active IKKβ or kinase-inactive IKKβ (C, lower blots), active or inactive IKKε, or active or inactive TBK1 (D). All IKK family members caused

ITCH phosphorylation. (E and F) Jurkat T cells (E) or A549 lung epithelial cells

(F) were treated with TNF-α as indicated. IP of IKK phospho-motif-containing proteins and immunoblotting were performed. (Continued on next page) 53

Figure 3.2 ITCH Is a Novel Substrate of IKKs (continued)

As a control, irrelevant rabbit polyclonal antibody was used (F). Phosphorylation of ITCH matched the time course of IKK activation and IKK phosphorylation of the known substrates IκBα and p105.

Figure 3.2.1 Production of recombinant ITCH and requirement of NEMO for

ITCH phosphorylation.

Supplemental (Related to Figures 3.2 and 3.4A). (A.) Recombinant GST–ITCH variants were produced in BL21 bacterial cells, purified via the GST tag and electrophoresed on an 8% acrylamide gel. Coomassie staining following SDS-

PAGE of the purified proteins is shown. These proteins were used in in vitro kinase assays (Figure 3.2B) and in in vitro ubiquitination assays (Figure 3.4A).

(B.) HEK 293 NEMO-/- and control CRISPR cells were stimulated with 10 ng/mL

TNFα for the indicated time points. Phospho IKK substrate antibody was used to immunoprecipitate proteins containing phosphomotif sequence. Samples were subjected SDS PAGE and probed. While phosphorylated ITCH was detected upon IKK activation in control CRISPR cells, phosphorylated ITCH was absent in

NEMO-/- cells.

To determine whether the predicted phosphoacceptor on ITCH corresponded to the actual phosphoacceptor, we immunopurified IKK-phosphorylated ITCH from Flag-tag ITCH-transfected cells. Purified ITCH was subjected to mass spectrometric analysis (Figure 3.3A); 251 peptides were analyzed encompassing

69% of the amino acids of ITCH. Phosphorylation occurred on 33% of peptides containing S687 (DLESIDPEFYNpSLIWVK). Mass spectrometric sequence analysis also identified an additional phosphoacceptor (S13) occurring within an

IKK peptide motif (F/Y/M-X-pS-L/I/M). To further determine which of these two sites was detected by our IKK phospho-substrate antibody, site-directed mutagenesis was employed. While single mutations did not result in a loss of detected phosphorylation, we found that mutation of both sites (S13A/S687A

ITCH) abolished the signal (Figure 3.3B). To differentiate the importance of these two potential phosphorylation sites, we conducted further sequence analysis and molecular modeling. Although S687 was conserved through zebrafish, S13A was not conserved (Figure 3.3C). Molecular modeling showed that Ser 687 lies within the N-terminal lobe of the HECT domain. This region of the HECT domain is known to make contact with E2-conjugating enzymes (Hatakeyama et al., 1997), and this region of ITCH has been reported to make contact with the E2 ubiquitin ligase UBCH7 (Ingham et al., 2004; Schwarz et al., 1998). These findings lead to the testable hypothesis that IKK-mediated phosphorylation of ITCH on S687 affects its E3 ubiquitin ligase activity, while phosphorylation of S13 does not.

Figure 3.3 ITCH Is Phosphorylated on Ser 687

(A) ITCH was co-transfected with IKKβ and immunopurified. Phosphorylated

ITCH was excised from the Coomassie-stained gel and analyzed by mass spectrometry; 251 peptides from ITCH were identified with 69% coverage obtained. Time-of-flight histogram shows a mass-to-charge shift in 33% of peptides DLESIDPEFYNpSLIWVK, indicating phosphorylation at residue Ser

687. (B) HEK293 cells were co-transfected with (continued on next page)

Figure 3.3 ITCH Is Phosphorylated on Ser 687 (continued)

IKKβ and each of the following ITCH variants: WT, S13A, S687A, and

S13A/S687A. Mutation of both Ser 13 and Ser 687 abolished the phosphorylation signal in the presence of IKKβ. (C) Sequence alignment indicates conservation of

S687 in zebrafish, while S13 is not conserved. (D) The HECT domain’s predicted molecular structure is shown with Ser 687 highlighted. Ser 687 lies within the N- terminal lobe of the HECT domain.

3.3.2 Ubiquitin ligase activity and downstream signaling is modulated in an

ITCH S687D phosphomimetic mutant

To determine the effect of Ser 687 phosphorylation on ITCH’s E3 ligase activity, we generated a phosphomimetic mutant and used this mutant to perform in vitro ubiquitination assays. Multi-ubiquitin chains were detected in the presence of wild-type (WT) ITCH, whereas no ubiquitin chains were detected in the presence of either ligase-dead C830A ITCH or phosphomimetic S687D ITCH

(Figure 3.4A), suggesting that this phosphorylation site might negatively influence

ITCH’s E3 ubiquitin ligase activity. We then performed cellular ubiquitination assays. HEK293 cells were transiently transfected with HA-tagged ubiquitin and

ITCH variants as indicated. Lysates were generated and ITCH was immunoprecipitated. Western blotting indicated that both ITCH and S687A ITCH could autoubiquitinate, while S687D ITCH or ligase-dead C830A ITCH could not

(Figure 3.4B). To then test whether ITCH has impaired ubiquitin ligase activity on known substrates, we performed substrate ubiquitin assays with two known substrates of ITCH, DVL2 and RIP2. ITCH variants were co-transfected with HA-

Ubiquitin and Omni-tagged RIP2 or DVL2 in separate experiments. ITCH and

S687A ITCH were shown to have similar ubiquitination activity on both RIP2 and

DVL2. Catalytically inactive C830A ITCH and phosphomimetic S687D ITCH showed greatly reduced ubiquitin chains on both of these proteins (Figures 3.4C and 2.4D, upper blots). In a similar experiment without the addition of HA- ubiquitin, ITCH and S687A ITCH catalyzed the formation of ubiquitin chains using

endogenous ubiquitin, while again S687D and C830A showed greatly reduced ubiquitination of RIP2 (Figure 3.4.1).

Both the TNF pathway and the WNT/β-catenin pathway are known to be downregulated by ITCH (Shembade et al., 2008; Wei et al., 2012). To determine the role of ITCH phosphorylation on these pathways, luciferase assays were performed with NF-κB and TCF/LEF reporter constructs. TNF-α and WNT gene expression activity were strongly reduced with increasing amounts of ITCH, but they remained largely unaffected in the presence of S687D ITCH (Figure 3.4D).

Comparable experiments were performed to investigate the effect of phosphorylation at the S13 phosphomotif of ITCH; however, no differences were detected (Figures 3.4.2A and 2.4.2B). Likewise, an ITCH construct lacking the C2 domain and, therefore, lacking the ability to be phosphorylated had no effect on

TNF-induced NF-κB activation (Figure 3.4.2C). Taken together, these findings suggest that the IKKs phosphorylate ITCH at residue S687 to inhibit ITCH’s ability to downregulate signaling pathways.

Figure 3.4 Ubiquitin Ligase Activity and Downstream Signaling Is

Modulated in ITCH S687D Phosphomimetic Mutant

(A) Recombinant ITCH, S687D ITCH, and C830A ITCH were added to a reaction mix that contained Omni-UBCH7, HA-ubiquitin, E1-activating enzyme, and ATP, as indicated. Reactions were incubated at 37°C for 30 min, then subjected to

SDS-PAGE and immunoblotting. S687D ITCH showed a loss of ubiquitination activity that was comparable to the ligase-dead (C830A) ITCH mutant. (B)

HEK293 cells were transfected with FLAG-tagged ITCH, S687D ITCH, S687A

ITCH, or C830A ITCH with HA-tagged ubiquitin. Cell lysates were generated.

ITCH was immunoprecipitated and immunoblotting (continued on next page)

Figure 3.4 Ubiquitin Ligase Activity and Downstream Signaling Is

Modulated in ITCH S687D Phosphomimetic Mutant (continued) was performed. S687D ITCH showed greatly decreased autoubiquitination activity. (C) HEK293 cells were transfected with ITCH variants, HA-tagged ubiquitin, and Omni-tagged DVL2 or RIP2 in separate experiments. DVL2 or

RIP2 were immunoprecipitated in each respective experiment and subjected to western blotting. S687D ITCH showed greatly decreased substrate ubiquitination. (D) HEK293 cells were transfected with NF-κB luciferase and

CMV-Renilla reporter constructs with either ITCH or ITCH S687D mutant expression constructs. After 16 hr, cells were treated with 10 ng/ml TNF-α for 7 hr and harvested for a luciferase assay (upper graph). Separately, HEK293 cells were transfected with TCF/LEF luciferase and CMV-Renilla reporter constructs with ITCH or S687D ITCH ± DVL2. Cells were harvested for a luciferase assay

24 hr post-transfection. (Data are represented as mean ± SEM with ∗p < 0.05.)

ITCH could inhibit both TNF and β-catenin signaling, however, this activity was lost in the S687D ITCH variant.

Figure 3.4.1 ITCH S687D has impaired ubiquitin ligase activity utilizing endogenous ubiquitin

Supplemental (Related to Figure 3.4C). RIP2 and ITCH variants were transfected into HEK 293 cells. RIP2 was immunoprecipitated and subjected to

SDS PAGE and Western blotting as indicated. Probing immunoprecipitates with monoclonal Ubiquitin antibody PD41 shows ubiquitinated RIP2 in the presence of wild type ITCH and S687D ITCH, however ITCH S687D is impaired in this function.

Figure 3.4.2 Changes in S13 and the C2 domain do not affect ITCH ubiquitination activity

Supplemental (Related to Figure 3.4). (A.) HA-tagged ubiquitin, NTAP-RIP2,

ITCH, and ITCH variants S13A ITCH, S13D ITCH, and C830A ITCH were transfected as indicated. NTAP-RIP2 was immunoprecipitated and subjected to

SDS PAGE. Western blots were probed as indicated, showing similar ubiquitination of RIP2 by WT ITCH, S13A ITCH, and S13D ITCH. (B, C). HEK

293 cells were transfected with NF-κB luciferase reporter and CMV-Renilla constructs along with empty vector or ITCH variants. Cells were then stimulated with 10 ng/mL TNFα for 7 hours and harvested for NF-κB luciferase assays. Fold 64

increase is shown. NF-κB luciferase activity was not significantly different between WT ITCH and the following ITCH variants: S687A ITCH, S13A ITCH,

S13D ITCH, and ΔC2 domain ITCH.

3.3.3 ITCH phosphorylation causes increased TNF-induced proinflammatory cytokine release, and loss of TNF signaling delays the pulmonary inflammatory phenotype in ITCH−/− mice

To further investigate the downstream effects of phosphorylation at S687,

ITCH expression was stably inhibited through small hairpin RNA (shRNA) knockdown in A549 cells (Figure 3.5A, left). These cells were subsequently transduced with RNAi-resistant lentiviral FLAG-tagged ITCH variants using mutagenesis of the third nucleotide in a codon in such a way that does not alter the amino acid sequence (Figure 3.5A, right). Each reconstituted cell line was stimulated with TNF-α to determine induced expression of IL-6 and IL-8 (Figure

3.5B). Levels of IL-6 and IL-8 mRNA were similarly high in cells with vector only and S687D ITCH, while they were greatly reduced in cells reconstituted with WT

ITCH.

To then determine whether this finding is true in vivo, a genetic approach was utilized. ITCH−/− mice develop pulmonary interstitial pneumonitis and consolidated peripheral inflammation of the alveolar space that ultimately leads to their death at approximately 6–8 months of age (Matesic et al., 2008).

Because TNF-mediated phosphorylation of ITCH is functionally similar to genetic

ITCH loss, we hypothesized that unrestrained TNF signaling might be influencing the inflammatory lung phenotype in the ITCH−/− mice. To test this hypothesis,

ITCH−/− mice were bred with TNFR1−/− mice to yield ITCH−/−TNFR1−/− mice.

Lungs were harvested from mice aged 2, 4, and 6 months, and histopathological

analysis was performed. Consolidated inflammation was most prominent at the peripheral, pleural alveolar space in the ITCH−/− mice. This was significantly delayed and decreased in the ITCH−/−TNFR1−/− mice (Figure 3.5C). WT,

TNFR1−/−, ITCH−/−, and ITCH−/−TNFR1−/− lung histology slides were then blindly scored to indicate differences in histology scores at 4 and 6 months of age

(Figure 3.5D). ITCH−/−TNFR1−/− showed a significant decrease in lung pathology.

To further show the delay in pathology, mice were aged for up to 300 days and survival was plotted. ITCH−/−TNFR1−/− mice had significantly greater survival time compared to ITCH−/− mice (Figure 3.5E, lower graph). These findings suggest that unrestrained TNF signaling partially underlies pathology in the ITCH−/− mouse. Coupled with the fact that TNF-activated IKKs phosphorylate ITCH to halt

ITCH’s inhibitory effect on TNF signaling (Figures 3.2, 3.3, and 3.4), these data suggest a positive feedback loop centered on ITCH phosphorylation.

Figure 3.5 Loss of TNFR1 partially complements the inflammatory phenotype in ITCH−/− mice

(A) A549 cells were stably transduced with lentiviral shRNA constructs directed against ITCH. ITCH shRNA1 cell lines were then stably reconstituted with vector only or RNAi-resistant FLAG-ITCH and FLAG-S687D ITCH retroviral constructs.

Western blots show both ITCH expression knockdown as well as reconstitution.

(B) Reconstituted ITCH shRNA1 cells were stimulated with 10 ng/ml TNF-α for the indicated times. RNA was isolated and subjected to qRT-PCR to determine

IL-6 and IL-8 gene expression. (Data are represented as mean ± SEM with ∗p <

0.05.) (C) Representative images of ITCH−/− and ITCH−/−TNFR1−/− lung histology at the pleural surface at 2, 4, and 6 months of age. While the ITCH−/− mouse shows significant distal inflammation, consolidation, and chronic inflammation, the TNFR1−/−ITCH−/− mouse shows a significant delay in lung pathology.

(D) Histopathology of the lungs was blindly scored at 4 (WT, n = 4; TNFR1−/−, n =

4; ITCH−/−, n = 7; and ITCH−/−TNFR1−/−, n = 5) and 6 (WT, n = 4; TNFR1−/−, n = 4;

ITCH−/−, n = 5; and ITCH−/−TNFR1−/−, n = 6) months. TNFR1−/−ITCH−/− mice show significantly less lung pathology. (E) Survival of the mice was plotted on a

Kaplan-Meier curve (ITCH−/−, n = 24; ITCH−/−TNFR1−/−, n = 22; and TNFR1−/−, n =

22). Survival time varied significantly between ITCH−/− mice and ITCH−/−TNFR1−/− mice (median survival ratio = 0.6863; log-rank p value of 0.0009).

3.3.4 Conclusions

As central kinases in inflammatory signaling cascades, the IKKs are poised to be central regulators of a diverse set of cellular responses. Through a proteomic/bioinformatic approach designed to identify novel IKK substrates, we have identified a novel IKK phosphorylation site on the E3 ubiquitin ligase, ITCH, which increases the duration of NF-κB signaling. This phosphorylation site lies in a region of ITCH that is required for ITCH’s enzymatic activity, and IKK-mediated phosphorylation of this site greatly decreases ITCH’s E3 ubiquitin ligase activity.

Biochemically, we hypothesize that since S687 is a conserved residue in the E2- binding region of the HECT domain of ITCH, phosphorylation may impair E2 binding or limit transfer of ubiquitin from the E2 ubiquitin complex to the HECT domain of ITCH.

The WW-HECT domain E3 ubiquitin ligase family, of which ITCH is a member, is subject to extensive regulation. These family members lie in a catalytically inactive state that requires phosphorylation or Ca2+ binding by the

C2 domain to be activated (Mund and Pelham, 2009; Wang et al., 2010). Our data suggest that phosphorylation of S687 is not required to activate ITCH, but rather to deactivate it. Thus, it is not surprising that the ΔC2 domain mutant, a

200+ amino acid deletion mutant that relieves both auto-inhibition and cellular localization, is neither phosphorylated nor inactivated by the IKKs (Figures 3C and 3.4.2C). More surprising is the fact that a mutant that lacks the ability to be phosphorylated (S687A) is not hyperactive. This could be due to a number of factors, including an increased basal inhibitory state in the mutant and/or a

limiting amount of E2 ubiquitin conjugates in the cell, such that the rate of ubiquitin transfer can’t increase. Additionally, given that Serine-687 is completely conserved in all WW-HECT family members and lies in an invariant region of the

E2-binding domain, there may be subtle structural changes that make the E2-

HECT interaction less effective. What is clear is that the activity of this family of proteins is heavily regulated in the cell and that, when activated, ITCH downregulates a variety of signaling pathways, including the WNT signaling pathway and the TNF signaling pathway. This work adds a new dynamic to the signaling pathway by which the IKKs can more globally influence diverse signal transduction cascades.

3.5 Works cited in this chapter

Abbott, D.W., Wilkins, A., Asara, J.M., and Cantley, L.C. (2004). The Crohn's

disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of

a novel site on NEMO. Current biology : CB 14, 2217-2227.

Abbott, D.W., Yang, Y., Hutti, J.E., Madhavarapu, S., Kelliher, M.A., and Cantley,

L.C. (2007). Coordinated regulation of Toll-like receptor and NOD2

signaling by K63-linked polyubiquitin chains. Molecular and cellular

biology 27, 6012-6025.

Angers, A., Ramjaun, A.R., and McPherson, P.S. (2004). The HECT domain

ligase itch ubiquitinates endophilin and localizes to the trans-Golgi network

and endosomal system. The Journal of biological chemistry 279, 11471-

11479.

Chastagner, P., Israel, A., and Brou, C. (2006). Itch/AIP4 mediates Deltex

degradation through the formation of K29-linked polyubiquitin chains.

EMBO reports 7, 1147-1153.

Chen, Z.J., Parent, L., and Maniatis, T. (1996). Site-specific phosphorylation of

IκBα by a novel ubiquitination-dependent protein kinase activity. Cell 84,

853-862.

Gallagher, E., Gao, M., Liu, Y.C., and Karin, M. (2006). Activation of the E3

ubiquitin ligase Itch through a phosphorylation-induced conformational

change. Proceedings of the National Academy of Sciences of the United

States of America 103, 1717-1722.

Hatakeyama, S., Jensen, J.P., and Weissman, A.M. (1997). Subcellular

localization and ubiquitin-conjugating enzyme (E2) interactions of

mammalian HECT family ubiquitin protein ligases. Journal of Biological

Chemistry 272, 15085-15092.

Hayden, M.S., and Ghosh, S. (2012). NF-kappaB, the first quarter-century:

remarkable progress and outstanding questions. Genes & development

26, 203-234.

Hunter, T. (2007). The age of crosstalk: phosphorylation, ubiquitination, and

beyond. Molecular cell 28, 730-738.

Hutti, J.E., Porter, M.A., Cheely, A.W., Cantley, L.C., Wang, X., Kireev, D.,

Baldwin, A.S., and Janzen, W.P. (2012). Development of a high-

throughput assay for identifying inhibitors of TBK1 and IKKε. PloS one 7,

e41494.

Hutti, J.E., Shen, R.R., Abbott, D.W., Zhou, A.Y., Sprott, K.M., Asara, J.M., Hahn,

W.C., and Cantley, L.C. (2009). Phosphorylation of the tumor suppressor

CYLD by the breast cancer oncogene IKKepsilon promotes cell

transformation. Molecular cell 34, 461-472.

Hutti, J.E., Turk, B.E., Asara, J.M., Ma, A., Cantley, L.C., and Abbott, D.W. (2007).

IkappaB kinase beta phosphorylates the K63 deubiquitinase A20 to cause

feedback inhibition of the NF-kappaB pathway. Molecular and cellular

biology 27, 7451-7461.

Ingham, R.J., Gish, G., and Pawson, T. (2004). The Nedd4 family of E3 ubiquitin

ligases: functional diversity within a common modular architecture.

Oncogene 23, 1972-1984.

Jin, H.S., Park, Y., Elly, C., and Liu, Y.C. (2013). Itch expression by Treg cells

controls Th2 inflammatory responses. The Journal of clinical investigation 123, 4923-4934.

Krikos, A., Laherty, C.D., and Dixit, V.M. (1992). Transcriptional Activation of the

Tumor-Necrosis-Factor Alpha-Inducible Zinc Finger Protein, A20, Is

Mediated by Kappa-B Elements. Journal of Biological Chemistry 267,

17971-17976. 73

Liu, F., Xia, Y., Parker, A.S., and Verma, I.M. (2012). IKK biology. Immunological

reviews 246, 239-253.

Lopez-Pelaez, M., Lamont, D.J., Peggie, M., Shpiro, N., Gray, N.S., and Cohen,

P. (2014). Protein kinase IKKbeta-catalyzed phosphorylation of IRF5 at

Ser462 induces its dimerization and nuclear translocation in myeloid cells.

Proceedings of the National Academy of Sciences of the United States of

America 111, 17432-17437.

Marinis, J.M., Hutti, J.E., Homer, C.R., Cobb, B.A., Cantley, L.C., McDonald, C.,

and Abbott, D.W. (2012). IkappaB kinase alpha phosphorylation of TRAF4

downregulates innate immune signaling. Molecular and cellular biology 32,

2479-2489.

Matesic, L.E., Copeland, N.G., and Jenkins, N.A. (2008). Itchy mice: the

identification of a new pathway for the development of autoimmunity. In

Immunology, Phenotype First: How Mutations Have Established New

Principles and Pathways in Immunology (Springer), pp. 185-200.

Narimatsu, M., Bose, R., Pye, M., Zhang, L., Miller, B., Ching, P., Sakuma, R.,

Luga, V., Roncari, L., and Attisano, L. (2009). Regulation of planar cell

polarity by Smurf ubiquitin ligases. Cell 137, 295-307.

Obenauer, J.C., Cantley, L.C., and Yaffe, M.B. (2003). Scansite 2.0: Proteome-

wide prediction of cell signaling interactions using short sequence motifs.

Nucleic acids research 31, 3635-3641. 74

Ogura, H., Murakami, M., Okuyama, Y., Tsuruoka, M., Kitabayashi, C.,

Kanamoto, M., Nishihara, M., Iwakura, Y., and Hirano, T. (2008).

Interleukin-17 promotes autoimmunity by triggering a positive-feedback

loop via interleukin-6 induction. Immunity 29, 628-636.

Perkins, N.D. (2006). Post-translational modifications regulating the activity and

function of the nuclear factor kappa B pathway. Oncogene 25, 6717-6730.

Perry, W.L., Hustad, C.M., Swing, D.A., O'Sullivan, T.N., Jenkins, N.A., and

Copeland, N.G. (1998). The itchy locus encodes a novel ubiquitin protein

ligase that is disrupted in a18H mice. Nature genetics 18, 143-146.

Prabakaran, S., Lippens, G., Steen, H., and Gunawardena, J. (2012). Post‐

translational modification: nature's escape from genetic imprisonment and

the basis for dynamic information encoding. Wiley Interdisciplinary

Reviews: Systems Biology and Medicine 4, 565-583.

Ren, J., Chen, X., and Chen, Z.J. (2014). IKKbeta is an IRF5 kinase that

instigates inflammation. Proceedings of the National Academy of Sciences

of the United States of America 111, 17438-17443.

Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome-

wide libraries for CRISPR screening. Nature methods 11, 783-784.

Schwarz, S.E., Rosa, J.L., and Scheffner, M. (1998). Characterization of human

hect domain family members and their interaction with UbcH5 and UbcH7.

Journal of Biological Chemistry 273, 12148-12154.

Shembade, N., and Harhaj, E.W. (2012). Regulation of NF-kappaB signaling by

the A20 deubiquitinase. Cellular & molecular immunology 9, 123-130.

Shembade, N., Harhaj, N.S., Parvatiyar, K., Copeland, N.G., Jenkins, N.A.,

Matesic, L.E., and Harhaj, E.W. (2008). The E3 ligase Itch negatively

regulates inflammatory signaling pathways by controlling the function of

the ubiquitin-editing enzyme A20. Nature immunology 9, 254-262.

Shembade, N., Pujari, R., Harhaj, N.S., Abbott, D.W., and Harhaj, E.W. (2011).

The kinase IKKalpha inhibits activation of the transcription factor NF-

kappaB by phosphorylating the regulatory molecule TAX1BP1. Nature

immunology 12, 834-843.

Sun, S.-C., Ganchi, P.A., Ballard, D.W., and Greene, W.C. (1993). NF-kappa B

controls expression of inhibitor I kappa B alpha: evidence for an inducible

autoregulatory pathway. Science 259, 1912-1915.

Tao, M., Scacheri, P.C., Marinis, J.M., Harhaj, E.W., Matesic, L.E., and Abbott,

D.W. (2009). ITCH K63-ubiquitinates the NOD2 binding protein, RIP2, to

influence inflammatory signaling pathways. Current biology : CB 19, 1255-

1263.

Tigno-Aranjuez, J.T., Bai, X., and Abbott, D.W. (2013). A discrete ubiquitin-

mediated network regulates the strength of NOD2 signaling. Molecular

and cellular biology 33, 146-158.

Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003).

Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates

gastrulation movements. Current biology : CB 13, 680-685.

Wei, W., Li, M., Wang, J., Nie, F., and Li, L. (2012). The E3 ubiquitin ligase ITCH

negatively regulates canonical Wnt signaling by targeting dishevelled

protein. Molecular and cellular biology 32, 3903-3912.

Wilkins, A., Ping, Q., and Carpenter, C.L. (2004). RhoBTB2 is a substrate of the

mammalian Cul3 ubiquitin ligase complex. Genes & development 18, 856-

861.

You, F., Sun, H., Zhou, X., Sun, W., Liang, S., Zhai, Z., and Jiang, Z. (2009).

PCBP2 mediates degradation of the adaptor MAVS via the HECT ubiquitin

ligase AIP4. Nature immunology 10, 1300-1308.

Chapter 4: Phosphorylation of E3 reduces E2-E3 binding

The material in this chapter is adapted from a manuscript submitted to J. Biol.

Chem. (August 2017): Perez, J.M., Xiao, T., and Abbott, D.W. Phosphorylation impairs the binding between a HECT domain-containing E3 ligase and its cognate E2 conjugating enzyme.

Ubiquitin networks help dictate the strength and duration of inflammatory signaling. In innate immunity, the ITCH-A20 ubiquitin-editing complex inhibits RIP kinase activation by removing K63-linked polyubiquitinated chains from key proteins in the NF-κB signaling pathway. The complex then attaches polyubiquitinated chains to those proteins to target them for lysosomal or proteasomal destruction. ITCH is phosphorylated by IKKβ to tailor the inflammatory response to the strength of the offending signal, however the biochemical mechanism by which E3 ubiquitination is impaired by IKK-driven phosphorylation remains unclear. Here we show that this phosphorylation impedes ITCH binding to its cognate E2, UbcH7. Using CRISPR-Cas9 genetic knock-out to mimic the ITCH-UbcH7-inhibited state, we further show that genetic

UbcH7 deficiency phenocopies ITCH phosphorylation in regulating RIPK2 ubiquitination. Thus, phosphorylation can interrupt the binding of an E3 ubiquitin ligase to an E2 conjugating enzyme to prolong inflammatory signaling.

4.1 Introduction

As important as it is to initiate an inflammatory response, it is equally important to halt this response when it is no longer needed. A heightened and prolonged inflammatory response is implicated in the pathogenesis of diseases as diverse as Inflammatory Bowel Disease, Sepsis, Inflammatory Arthritis and many others(1-5). Given the importance of a well-regulated inflammatory response, it is not surprising that the body has evolved mechanisms designed to maintain inflammatory homeostasis. For instance, among the first genes transcribed upon NF-κB activation are those designed to limit NF-κB activation(6-

8). This sort of temporal self-limiting mechanism is crucial in tailoring the inflammation to the offending incident.

We have previously described a novel inflammatory feedback circuit involving a key protein kinase in the NF-κB pathway, IKKβ, and an E3 ubiquitin ligase, ITCH, that inhibits many inflammatory signaling cascades, most notably

TNF signaling and NOD2 signaling(9). ITCH acts in concert with the deubiquitinase, A20, to perform ubiquitin-editing functions. In this complex, A20 deubiquitinates K63 polyubiquitinated proteins and ITCH then attaches separate polyubiquitin chains that can subsequently target that protein for lysosomal or proteasomal degradation(5). The importance of this complex is manifest in vivo as A20-/- mice die within three weeks of birth of a massive, unregulated inflammatory response that includes severe colitis, severe ileitis and severe hepatitis(10). ITCH-/- mice likewise die of an inflammatory disease as they develop severe pneumonitis and severe gastritis(11-13). Patients with ITCH

mutations likewise develop inflammatory disease with lung inflammation, nephritis and inflammatory bowel disease(14). Thus, not only is this pathway important in limiting acute signaling, but also in maintaining inflammatory homeostasis in vivo.

Our previous work established that IKKβ, a key kinase in the NF-κB pathway, phosphorylates both A20 and ITCH. A20 phosphorylation limits its ability to function as a deubiquitinase(15), and ITCH phosphorylation inhibits its E3 ligase activity(9). This feed-forward inflammatory pathway allows the strength of IKKβ kinase activity to dictate the duration of inflammatory response, and as such, when TNF signaling is genetically removed from ITCH mice, the inflammatory phenotype of the ITCH mouse is diminished(9). While we understand the consequences of ITCH phosphorylation at the cell biological level and on the organismal level, the biochemical mechanism by which IKKβ phosphorylation of

ITCH inhibits its E3 ligase activity is unknown. In this work, we show that phosphorylation of ITCH causes a static interruption that diminishes its affinity for the E2 and this manifests in attenuated E3 ubiquitin ligase activity. Genetically removing the E2, UbcH7, phenocopies ITCH phosphorylation and therefore provides genetic evidence for the mechanism by which ITCH and phosphorylation by IKKβ alters its biochemical activity. To our knowledge, this is the first instance in which phosphorylation of an E3 ligase inhibits its ubiquitin ligase activity through impairment of the formation of an E2-E3 complex.

4.2 Materials and methods

4.2.1 Cell culture, transient transfection and immunoprecipitation/pull-down

HEK 293T (CRL-1573; American Type Culture Collection) cells were grown in

DMEM 10% SCS with 1% penicillin/streptomycin. HEK 293T cells were transfected with respective plasmids using a standard calcium phosphate transfection protocol and lysed 20-24 hours post transfection. Cells were lysed in

Triton Lysis Buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton X-100, 1 mM

EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate,

5 mM iodoacetimide, 5 mM N-ethylmaleimide) with the following additives:

Calyculin, Protease Inhibitor Cocktail, 1 mM PMSF, 1µM Na3VO4. Streptavidin or anti-FLAG Affinity gel beads (Sigma-Aldrich) were used in pull down assays and co-Immunoprecipitations and incubated at 4 °C overnight. Precipitated proteins on beads were washed in buffer of lysis, under stringent conditions (1% SDS,

500 mM NaCl) four times before boiling in a 2 × Laemmli sample buffer.

Immunoprecipitation with Anti-UBE2L3 (Cell Signaling Technology) was performed as per the manufacturer’s protocol with Protein A/G PLUS Agarose beads (Santa Cruz Biotechnology).

4.2.2 Western blotting

Samples were run through SDS-PAGE and transferred to nitrocellulose. (See

Supplemental Materials and Methods for antibody resources.) Blocking and primary antibody dilution was performed as per the manufacturer’s instruction.

4.2.3 Protein purification and SPR

The HECT domain of ITCH was Gibson-cloned into a bacterial expression vector encoding a GST-fusion tag and transformed into BL21 (DE3) codon plus

RIPL cells (Agilent Technologies, Santa Clara, CA). UbcH7 was cloned into the pTrcHis bacterial expression vector and transformed into the same BL21 cells.

The transformed BL21 cells were grown at 37 °C and protein expression was induced at 18 °C overnight with 0.5 mM IPTG. Cells were harvested and lysed by sonication in a lysis buffer containing 25 mM Tris-HCl (pH 8.0), 150 mM NaCl.

The ITCH HECT domains were purified using Glutathione agarose and the

UbcH7 was purified using Ni-NTA beads. Buffer exchange was performed on the

ITCH HECT domains for immobilization compatibility (10 mM HEPES, 150 mM

NaCl, pH 7.4). The wildtype or mutant GST-HECT domain was immobilized through amine coupling using an Amine Coupling Kit (GE Healthcare Life

Sciences), and the purified UbcH7 protein was flown over the immobilized HECT domain. The running buffer contained 25 mM Tris pH 8.0, 100 mM NaCl and 1 mM DTT. KD values were determined by kinetic fit with a heterogeneous ligand binding model.

4.2.4 Lentiviral transduction, CRISPR Resistant UbcH7 Construct

LentiCRISPR V2(33) was customized with Guide 1 targeting UbcH7 (F: 5’ -

CCGAAGCGGGTGCTCAGGCT - 3’, R: 5’ - AGCCTGAGCACCCGCTTCGG -

3’). To make lentivirus, LentiCRISPR V2, psPAX and pMD.2 were transfected into

HEK 293T cells using a standard calcium phosphate transfection protocol. Media was harvested two days post-transfection, cleared, and filtered through a .45 µm

filter. Polybrene was added to the media prior to infecting target cells. Puromycin selection media was added 3 days after target cell infection with the CRISPR lentivirus and cells were split at a low concentration to facilitate selection of individual colonies. 6 clones were pooled to create the Ubch7-/- cell line for experiments. To create a CRISPR-resistant UbcH7 construct (Myc-UbcH7 NGX), primers were designed to silently mutate the –NGG pam sequence (F: 5' -

GGTGAATGACCCACAGCCTGAGCAC - 3', R: 5' –

GTGCTCAGGCTGTGGGTCATTCACC - 3'). Linear DNA was transformed into

Stbl3 cells for colony selection and sequencing confirmation.

4.3 Results and discussion

4.3.1 ITCH phosphorylation impairs UbcH7 binding

We have previously shown that IKKβ phosphorylates ITCH on Serine 687 within the HECT domain(9). Given the structural homology of HECT domains in general, we used the crystal structure of HECT domain-containing protein, E6AP, complexed with an E2 ubiquitin conjugating enzyme, UbcH7 (PDB: 1C4Z)(16), to model the effects of phosphorylation and mutagenesis on ITCH Serine 687.

Figure 4.1 shows structure of E6AP-UbcH7 complex and models for the ITCH-

UbcH7 complex. The E6AP residue S638 is located at the E2-E3 interface, where it forms a hydrogen bond with the main chain carbonyl of the UbcH7 residue F63 from its L1 specificity loop (Figure 4.1A, top left panel). F63 in

UbcH7 has been reported to make significant contribution to the E2-E3 interaction(16,17). In the modeled structure of an ITCH-UbcH7 complex, residue 83

S687 of ITCH forms a similar hydrogen bond with the main chain carbonyl oxygen of F63 from UbcH7 (Figure 4.1A, top right panel). To examine the effects of phospho-ITCH and phosphomimetic S687D ITCH, we modeled each structure, which revealed significant clash between F63 of UbcH7 and D687 or pS687 from

ITCH (Figure 4.1A, lower panels). Because both models exhibit interruption of a main chain to side chain hydrogen bond, and significant steric hindrance at the

E2-E3 interface, it is likely that the ITCH-UbcH7 interaction would be impaired upon S687 phosphorylation (Figure 4.1A).

To test this prediction, HEK293T cells were transfected with FLAG-tagged

ITCH and Omni-tagged UbcH7. Immunoprecipitation showed that while wildtype

ITCH strongly bound UbcH7, the S687D phosphomimetic did not (Figure 4.1B).

We would then predict that upon IKK activation, the endogenous ITCH-UbcH7 interaction would be diminished. To test this, HEK293T cells were stimulated with

TNFα for the indicated time points corresponding to IKK activation. TNFα is a potent activator of IKKs(18), and has been shown to promote ITCH phosphorylation(9). UbcH7 was immunoprecipitated and analyzed for co- precipitating endogenous ITCH. We observed robust activation of IKKα/β, which was accompanied by a decrease in ITCH-UbcH7 binding (Figure 4.1C). To then investigate difference in UbcH7 binding by wildtype or mutant ITCH, we purified

UbcH7 and the recombinant HECT domains of ITCH and phosphomimetic

S687D ITCH (Supplemental Figure 4.1) for surface plasmon resonance (SPR) experiments. Full-length ITCH and ITCHHECT bind UbcH7 with similar affinity(19).

Wild type ITCHHECT and S687D ITCHHECT were immobilized on an SPR chip and

tested for binding to recombinant UbcH7. ITCHHECT was found to have a stronger binding affinity of 3.69 µM, while ITCH S687DHECT had a weaker 18.38 µM affinity

(Figure 4.1D, right panels). The affinity of the ITCHHECT-UbcH7 association was similar to those of E6APHECT-UbcH7 previously measured by Fluorescence

Polarization and Isothermal Titration Calorimetry (5.0 µM and 2.2 µM, respectively)(17). These experiments strongly suggest that unmodified Serine

687 in ITCH is required for optimal binding to UbcH7, and that a phosphomimetic mutation at this site can impair affinity for UbcH7.

Figure 4.1 Phosphorylation disrupts UbcH7 Binding.

(A.) The structure of the E6AP-UbcH7 complex (1C4Z) is shown to the left of the panel series with the E6AP HECT domain colored cyan and UbcH7 colored yellow. The upper panel highlights the E6AP-UbcH7 interface near E6AP residue

S638 at the H7 helix, which forms a side chain to main chain hydrogen bond with

UbcH7 residue F63 at the L1 loop. To model the ITCH-UbcH7 interface, the structure of the ITCH HECT domain (3TUG, colored green) is superimposed onto the E6AP HECT domain within the E6AP-UbcH7 complex and shown at the upper right panel. Similar to the E6AP residue S638, the ITCH residue S687 is predicted to form the same side chain to main chain hydrogen bond with the

UbcH7 residue F63. Mutation of S687 to Asp (lower left) or phosphorylation of 86

S687 (lower right) would lead to loss of the hydrogen bond and significant steric hindrance at the E2-E3 interface, thus severely impair ITCH-UbcH7 interaction.

(B.) HEK 293T cells were transfected with FLAG-ITCH and FLAG-ITCH S687D alone or with Omni-UbcH7 for co-precipitation. FLAG-ITCH was immunoprecipitated (IP) in each sample. After stringent washing of IP samples, lysate and IP samples were ran on SDS-PAGE, transferred to nitrocellulose, and probed as indicated. Similar results were obtained in three independent experiments. (C.) HEK 293T cells were stimulated with 1µg/mL TNFα for the indicated time points and UbcH7 was immunoprecipitated. After gentle washing, lysate and IP samples were processed by Western technique. Membranes were probed as indicated. Similar results were obtained in two independent experiments (D.) Biacore SPR sensorgrams for binding of UbcH7 to wildtype or

S687D mutant ITCH.

Figure 4.1.1 HECT domains and UbcH7 were purified for SPR

Supplemental (Related to Figure 4.1) (A.) Protein fractions were taken during purification of GST-ITCH and GST-ITCH S687D HECT domains and run on SDS-

PAGE gels stained with Coomassie Brilliant Blue R-250 (Amresco). Fractions E1-

E3 for the ITCH HECT domains were pooled and concentrated on an Amicon

Ultra-15 10K Centrifugal Filter Device for use in SPR Experiments. (B.) Purified

UbcH7 was boiled in 2 × Laemmli sample buffer before running 10, 5, and 2.5 µg on an SDSPAGE gel and staining with Coomassie (as in A.).

4.3.2 Genetic deletion of UbcH7 phenocopies phosphorylation of ITCH

Given that phosphorylation of ITCH appears to alter UbcH7 binding, we reasoned that genetic deletion of UbcH7 may phenocopy the phosphorylation of

ITCH. In particular, we anticipated that UbcH7 deficiency would lead to prolonged inflammatory signaling and loss of RIPK2 ubiquitination by ITCH. To test this,

UbcH7 was genetically deleted from HEK293T cells using CRISPR-Cas9 lentiviral transduction with a puromycin resistant-containing vector. Transduced cells were puromycin-selected and individual clones were isolated, tested for

UbcH7 knockout, and pooled as the UbcH7-/- cell line. Due to the fact that the same antibody often detects UbcH7 and UbcH8, lysates were probed with 2 antibodies confirmed to detect human UbcH7 (labeled as UBE2L3 and UbcH7, see Supplemental Materials and Methods). Both antibodies showed depletion of

UbcH7 in the pooled clonal CRISPR cell line (Figure 4.2A). To next test for prolonged inflammatory signaling, we stimulated both the Neg control cells and the UbcH7-/- cells with 10 ng/mL TNFα for the indicated times and queried lysates for downstream signaling. In Neg control cells, there was quick resolution of the phospho p105 signal in comparison to the prolonged phospho p105 signal in the

UbcH7-/- cells (Figure 4.2B). This signaling defect mimics the prolonged signaling in cells with ITCH S687D(9) and the prolonged signaling observed by other labs in ITCH-/- cells(5,20,21). To then test the ability of ITCH to ubiquitinate the exogenous ligand, RIPK2, we transiently transfected HA-tagged Ubiquitin, NTAP-

RIPK2, and FLAG-ITCH or FLAG-ITCH C830A. Streptavidin pulldown of NTAP-

RIPK2 revealed more ITCH-ubiquitinated RIPK2 in the control cell line as

compared to the UbcH7-/- cell line (Figure 4.2C), phenocopying the effect of ITCH phosphorylation(9). In a similar experiment, we replaced UbcH7 within the

UbcH7-/- cell line using a CRISPR-resistant Myc-UbcH7 NGX construct to recover

RIPK2 ubiquitination by ITCH (Figure 4.2D). Thus, genetic loss of UbcH7 phenocopies IKKβ phosphorylation of ITCH, and provides independent experimental verification that phosphorylation-mediated uncoupling of an E2-E3 interaction is physiologically relevant.

Figure 4.2 UbcH7 deficiency phenocopies ITCH phosphorylation.

(A.) HEK 293T cells were transduced with Lentivirus containing CRISPR Cas9 with either a negative control-RNA guide, or UbcH7 Guide 1-RNA. Lysate from pooled select UbcH7-/- clones was ran next to controls on SDS-PAGE and probed for UbcH7 and GAPDH as shown. (B.) Negative control and UbcH7-/- HEK 293T cells were stimulated with 10 ng/mL TNFα for the indicated time points. Lysates were standardized for total protein and analyzed and subjected to SDS-PAGE and Western blot analysis. (C.) Negative control and UbcH7-/- HEK 293T cells were transiently transfected with HA-Ubiquitin, NTAP-RIPK2, and ITCH or ITCH

C830A to assess ITCH ubiquitination of RIPK2. Cellular lysates were collected and cleared. Streptavidin beads were used to pull down RIPK2 via SBP tag

within the NTAP tag. Samples were analyzed by Western blot. (D.) UbcH7-/- HEK

293T cells were transiently transfected with HA-Ubiquitin, NTAP-RIPK2, FLAG-

ITCH, FLAG-ITCH C830A and Myc-UbcH7. NTAP was precipitated as in C.

Samples were run on SDS-PAGE next to WT samples that were similarly transfected. Samples were subjected to Western blot analysis as indicated.

Results shown are representative of 3 independent experiments.

4.3.3 Conclusions

The link between ubiquitination and phosphorylation is well known(22-24).

The NF-κB inhibitor protein, IκBα, for instance, is phosphorylated on S32 and

S36 such that it can be ubiquitinated and targeted to the proteasome(24,25). Cell cycle re-entry and mitotic advancement proceed through similar systems(26,27).

While it is well recognized that phosphorylation can recruit E3 ligases to a target(18,27-29), it has yet to be shown that phosphorylation can alter E2-E3 binding. Coupled with our prior manuscript, our work shows that IKKβ phosphorylation of ITCH uncouples E2-E3 binding and can prolong inflammatory signaling. This work thus provides a new mechanism by which signal transduction output can be tailored to the stimulus.

4.5 Works cited in this chapter

1. Podolsky, D. K. (2002) Inflammatory bowel disease. The New England

journal of medicine 347, 417-429

2. Wiersinga, W. J., Leopold, S. J., Cranendonk, D. R., and van der Poll, T.

(2014) Host innate immune responses to sepsis. Virulence 5, 36-44

3. Baker, R. G., Hayden, M. S., and Ghosh, S. (2011) NF-kappaB,

inflammation, and metabolic disease. Cell metabolism 13, 11-22

4. Arend, W. P. (2001) Cytokine imbalance in the pathogenesis of

rheumatoid arthritis: the role of interleukin-1 receptor antagonist. Seminars

in arthritis and rheumatism 30, 1-6

5. Shembade, N., Harhaj, N. S., Parvatiyar, K., Copeland, N. G., Jenkins, N.

A., Matesic, L. E., and Harhaj, E. W. (2008) The E3 ligase Itch negatively

regulates inflammatory signaling pathways by controlling the function of

the ubiquitin-editing enzyme A20. Nature immunology 9, 254-262

6. Krikos, A., Laherty, C. D., and Dixit, V. M. (1992) Transcriptional Activation

of the Tumor-Necrosis-Factor Alpha-Inducible Zinc Finger Protein, A20, Is

Mediated by Kappa-B Elements. Journal of Biological Chemistry 267,

17971-17976

7. Smith, M. F., Jr., Eidlen, D., Arend, W. P., and Gutierrez-Hartmann, A.

(1994) LPS-induced expression of the human IL-1 receptor antagonist

gene is controlled by multiple interacting promoter elements. Journal of

immunology 153, 3584-3593

8. Sun, S.-C., Ganchi, P. A., Ballard, D. W., and Greene, W. C. (1993) NF-

kappa B controls expression of inhibitor I kappa B alpha: evidence for an

inducible autoregulatory pathway. Science 259, 1912-1915

9. Perez, J. M., Chirieleison, S. M., and Abbott, D. W. (2015) An IkappaB

Kinase-Regulated Feedforward Circuit Prolongs Inflammation. Cell reports

12, 537-544

10. Lee, E. G., Boone, D. L., Chai, S., Libby, S. L., Chien, M., Lodolce, J. P.,

and Ma, A. (2000) Failure to regulate TNF-induced NF-kappaB and cell

death responses in A20-deficient mice. Science 289, 2350-2354

11. Perry, W. L., Hustad, C. M., Swing, D. A., O'Sullivan, T. N., Jenkins, N. A.,

and Copeland, N. G. (1998) The itchy locus encodes a novel ubiquitin

protein ligase that is disrupted in a18H mice. Nature genetics 18, 143-146

12. Matesic, L. E., Copeland, N. G., and Jenkins, N. A. (2008) Itchy mice: the

identification of a new pathway for the development of autoimmunity. in

Immunology, Phenotype First: How Mutations Have Established New

Principles and Pathways in Immunology, Springer. pp 185-200

13. Melino, G., Gallagher, E., Aqeilan, R. I., Knight, R., Peschiaroli, A., Rossi,

M., Scialpi, F., Malatesta, M., Zocchi, L., Browne, G., Ciechanover, A., and

Bernassola, F. (2008) Itch: a HECT-type E3 ligase regulating immunity,

skin and cancer. Cell death and differentiation 15, 1103-1112

14. Lohr, N. J., Molleston, J. P., Strauss, K. A., Torres-Martinez, W., Sherman,

E. A., Squires, R. H., Rider, N. L., Chikwava, K. R., Cummings, O. W.,

Morton, D. H., and Puffenberger, E. G. (2010) Human ITCH E3 ubiquitin

ligase deficiency causes syndromic multisystem autoimmune disease.

American journal of human genetics 86, 447-453

15. Hutti, J. E., Turk, B. E., Asara, J. M., Ma, A., Cantley, L. C., and Abbott, D.

W. (2007) IkappaB kinase beta phosphorylates the K63 deubiquitinase

A20 to cause feedback inhibition of the NF-kappaB pathway. Molecular

and cellular biology 27, 7451-7461

16. Huang, L., Kinnucan, E., Wang, G., Beaudenon, S., Howley, P. M.,

Huibregtse, J. M., and Pavletich, N. P. (1999) Structure of an E6AP-UbcH7

complex: insights into ubiquitination by the E2-E3 enzyme cascade.

Science 286, 1321-1326

17. Eletr, Z. M., and Kuhlman, B. (2007) Sequence determinants of E2-E6AP

binding affinity and specificity. Journal of molecular biology 369, 419-428

18. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J.,

Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997)

IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-

kappaB activation. Science 278, 860-866

19. Riling, C., Kamadurai, H., Kumar, S., O'Leary, C. E., Wu, K. P., Manion, E.

E., Ying, M., Schulman, B. A., and Oliver, P. M. (2015) Itch WW Domains

Inhibit Its E3 Ubiquitin Ligase Activity by Blocking E2-E3 Ligase Trans-

thiolation. The Journal of biological chemistry 290, 23875-23887

20. Tao, M., Scacheri, P. C., Marinis, J. M., Harhaj, E. W., Matesic, L. E., and

Abbott, D. W. (2009) ITCH K63-ubiquitinates the NOD2 binding protein,

RIP2, to influence inflammatory signaling pathways. Current biology : CB

19, 1255-1263

21. You, F., Sun, H., Zhou, X., Sun, W., Liang, S., Zhai, Z., and Jiang, Z.

(2009) PCBP2 mediates degradation of the adaptor MAVS via the HECT

ubiquitin ligase AIP4. Nature immunology 10, 1300-1308

22. Hunter, T. (2007) The age of crosstalk: phosphorylation, ubiquitination, and

beyond. Molecular cell 28, 730-738

23. Tigno-Aranjuez, J. T., and Abbott, D. W. (2012) Ubiquitination and

phosphorylation in the regulation of NOD2 signaling and NOD2-mediated

disease. Biochimica et biophysica acta 1823, 2022-2028

24. Karin, M., and Ben-Neriah, Y. (2000) Phosphorylation meets ubiquitination:

the control of NF-κB activity. Annual review of immunology 18, 621-663

25. Perkins, N. D. (2006) Post-translational modifications regulating the

activity and function of the nuclear factor kappa B pathway. Oncogene 25,

6717-6730

26. King, R. W., Deshaies, R. J., Peters, J.-M., and Kirschner, M. W. (1996)

How Proteolysis Drives the Cell Cycle. Science 274, 1652-1659

27. Fraser, J. A., Vojtesek, B., and Hupp, T. R. (2010) A novel p53

phosphorylation site within the MDM2 ubiquitination signal: I.

phosphorylation at SER269 in vivo is linked to inactivation of p53 function.

The Journal of biological chemistry 285, 37762-37772

28. Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J., and Harper, J. W.

(1997) F-box proteins are receptors that recruit phosphorylated substrates

to the SCF ubiquitin-ligase complex. Cell 91, 209-219

29. Wei, W., Li, M., Wang, J., Nie, F., and Li, L. (2012) The E3 ubiquitin ligase

ITCH negatively regulates canonical Wnt signaling by targeting

dishevelled protein. Molecular and cellular biology 32, 3903-3912

Chapter 5: Conclusions and Future Directions

5.1 Introduction: Scope of work

This study employed a dual bioinformatic and proteomic approach to identify novel substrates of IKKs. Peptide substrate array analysis allowed identification of the IKK phosphorylation motif, and thus, provided a template with which to generate a polyclonal antibody that recognized the phosphorylated motif on potential substrates. Our bioinformatic screening highlighted a family of WW

Domain-containing HECT E3 ubiquitin ligases with a conserved phosphoacceptor. Within this family of proteins, we focused on ITCH. We confirmed that all IKKs (IKKα, IKKβ, TBK1, and IKKε) targeted ITCH for phosphorylation. We also explored the effect of phosphorylation on ITCH ubiquitin ligase activity and binding to UbcH7, and revealed the mechanism by which ITCH activity was altered.

Previously, it was not known that ITCH was a substrate of IKKs and IKK- related kinases, or even that phosphorylation on ITCH S687 affects ubiquitin ligase activity. This dissertation presents novel insights into a mechanism of prolonged inflammation where an E3 ubiquitin ligase, ITCH, is phosphorylated to directly block interaction with an E2 conjugating enzyme, UbcH7. Overall, the work suggests that ITCH phosphorylation at S687 is a mechanism to prolong the inflammatory response. This chapter presents discussion on future directions, therapeutic implications, and closing remarks. First, future directions are highlighted.

5.2 Future directions

Over the course of this study, the following questions have risen: What is the phenotype of a mouse reconstituted with phospho-mimetic, mutant ITCH? Are other related E3 ubiquitin ligases phosphorylated by the IKKs or IKK-related kinases? Are other E3 ubiquitin ligases phosphorylated to block interaction of E2 conjugating enzymes? Can a point mutation on UbcH7 accommodate the negatively charged bulk of a phospho-group? Can adapter protein NDFIP1 recover loss of ubiquitin activity on ITCH S687D phosphomimetic? The following section discusses these potential future directions.

5.2.1 In vivo reconstitution with phosphomimetic ITCH

A direct follow-up of this study involves generation of phospho-mimetic mutant mice generated on the ITCH-/- background. If we reconstituted ITCH-/- with S687D

ITCH, we would expect the inflammatory phenotype to remain the same as ITCH-

/- mice. While cellular upregulation of NDFIP1 in some tissues might recover some ITCH function (as indicated in section 5.2.5), ITCH activity on other substrates would not be efficacious in attenuating inflammatory signaling. We would expect a phenotype similar to that of the ITCH-/- mice.

5.2.2 IKK and IKK-related Kinase phosphorylation of other CWD ubiquitin ligases

Moving forward, IKK phosphorylation of other CWD ubiquitin ligases should be investigated. The IKK phosphorylated serine is within a highly conserved region of the HECT domain, and because the flanking residues are also conserved (Figure 5.1A), we have reason to believe that IKK phosphorylation

can similarly regulate other CWD family members. Preliminary data probing

WWP1, WWP2, and Nedd4 with the custom IKK substrate antibody indicates that the IKK-related kinases, IKKε and TBK1 phosphorylate Nedd4 in transient transfection (Figure 5.1B). The context of Nedd4 phosphorylation by the viral- signaling, IKK-Related Kinases may be different than that of ITCH(1).

We should further investigate phosphorylation of Nedd4 by IKK-Related

Kinases. Phosphorylation may also affect the E2-E3 interaction between Nedd4 and its cognate E2 enzymes. Considering that IKKs phosphorylate ITCH to modulate the E2-E3 binding interaction, we would expect inhibition of ubiquitin ligase activity on Nedd4. The IKK-related kinases are activated upon detection of viral infection or viral components. That Nedd4 is specifically phosphorylated by the viral-signaling IKK-Related Kinases begs the question: What stimuli promote endogenous phosphorylation of Nedd4? What is the signaling outcome?

Considering IKK mediated phosphorylation of ITCH, we would expect a prolonged inflammatory response as a result of viral infection. However, Nedd4 has roles in viral egress(2). IKK-related kinases may be indirectly inhibiting viral egress through phosphorylation of Nedd4.

100

A. IKK Phospho- Motif

F/Y/M – X – pS – L/I/M IKK Substrate Antibody Recognition

E2 Interaction Region within the HECT Domain (highlighted residues required) B. FLAG-ITCH + - + - + - + - + HA-NEDD4 + - + - + - + - + GST-IKKα - + + ------GST-IKKα - + + ------GST-IKKβ - - - + + - - - - GST-IKKβ - - - + + - - - - GST-IKKε - - - - - + + - - GST-IKKε - - - - - + + - - GST-TBK1 ------+ + GST-TBK1 ------+ + IP: FLAG IP: HA Blot: IKK Substrate Blot: IKK Substrate

IP: FLAG IP: HA Blot: FLAG Blot: Nedd4

Lysate Lysate Blot: GST Blot: GST

NTAP-WWP1 + - + - + - + - + NTAP-WWP1NTAP-WWP2 + - + - + - + - + GST-IKKα - + + ------GST-IKKα - + + ------Positive Positive GST-IKKβ - - - + + - - - - GST-IKKβ - - - + + - - - - Control Control GST-IKKε - - - - - + + - - GST-IKKIKKε - - - - - + + - - GST-TBK1 ------+ + GST-TBK1 ------+ +

IP: NTAP IP:IP: NTAPNTAP Blot: IKK Substrate Blot:Blot: IKKIKK Substrate

IP: NTAP IP:IP: NTAPNTAP Blot: CBP Blot:Blot: CBPCBP

Lysate LysateLysate * Blot: GST Blot:Blot: GSTGST

Figure 5.1 Phosphorylation on other CWD ubiquitin ligases

A. Sequence alignment of the E2 interacting region of the CWD ubiquitin ligases.

B. Co transfection of IKKs and CWD ubiquitin ligases to determine IKK-mediated phosphorylation. Methods used are in Chapter 3. *Indicates wrong sample was loaded in the wrong lane.

101

5.2.3 UbcH7 point mutation to chemically accommodate phosphoITCH S687

Another pivot point is to investigate whether changing the F63 residue on

UbcH7 can recover phospho-ITCH binding and enzymatic activity. While the interacting group is on the main chain of the peptide, a change in residue may allow for coordination of the extra bulk on ITCH phosphoS687. Upon examination of multiple E2 sequence alignments within the Loop 4 region of E2 conjugating enzymes, we have determined 4 residues which occur naturally and should leave the protein structure intact while recovering binding(3) (Table 5.1). The four residues are serine, histidine, asparagine, and tyrosine, and can be found at the

F63 position on Ubc9, Ubc12, Rad6b, and UbcH10, respectively. These are all amino acids that have both hydrogen donor and acceptor atoms in their side chains. Based on charge, we expect that histidine might be more likely to accommodate the pS687 or S687D on ITCH.

In a preliminary experiment, the four UbcH7 F63 mutant constructs were made on a CRISPR resistant Myc-tagged UbcH7. Each mutant UbcH7 mutant construct was transfected into UbcH7-/- cells with HA-Ub, NTAP-RIPK2, and

ITCH S687D. RIPK2 was pulled down to compare levels of substrate ubiquitination (Figure 5.2). Ubiquitination comparable to WT ITCH levels was detected in UbcH7 F63H-transfected cells, indicating that positive charge may be accommodating the phosphomimetic bulk. Follow-up on this experiment should be performed.

102

UBCH7 Mutation E2 with this residue at Molecule Hydrogen Hydrogen

on F63 this relative position Transferred Donor Acceptor

S Ubc9 SUMO-1 Yes Yes

H Ubc12 NEDD8 Yes Yes

N Rad6b Ubiquitin Yes Yes

Y UbcH10 Ubiquitin Yes Yes

Table 5.1 Potential UbcH7 Mutants to accommodate binding to phosphoITCH

103

HA-Ubiquitin+ + + + + + + + + + + NTAP-RIPK2+ + - - + + + + + + + FLAG-ITCH+ - - - - + - - - - - FLAG-ITCH- S687D + - - - - + + + + + Omni-UbcH7- -NGX - + + + + - - - - Omni-UbcH7 NGX,- F63H------+ - - - Omni-UbcH7 NGX,- -F63Y ------+ - - Omni-UbcH7 NGX,- -F63S ------+ - Omni-UbcH7 NGX,- F63N------+

HA Modified RIPK2

RIPK2 Pull down: down: Pull Streptavidin Streptavidin RIPK2 RIPK2

Myc UbcH7

FLAG ITCH Lysate Lysate HA

UbcH7-/- HEK 293T Figure 5.2 F63H recovers RIP2 ubiquitination by ITCH S687D

CRISPR UbcH7-/- HEK293T cells were transfected with HA-Ubiquitin, NTAP-

RIPK2, ITCH S687D or ITCH WT, and CRISPR resistant WT or mutant UbcH7.

RIPK2 was pulled down with streptavidin beads via the NTAP tag and precipitated protein was washed stringently. Samples were run on SDS PAGE and analyzed via Western blot analysis. Blots were probed as indicated. Detailed methods are described in Chapter 3.

104

5.2.4 NDFIP1 recovery of phosphoITCH Ubiquitin ligase activity

NDFIP1 is known to bind to ITCH(4) and to interact with UbcH7(5). Could

NDFIP1 be serving as an adapter protein to assist in binding between phospho-

ITCH and UbcH7? Preliminary data has indicated that both binding and autoubiquitination of IKK-phosphorylated ITCH is recovered in the presence of overexpressed NDFIP1 adapter protein (Figure 5.3). In this pair of experiments,

Myc-tagged NDFIP1 was transiently transfected into HEK 293T cells along with

ITCH or ITCH S687D. First we demonstrate increased binding between ITCH and ITCH S687D in the presence of NDFIP1 (Figure 5.3A). This is performed by immunoprecipitation of ITCH and probing for UbcH7. Next, we demonstrate indication of recovered autoubiquitination in a ubiquitination assay. As in Figure

5.3A, S687D ITCH was immunoprecipitated in the absence or presence of

NDFIP1 and then probed for conjugated Ubiquitin. Ubiquitination was detected on ITCH S687D in the presence of NDFIP1.

Because different chain linkages can confer different signaling activities(6), and because ITCH can produce polyubiquitin chains with differing linkages it would also be important to compare ubiquitin chain linkage formation between basal state ITCH and phosphoITCH with NDFIP1. This could be performed in ubiquitination assays with mutant Ubiquitin, or with Ubiquitin Chain Restriction

(UbiCRest) analysis. UbiCRest utilizes the specificity of deubiquitinases for ubiquitin bonds to map the composition of ubiquitin chain linkages.

Deubiquitinase-digest total protein products are compared over time. For example, OTUB1 deubiquitinase specifically cleaves ubiquitin chains linked at

105

Myc-NDFIP1 + + + + + - - FLAG-ITCH + - - + - + - FLAG-ITCH S687D - + - - + - + Omni-UBCH7 - - + + + + + IP: FLAG Immunoprecipitated Blot: Omni (Rbt) UbcH7

Lysate Blot: Omni (Rbt) UbcH7

IP: FLAG Blot: FLAG (Rbt) ITCH / ITCH S687D

Lysate Blot: Myc (Rbt) NDFIP1

HA-Ubiquitin + + + + + B. FLAG-ITCH - + - + - FLAG-ITCH S687D - - + - + Myc-NDFIP1 - - - + +

Blot: ITCH (Rbt) ITCHITCH / ITCH S687D IP: FLAG FLAG IP:

Blot: Myc (Rbt) NDFIP1NDFIP1 Lysate Lysate Blot: Actin

Figure 5.3 NDFIP1 recovers ITCH binding and ubiquitination to UbcH7

Shown are Western blots from cotransfection experiments in HEK 293T cells.

Methods are described in Chapter 3. A. Binding experiment between ITCH and

UbcH7. Binding was performed in the absence and presence of NDFIP1. ITCH was immunoprecipitated via its FLAG tag and compared in the absence and presence of NDFIP1. B. As in A. Ubiquitin smears patterns are observed.

106

K48 on ubiquitin(7). Digestion over time would reveal a decrease in ubiquitinated substrate if the substrate were ubiquitinated with a majority of K48- linked chains. Similarly, the deubiquitinase OTUD3 has preference for cleaving

K6- and K11- linked di-ubiquitin(7). This technique could be used to investigate the composition of ubiquitin linkages made by ITCH S687D in the presence of

NDFIP1.

5.3 Therapeutic implications

Based on feed-forward properties in chronic inflammation, it would seem that the most direct approach in treating inflammation would be to pharmacologically inhibit IKKs. Targeting IKKs could restore the inflammatory attenuator function of

ITCH and possibly promote homeostasis. Such an approach is in line with previous therapeutic trends. Since the late 1990s, protein kinases have become increasingly established as clinical targets(8). The nature of receptor tyrosine kinases and protein kinases as signaling initiators and hubs, respectively, has made them prime candidates for modulation in cancer, inflammatory disease and autoimmunity(9).

While inhibitors typically undergo target-directed chemical optimization, specificity and toxicity still present challenges for inhibiting IKKs in the clinical setting(10-12). Researchers have also sought other nodal points to inhibit downstream of the IKKs in the inflammatory cascade. An example is dual specificity Serine/Threonine, Tyrosine Kinase, RIPK2. Small molecule-inhibition of RIPK2 has shown favorable results in alleviating inflammation in mouse

107

models of peritonitis and Crohn’s Disease (13) and could have potential for use in other inflammatory diseases.

While the trends of pharmacoinhibition during the 1990s and 2000s leaned heavily on inhibiting kinases(8), our increased understanding of the ubiquitin proteasome system has presented a new theme of candidate targets(14).

5.3.1 Targeting the ubiquitin system for inhibition

In an article reviewing the current state of development for ubiquitin as a therapeutic target, Huang and Dixit highlight that complexity within the ubiquitin system presents many potential mechanisms for targeting. Of which, i) blocking the release of ubiquitin and ii.) blocking the E2 thioester conjugation of ubiquitin on E3 ligases seem to be the most immediately applicable(8). Additionally, targeting of the E3 ubiquitin ligases—in comparison to other ubiquitin system components—has the advantage of increased specificity and lowered toxicity.

Drug development for each approach might entail screening and identification of ubiquitin analogues to target E3s(15). Ongoing research has revealed many promising examples of E3 targets including MDM2, Skp2, and IAPs. For example, one group of targets are the Inhibitor of apoptosis proteins (IAPs). As their name entails, IAPs inhibit programmed cell death. They do this by binding sequestering caspases in an inhibitory manner. In one targeting strategy, smac mimetics are used to promote IAP auto-ubiquitination for degradation.

ITCH is another promising E3 ubiquitin ligase pharmacotherapy target.

Because ubiquitin variants bind selectively to the ubiquitin-binding domain of E3 ligases, ubiquitin analogues with inhibitory properties can be generated(16). 108

Another strategy with which to target ITCH involves blocking the WW substrate specificity domain. This would block the E3-substrate interaction, and thus inhibition of substrate ubiquitination. Each of these strategies aims to inhibit the enzymatic activity of ITCH. While this might be desirable in the setting of some cancers, where ITCH inhibition predisposes cancer cells to chemosensitivity independent of p53 status(17), inhibition of ITCH would be undesirable in the context of inflammatory disease.

For the purposes of regulating rampant inflammation, you would not want an inhibitor, but rather, an activator of ITCH. And specifically, you would want an activator that promotes the interaction of UbcH7 and phospho 687 ITCH. An approach to achieve this aim could be a recombinant protein therapeutic in which

F63H UbcH7 is delivered to affected tissues such as lung, skin, and gut via nanoparticle. With a molecular weight of only 18 kDa, UbcH7 has promise of being favorable in this system. Such an approach is not outside the possibility of the current state of nanoparticle technology (18).

In sum, a firm understanding of the ubiquitin system and its components can yield exploitable mechanisms that can be used for therapeutic gain.

5.3.2 Phosphorylation of an E3 ligase to inhibit binding of an E2

The work in this dissertation features the first example of phosphorylation blocking binding between an E2 and an E3 ubiquitin ligase. Others have demonstrated phosphorylation as a functional recruiting signal for ubiquitin ligases(19-21), however, we show that phosphorylation of ITCH within the binding interface can block the ITCH binding interaction with UbcH7. To advance 109

these findings, we should also investigate whether UbcH7 is the only E2 conjugating enzyme that is regulated in this fashion.

While the studies described in this manuscript are limited to examining a blocking mechanism of an E2-E3 interaction, it is important to note that required post- or co-translational modifications exist. A notable E2-E3 interaction requiring a post-translational modification is that of DCN1-UBE2M. DCN1 is a Neddylation ligase that holds substrate, Cullin. DCN1 has a hydrophobic pocket that only interacts with an N-terminally acetylated E2 conjugating enzyme,

UBE2M/UbcH12. In this complex, UBE2M/UbcH12 is required to be N-terminally acetylated for binding interaction with its E3, DCN1(22). This finding is important because it has been difficult to target specific E2 conjugating enzymes. Many E2 conjugating enzymes share conserved homology within the Ubc domain(23).

Amplification of DCN1 has been found in most squamous cell carcinomas and thus, may be a target for anticancer therapeutics(24). In the study, the authors screened for small molecule probes that blocked the interaction of

UBE2M/UbcH12(22). The blocked interaction resulted in decreased binding, decreased Neddylation of the DCN1 target, Cullin, and thus, suppression of anchorage-independent growth of cell lines with DCN1 amplification. These results suggest efficacy in the treatment of squamous cell carcinomas with DCN1 amplification(22). The study also presents an overarching emphasis on the importance in exploiting specific secondary mechanisms, such as posttranslational modifications, to precisely target molecules that have high sequence homology with related proteins.

110

Such studies highlight that the findings presented in this dissertation are specific and important.

5.4 Closing remarks

Most interesting is the paradoxical nature of polymorphisms in NOD2. On one hand, defects throughout the gene can lead to loss of function, leading to immunodeficiency. This manifests as Crohn’s disease, a chronic granulomatous disease that targets the gut. Other classic symptoms are juvenile arthritis and skin lesions. On the other hand, polymorphisms specifically within the central

NOD domain can lead to gain of function/overactivation of NOD2 signaling.

Constitutive NOD2 signaling leads to overactive IKKs and other inflammatory defects in Blau Syndrome. BS presents with juvenile inflammatory arthritis, an erythematous skin rash, and uveitis.

Two reoccurring genetic components in BS and Sarcoidosis are NOD2 and

ITCH. As an attenuator of NOD2-mediated NF-κB signaling, ITCH acts through

K63 ubiquitination of Rip2. Absence of ITCH results in over activation of IKKs.

Furthermore, absence or impairment of ITCH has furthermore been suspect in contributing to other disease states. We have discovered a novel phosphorylation site on ITCH, which impairs ubiquitin ligase activity. Taken together, these findings suggest that gain of function NOD2 polymorphisms may result in ITCH impairment through posttranslational modification by IKKs.

111

We hypothesize that IKK-mediated disruption of ITCH promotes a feedforward loop of inflammatory signaling and leads to chronic- or hyper-activation.

These signaling outcomes could explain eventual lung involvement in some EOS patients with NOD2 GOF mutations. One study showed that about 19% of individuals with EOS eventually develop Sarcoidosis involvement in the lung(28).

This suggests that while NOD2 signaling may not be as important in development, chronic activation of IKKs may be leading to an event that sensitizes the lung to chronic inflammation. Genetic NOD2 mutations in patients with Sarcoidosis often present with aggressive lung involvement(29). In this study, we discover a novel IKK substrate whose deficiency is implicated in granulomatous lung disease.

5.5 Works cited in this chapter

1. Hiscott, J. (2007) Convergence of the NF-kappaB and IRF pathways in the

regulation of the innate antiviral response. Cytokine & growth factor

reviews 18, 483-490

2. Han, Z., Lu, J., Liu, Y., Davis, B., Lee, M. S., Olson, M. A., Ruthel, G.,

Freedman, B. D., Schnell, M. J., Wrobel, J. E., Reitz, A. B., and Harty, R.

N. (2014) Small-molecule probes targeting the viral PPxY-host Nedd4

interface block egress of a broad range of RNA viruses. Journal of virology

88, 7294-7306

11 2

3. Eletr, Z. M., and Kuhlman, B. (2007) Sequence determinants of E2-E6AP

binding affinity and specificity. Journal of molecular biology 369, 419-428

4. Mund, T., and Pelham, H. R. (2009) Control of the activity of WW-HECT

domain E3 ubiquitin ligases by NDFIP proteins. EMBO reports 10, 501-

507

5. Kathania, M., Zeng, M., Yadav, V. N., Moghaddam, S. J., Yang, B., and

Venuprasad, K. (2015) Ndfip1 regulates itch ligase activity and airway

inflammation via UbcH7. Journal of immunology 194, 2160-2167

6. Castaneda, C. A., Dixon, E. K., Walker, O., Chaturvedi, A., Nakasone, M.

A., Curtis, J. E., Reed, M. R., Krueger, S., Cropp, T. A., and Fushman, D.

(2016) Linkage via K27 Bestows Ubiquitin Chains with Unique Properties

among Polyubiquitins. Structure 24, 423-436

7. Hospenthal, M. K., Mevissen, T. E. T., and Komander, D. (2015)

Deubiquitinase-based analysis of ubiquitin chain architecture using

Ubiquitin Chain Restriction (UbiCRest). Nature protocols 10, 349-361

8. Rask-Andersen, M., Almen, M. S., and Schioth, H. B. (2011) Trends in the

exploitation of novel drug targets. Nature reviews. Drug discovery 10, 579-

590

9. Patterson, H., Nibbs, R., McInnes, I., and Siebert, S. (2014) Protein kinase

inhibitors in the treatment of inflammatory and autoimmune diseases.

Clinical and experimental immunology 176, 1-10

113

10. Mustapha, S., Kirshner, A., De Moissac, D., and Kirshenbaum, L. A.

(2000) A direct requirement of nuclear factor-kappa B for suppression of

apoptosis in ventricular myocytes. American journal of physiology. Heart

and circulatory physiology 279, H939-945

11. Nenci, A., Becker, C., Wullaert, A., Gareus, R., van Loo, G., Danese, S.,

Huth, M., Nikolaev, A., Neufert, C., Madison, B., Gumucio, D., Neurath, M.

F., and Pasparakis, M. (2007) Epithelial NEMO links innate immunity to

chronic intestinal inflammation. Nature 446, 557-561

12. Tilstra, J. S., Gaddy, D. F., Zhao, J., Dave, S. H., Niedernhofer, L. J.,

Plevy, S. E., and Robbins, P. D. (2014) Pharmacologic IKK/NF-kappaB

inhibition causes antigen presenting cells to undergo TNFalpha dependent

ROS-mediated programmed cell death. Scientific reports 4, 3631

13. Tigno-Aranjuez, J. T., Benderitter, P., Rombouts, F., Deroose, F., Bai, X.,

Mattioli, B., Cominelli, F., Pizarro, T. T., Hoflack, J., and Abbott, D. W.

(2014) In vivo inhibition of RIPK2 kinase alleviates inflammatory disease.

The Journal of biological chemistry 289, 29651-29664

14. Huang, X., and Dixit, V. M. (2016) Drugging the undruggables: exploring

the ubiquitin system for drug development. Cell research 26, 484-498

15. Landre, V., Rotblat, B., Melino, S., Bernassola, F., and Melino, G. (2014)

Screening for E3-ubiquitin ligase inhibitors: challenges and opportunities.

Oncotarget 5, 7988-8013

114

16. Ernst, A., Avvakumov, G., Tong, J., Fan, Y., Zhao, Y., Alberts, P., Persaud,

A., Walker, J. R., Neculai, A. M., Neculai, D., Vorobyov, A., Garg, P.,

Beatty, L., Chan, P. K., Juang, Y. C., Landry, M. C., Yeh, C., Zeqiraj, E.,

Karamboulas, K., Allali-Hassani, A., Vedadi, M., Tyers, M., Moffat, J.,

Sicheri, F., Pelletier, L., Durocher, D., Raught, B., Rotin, D., Yang, J.,

Moran, M. F., Dhe-Paganon, S., and Sidhu, S. S. (2013) A strategy for

modulation of enzymes in the ubiquitin system. Science 339, 590-595

17. Hansen, T. M., Rossi, M., Roperch, J. P., Ansell, K., Simpson, K., Taylor,

D., Mathon, N., Knight, R. A., and Melino, G. (2007) Itch inhibition

regulates chemosensitivity in vitro. Biochemical and biophysical research

communications 361, 33-36

18. Rossi, M., Rotblat, B., Ansell, K., Amelio, I., Caraglia, M., Misso, G.,

Bernassola, F., Cavasotto, C. N., Knight, R. A., Ciechanover, A., and

Melino, G. (2014) High throughput screening for inhibitors of the HECT

ubiquitin E3 ligase ITCH identifies antidepressant drugs as regulators of

autophagy. Cell death & disease 5, e1203

19. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J.,

Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997)

IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-

kappaB activation. Science 278, 860-866

20. Fraser, J. A., Vojtesek, B., and Hupp, T. R. (2010) A novel p53

phosphorylation site within the MDM2 ubiquitination signal: I.

115

phosphorylation at SER269 in vivo is linked to inactivation of p53 function.

The Journal of biological chemistry 285, 37762-37772

21. Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J., and Harper, J. W.

(1997) F-box proteins are receptors that recruit phosphorylated substrates

to the SCF ubiquitin-ligase complex. Cell 91, 209-219

22. Scott, D. C., Hammill, J. T., Min, J., Rhee, D. Y., Connelly, M., Sviderskiy,

V. O., Bhasin, D., Chen, Y., Ong, S. S., Chai, S. C., Goktug, A. N., Huang,

G., Monda, J. K., Low, J., Kim, H. S., Paulo, J. A., Cannon, J. R., Shelat,

A. A., Chen, T., Kelsall, I. R., Alpi, A. F., Pagala, V., Wang, X., Peng, J.,

Singh, B., Harper, J. W., Schulman, B. A., and Guy, R. K. (2017) Blocking

an N-terminal acetylation-dependent protein interaction inhibits an E3

ligase. Nature chemical biology 13, 850-857

23. Papaleo, E., Casiraghi, N., Arrigoni, A., Vanoni, M., Coccetti, P., and De

Gioia, L. (2012) Loop 7 of E2 enzymes: an ancestral conserved functional

motif involved in the E2-mediated steps of the ubiquitination cascade.

PloS one 7, e40786

24. Sarkaria, I., P, O. c., Talbot, S. G., Reddy, P. G., Ngai, I., Maghami, E.,

Patel, K. N., Lee, B., Yonekawa, Y., Dudas, M., Kaufman, A., Ryan, R.,

Ghossein, R., Rao, P. H., Stoffel, A., Ramanathan, Y., and Singh, B.

(2006) Squamous cell carcinoma related oncogene/DCUN1D1 is highly

conserved and activated by amplification in squamous cell carcinomas.

Cancer research 66, 9437-9444

116

25. Perez, J. M., Chirieleison, S. M., and Abbott, D. W. (2015) An IkappaB

Kinase-Regulated Feedforward Circuit Prolongs Inflammation. Cell reports

12, 537-544

26. Nigrovic, P. Periodic fever syndromes and other autoinflammatory

diseases: An overview. in UpToDate (Post, T. ed.), UpToDate,Waltham,

MA. (Accessed on August 21, 2017). pp

27. Gabrielsen, M., Buetow, L., Nakasone, M. A., Ahmed, S. F., Sibbet, G. J.,

Smith, B. O., Zhang, W., Sidhu, S. S., and Huang, D. T. (2017) A General

Strategy for Discovery of Inhibitors and Activators of RING and U-box E3

Ligases with Ubiquitin Variants. Molecular cell 68, 456-470 e410

28. Dosanjh, A. (2017) An Analysis of Early Onset Sarcoidosis and Pulmonary

Findings at Presentation. EC Pulmonology and Respiratory Medicine 3.4,

105-107

29. Sato, H., Williams, H. R., Spagnolo, P., Abdallah, A., Ahmad, T., Orchard,

T. R., Copley, S. J., Desai, S. R., Wells, A. U., du Bois, R. M., and Welsh,

K. I. (2010) CARD15/NOD2 polymorphisms are associated with severe

pulmonary sarcoidosis. The European respiratory journal 35, 324-330

117

118

119

120

121

122

Bibliography

Abbott, D.W., Wilkins, A., Asara, J.M., and Cantley, L.C. (2004). The Crohn's disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO. Current biology : CB 14, 2217-2227. Abbott, D.W., Yang, Y., Hutti, J.E., Madhavarapu, S., Kelliher, M.A., and Cantley, L.C. (2007). Coordinated regulation of Toll-like receptor and NOD2 signaling by K63-linked polyubiquitin chains. Molecular and cellular biology 27, 6012-6025. Adhikari, A., Xu, M., and Chen, Z.J. (2007). Ubiquitin-mediated activation of TAK1 and IKK. Oncogene 26, 3214-3226. Agostini, C., and Semenzato, G. (1998). Cytokines in sarcoidosis. Seminars in respiratory infections 13, 184-196. Amiri, P., Locksley, R.M., Parslow, T.G., Sadick, M., Rector, E., Ritter, D., and McKerrow, J.H. (1992). Tumour necrosis factor alpha restores granulomas and induces parasite egg-laying in schistosome-infected SCID mice. Nature 356, 604-607. Angers, A., Ramjaun, A.R., and McPherson, P.S. (2004). The HECT domain ligase itch ubiquitinates endophilin and localizes to the trans-Golgi network and endosomal system. The Journal of biological chemistry 279, 11471- 11479. Arend, W.P. (2001). Cytokine imbalance in the pathogenesis of rheumatoid arthritis: the role of interleukin-1 receptor antagonist. Seminars in arthritis and rheumatism 30, 1-6. Baker, R.G., Hayden, M.S., and Ghosh, S. (2011). NF-kappaB, inflammation, and metabolic disease. Cell metabolism 13, 11-22. Becker, M.L., and Rose, C.D. (2005). Blau syndrome and related genetic disorders causing childhood arthritis. Current rheumatology reports 7, 427- 433. Bertrand, M.J., Doiron, K., Labbe, K., Korneluk, R.G., Barker, P.A., and Saleh, M. (2009). Cellular inhibitors of apoptosis cIAP1 and cIAP2 are required for innate immunity signaling by the pattern recognition receptors NOD1 and NOD2. Immunity 30, 789-801. Blonska, M., and Lin, X. (2011). NF-kappaB signaling pathways regulated by CARMA family of scaffold proteins. Cell research 21, 55-70. Castaneda, C.A., Dixon, E.K., Walker, O., Chaturvedi, A., Nakasone, M.A., Curtis, J.E., Reed, M.R., Krueger, S., Cropp, T.A., and Fushman, D. (2016). Linkage via K27 Bestows Ubiquitin Chains with Unique Properties among Polyubiquitins. Structure 24, 423-436.

123

Chastagner, P., Israel, A., and Brou, C. (2006). Itch/AIP4 mediates Deltex degradation through the formation of K29-linked polyubiquitin chains. EMBO reports 7, 1147-1153. Chen, Y., Zhang, J., Ge, X., Du, J., Deb, D.K., and Li, Y.C. (2013). Vitamin D receptor inhibits nuclear factor kappaB activation by interacting with IkappaB kinase beta protein. The Journal of biological chemistry 288, 19450-19458. Crowley, L.E., Herbert, R., Moline, J.M., Wallenstein, S., Shukla, G., Schechter, C., Skloot, G.S., Udasin, I., Luft, B.J., Harrison, D., et al. (2011). "Sarcoid like" granulomatous pulmonary disease in World Trade Center disaster responders. American journal of industrial medicine 54, 175-184. de Boer, S., and Wilsher, M. (2010). Review series: Aspects of interstitial lung disease. Sarcoidosis. Chronic respiratory disease 7, 247-258. Edinger, R.S., Lebowitz, J., Li, H., Alzamora, R., Wang, H., Johnson, J.P., and Hallows, K.R. (2009). Functional regulation of the epithelial Na+ channel by IkappaB kinase-beta occurs via phosphorylation of the ubiquitin ligase Nedd4-2. The Journal of biological chemistry 284, 150-157. Eletr, Z.M., and Kuhlman, B. (2007). Sequence determinants of E2-E6AP binding affinity and specificity. Journal of molecular biology 369, 419-428. Erdal, B.S., Clymer, B.D., Yildiz, V.O., Julian, M.W., and Crouser, E.D. (2012). Unexpectedly high prevalence of sarcoidosis in a representative U.S. Metropolitan population. Respiratory medicine 106, 893-899. Ernst, A., Avvakumov, G., Tong, J., Fan, Y., Zhao, Y., Alberts, P., Persaud, A., Walker, J.R., Neculai, A.M., Neculai, D., et al. (2013). A strategy for modulation of enzymes in the ubiquitin system. Science 339, 590-595. Facco, M., Cabrelle, A., Teramo, A., Olivieri, V., Gnoato, M., Teolato, S., Ave, E., Gattazzo, C., Fadini, G.P., Calabrese, F., et al. (2011). Sarcoidosis is a Th1/Th17 multisystem disorder. Thorax 66, 144-150. Fang, N.N., Chan, G.T., Zhu, M., Comyn, S.A., Persaud, A., Deshaies, R.J., Rotin, D., Gsponer, J., and Mayor, T. (2014). Rsp5/Nedd4 is the main ubiquitin ligase that targets cytosolic misfolded proteins following heat stress. Nature cell biology 16, 1227-1237. Fraser, J.A., Vojtesek, B., and Hupp, T.R. (2010). A novel p53 phosphorylation site within the MDM2 ubiquitination signal: I. phosphorylation at SER269 in vivo is linked to inactivation of p53 function. The Journal of biological chemistry 285, 37762-37772. Gallagher, E., Gao, M., Liu, Y.C., and Karin, M. (2006). Activation of the E3 ubiquitin ligase Itch through a phosphorylation-induced conformational change. Proceedings of the National Academy of Sciences of the United States of America 103, 1717-1722. 124

Girardin, S.E., Boneca, I.G., Viala, J., Chamaillard, M., Labigne, A., Thomas, G., Philpott, D.J., and Sansonetti, P.J. (2003). Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. The Journal of biological chemistry 278, 8869-8872. Han, Z., Lu, J., Liu, Y., Davis, B., Lee, M.S., Olson, M.A., Ruthel, G., Freedman, B.D., Schnell, M.J., Wrobel, J.E., et al. (2014). Small-molecule probes targeting the viral PPxY-host Nedd4 interface block egress of a broad range of RNA viruses. Journal of virology 88, 7294-7306. Hansen, T.M., Rossi, M., Roperch, J.P., Ansell, K., Simpson, K., Taylor, D., Mathon, N., Knight, R.A., and Melino, G. (2007). Itch inhibition regulates chemosensitivity in vitro. Biochemical and biophysical research communications 361, 33-36. Hasegawa, M., Fujimoto, Y., Lucas, P.C., Nakano, H., Fukase, K., Nunez, G., and Inohara, N. (2008). A critical role of RICK/RIP2 polyubiquitination in Nod- induced NF-kappaB activation. The EMBO journal 27, 373-383. Hatakeyama, S., Jensen, J.P., and Weissman, A.M. (1997). Subcellular localization and ubiquitin-conjugating enzyme (E2) interactions of mammalian HECT family ubiquitin protein ligases. Journal of Biological Chemistry 272, 15085-15092. Hayden, M.S., and Ghosh, S. (2008). Shared principles in NF-kappaB signaling. Cell 132, 344-362. Hayden, M.S., and Ghosh, S. (2012). NF-kappaB, the first quarter-century: remarkable progress and outstanding questions. Genes & development 26, 203-234. Hiscott, J. (2007). Convergence of the NF-kappaB and IRF pathways in the regulation of the innate antiviral response. Cytokine & growth factor reviews 18, 483-490. Hospenthal, M.K., Mevissen, T.E.T., and Komander, D. (2015). Deubiquitinase- based analysis of ubiquitin chain architecture using Ubiquitin Chain Restriction (UbiCRest). Nature protocols 10, 349-361. Huang, L., Kinnucan, E., Wang, G., Beaudenon, S., Howley, P.M., Huibregtse, J.M., and Pavletich, N.P. (1999). Structure of an E6AP-UbcH7 complex: insights into ubiquitination by the E2-E3 enzyme cascade. Science 286, 1321-1326. Huang, X., and Dixit, V.M. (2016). Drugging the undruggables: exploring the ubiquitin system for drug development. Cell research 26, 484-498. Hunter, T. (2007). The age of crosstalk: phosphorylation, ubiquitination, and beyond. Molecular cell 28, 730-738.

125

Hutti, J.E., Jarrell, E.T., Chang, J.D., Abbott, D.W., Storz, P., Toker, A., Cantley, L.C., and Turk, B.E. (2004). A rapid method for determining protein kinase phosphorylation specificity. Nature methods 1, 27-29. Hutti, J.E., Porter, M.A., Cheely, A.W., Cantley, L.C., Wang, X., Kireev, D., Baldwin, A.S., and Janzen, W.P. (2012). Development of a high- throughput assay for identifying inhibitors of TBK1 and IKKε. PloS one 7, e41494. Hutti, J.E., Shen, R.R., Abbott, D.W., Zhou, A.Y., Sprott, K.M., Asara, J.M., Hahn, W.C., and Cantley, L.C. (2009). Phosphorylation of the tumor suppressor CYLD by the breast cancer oncogene IKKepsilon promotes cell transformation. Molecular cell 34, 461-472. Hutti, J.E., Turk, B.E., Asara, J.M., Ma, A., Cantley, L.C., and Abbott, D.W. (2007). IkappaB kinase beta phosphorylates the K63 deubiquitinase A20 to cause feedback inhibition of the NF-kappaB pathway. Molecular and cellular biology 27, 7451-7461. Iannuzzi, M.C. (2007). Genetics of sarcoidosis. Seminars in respiratory and critical care medicine 28, 15-21. Ingham, R.J., Gish, G., and Pawson, T. (2004). The Nedd4 family of E3 ubiquitin ligases: functional diversity within a common modular architecture. Oncogene 23, 1972-1984. Jin, H.S., Park, Y., Elly, C., and Liu, Y.C. (2013). Itch expression by Treg cells controls Th2 inflammatory responses. The Journal of clinical investigation 123, 4923-4934. Karin, M., and Ben-Neriah, Y. (2000). Phosphorylation meets ubiquitination: the control of NF-κB activity. Annual review of immunology 18, 621-663. Kathania, M., Zeng, M., Yadav, V.N., Moghaddam, S.J., Yang, B., and Venuprasad, K. (2015). Ndfip1 regulates itch ligase activity and airway inflammation via UbcH7. Journal of immunology 194, 2160-2167. Kindler, V., Sappino, A.P., Grau, G.E., Piguet, P.F., and Vassalli, P. (1989). The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 56, 731-740. King, R.W., Deshaies, R.J., Peters, J.-M., and Kirschner, M.W. (1996). How Proteolysis Drives the Cell Cycle. Science 274, 1652-1659. Komander, D., and Rape, M. (2012). The ubiquitin code. Annual review of biochemistry 81, 203-229. Krieg, A., Correa, R.G., Garrison, J.B., Le Negrate, G., Welsh, K., Huang, Z., Knoefel, W.T., and Reed, J.C. (2009). XIAP mediates NOD signaling via interaction with RIP2. Proceedings of the National Academy of Sciences of the United States of America 106, 14524-14529.

126

Krikos, A., Laherty, C.D., and Dixit, V.M. (1992). Transcriptional Activation of the Tumor-Necrosis-Factor Alpha-Inducible Zinc Finger Protein, A20, Is Mediated by Kappa-B Elements. Journal of Biological Chemistry 267, 17971-17976. Kumar, S., Kao, W.H., and Howley, P.M. (1997). Physical interaction between specific E2 and Hect E3 enzymes determines functional cooperativity. The Journal of biological chemistry 272, 13548-13554. Landre, V., Rotblat, B., Melino, S., Bernassola, F., and Melino, G. (2014). Screening for E3-ubiquitin ligase inhibitors: challenges and opportunities. Oncotarget 5, 7988-8013. Lee, E.G., Boone, D.L., Chai, S., Libby, S.L., Chien, M., Lodolce, J.P., and Ma, A. (2000). Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 289, 2350-2354. Leli, I., Salimbene, I., Varone, F., Fuso, L., and Valente, S. (2013). Husband and wife with sarcoidosis: possible environmental factors involved. Multidisciplinary respiratory medicine 8, 5. Liu, Y.C. (2007). The E3 ubiquitin ligase Itch in T cell activation, differentiation, and tolerance. Seminars in immunology 19, 197-205. Lohr, N.J., Molleston, J.P., Strauss, K.A., Torres-Martinez, W., Sherman, E.A., Squires, R.H., Rider, N.L., Chikwava, K.R., Cummings, O.W., Morton, D.H., et al. (2010). Human ITCH E3 ubiquitin ligase deficiency causes syndromic multisystem autoimmune disease. American journal of human genetics 86, 447-453. Lopez-Pelaez, M., Lamont, D.J., Peggie, M., Shpiro, N., Gray, N.S., and Cohen, P. (2014). Protein kinase IKKbeta-catalyzed phosphorylation of IRF5 at Ser462 induces its dimerization and nuclear translocation in myeloid cells. Proceedings of the National Academy of Sciences of the United States of America 111, 17432-17437. Maekawa, S., Ohto, U., Shibata, T., Miyake, K., and Shimizu, T. (2016). Crystal structure of NOD2 and its implications in human disease. Nature communications 7, 11813. Marinis, J.M., Homer, C.R., McDonald, C., and Abbott, D.W. (2011). A novel motif in the Crohn's disease susceptibility protein, NOD2, allows TRAF4 to down-regulate innate immune responses. The Journal of biological chemistry 286, 1938-1950. Marinis, J.M., Hutti, J.E., Homer, C.R., Cobb, B.A., Cantley, L.C., McDonald, C., and Abbott, D.W. (2012). IkappaB kinase alpha phosphorylation of TRAF4 downregulates innate immune signaling. Molecular and cellular biology 32, 2479-2489.

127

Matesic, L.E., Copeland, N.G., and Jenkins, N.A. (2008). Itchy mice: the identification of a new pathway for the development of autoimmunity. In Immunology, Phenotype First: How Mutations Have Established New Principles and Pathways in Immunology (Springer), pp. 185-200. McCaskill, J.G., Chason, K.D., Hua, X., Neuringer, I.P., Ghio, A.J., Funkhouser, W.K., and Tilley, S.L. (2006). Pulmonary immune responses to Propionibacterium acnes in C57BL/6 and BALB/c mice. American journal of respiratory cell and molecular biology 35, 347-356. Melino, G., Gallagher, E., Aqeilan, R.I., Knight, R., Peschiaroli, A., Rossi, M., Scialpi, F., Malatesta, M., Zocchi, L., Browne, G., et al. (2008). Itch: a HECT-type E3 ligase regulating immunity, skin and cancer. Cell death and differentiation 15, 1103-1112. Mercurio, F., Zhu, H., Murray, B.W., Shevchenko, A., Bennett, B.L., Li, J., Young, D.B., Barbosa, M., Mann, M., Manning, A., et al. (1997). IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278, 860-866. Miyaoka, Y., Chan, A.H., Judge, L.M., Yoo, J., Huang, M., Nguyen, T.D., Lizarraga, P.P., So, P.L., and Conklin, B.R. (2014). Isolation of single-base genome-edited human iPS cells without antibiotic selection. Nature methods 11, 291-293. Müller-Quernheim, J. (1998). Sarcoidosis: immunopathogenetic concepts and their clinical application. European Respiratory Journal 12, 716-738. Mund, T., and Pelham, H.R. (2009). Control of the activity of WW-HECT domain E3 ubiquitin ligases by NDFIP proteins. EMBO reports 10, 501-507. Mustapha, S., Kirshner, A., De Moissac, D., and Kirshenbaum, L.A. (2000). A direct requirement of nuclear factor-kappa B for suppression of apoptosis in ventricular myocytes. American journal of physiology Heart and circulatory physiology 279, H939-945. Nalefski, E.A., and Falke, J.J. (1996). The C2 domain calcium-binding motif: structural and functional diversity. Protein science : a publication of the Protein Society 5, 2375-2390. Narimatsu, M., Bose, R., Pye, M., Zhang, L., Miller, B., Ching, P., Sakuma, R., Luga, V., Roncari, L., and Attisano, L. (2009). Regulation of planar cell polarity by Smurf ubiquitin ligases. Cell 137, 295-307. Nenci, A., Becker, C., Wullaert, A., Gareus, R., van Loo, G., Danese, S., Huth, M., Nikolaev, A., Neufert, C., Madison, B., et al. (2007). Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557- 561. Nguyen, K., Vleugels, R.A., Velez, N.F., Merola, J.F., and Qureshi, A.A. (2013). Psoriasiform reactions to anti-tumor necrosis factor alpha therapy. Journal 128

of clinical rheumatology : practical reports on rheumatic & musculoskeletal diseases 19, 377-381. Nigrovic, P. Periodic fever syndromes and other autoinflammatory diseases: An overview. In UpToDate, T. Post, ed. (UpToDate,Waltham, MA. (Accessed on August 21, 2017)). Nikolaou, K., Tsagaratou, A., Eftychi, C., Kollias, G., Mosialos, G., and Talianidis, I. (2012). Inactivation of the deubiquitinase CYLD in hepatocytes causes apoptosis, inflammation, fibrosis, and cancer. Cancer cell 21, 738-750. Obenauer, J.C., Cantley, L.C., and Yaffe, M.B. (2003). Scansite 2.0: Proteome- wide prediction of cell signaling interactions using short sequence motifs. Nucleic acids research 31, 3635-3641. Ogura, H., Murakami, M., Okuyama, Y., Tsuruoka, M., Kitabayashi, C., Kanamoto, M., Nishihara, M., Iwakura, Y., and Hirano, T. (2008). Interleukin-17 Promotes Autoimmunity by Triggering a Positive-Feedback Loop via Interleukin-6 Induction. Immunity 29, 628-636. Ohtake, F., Saeki, Y., Ishido, S., Kanno, J., and Tanaka, K. (2016). The K48-K63 Branched Ubiquitin Chain Regulates NF-kappaB Signaling. Molecular cell 64, 251-266. Okafuji, I., Nishikomori, R., Kanazawa, N., Kambe, N., Fujisawa, A., Yamazaki, S., Saito, M., Yoshioka, T., Kawai, T., Sakai, H., et al. (2009). Role of the NOD2 genotype in the clinical phenotype of Blau syndrome and early- onset sarcoidosis. Arthritis and rheumatism 60, 242-250. Otte, L., Wiedemann, U., Schlegel, B., Pires, J.R., Beyermann, M., Schmieder, P., Krause, G., Volkmer-Engert, R., Schneider-Mergener, J., and Oschkinat, H. (2003). WW domain sequence activity relationships identified using ligand recognition propensities of 42 WW domains. Protein science : a publication of the Protein Society 12, 491-500. Papaleo, E., Casiraghi, N., Arrigoni, A., Vanoni, M., Coccetti, P., and De Gioia, L. (2012). Loop 7 of E2 enzymes: an ancestral conserved functional motif involved in the E2-mediated steps of the ubiquitination cascade. PloS one 7, e40786. Patterson, H., Nibbs, R., McInnes, I., and Siebert, S. (2014). Protein kinase inhibitors in the treatment of inflammatory and autoimmune diseases. Clinical and experimental immunology 176, 1-10. Perez, J.M., Chirieleison, S.M., and Abbott, D.W. (2015). An IkappaB Kinase- Regulated Feedforward Circuit Prolongs Inflammation. Cell reports 12, 537-544. Perkins, N.D. (2006). Post-translational modifications regulating the activity and function of the nuclear factor kappa B pathway. Oncogene 25, 6717-6730.

129

Perry, W.L., Hustad, C.M., Swing, D.A., O'Sullivan, T.N., Jenkins, N.A., and Copeland, N.G. (1998). The itchy locus encodes a novel ubiquitin protein ligase that is disrupted in a18H mice. Nature genetics 18, 143-146. Podolsky, D.K. (2002). Inflammatory bowel disease. The New England journal of medicine 347, 417-429. Porto Neto, L.R., Jonsson, N.N., Ingham, A., Bunch, R.J., Harrison, B.E., Barendse, W., and Cooperative Research Centre for Beef Genetic, T. (2012). The RIPK2 gene: a positional candidate for tick burden supported by genetic associations in cattle and immunological response of knockout mouse. Immunogenetics 64, 379-388. Prabakaran, S., Lippens, G., Steen, H., and Gunawardena, J. (2012). Post‐ translational modification: nature's escape from genetic imprisonment and the basis for dynamic information encoding. Wiley Interdisciplinary Reviews: Systems Biology and Medicine 4, 565-583. Qing, G., Qu, Z., and Xiao, G. (2005). Stabilization of basally translated NF- kappaB-inducing kinase (NIK) protein functions as a molecular switch of processing of NF-kappaB2 p100. The Journal of biological chemistry 280, 40578-40582. Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M., Suzuki, N., Kato, R., Kensche, T., Uejima, T., Bloor, S., Komander, D., et al. (2009). Specific recognition of linear ubiquitin chains by NEMO is important for NF-kappaB activation. Cell 136, 1098-1109. Rask-Andersen, M., Almen, M.S., and Schioth, H.B. (2011). Trends in the exploitation of novel drug targets. Nature reviews Drug discovery 10, 579- 590. Ren, J., Chen, X., and Chen, Z.J. (2014). IKKbeta is an IRF5 kinase that instigates inflammation. Proceedings of the National Academy of Sciences of the United States of America 111, 17438-17443. Riling, C., Kamadurai, H., Kumar, S., O'Leary, C.E., Wu, K.P., Manion, E.E., Ying, M., Schulman, B.A., and Oliver, P.M. (2015). Itch WW Domains Inhibit Its E3 Ubiquitin Ligase Activity by Blocking E2-E3 Ligase Trans-thiolation. The Journal of biological chemistry 290, 23875-23887. Robbins, S.L., Kumar, V., and Cotran, R.S. (2010). Robbins and Cotran pathologic basis of disease, 8th edn (Philadelphia, PA: Saunders/Elsevier). Rossi, M., Rotblat, B., Ansell, K., Amelio, I., Caraglia, M., Misso, G., Bernassola, F., Cavasotto, C.N., Knight, R.A., Ciechanover, A., et al. (2014). High throughput screening for inhibitors of the HECT ubiquitin E3 ligase ITCH identifies antidepressant drugs as regulators of autophagy. Cell death & disease 5, e1203.

130

Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome- wide libraries for CRISPR screening. Nature methods 11, 783-784. Sarkaria, I., P, O.c., Talbot, S.G., Reddy, P.G., Ngai, I., Maghami, E., Patel, K.N., Lee, B., Yonekawa, Y., Dudas, M., et al. (2006). Squamous cell carcinoma related oncogene/DCUN1D1 is highly conserved and activated by amplification in squamous cell carcinomas. Cancer research 66, 9437- 9444. Sato, H., Williams, H.R., Spagnolo, P., Abdallah, A., Ahmad, T., Orchard, T.R., Copley, S.J., Desai, S.R., Wells, A.U., du Bois, R.M., et al. (2010). CARD15/NOD2 polymorphisms are associated with severe pulmonary sarcoidosis. The European respiratory journal 35, 324-330. Scheffner, M., Huibregtse, J.M., Vierstra, R.D., and Howley, P.M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505. Scheffner, M., Werness, B.A., Huibregtse, J.M., Levine, A.J., and Howley, P.M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136. Schwarz, S.E., Rosa, J.L., and Scheffner, M. (1998). Characterization of human hect domain family members and their interaction with UbcH5 and UbcH7. Journal of Biological Chemistry 273, 12148-12154. Scott, D.C., Hammill, J.T., Min, J., Rhee, D.Y., Connelly, M., Sviderskiy, V.O., Bhasin, D., Chen, Y., Ong, S.S., Chai, S.C., et al. (2017). Blocking an N- terminal acetylation-dependent protein interaction inhibits an E3 ligase. Nature chemical biology 13, 850-857. Seitzer, U., Swider, C., Stuber, F., Suchnicki, K., Lange, A., Richter, E., Zabel, P., Muller-Quernheim, J., Flad, H.D., and Gerdes, J. (1997). Tumour necrosis factor alpha promoter gene polymorphism in sarcoidosis. Cytokine 9, 787- 790. Shembade, N., and Harhaj, E.W. (2012). Regulation of NF-kappaB signaling by the A20 deubiquitinase. Cellular & molecular immunology 9, 123-130. Shembade, N., Harhaj, N.S., Parvatiyar, K., Copeland, N.G., Jenkins, N.A., Matesic, L.E., and Harhaj, E.W. (2008). The E3 ligase Itch negatively regulates inflammatory signaling pathways by controlling the function of the ubiquitin-editing enzyme A20. Nature immunology 9, 254-262. Shembade, N., Ma, A., and Harhaj, E.W. (2010). Inhibition of NF-kappaB signaling by A20 through disruption of ubiquitin enzyme complexes. Science 327, 1135-1139. Shembade, N., Pujari, R., Harhaj, N.S., Abbott, D.W., and Harhaj, E.W. (2011). The kinase IKKalpha inhibits activation of the transcription factor NF-

131

kappaB by phosphorylating the regulatory molecule TAX1BP1. Nature immunology 12, 834-843. Skowyra, D., Craig, K.L., Tyers, M., Elledge, S.J., and Harper, J.W. (1997). F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91, 209-219. Smith, M.F., Jr., Eidlen, D., Arend, W.P., and Gutierrez-Hartmann, A. (1994). LPS- induced expression of the human IL-1 receptor antagonist gene is controlled by multiple interacting promoter elements. Journal of immunology 153, 3584-3593. Soler, P., and Basset, F. (1976). Morphology and distribution of the cells of a sarcoid granuloma: ultrastructural study of serial sections. Annals of the New York Academy of Sciences 278, 147-160. Sun, S.-C., Ganchi, P.A., Ballard, D.W., and Greene, W.C. (1993). NF-kappa B controls expression of inhibitor I kappa B alpha: evidence for an inducible autoregulatory pathway. Science 259, 1912-1915. Tao, M., Scacheri, P.C., Marinis, J.M., Harhaj, E.W., Matesic, L.E., and Abbott, D.W. (2009). ITCH K63-ubiquitinates the NOD2 binding protein, RIP2, to influence inflammatory signaling pathways. Current biology : CB 19, 1255- 1263. Tigno-Aranjuez, J.T., and Abbott, D.W. (2012). Ubiquitination and phosphorylation in the regulation of NOD2 signaling and NOD2-mediated disease. Biochimica et biophysica acta 1823, 2022-2028. Tigno-Aranjuez, J.T., Asara, J.M., and Abbott, D.W. (2010). Inhibition of RIP2's tyrosine kinase activity limits NOD2-driven cytokine responses. Genes & development 24, 2666-2677. Tigno-Aranjuez, J.T., Bai, X., and Abbott, D.W. (2013). A discrete ubiquitin- mediated network regulates the strength of NOD2 signaling. Molecular and cellular biology 33, 146-158. Tigno-Aranjuez, J.T., Benderitter, P., Rombouts, F., Deroose, F., Bai, X., Mattioli, B., Cominelli, F., Pizarro, T.T., Hoflack, J., and Abbott, D.W. (2014). In vivo inhibition of RIPK2 kinase alleviates inflammatory disease. The Journal of biological chemistry 289, 29651-29664. Tilstra, J.S., Gaddy, D.F., Zhao, J., Dave, S.H., Niedernhofer, L.J., Plevy, S.E., and Robbins, P.D. (2014). Pharmacologic IKK/NF-kappaB inhibition causes antigen presenting cells to undergo TNFalpha dependent ROS- mediated programmed cell death. Scientific reports 4, 3631. Ulbricht, K.U., Stoll, M., Bierwirth, J., Witte, T., and Schmidt, R.E. (2003). Successful tumor necrosis factor alpha blockade treatment in therapy- resistant sarcoidosis. Arthritis and rheumatism 48, 3542-3543.

132

Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003). Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Current biology : CB 13, 680-685. Verstrepen, L., Bekaert, T., Chau, T.L., Tavernier, J., Chariot, A., and Beyaert, R. (2008). TLR-4, IL-1R and TNF-R signaling to NF-kappaB: variations on a common theme. Cellular and molecular life sciences : CMLS 65, 2964- 2978. Wang, C., An, J., Zhang, P., Xu, C., Gao, K., Wu, D., Wang, D., Yu, H., Liu, J.O., and Yu, L. (2012). The Nedd4-like ubiquitin E3 ligases target angiomotin/p130 to ubiquitin-dependent degradation. The Biochemical journal 444, 279-289. Wang, Y.Y., Li, L., Han, K.J., Zhai, Z., and Shu, H.B. (2004). A20 is a potent inhibitor of TLR3- and Sendai virus-induced activation of NF-kappaB and ISRE and IFN-beta promoter. FEBS letters 576, 86-90. Wei, W., Li, M., Wang, J., Nie, F., and Li, L. (2012). The E3 ubiquitin ligase ITCH negatively regulates canonical Wnt signaling by targeting dishevelled protein. Molecular and cellular biology 32, 3903-3912. Wiersinga, W.J., Leopold, S.J., Cranendonk, D.R., and van der Poll, T. (2014). Host innate immune responses to sepsis. Virulence 5, 36-44. Wiesner, S., Ogunjimi, A.A., Wang, H.R., Rotin, D., Sicheri, F., Wrana, J.L., and Forman-Kay, J.D. (2007). Autoinhibition of the HECT-type ubiquitin ligase Smurf2 through its C2 domain. Cell 130, 651-662. Wilkins, A., Ping, Q., and Carpenter, C.L. (2004). RhoBTB2 is a substrate of the mammalian Cul3 ubiquitin ligase complex. Genes & development 18, 856- 861. Winget, J.M., and Mayor, T. (2010). The diversity of ubiquitin recognition: hot spots and varied specificity. Molecular cell 38, 627-635. Wouters, C.H., Maes, A., Foley, K.P., Bertin, J., and Rose, C.D. (2014). Blau syndrome, the prototypic auto-inflammatory granulomatous disease. Pediatric rheumatology online journal 12, 33. Yang, B., Gay, D.L., MacLeod, M.K., Cao, X., Hala, T., Sweezer, E.M., Kappler, J., Marrack, P., and Oliver, P.M. (2008). Nedd4 augments the adaptive immune response by promoting ubiquitin-mediated degradation of Cbl-b in activated T cells. Nature immunology 9, 1356-1363. Yee, A.M., and Pochapin, M.B. (2001). Treatment of complicated sarcoidosis with infliximab anti-tumor necrosis factor-alpha therapy. Annals of internal medicine 135, 27-31. You, F., Sun, H., Zhou, X., Sun, W., Liang, S., Zhai, Z., and Jiang, Z. (2009). PCBP2 mediates degradation of the adaptor MAVS via the HECT ubiquitin ligase AIP4. Nature immunology 10, 1300-1308. 133

Zhang, J., Clark, K., Lawrence, T., Peggie, M.W., and Cohen, P. (2014). An unexpected twist to the activation of IKKbeta: TAK1 primes IKKbeta for activation by autophosphorylation. The Biochemical journal 461, 531-537. Zissel, G., Prasse, A., and Muller-Quernheim, J. (2010). Immunologic response of sarcoidosis. Seminars in respiratory and critical care medicine 31, 390- 403.

134