DOCSLIB.ORG

Managing Files with Sterling Connect:Direct File Agent 1.4.0.1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Managing Files with Sterling Connect:Direct File Agent 1.4.0.1 Managing Files with Sterling Connect:Direct File Agent 1.4.0.1 IBM Contents Managing Files with Sterling Connect:Direct File Agent.......................................... 1 Sterling Connect:Direct File Agent Overview.............................................................................................. 1 How to Run Sterling Connect:Direct File Agent.......................................................................................... 2 Sterling Connect:Direct File Agent Logging.................................................................................................3 Sterling Connect:Direct File Agent Configuration Planning........................................................................ 3 Sterling Connect:Direct File Agent Worksheet ...........................................................................................4 Considerations for a Large Number of Watch Directories.......................................................................... 6 Modifying MaxFileSize............................................................................................................................ 6 Modifying MaxBackupIndex...................................................................................................................6 Considerations for a Large Number of Files in a Watch Directory..............................................................7 Sterling Connect:Direct File Agent Configuration Scenarios...................................................................... 7 Scenario:Detecting a File Added to a Watched Directory on a z/OS System........................................7 Scenario:Detecting a VSAM Data File Added to a Watched Directory on a z/OS System.....................8 Scenario:Detecting a File by File Size on a Microsoft Windows System...............................................8 Scenario:Detecting a System Event by Title on a Microsoft Windows System.....................................9 Scenario:Passing the UNIX Pathname for a Detected File to a Process............................................ 10 Scenario:Configuring the Gate Keeper for Multiple Sterling Connect:Direct File Agent Instances...11 Tips for Using Sterling Connect:Direct File Agent.....................................................................................12 Configure the Default Settings............................................................................. 12 A Default Configuration..............................................................................................................................12 Creating the Default Configuration File............................................................................................... 13 Verifying the Default Configuration......................................................................................................17 Sterling Connect:Direct File Agent Variables............................................................................................ 18 Microsoft Windows or UNIX Process Arguments Example...................................................................... 18 z/OS Process Arguments Example...................................................................................................... 21 The Default Configuration with Rules........................................................................................................21 Match Criteria and Operators...............................................................................................................21 Rules Processing.................................................................................................................................. 23 Guidelines for Defining Rules...............................................................................................................23 Creating a Watched File Rule.................................................................................................................... 23 Validating a Watched File Rule.................................................................................................................. 25 Creating a System Event Rule................................................................................................................... 26 Reordering Rules....................................................................................................................................... 29 Configuration File Hierarchy......................................................................................................................29 Configuration Files.............................................................................................. 29 Creating a New Configuration File.............................................................................................................29 Editing a Configuration File........................................................................................................................34 Deleting a Configuration File..................................................................................................................... 34 Creating Multiple Configurations with the Copy Function........................................................................ 35 Creating Multiple Configurations...............................................................................................................39 Configuration Template Variable Rules............................................................................................... 40 Configuration Build File Variable Rules............................................................................................... 40 Locking a Configuration File for Distribution....................................................................................... 40 Copying a Rule........................................................................................................................................... 41 Deleting a Rule...........................................................................................................................................41 Enabling and Disabling a Rule................................................................................................................... 42 Editing a Rule........................................................................................................................................42 Variables in Rules................................................................................................................................. 42 ii Saving a Configuration in a Text File....................................................................................................45 Operating Sterling Connect:Direct File Agent........................................................47 Running Sterling Connect:Direct File Agent as a Microsoft Windows Service......................................... 47 Starting Sterling Connect:Direct File Agent Automatically on a UNIX Computer....................................47 Starting Sterling Connect:Direct File Agent from a Microsoft Windows Shortcut................................... 47 Running Sterling Connect:Direct File Agent from the UNIX Command Line with a Specific Configuration File............................................................................................................................ 48 Microsoft Windows Command............................................................................................................. 48 Using UNIX Commands to Start...........................................................................................................48 Sterling Connect:Direct File Agent in a z/OS Environment.......................................................................49 Sterling Connect:Direct File Agent with SMS-Managed GDGs............................................................50 Sterling Connect:Direct File Agent for SMS-Deferred Roll In Configuration............................................50 Modifying the Script for the Sterling Connect:Direct File Agent Execution Job................................. 50 Shutting Down Sterling Connect:Direct File Agent on z/OS................................................................51 Ending a Sterling Connect:Direct File Agent Configuration Session........................................................ 51 Sterling Connect:Direct File Agent Log Files.............................................................................................52 Changing Console Logging Level to WARN.......................................................................................... 52 Changing Console Logging Level to DEBUG.........................................................................................53 Configuring to Run in Verbose Mode....................................................................................................53 Status and Monitoring..........................................................................................53 Sterling Connect:Direct File Agent Status Information............................................................................ 53 Sterling Connect:Direct File Agent Configuration Guidelines...................................................................54 Sterling Control Center Monitoring Guidelines......................................................................................... 54 SNMP Trap Information......................................................................................................................
Load more

Recommended publications
  • Types and Programming Languages by Benjamin C
    < Free Open Study > . .Types and Programming Languages by Benjamin C. Pierce ISBN:0262162091 The MIT Press © 2002 (623 pages) This thorough type-systems reference examines theory, pragmatics, implementation, and more Table of Contents Types and Programming Languages Preface Chapter 1 - Introduction Chapter 2 - Mathematical Preliminaries Part I - Untyped Systems Chapter 3 - Untyped Arithmetic Expressions Chapter 4 - An ML Implementation of Arithmetic Expressions Chapter 5 - The Untyped Lambda-Calculus Chapter 6 - Nameless Representation of Terms Chapter 7 - An ML Implementation of the Lambda-Calculus Part II - Simple Types Chapter 8 - Typed Arithmetic Expressions Chapter 9 - Simply Typed Lambda-Calculus Chapter 10 - An ML Implementation of Simple Types Chapter 11 - Simple Extensions Chapter 12 - Normalization Chapter 13 - References Chapter 14 - Exceptions Part III - Subtyping Chapter 15 - Subtyping Chapter 16 - Metatheory of Subtyping Chapter 17 - An ML Implementation of Subtyping Chapter 18 - Case Study: Imperative Objects Chapter 19 - Case Study: Featherweight Java Part IV - Recursive Types Chapter 20 - Recursive Types Chapter 21 - Metatheory of Recursive Types Part V - Polymorphism Chapter 22 - Type Reconstruction Chapter 23 - Universal Types Chapter 24 - Existential Types Chapter 25 - An ML Implementation of System F Chapter 26 - Bounded Quantification Chapter 27 - Case Study: Imperative Objects, Redux Chapter 28 - Metatheory of Bounded Quantification Part VI - Higher-Order Systems Chapter 29 - Type Operators and Kinding Chapter 30 - Higher-Order Polymorphism Chapter 31 - Higher-Order Subtyping Chapter 32 - Case Study: Purely Functional Objects Part VII - Appendices Appendix A - Solutions to Selected Exercises Appendix B - Notational Conventions References Index List of Figures < Free Open Study > < Free Open Study > Back Cover A type system is a syntactic method for automatically checking the absence of certain erroneous behaviors by classifying program phrases according to the kinds of values they compute.
    [Show full text]
  • A High-Level Programming Language for Multimedia Streaming
    Liquidsoap: a High-Level Programming Language for Multimedia Streaming David Baelde1, Romain Beauxis2, and Samuel Mimram3 1 University of Minnesota, USA 2 Department of Mathematics, Tulane University, USA 3 CEA LIST – LMeASI, France Abstract. Generating multimedia streams, such as in a netradio, is a task which is complex and difficult to adapt to every users’ needs. We introduce a novel approach in order to achieve it, based on a dedi- cated high-level functional programming language, called Liquidsoap, for generating, manipulating and broadcasting multimedia streams. Unlike traditional approaches, which are based on configuration files or static graphical interfaces, it also allows the user to build complex and highly customized systems. This language is based on a model for streams and contains operators and constructions, which make it adapted to the gen- eration of streams. The interpreter of the language also ensures many properties concerning the good execution of the stream generation. The widespread adoption of broadband internet in the last decades has changed a lot our way of producing and consuming information. Classical devices from the analog era, such as television or radio broadcasting devices have been rapidly adapted to the digital world in order to benefit from the new technologies available. While analog devices were mostly based on hardware implementations, their digital counterparts often consist in software implementations, which po- tentially offers much more flexibility and modularity in their design. However, there is still much progress to be done to unleash this potential in many ar- eas where software implementations remain pretty much as hard-wired as their digital counterparts.
    [Show full text]
  • An Overview of the Jumplist Configuration File in Windows 7
    Journal of Digital Forensics, Security and Law Volume 7 Number 1 Article 2 2012 An Overview of the Jumplist Configuration File in Windows 7 Harjinder S. Lallie University of Warwick, Coventry Parmjit S. Bains University of Derby, School of Computing and Mathematics Follow this and additional works at: https://commons.erau.edu/jdfsl Part of the Computer Engineering Commons, Computer Law Commons, Electrical and Computer Engineering Commons, Forensic Science and Technology Commons, and the Information Security Commons Recommended Citation Lallie, Harjinder S. and Bains, Parmjit S. (2012) "An Overview of the Jumplist Configuration File in Windows 7," Journal of Digital Forensics, Security and Law: Vol. 7 : No. 1 , Article 2. DOI: https://doi.org/10.15394/jdfsl.2012.1110 Available at: https://commons.erau.edu/jdfsl/vol7/iss1/2 This Article is brought to you for free and open access by the Journals at Scholarly Commons. It has been accepted for inclusion in Journal of Digital Forensics, Security and Law by an authorized administrator of (c)ADFSL Scholarly Commons. For more information, please contact [email protected]. Journal of Digital Forensics, Security and Law, Vol. 7(1) An Overview of the Jumplist Configuration File in Windows 7 Harjinder Singh Lalli University of Warwick, International Digital Laboratory (WMG), University of Warwick, Coventry, CV4 7AL, UK; [email protected] Parmjit Singh Bains University of Derby, School of Computing and Mathematics, Kedleston Road, Derby, DE22 1GB, UK; [email protected] ABSTRACT The introduction of Jumplists in Windows 7 was an important feature from a forensic examiners viewpoint. Jumplist configuration files can provide the examiner with a wealth of information relating to file access and in particular: dates/times, Volume GUIDs and unique file object IDs relating to those files.
    [Show full text]
  • The Sitcom | Arts & Entertainment in Spokane Valley, WA | Mainvest
    3/18/2021 Invest in Selling Seattle- The Sitcom | Arts & Entertainment in Spokane Valley, WA | Mainvest ls dashboard | Print to text | View investment opportunities on Mainvest Edit Profile Watch this investment opportunity Share Selling Seattle- The Sitcom Arts & Entertainment 17220 E Mansfield Ave Spokane Valley, WA 99016 Get directions Coming Soon View Website Profile Data Room Discussion This is a preview. It will become public when you start accepting investment. THE PITCH Selling Seattle- The Sitcom is seeking investment to produce one or two episodes. Generating Revenue This is a preview. It will become public when you start accepting investment. Early Investor Bonus: The investment multiple is increased to 20 for the next $200,000 invested. This is a preview. It will become public when you start accepting investment. SELLING SEATTLE IS? Play 0000 0107 Mute Settings Enter fullscreen Play Who or What is Michael? This is a preview. It will become public when you start accepting investment. OUR STORY "Selling Seattle" is a smart broad comedy in the vein of "Seinfeld" and "Arrested Development". We are working with the video production company North by Northwest to produce the pilot and the second episode in Spokane, Washington this spring. We plan to stream episodes on the internet with commercials in a thirty-minute format. With cash flow from the pilot and second episode we will produce four to six episodes this fall and at least twelve episodes next year. The money raised through Mainvest will be used to produce the first one or two episodes of Selling Seattle and for advertising costs, office expenses and an income for Jim McGuffin not to exceed $15,000 per episode.
    [Show full text]
  • Filesystem Hierarchy Standard
    Filesystem Hierarchy Standard LSB Workgroup, The Linux Foundation Filesystem Hierarchy Standard LSB Workgroup, The Linux Foundation Version 3.0 Publication date March 19, 2015 Copyright © 2015 The Linux Foundation Copyright © 1994-2004 Daniel Quinlan Copyright © 2001-2004 Paul 'Rusty' Russell Copyright © 2003-2004 Christopher Yeoh Abstract This standard consists of a set of requirements and guidelines for file and directory placement under UNIX-like operating systems. The guidelines are intended to support interoperability of applications, system administration tools, development tools, and scripts as well as greater uniformity of documentation for these systems. All trademarks and copyrights are owned by their owners, unless specifically noted otherwise. Use of a term in this document should not be regarded as affecting the validity of any trademark or service mark. Permission is granted to make and distribute verbatim copies of this standard provided the copyright and this permission notice are preserved on all copies. Permission is granted to copy and distribute modified versions of this standard under the conditions for verbatim copying, provided also that the title page is labeled as modified including a reference to the original standard, provided that information on retrieving the original standard is included, and provided that the entire resulting derived work is distributed under the terms of a permission notice identical to this one. Permission is granted to copy and distribute translations of this standard into another language, under the above conditions for modified versions, except that this permission notice may be stated in a translation approved by the copyright holder. Dedication This release is dedicated to the memory of Christopher Yeoh, a long-time friend and colleague, and one of the original editors of the FHS.
    [Show full text]
  • Ugp-20G Of1 Classic Gas Range Installation and Owner's
    CLASSIC GAS RANGE (LPG & NG convertible) INSTALLATION UGP-20G OF1 AND OWNER’S MANUAL 20” (50.8 cm) SERIAL NUMBER: READ AND SAVE THESE INSTRUCTIONS AUG17V2 UNIQUE 20G CLASSIC MODEL OFF GRID GAS RANGE – LPG & NG CONVERTIBLE Installation and Owner’s Manual This manual contains information for: • Important Safeguards • Installation • Use and Care Certain ranges come equipped with special features. Determine from a study of your range which of the instructions given in this booklet pertain to your range. This booklet gives valuable instructions covering the installation, adjustment and use of your range. How to Obtain Service and/or Parts When your range does not operate in accordance with the instructions in the manual, you should contact the dealer in your immediate vicinity for service. Or, the purchaser may contact the service organization noted on the warranty. Important TO THE OWNER OF THE RANGE: Retain this owner’s manual for future reference. TO THE INSTALLER: Leave this owner’s manual with the range. Read and Save These Instructions The installation of the appliance must conform with local codes ANSI Z21.1b-2012, in the absence of local national Fuel Gas Code, ANSI Z233.1, and in Canada B149.2 Propane Storage and Handling Code MANUFACTURED AND CERTIFIED BY Unique Gas Products Ltd A child or adult can tip WARNING the range and be killed. Install the anti-tip device to the structure and/or the range. Verify the anti-tip device has been properly installed and engaged. Engage the range to the anti-tip device by ensuring the anti-tip device is re-engaged when the range is moved.
    [Show full text]
  • Learning the Vi Editor
    Learning the vi Editor en.wikibooks.org December 29, 2013 On the 28th of April 2012 the contents of the English as well as German Wikibooks and Wikipedia projects were licensed under Creative Commons Attribution-ShareAlike 3.0 Unported license. A URI to this license is given in the list of figures on page 103. If this document is a derived work from the contents of one of these projects and the content was still licensed by the project under this license at the time of derivation this document has to be licensed under the same, a similar or a compatible license, as stated in section 4b of the license. The list of contributors is included in chapter Contributors on page 101. The licenses GPL, LGPL and GFDL are included in chapter Licenses on page 107, since this book and/or parts of it may or may not be licensed under one or more of these licenses, and thus require inclusion of these licenses. The licenses of the figures are given in the list of figures on page 103. This PDF was generated by the LATEX typesetting software. The LATEX source code is included as an attachment (source.7z.txt) in this PDF file. To extract the source from the PDF file, you can use the pdfdetach tool including in the poppler suite, or the http://www. pdflabs.com/tools/pdftk-the-pdf-toolkit/ utility. Some PDF viewers may also let you save the attachment to a file. After extracting it from the PDF file you have to rename it to source.7z.
    [Show full text]
  • Programming Language Features for Refinement
    Programming Language Features for Refinement Jason Koenig K. Rustan M. Leino Stanford University Microsoft Research [email protected] [email protected] Algorithmic and data refinement are well studied topics that provide a mathematically rigorous ap- proach to gradually introducing details in the implementation of software. Program refinements are performed in the context of some programming language, but mainstream languages lack features for recording the sequence of refinement steps in the program text. To experiment with the combination of refinement, automated verification, and language design, refinement features have been added to the verification-aware programming language Dafny. This paper describes those features and reflects on some initial usage thereof. 0. Introduction Two major problems faced by software engineers are the development of software and the maintenance of software. In addition to fixing bugs, maintenance involves adapting the software to new or previously underappreciated scenarios, for example, using new APIs, supporting new hardware, or improving the performance. Software version control systems track the history of software changes, but older versions typically do not play any significant role in understanding or evolving the software further. For exam- ple, when a simple but inefficient data structure is replaced by a more efficient one, the program edits are destructive. Consequently, understanding the new code may be significantly more difficult than un- derstanding the initial version, because the source code will only show how the more complicated data structure is used. The initial development of the software may proceed in a similar way, whereby a software engi- neer first implements the basic functionality and then extends it with additional functionality or more advanced behaviors.
    [Show full text]
  • Filesystem Hierarchy Standard
    Filesystem Hierarchy Standard Filesystem Hierarchy Standard Group Edited by Rusty Russell Daniel Quinlan Filesystem Hierarchy Standard by Filesystem Hierarchy Standard Group Edited by Rusty Russell and Daniel Quinlan Published November 4 2003 Copyright © 1994-2003 Daniel Quinlan Copyright © 2001-2003 Paul ’Rusty’ Russell Copyright © 2003 Christopher Yeoh This standard consists of a set of requirements and guidelines for file and directory placement under UNIX-like operating systems. The guidelines are intended to support interoperability of applications, system administration tools, development tools, and scripts as well as greater uniformity of documentation for these systems. All trademarks and copyrights are owned by their owners, unless specifically noted otherwise. Use of a term in this document should not be regarded as affecting the validity of any trademark or service mark. Permission is granted to make and distribute verbatim copies of this standard provided the copyright and this permission notice are preserved on all copies. Permission is granted to copy and distribute modified versions of this standard under the conditions for verbatim copying, provided also that the title page is labeled as modified including a reference to the original standard, provided that information on retrieving the original standard is included, and provided that the entire resulting derived work is distributed under the terms of a permission notice identical to this one. Permission is granted to copy and distribute translations of this standard into another language, under the above conditions for modified versions, except that this permission notice may be stated in a translation approved by the copyright holder. Table of Contents 1. Introduction........................................................................................................................................................1 1.1.
    [Show full text]
  • Agenda Planning Commission Virtual/Electronic Regular Meeting
    AGENDA PLANNING COMMISSION VIRTUAL/ELECTRONIC REGULAR MEETING Thursday, June 3, 2021 Held Remotely on Zoom 7:00 p.m. https://us02web.zoom.us/j/81758727894?pwd=VkVXblhNYlIwOVdYOFRyNTRWSzNNUT09 Passcode: 685842 In an effort to curtail the spread of the COVID-19 virus, the Planning Commission meeting will take place online using the Zoom platform and the public will not be allowed to attend in-person. You may watch a live feed of the meeting online; join the meeting via Zoom Webinar; or listen to the meeting over the telephone. The Planning Commission is providing opportunities for public comment by submitting written comment or calling into the meeting to provide oral public comment. To provide oral public comment you must sign-up by 6:30 p.m. the night of the meeting. Please see the information listed below to access all of these options: Click here to watch live streaming video of the Meeting on shorelinewa.gov Attend the Meeting via Zoom Webinar: https://us02web.zoom.us/j/81758727894?pwd=VkVXblhNYlIwOVdYOFRyNTRWSzNNUT09 Passcode: 685842 Call into the Live Meeting: (253) 215-8782 - Webinar ID: 817 5872 7894 Click Here to Sign-Up to Provide Oral Testimony Pre-registration is required by 6:30 p.m. the night of the meeting. Click Here to Submit Written Public Comment Written comments will be presented to Council and posted to the website if received by 4:00 p.m. the night of the meeting; otherwise they will be sent and posted the next day. Estimated Time 1. CALL TO ORDER 7:00 2. ROLL CALL 7:01 3.
    [Show full text]
  • Command $Line; Done
    http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA
    [Show full text]
  • User's Manual
    USER’S MANUAL USER’S > UniQTM UniQTM User’s Manual Ed.: 821003146 rev.H © 2016 Datalogic S.p.A. and its Group companies • All rights reserved. • Protected to the fullest extent under U.S. and international laws. • Copying or altering of this document is prohibited without express written consent from Datalogic S.p.A. • Datalogic and the Datalogic logo are registered trademarks of Datalogic S.p.A. in many countries, including the U.S. and the E.U. All other brand and product names mentioned herein are for identification purposes only and may be trademarks or registered trademarks of their respective owners. Datalogic shall not be liable for technical or editorial errors or omissions contained herein, nor for incidental or consequential damages resulting from the use of this material. Printed in Donnas (AO), Italy. ii SYMBOLS Symbols used in this manual along with their meaning are shown below. Symbols and signs are repeated within the chapters and/or sections and have the following meaning: Generic Warning: This symbol indicates the need to read the manual carefully or the necessity of an important maneuver or maintenance operation. Electricity Warning: This symbol indicates dangerous voltage associated with the laser product, or powerful enough to constitute an electrical risk. This symbol may also appear on the marking system at the risk area. Laser Warning: This symbol indicates the danger of exposure to visible or invisible laser radiation. This symbol may also appear on the marking system at the risk area. Fire Warning: This symbol indicates the danger of a fire when processing flammable materials.
    [Show full text]