Introduction

Total Page:16

File Type:pdf, Size:1020Kb

Introduction introduction Harvard Apparatus has been supplying life science researchers studying these model organisms have been making with innovative products and excellent customer support since considerable contributions using Harvard Apparatus products 1902. Over the last 102 years Harvard Apparatus has played a for years, but now new products are required to enhance their significant role in the advancement of science, and we are research. For this catalog, Harvard Apparatus reviewed proud to maintain that role today. Harvard Apparatus is well published research on model organisms and organized our known for its support of small animal research, providing products accordingly. We have added new products to enhance products ideal for studies on mice, rats, guinea pigs, cats and model organism research and included sample publications to dogs. Now the time has come to extend our renowned support assist you in utilizing both the new and existing products. to new research models in bioresearch, including Drosophila, Nematodes, Xenopus and Zebrafish. Life science researchers What are 'model organisms'? (Richard Twyman) A model organism is a species that has been widely studied, usually because it is easy to maintain and breed in a laboratory setting and has particular experimental advantages. Over the years, a great deal of data has accumulated about such organisms and this in itself makes them more attractive to study. Model organisms are used to obtain information about other species – including humans – that are more difficult to study directly. MODEL TYPES SPECIES CHARACTERISTICS Genetic Model Organisms These species are amenable to Baker’s Yeast Many different mutants are generally available and genetic analysis: (Saccharomyces cerevisiae) highly detailed genetic maps can be created. 1. they breed in large numbers 2. have a short generation time Fruit Fly so large-scale crosses can be set up (Drosophila melanogaster) and followed over several generations. Nematode Worm (Caenorhabditis elegans) Experimental Model Organisms These species may not necessarily Chicken They have many disadvantages in terms of genetics be genetically amenable: but they produce robust embryos that can be studied 1. they may have long generation intervals African Clawed Frog and manipulated with ease. These species are widely 2. poor genetic maps (Xenopus laevis) used model organisms in developmental biology. but they have other experimental advantages Genomic Model Organisms Regardless of their genetic or experimental Puffer Fish Has a similar gene repertoire to humans but a much advantages and disadvantages, certain species (Fugu rubripes) smaller genome (400 million base pairs instead of are chosen as model organisms because they 3000 million.) The difference in size is mainly due to occupy a pivotal position in the evolutionary the presence of more repetitive DNA, larger segments tree or because some quality of their genome of DNA between genes and larger introns in the makes them ideal to study. human genome. Fly and Worm Surprisingly, over 60% of the human disease genes that have been identified thus far have counterparts in the fly and worm, revealing a core of about 1,500 gene families that is conserved in all animals. Mouse Harvard Apparatus • phone 508.893.8999 • toll free U.S. 800.272.2775 • fax 508.429.5732 • www.harvardapparatus.com.
Recommended publications
  • L. Lacey Knowles
    Curriculum Vitae L. Lacey Knowles Department of Ecology and Evolutionary Biology E-mail: knowlesl@umich.edu Museum of Zoology, University of Michigan Orcid ID: 0000-0002-6567-4853 Ann Arbor, MI 48109-1079 POSITIONS 2015-present, Robert B. Payne Collegiate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2012-2015, Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2008-2012, Associate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2003-2008, Assistant Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan ACADEMIC APPOINTMENTS: Science Communication Fellow, Museum of Natural History, University of Michigan Member, Center for statistical Genetics, University of Michigan NIH Training Program in Genome Sciences, University of Michigan EDUCATION 2001-2002 NIH Postdoctoral Fellowship (PERT: Postdoctoral Excellence in Research and Teaching) awarded through the Center for Insect Science at the University of Arizona 1999-2001 Postdoctoral Fellowship from the National Science Foundation Research Training Group in the Analysis of Biological Diversification at the University of Arizona 1999 Ph.D., Ecology and Evolution, State University of New York at Stony Brook Dissertation title: Genealogical portraits of Pleistocene speciation and diversity patterns in montane grasshoppers 1993 M.S., Zoology, University of South Florida. Thesis title: Effects of habitat structure on community assemblages of epifaunal macroinvertebrates in seagrass systems. 1989 B.S., cum laude with honors in Marine Biology, University of North Carolina, Wilmington RESEARCH INTERESTS Speciation and processes that promote divergence Phylogenomics and statistical phylogeography Evolutionary consequences of climate change HONORS AND AWARDS *Fulbright U.S.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Network Access to the Genome and Biology of Caenorhabditis Elegans
    82–86 Nucleic Acids Research, 2001, Vol. 29, No. 1 © 2001 Oxford University Press WormBase: network access to the genome and biology of Caenorhabditis elegans Lincoln Stein*, Paul Sternberg1, Richard Durbin2, Jean Thierry-Mieg3 and John Spieth4 Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724, USA, 1Howard Hughes Medical Institute and California Institute of Technology, Pasadena, CA, USA, 2The Sanger Centre, Hinxton, UK, 3National Center for Biotechnology Information, Bethesda, MD, USA and 4Genome Sequencing Center, Washington University, St Louis, MO, USA Received September 18, 2000; Accepted October 4, 2000 ABSTRACT and a page that shows the locus in the context of the physical map. WormBase (http://www.wormbase.org) is a web-based WormBase uses HTML linking to represent the relationships resource for the Caenorhabditis elegans genome and between objects. For example, a segment of genomic sequence its biology. It builds upon the existing ACeDB data- object is linked with the several predicted gene objects base of the C.elegans genome by providing data contained within it, and each predicted gene is linked to its curation services, a significantly expanded range of conceptual protein translation. subject areas and a user-friendly front end. The major components of the resource are described below. The C.elegans genome DESCRIPTION WormBase contains the ‘essentially complete’ genome of Caenorhabditis elegans (informally known as ‘the worm’) is a C.elegans, which now stands at 99.3 Mb of finished DNA small, soil-dwelling nematode that is widely used as a model interrupted by approximately 25 small gaps. In addition, the system for studies of metazoan biology (1).
    [Show full text]
  • Lower Organisms As Alternatives for Toxicity Testing in Rodents with a Focus on Ceanorhabditis Elegans and the Zebrafish (Danio Rerio)
    Report 340720003/2009 L.T.M. van der Ven Lower organisms as alternatives for toxicity testing in rodents With a focus on Ceanorhabditis elegans and the zebrafish (Danio rerio) RIVM report 340720003/2009 Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabditis elegans and the zebrafish (Danio rerio) L.T.M. van der Ven Contact: L.T.M. van der Ven Laboratory for Health Protection Research leo.van.der.ven@rivm.nl This investigation has been performed by order and for the account of the Ministry of Health, Welfare and Sport, within the framework of V/340720 Alternatives for animal testing RIVM, P.O. Box 1, 3720 BA Bilthoven, the Netherlands Tel +31 30 274 91 11 www.rivm.nl © RIVM 2009 Parts of this publication may be reproduced, provided acknowledgement is given to the 'National Institute for Public Health and the Environment', along with the title and year of publication. RIVM report 340720003 2 Abstract Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabiditis elegans and the zebrafish (Danio rerio) The nematode C. elegans and the zebrafish embryo are promising alternative test models for assessment of toxic effects in rodents. Tests with these lower organisms may have a good predictive power for effects in humans and are thus complementary to tests with in vitro models (cell cultures). However, all described tests need further validation. This is the outcome of a literature survey, commissioned by the ministry of Health, Welfare and Sport of the Netherlands. The survey is part of the policy to reduce, refine and replace animal testing (3R policy).
    [Show full text]
  • Hypothesis As an Alternative. the Distribution Of
    Heredity (1976), 36 (3), 293-304 REASSOCIATIONPATTERNS AMONG SEGMENTAL INTERCHANGES IN MAIZE D.B. WALDEN and R. C. JANCEY Department of Plant Sciences,Universityof WesternOntario,London, Ontario N6A 3K7 Received2.iv.75 SUMMARY Data from Longley (1961) and Burnham (1969) on the cytological position of the break-points in chrornosomal rearrangements in maize were re-expressed in terms of segment lengths and analysed. After correction for the deviation of the distribution of break-points from an equidistribution, it was shown that highly significant excesses and deficits occurred among some but not all segment length classes. It was concluded that the pattern of reassociation shows: (i) that reassociation involves non-homologues whose interstitial segments are of similar length more frequently than expected; (ii) that the two interchange segments involved in a translocation are of similar length more frequently than expected. 1. INTRODUCTION AN extensive literature exists on the genetic effects and consequences of exposure to radiation and radiomimetic and radiochemical compounds. The origin of chromosomal aberrations had long been considered to be the consequence of" breakage and reunion" until Revell (1955) proposed an "exchange" hypothesis as an alternative. The distribution of the "breakage" or "exchange" events has been approximately determined in several species, with a" random "distribution being claimed by some workers and a "non-random" distribution favoured by several recent investigators (e.g. Caspersson et al., 1972). It is important for the present communication to note that most of the studies record observations made one or a few cell generations after exposure to the mutagen and that only limited information is available about the survival of the aberrations so induced.
    [Show full text]
  • Effects of Gut-Associated Yeasts on Drosophila Melanogaster Performance
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 12-6-2016 12:00 AM Effects of gut-associated yeasts on Drosophila melanogaster performance Yanira Jiménez Padilla The University of Western Ontario Supervisor Brent Sinclair The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Yanira Jiménez Padilla 2016 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Biology Commons Recommended Citation Jiménez Padilla, Yanira, "Effects of gut-associated yeasts on Drosophila melanogaster performance" (2016). Electronic Thesis and Dissertation Repository. 4285. https://ir.lib.uwo.ca/etd/4285 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact wlswadmin@uwo.ca. Abstract I used Drosophila melanogaster as a model to study the role of the gut microbiota, specifically yeasts, in animal physiology. I used Saccharomyces cerevisiae, the yeast commonly included in Drosophila diet, and Lachancea kluyveri, isolated from some Drosophila in the wild, and generated axenic (germ-free) and gnotobiotic (yeast-fed) flies. I found that L. kluyveri persists in the crop, as ascospores and vegetative cells, longer than S. cerevisiae. Some L. kluyveri vegetative cells survive passage through the gut. Egg to adult development time is reduced by 14% in vials containing live L. kluyveri or S. cerevisiae, whereas heat-killed yeasts reduced development time by 3.5-4.5%.
    [Show full text]
  • DROSOPHILA MELANOGASTER - the MODEL ORGANISM of CHOICE for the COMPLEX BIOLOGY of MULTI-CELLULAR ORGANISMS Kathleen M
    DROSOPHILA MELANOGASTER - THE MODEL ORGANISM OF CHOICE FOR THE COMPLEX BIOLOGY OF MULTI-CELLULAR ORGANISMS Kathleen M. Beckingham 1*, J. Douglas Armstrong2, Michael J. Texada1, Ravi Munjaal1, Dean A. Baker2 1 Department of Biochemistry and Cell Biology, MS-140, Rice University, Houston, Texas 77251. 2 School of Informatics, Institute for Adaptive and Neural Computation Edinburgh, EH1 2QL, UK. ABSTRACT Although the route from mutation to sequenced gene may Drosophila melanogaster has been intensely studied for almost be long and hard, genetics is an extremely powerful 100 years. The sophisticated array of genetic and molecular approach because it can be applied to much more tools that have evolved for analysis of gene function in this complex biological processes than biochemistry. Clearly organism are unique. Further, Drosophila is a complex multi- for fundamental, universal processes that can be studied cellular organism in which many aspects of development and behavior parallel those in human beings. These combined in cell-free extracts, the biochemical approach is highly advantages have permitted research in Drosophila to make effective. But for complex processes, such as seminal contributions to the understanding of fundamental developmental events or behavioral responses, in which biological processes and ensure that Drosophila will continue to many components of the whole organism are in play, provide unique insights in the genomic era. An overview of the genetics offers perhaps the only viable route to dissecting genetic methodologies available in Drosophila is given here, out the protein components. together with examples of outstanding recent contributions of Drosophila to our understanding of cell and organismal biology. The genetic approach has been used to probe gene/protein The growing contribution of Drosophila to our knowledge of function in many organisms.
    [Show full text]
  • Patterns and Potential Mechanisms of Thermal Preference in E. Muscae-Infected Drosophila Melanogaster
    Western Washington University Western CEDAR WWU Honors Program Senior Projects WWU Graduate and Undergraduate Scholarship Spring 2020 Patterns and potential mechanisms of thermal preference in E. muscae-infected Drosophila melanogaster Aundrea Koger Western Washington University Carolyn Elya Ph.D. Harvard University Jamilla Akhund-Zade Ph.D. Harvard University Benjamin de Bivort Ph.D. Harvard University Follow this and additional works at: https://cedar.wwu.edu/wwu_honors Recommended Citation Koger, Aundrea; Elya, Carolyn Ph.D.; Akhund-Zade, Jamilla Ph.D.; and de Bivort, Benjamin Ph.D., "Patterns and potential mechanisms of thermal preference in E. muscae-infected Drosophila melanogaster" (2020). WWU Honors Program Senior Projects. 406. https://cedar.wwu.edu/wwu_honors/406 This Project is brought to you for free and open access by the WWU Graduate and Undergraduate Scholarship at Western CEDAR. It has been accepted for inclusion in WWU Honors Program Senior Projects by an authorized administrator of Western CEDAR. For more information, please contact westerncedar@wwu.edu. Patterns and potential mechanisms of thermal preference in Entomophthora ​ muscae-infected Drosophila melanogaster ​ ​ 1 2 2 Aundrea Koger ,​ Carolyn Elya, Ph.D. ,​ Jamilla Akhund-Zade, Ph.D. ,​ and Benjamin de Bivort, ​ ​ ​ Ph.D.2 ​ 1 2 Honors​ Program, Western Washington University, Department​ of Organismic and ​ Evolutionary Biology, Harvard University Abstract Animals use various strategies to defend against pathogens. Behavioral fever, or fighting infection by moving to warm locations, is seen in many ectotherms. The behavior-manipulating fungal pathogen Entomophthora muscae infects numerous dipterans, including fruit flies and ​ ​ ​ ​ house flies, Musca domestica. House flies have been shown to exhibit robust behavioral fever ​ ​ early after exposure to E.
    [Show full text]
  • Helical Insertion of Peptidoglycan Produces Chiral Ordering of the Bacterial Cell Wall
    Helical insertion of peptidoglycan produces PNAS PLUS chiral ordering of the bacterial cell wall Siyuan Wanga,b, Leon Furchtgottc,d, Kerwyn Casey Huangd,1, and Joshua W. Shaevitza,e,1 aLewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544; bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544; cBiophysics Program, Harvard University, Cambridge, MA 02138; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; and eDepartment of Physics, Princeton University, Princeton, NJ 08854 AUTHOR SUMMARY Cells from all kingdoms of wall growth to demonstrate life face the task of that patterning of cell-wall constructing a specific, synthesis by left-handed mechanically robust three- MreB polymers leads to a dimensional (3D) cell shape right-handed chiral from molecular-scale organization of the glycan components. For many strands. This organization bacteria, maintaining a rigid, produces a left-handed rod-like shape facilitates a twisting of the cell body diverse range of behaviors during elongational growth. including swimming motility, We then confirm the detection of chemical existence of right-handed gradients, and nutrient access Fig. P1. Helical insertion of material into the bacterial cell wall (green) glycan organization in E. coli during elongational growth, guided by the protein MreB (yellow), leads and waste evacuation in by osmotically shocking biofilms. The static shape of to an emergent chiral order in the cell-wall network and twisting of the cell that can be visualized using surface-bound beads (red). surface-labeled cells and a bacterial cell is usually directly measuring the defined by the cell wall, a difference in stiffness macromolecular polymer network composed of glycan strands between the longitudinal and transverse directions.
    [Show full text]
  • High Abundance of Invasive African Clawed Frog Xenopus Laevis in Chile: Challenges for Their Control and Updated Invasive Distribution
    Management of Biological Invasions (2019) Volume 10, Issue 2: 377–388 CORRECTED PROOF Research Article High abundance of invasive African clawed frog Xenopus laevis in Chile: challenges for their control and updated invasive distribution Marta Mora1, Daniel J. Pons2,3, Alexandra Peñafiel-Ricaurte2, Mario Alvarado-Rybak2, Saulo Lebuy2 and Claudio Soto-Azat2,* 1Vida Nativa NGO, Santiago, Chile 2Centro de Investigación para la Sustentabilidad & Programa de Doctorado en Medicina de la Conservación, Facultad de Ciencias de la Vida, Universidad Andres Bello, Republica 440, Santiago, Chile 3Facultad de Ciencias Exactas, Departamento de Matemáticas, Universidad Andres Bello, Santiago, Republica 470, Santiago, Chile Author e-mails: csoto@unab.cl (CSA), marta_mora@hotmail.com (MM), dpons@unab.cl (DJP), alexandra.penafiel.r@gmail.com (APR), maalry@gmail.com (MAR), saulo.lebuy@unab.cl (SL) *Corresponding author Citation: Mora M, Pons DJ, Peñafiel- Ricaurte A, Alvarado-Rybak M, Lebuy S, Abstract Soto-Azat C (2019) High abundance of invasive African clawed frog Xenopus Invasive African clawed frog Xenopus laevis (Daudin, 1802) are considered a major laevis in Chile: challenges for their control threat to aquatic environments. Beginning in the early 1970s, invasive populations and updated invasive distribution. have now been established throughout much of central Chile. Between September Management of Biological Invasions 10(2): and December 2015, we studied a population of X. laevis from a small pond in 377–388, https://doi.org/10.3391/mbi.2019. 10.2.11 Viña del Mar, where we estimated the population size and evaluated the use of hand nets as a method of control. First, by means of a non-linear extrapolation Received: 26 October 2018 model using the data from a single capture session of 200 min, a population size of Accepted: 7 March 2019 1,182 post-metamorphic frogs (range: 1,168–1,195 [quadratic error]) and a density Published: 16 May 2019 of 13.7 frogs/m2 (range: 13.6–13.9) of surface water were estimated.
    [Show full text]
  • Interactions Between Drosophila and Its Natural Yeast Symbionts---Is
    Interactions between Drosophila and its natural yeast symbionts—Is Saccharomyces cerevisiae a good model for studying the fly-yeast relationship? Don Hoang1,2 , Artyom Kopp1 and James Angus Chandler1,3 1 Department of Evolution and Ecology and Center for Population Biology, University of California, Davis, CA, USA 2 Current aYliation: Program in Genomics of DiVerentiation, NIH/NICHD, Bethesda, MD, USA 3 Current aYliation: Department of Molecular and Cellular Biology, University of California, Berkeley, CA, USA ABSTRACT Yeasts play an important role in the biology of the fruit fly, Drosophila melanogaster. In addition to being a valuable source of nutrition, yeasts aVect D. melanogaster behavior and interact with the host immune system. Most experiments investigating the role of yeasts in D. melanogaster biology use the baker’s yeast, Saccharomyces cerevisiae. However, S. cerevisiae is rarely found with natural populations of D. melanogaster or other Drosophila species. Moreover, the strain of S. cerevisiae used most often in D. melanogaster experiments is a commercially and industrially important strain that, to the best of our knowledge, was not isolated from flies. Since disrupting natural host–microbe interactions can have profound eVects on host biology, the results from D. melanogaster–S. cerevisiae laboratory experiments may not be fully representative of host–microbe interactions in nature. In this study, we explore the D. melanogaster-yeast relationship using five diVerent strains of yeast that were isolated from wild Drosophila populations. Ingested live yeasts have variable persistence in the D. melanogaster gastrointestinal tract. For example, Hanseniaspora occidentalis persists relative to S. cerevisiae, while Submitted 25 April 2015 Brettanomyces naardenensis is removed.
    [Show full text]