Botany
Molecular insights into the lichen genus Alectoria (Parmeliaceae) in North America
Journal: Botany
Manuscript ID cjb-2015-0186.R1
Manuscript Type: Article
Date Submitted by the Author: 23-Nov-2015
Complete List of Authors: McMullin, Richard; University of Guelph , Integrative Biology Lendemer, James; New York Botanical Garden Braid, Heather ; Auckland University of Technology, School of Applied Sciences Draft Newmaster, Steven; University of Guelph
Infrageneric taxonomy, Parmeliaceae, lichenized fungi, Mcm7 rDNA, ITS Keyword: rDNA
https://mc06.manuscriptcentral.com/botany-pubs Page 1 of 33 Botany
Molecular insights into the lichen genus Alectoria (Parmeliaceae) in North America
Richard Troy McMullin 1,* , James C. Lendemer 2, Heather E. Braid 3, and Steven G. Newmaster 1
1Centre for Biodiversity Genomics, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada 2Institute of Systematic Botany, The New York Botanical Garden, Bronx NY 10458 5126, U.S.A 3Institute for Applied Ecology New Zealand, School of Applied Sciences, Auckland University of Technology, Private Bag 92006, Auckland 1142, New Zealand
*Corresponding author: [email protected]
Draft
1
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 2 of 33
Abstract
Alectoria is a genus of fruticose lichen characterised by the presence of usnic acid and conspicuous raised pseudocyphellae. This genus is particularly diverse and abundant in montane, boreal, and Arctic regions of North America. Because intermediate forms have been reported for several species of Alectoria on the continent it has been suggested that these species were initially delimited based on the extremes of morphological gradients. Here, we use the results of molecular phylogenetic analyses of two nuclear genes, ITS and Mcm7 , with 48 representatives of 9 taxa to examine the delineation of 5 taxa that have been previously shown to be related to, or confused with, A. sarmentosa : A. fallacina, A. imshaugii , A. sarmentosa var. sorediosa , A. sarmentosa ssp. vexillifera , and A. vancouverensis . Alectoria fallacina was found to be well supported and distantly related to A. sarmentosa . Conversely, the other four taxa were recovered as a single monophyletic group with little internal structure which did not support the presently defined morphological species. A provisional taxonomic treatment is proposed pending more detailed study at the population level. DraftAlectoria sarmentosa var. sorediosa is recognized at the species level, which necessitates the new combination: A. sorediosa . An updated key to the North American species of Alectoria is also provided.
Key Words
Infrageneric taxonomy, infraspecific taxonomy, lichenized fungi, Parmeliaceae, ITS rDNA, Mcm7 rDNA, Appalachians, arctic alpine.
2
https://mc06.manuscriptcentral.com/botany-pubs Page 3 of 33 Botany
Introduction
In North America, the fruticose lichen genus Alectoria Ach. (Parmeliaceae) is common throughout the Arctic, as well as on both northern coasts, with a distribution extending southwards in montane habitats of the Appalachian and western mountains (Hawksworth 1972; Brodo and Hawksworth 1977). Disjunct populations of some species also occur in montane habitats of Mexico, and at least one species, A. mexicana Brodo & D. Hawksw., is endemic to that region (Brodo and Hawksworth 1977). The last taxonomic treatment of the genus in North America was by Brodo and Hawksworth (1977), who included eight species and two subspecies. Recently, one species, A. nigricans (Ach.) Nyl., the only member of Alectoria that did not produce usnic acid, has been placed in a distinct genus, Gowardia Halonen et al., based on a molecular phylogenetic analysis (Halonen et al. 2009). With the exception of A. nigricans , the rest of the species have remained as circumscribed and classified by Brodo and Hawksworth (1977). Draft Brodo and Hawksworth (1977) discussed several cases in which the Alectoria taxa they recognized appeared to be linked by intermediates, nonetheless variously treating these taxa as independent species or subspecies. Specifically, they considered three species ( A. imshaugii , A. sarmentosa , and A. vancouverensis ) to display "morphological and chemical intermediaries between all possible combinations" (p. 71). Similarly, they recognized an ecologically and morphologically distinct entity restricted to Arctic and alpine regions as A. sarmentosa ssp. vexillifera based on its chemical similarity to A. sarmentosa ssp. sarmentosa . An additional species, A. fallacina was “tentatively recognized at the species level” by Brodo and Hawksworth (1977, p. 57) following Motyka (1960). However, Brodo and Hawksworth (1977) considered that A. fallacina may actually be a subspecies of A. sarmentosa because of chemical and morphological intermediates. A final variant of A. sarmentosa discussed by Brodo and Hawksworth (1977) was a rare sorediate form, which was neither classified as a species nor a subspecies, although it was previously recognized as a variety by Hawksworth (1972).
Since Brodo and Hawksworth's (1977) monograph, Alectoria has not been the direct subject of a major taxonomic revision and thus the taxonomic uncertainties outlined above remain unresolved. Despite the substantial resources that have been devoted to using molecular data to resolve outstanding questions of generic circumscription and species delimitation in the
3
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 4 of 33
Parmeliaceae (Crespo et al. 2010a,b; Buaruang et al. 2015; de Paz et al. 2010a,b; Del Prado et al. 2010, 2013; Divakar et al. 2010, 2013; Elix et al. 2010; Lendemer and Hodkinson 2010; Leavitt et al. 2014; Lendemer and Ruiz 2015; Mark et al. 2012; Nelson et al. 2012; Nelsen et al. 2013; Saag et al. 2014), and more specifically the related fruticose genus Bryoria (Myllys et al. 2014; Velmala et al. 2014), Alectoria has not been the direct subject of such a study. Nonetheless, recent molecular studies of Bryoria and Parmeliaceae have included samples of Alectoria and recovered results that strongly suggested further study was needed (Myllys et al. 2014; Halonen et al. 2009).
The aim of this study was to examine the current taxonomy of North American Alectoria using molecular phylogenetics. Our objectives were specifically to infer the evolutionary relationships of the taxa within Alectoria and then evaluate these inferences in light of characters traditionally used to delineate taxa in this genus. The results of this study, which drew on extensive field studies and herbarium work carried out by two of the authors (RTM and JCL), are presented here. Draft
4
https://mc06.manuscriptcentral.com/botany-pubs Page 5 of 33 Botany
Methods
Chemical and morphological study
A stereoscopic microscope was used to examine thallus morphology and observe chemical reactions with standard spot test reagents following Brodo et al. (2001). Thallus chemistry was also examined with thin layer chromatography (TLC) using solvents A and C following Culberson and Kristinsson (1970), with the modification of aluminum backed silica gel plates in smaller jars (Lendemer 2011). Images were captured with a Canon Elph130IS digital camera. Specimens used to generate new DNA sequence data are housed at the Biodiversity Institute of Ontario Herbarium (OAC) at the University of Guelph and at the New York Botanical Garden (NY). Specimens examined that were not included in the molecular analyses are listed in the Appendix.
Molecular data generation, dataset assembly,Draft and taxon sampling
Forty four new sequences were generated from 22 specimens for our study (Table 1). These included one specimen of Gowardia nigricans and the following 21 Alectoria specimens: three of A. fallacina , one of A. imshaugii , one of A. ochroleuca , ten of A. sarmentosa ssp. sarmentosa , two of A. sarmentosa var. sorediosa , two of A. sarmentosa ssp . vexillifera , and two of A. vancouverensis (Table 1). Collection data for these specimens are available on the Barcode of Life Data System (BOLD; Ratnasingham and Hebert 2007) in the public project titled ‘Alectoria Adventure’ (project code: ALECT).
For DNA extractions, approximately 15–20 mg of dry lichen thallus was subsampled and homogenised with sterile ceramic beads using a TissueLyser (Qiagen) at 30 Hz for 1 min. DNA was extracted using the NucleoSpin Plant II Kit (Macherey Nagel) with CTAB buffer following manufacturer's instructions for plants. Two nuclear genes—the minichromosome maintenance protein 7 gene ( Mcm7 ), the ribosomal internal transcribed spacer region (ITS)—and one mitochondrial gene—the mitochondrial small subunit ribosomal gene (mtSSU)—were amplified using the primers and reaction profiles listed in Table 2. The gene regions were amplified in 12.5 µl reaction volumes with 6.25 µl 10% trehalose, 2 µl ddH2O, 1.25 µl 10X buffer, 0.625 µl
5
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 6 of 33
MgCl2 (50 mM), 0.1 µl forward primer (10 µm), 0.1 µl reverse primer (10 µm), 0.0625 µl 10 mM dNTPs, 0.06 µl Platinum Taq polymerase (5 U/µl), and 2 µl of DNA (~ 10–20 ng). A secondary amplification was carried out on samples that did not amplify with the same reaction volumes as above except that 1 µl of PCR product and 1 µl of ddH 2O were used in place of DNA.
PCR products were visualised on 1% agarose gel (1X TBE buffer) stained with GelRed (Biotium). Samples with a clean single band were sequenced from the remaining PCR product. Sequencing reactions used the same primers used for PCR amplification and were carried out in 14 µl reaction volumes with 1 µl BigDye v3.1, 1 µl 5X SeqBuffer, 1 µl primer (10 µm), 10 µl ddH 2O, and 1–1.5 µl PCR product. Sequencing conditions were as follows: hot start of 96°C for 2 min; 30 cycles of 96°C for 30s, 55°C for 15s, and 60°C for 4 min; hold at 4°C indefinitely. PCR products were cleaned using Sephadex plates and bidirectionally sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems).Draft Bi directional sequence contigs were assembled and edited using Sequencher v. 4.9 (Gene Codes). Sequences were uploaded to the BOLD project 'Alectoria Adventure' (ALECT) and GenBank (Table 1).
To examine the relationships within Alectoria , individual datasets were constructed for each of the three genes with taxon sampling across the genus and with Gowardia nigricans used as an outgroup following Miadlikowska et al. (2014), Myllys et al. (2014), and Halonen et al. (2009). The datasets were assembled in Mesquite 3.03 (Maddison and Maddison 2015) by downloading the following from GenBank to supplement the newly generated sequences: all ITS, Mcm7 , and mtSSU sequences tagged with ‘‘Alectoria’’ and ‘‘Gowardia nigricans’’ returned from an NCBI Nucleotide search on 07 August 2015. The following two sequences were then pruned from the dataset because BLASTn searches in GenBank showed 100% similarity matches with the genus Bryoria : KF461055, KF461055. The MAFFT online interface (Katoh and Standley 2013) was then used for multiple sequence alignment and final adjustments were made manually in Mesquite. Terminal and ambiguously aligned regions were then excluded by defining them as part of an exclusion set in Mesquite. The datasets were then analyzed individually to search for conflict. As the Alectoria sequences within the mtSSU dataset were nearly identical and showed little phylogenetic structure these data were not included in a
6
https://mc06.manuscriptcentral.com/botany-pubs Page 7 of 33 Botany
concatenated muti gene data matrix. No conflict was recovered between the nuclear datasets (conflict defined following Mason Gamer and Kellogg 1996), and thus these were then concatenated manually into a two locus matrix with 48 terminals.
Molecular phylogenetic analyses
The individual datasets were prepared for maximum likelihood (ML) analyses by manually deleting the excluded regions, transforming the gaps ( ) to missing data (?), transforming uncertainties/polymorphisms to missing data (?), and exporting the file in a PHYLIP format in Mesquite. A rapid ML topology search and bootstrap analysis with 500 replicates was conducted in RAxML 8.0.0 (Stamatakis 2006) using the General Time Reversible (GTR) model (Tavaré 1986) with gamma. Results of the analyses were visualized in FigTree 1.4.2 (Rambaut 2009).
As no conflict was observed between the results of the ML analyses of the individual datasets, the concatenated ITS and Mcm7Draft alignment was prepared and analyzed in the same manner as above. A partitioned NEXUS formatted version of the alignment was then also analyzed with Bayesian Inference (BI) using MrBayes 3.1.2 (Huelsenbeck and Ronquest 2001) with the following models selected as the appropriate model of nucleotide substitution based on the Akaike Information Criterion (AIC; Akaike 1973) as evaluated by MrModeltest 2.3 (Nylander 2004): ITS = GTR+I, Mcm7 = K80+I. A Bayes block was produced with the model settings from MrModelTest and copied directly into the block. The Markov chain Monte Carlo (MCMC) parameters consisted of 10,000,000 generations, with four chains, and a tree sampled every 100 generations. The first 10,000 trees were discarded as burn in and the results were summarized as a 50% majority rule consensus tree. The results were again visualized in FigTree (Fig.1).
The datasets used in these analyses, together with the resulting phylogenies for the individual datasets have been archived in Dryad as doi:10.5061/dryad.ct140
7
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 8 of 33
Results
For this study, we conducted analyses to reconstruct evolutionary relationships within Alectoria using data from three genes with a much expanded sampling (both taxonomically and geographically) compared to previous published studies. The results of the maximum likelihood (ML) analyses for each individual dataset are available in the online data archive and not reproduced here. There was no conflict (defined as branches with >70% bootstrap support) observed between the results of the individual ML analyses of ITS and Mcm7 datasets, as such they were combined into a single two locus dataset. In the case of the mtSSU dataset, there were only two sequences (both of A. ochroleuca [Hoffm.] A. Massal.) available in GenBank and all of the sequences of Alectoria , including those newly generated, were nearly 100% identical. The ML analyses revealed virtually no phylogenetic structure within Alectoria and thus these data were not included in the larger combined dataset. Poor resolution among closely related species with mtSSU is a common phenomenon in Parmeliaceae (see e.g ., Crespo et al. 2010a) and this marker was included in our study largelyDraft to supplement the resources available in GenBank in order to provide more data for higher level phylogenetic studies within the Parmeliaceae.
The results of our analyses of the combined ITS and Mcm7 dataset are summarized in Figure 1. In these analyses, Alectoria was recovered as strongly monophyletic (ML/BI: 99/1.0). One taxon, the recently described A. spiculatosa Li S. Wang and Xin Y. Wang (≡ A. spinosa Li S. Wang and Xin Y. Wang non Taylor) (Wang et al. 2015), was recovered as strongly supported (ML/BI: 100/1.0) and monophyletic on a long branch in a sister relationship to all other members of the genus. The remainder of the taxa in Alectoria (i.e., A. fallacina , A. imshaugii, A. ochroleuca, A. sarmentosa ssp. sarmentosa , A. sarmentosa ssp. vexillifera , and A. vancouverensis ) were recovered as a weakly supported (ML/BI: 64/0.77) monophyletic group. Within with this group, two distinct clades were recovered with variable support, in a polytomy together with a single sequence of a voucher that was tentatively assigned to A. ochroleuca based on morphology. Notably, the Appalachian endemic, A. fallacina , was recovered as monophyletic and strongly supported (ML/BI: 100/1.0).
Alectoria ochroleuca was recovered as monophyletic with weak support from only maximum likelihood (ML = 66), A single voucher tentatively identified as A. ochroleuca (A. cf.
8
https://mc06.manuscriptcentral.com/botany-pubs Page 9 of 33 Botany
ochroleuca TL007 A01) was not recovered within the poorly supported clade comprised of other sequences of the taxon. Although poorly supported (ML = 60), Alectoria ochroleuca (excluding TL007 A01) was recovered as sister to a clade comprising the remainder of the members of Alectoria (A. imshaugii, A. sarmentosa ssp. sarmentosa , A. sarmentosa ssp. vexillifera , and A. vancouverensis ). This latter clade was recovered with moderate support from maximum likelihood and Bayesian Inference (ML/BI: 84/0.98). As it contains the type species of Alectoria , A. sarmentosa ssp. sarmentosa , we treat this as the core group within Alectoria , and collectively refer to the members of the group as the A. sarmentosa group. Sequences within the A. sarmentosa group were recovered with little divergence and almost no phylogenetic structure, with the exception of three representatives of A. sarmentosa ssp. sarmentosa , the sequences of which were generated from vouchers collected in Canada and Sweden (see Table 1). Other than the potential existence of a cryptic species within the A. sarmentosa group, our dataset did not recover any of the taxa currently recognized within the group as monophyletic. Sequences derived from vouchers of A. imshaugii,Draft A. sarmentosa ssp. sarmentosa , A. sarmentosa ssp. vexillifera , and A. vancouverensis were entirely intermixed throughout the clade.
9
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 10 of 33
Discussion
The results of our molecular phylogenetic analyses, despite employing an expanded taxon sampling, largely do not support the current taxonomic delineations of species within Alectoria that have been based on morphological and chemical characters. This supports the findings of previous studies (Myllys et al. 2014; Halonen et al. 2009) that have recovered similar results using a more limited sampling both taxonomically and geographically. However, our molecular analysis sheds considerable new light on this distinctive group of macrolichens and suggests substantial avenues for further search.
We found a clade within Alectoria that contained several taxa previously considered to be linked by morphological or chemical intermediates (Brodo and Hawksworth 1977; Hawksworth 1972; Myllys et al. 2014). This clade, the Alectoria sarmentosa group, includes a corticolous isidiate taxon (A. imshaugii , Fig. 2A), a corticolous sorediate taxon (A. sarmentosa var. sorediosa , Fig. 2C), a terricolous taxonDraft with flatten and wide branches (2 mm to 4 cm) (A. sarmentosa ssp. vexillifera , Fig. 2E), and two corticolous taxa with narrow branches that lack vegetative propagules but differ in the chemical characters and internal thallus anatomy (olivetoric acid and a dense medulla in A. vancouverensis , Fig. 2D; or miscellaneous substances other than olivetoric acid with a loose medulla in A. sarmentosa ssp. sarmentosa , Fig. 2B). Among these taxa, only A. imshaugii is currently considered to be narrowly endemic, occurring only in a small region of the Pacific Northwest of North America, which was illustrated by Brodo and Hawksworth (1977). Alectoria vancouverensis was considered to be endemic to the Pacific Northwest of North America (Brodo and Hawksworth 1977), but Halonen et al. (2009) subsequently reported a single population in Europe. The other members of this group are widespread and in some cases sympatric (Brodo and Hawksworth 1977). For instance, A. sarmentosa ssp. vexillifera is restricted to arctic alpine habitats in northern North America (including Greenland) and Europe, but appears to be largely allopatric with A. sarmentosa ssp. sarmentosa , which occurs primarily in oceanic and montane regions of the northern and southern hemispheres (Brodo and Hawksworth 1973; Dahl 1950; Hawksworth 1972). In the few regions where both A. sarmentosa ssp. sarmentosa and A. sarmentosa ssp. vexillifera occur, we have consistently found them to be ecologically separated, with the former taxon occurring in humid forested habitats on tree branches and the latter in drier exposed tundra habitats directly on the
10
https://mc06.manuscriptcentral.com/botany-pubs Page 11 of 33 Botany
ground (Lendemer and McMullin pers. observ.). An additional species that may belong to the A. sarmentosa group is A. lata (Taylor) Linds.; however, DNA was not successfully amplified from this species for our study.
Despite the differences between the members of the Alectoria sarmentosa group outlined above, the resolution of the taxonomy within the group is complicated by the existence of a small number of intermediates (discussed in detail by Brodo and Hawksworth 1977) and by the lack of resolution recovered in our phylogenetic analyses. The difficulty in resolving the taxonomy of this group is not new, and many of the taxa have been treated at multiple ranks or subsumed into synonymy. This is well illustrated by A. sarmentosa ssp. vexillifera , which has been treated as a form (Motyka 1964), a variety (James 1965), a subspecies (Hawksworth 1973; Brodo and Hawksworth 1977), and a species (Krog 1968) all within a period of less than fifteen years. The existence of intermediate forms, along with our current molecular evidence, supports lumping these taxa into a single, morphologicallyDraft variable species. A broad taxonomic circumscription is further supported by the sympatric distributions of several of the members of the group. For instance, in the small area where A. vancouverensis occurs, this species is entirely sympatric with the morphologically similar A. sarmentosa ssp . sarmentosa . Alectoria vancouverensis was initially considered to be a narrowly endemic, chemically distinct species until the discovery of a population referable to A. vancouverensis in Europe. Because it was found in a region dominated by A. sarmentosa ssp . sarmentosa , it suggests that the latter may be chemically variable. Similarly, A. sarmentosa var. sorediosa differs from A. sarmentosa ssp . sarmentosa in its reproductive mode (the production of soralia), but such sorediate individuals occur sporadically throughout the range of A. sarmentosa ssp . sarmentosa and thalli referable to the two entities often grow together at the same sites (McMullin pers. observ.). Sorediate populations are rare in North America, unlike in Europe (Ahlner 1948), but their distribution is scattered from California to northern British Columbia to Nova Scotia (Brodo and Hawksworth 1977) and it is possible that these are aberrant forms of A. sarmentosa ssp . sarmentosa . Although A. sarmentosa ssp. vexillifera does have a unique arctic alpine distribution that is largely allopatric with A. sarmentosa ssp . sarmentosa , it is possible that the flattened and wide foveolate branches of the taxon are an adaptation to, or induced by,
11
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 12 of 33
growing in harsh, exposed habitats directly on the ground and this taxon may again be a form of A. sarmentosa ssp . sarmentosa .
In all of the aforementioned cases, there is a plausible explanation for the existence of the chemical and morphological variation observed. Nonetheless, it is equally plausible that the molecular markers used in this study were insufficient to distinguish between these entities. Indeed, although many readers may agree with a proposal to lump A. sarmentosa ssp . sarmentosa , A. sarmentosa var. sorediosa , A. sarmentosa ssp. vexillifera and A. vancouverensis into a single taxon, there would likely be less agreement with treating A. imshaugii in the same manner. Alectoria imshaugii is narrowly endemic to the Pacific Northwest of North America, is morphologically quite divergent in having a short, caespitose thallus that produces abundant isidia, and is chemically distinctive in producing squamatic or thamnolic acid. Despite these clear chemical and morphological differences and narrow geographic distribution, our analyses did not recover any support for A. imshaugiiDraft as distinct from the other members of the group. Considering the lack of resolution within the Alectoria sarmentosa group recovered herein, and in light of the differences outlined above which have previously led to the recognition of these entities as distinct taxa, we assert that further study with detailed population level sampling is warranted before taking the radical step of placing these taxa in synonymy. Indeed, if the members of the A. sarmentosa group were treated as a single morphologically variable species, that species would encompass more morphological variation than any other lichen species currently circumscribed (i.e., covering a wide range of ecologies, growth forms, chemistries, and reproductive modes). Indeed, it is possible that, as has been suspected in the past (Brodo and Hawksworth 1977), the A. sarmentosa group is affected by phenomena such as hybridization. Similarly, it is possible the high concentration of the morphological and chemical variation in western North America reflects a recent rapid radiation as has been documented in vascular plants (Abbott et al. 2000; Brochmann and Brysting 2008; Brochmann et al. 2004; DeChaine et al. 2013, 2014). As is the case in other regions such as the southern Appalachians of eastern North America (Wen 1999), albeit on a much younger scale, the Pacific Northwest has had a dynamic environmental and geological history characterized by periods of isolated refugia followed by rapid expansion of available habitat ( Beatty and Provan 2010; Brunsfeld and Sullivan 2005; Brubaker et al. 2005; Godbout et al. 2008).
12
https://mc06.manuscriptcentral.com/botany-pubs Page 13 of 33 Botany
In the absence of detailed studies using appropriate population genetics molecular markers (i.e., microsatellites or NGS data, rather than ITS) aimed at resolving the status of the entities within the Alectoria sarmentosa group, we propose a conservative taxonomic treatment wherein all of the taxa are retained and recognized at the rank of species. This approach introduces a stable and uniform taxonomy that does not imply hierarchical relationships between the taxa that are not supported by the molecular data. Remarkably, this does not necessitate the description of any species, or a change in the rank of any epithet. The only new nomenclature required is the transfer of A. sarmentosa var. sorediosa from Bryopogon (as Bryopogon sorediosus (K.G.W. Lång) Gyeln.) to Alectoria (see nomenclature section below).
Draft
13
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 14 of 33
Nomenclature Section
Synonymies for species in the Alectoria sarmentosa group are listed below alphabetically. Journal acronyms follow the Hunt Institute for Botanical Documentation (2015) and book acronyms follow the Smithsonian Libraries (2015). Synonymies are provided as a reference, but types are omitted because they have already been documented and examined in detail as part of previous studies (Hawskworth 1972, Brodo and Hawksworth 1977).
Alectoria imshaugii Brodo & D. Hawksw., Oper. bot. 42 : 59 (1977)
Alectoria sarmentosa (Ach.) Ach. , Lichenograph. universalis : 595 (1810)
≡ Lichen sarmentosus Ach., K. Vet. Acad. Nya Handl . 16 : 212 (1795). ≡ Parmelia sarmentosa (Ach.) Ach., Meth. Lich. : 271 (1803). ≡ Cornicularia sarmentosa (Ach.) DC., Fl. Franç . 6: 179 (1815). ≡ Evernia sarmentosa (Ach.) Fr., Nov. Sched. Crit. Lich .: 34 (1826). ≡ Evernia ochroleuca var. sarmentosa (Ach.) Fr., Lich. Eur. Ref. : 22 (1831). ≡ Bryopogon sarmentosus (Ach.) Link, Grund. Kräut. 3: 164 (1833). ≡ Parmelia ochroleuca var. sarmentosa (Ach.) Schaer., Lich. Helv. Spic. 10 : 499 (1840). ≡ Cornicularia ochroleuca var. sarmentosa (Ach.) Schaer., Enum. Crit. Lich. Eur. : 6 (1850).Draft ≡ Alectoria ochroleuca var. sarmentosa (Ach.) Nyl., Syn. Lich. 1: 282 (1858 60). ≡ Bryopogon ochroleucus var. sarmentosus (Ach.) Rabenh., Krypt. Fl. Sachs. 2: 383 (1870). ≡ Eualectoria sarmentosa (Ach.) Gyeln., Annls Mus. Nat. Hungar. 28 : 283 (1934). ≡ Alectoriomyces sarmentosa (Ach.) Cif. & Tom., Atti Ist. Bot. Lab. Crittog. Univ. Pavia 5 (10): 70 et 277 (1953). ≡ Alectoria sarmentosa (Ach.) Ach. ssp. sarmentosa , Oper. bot. 42 : 68 (1977).
= Bryopogon sarmentosus var. genuinum Körb., Syst. Lich. Germ. : 7 (1855). ≡ Alectoria sarmentosa var. genuina (Körb.) Flagey, Mém. Soc. d'Émultat. Doubs., sér. 5, 7: 351 (1882).
= Alectoria luteola Mont. ex deNot., Giorn. Bot. Ital. 1: 206 (1846). ≡ Bryopogon luteolus (Mont. ex deNot.) Schwend., Naegeli Beitr. Bot. 2: 149 (1860). ≡ Ceratocladia luteola (Mont. ex deNot.) Schwend., Naegeli Beitr. Bot. 2: 149 (1860), nom. inval. (Art. 34) ≡ Alectoria sarmentosa var. luteola (Mont. ex deNot.) Howe, Class. Fam. Usneaceae : 24 (1912).
= Alectoria sarmentosa var. gigantea Räs., Ann. Missouri Bot. Gard. 20 : 10 (1933).
= Alectoria sarmentosa var. hypocyphellata Gyeln., Ann. Mus. Hat. Hungar. 28 : 283 (1934), nom. inval. (Art. 32).
= Alectoria sarmentosa f. rubropunctata Räs., Ann. Bot. Soc. zool. bot. fenn. "Vanamo" 12 : 36 (1939).
= Alectoria patagonica R. Sant., Ark. Bot. 30A (6): 7 (1943).
= Alectoria sarmentosa var. pseudocincinnata Mot., Fl. Polska, Porosty 5(2): 102 (1962), nom. inval. (Art. 37).
14
https://mc06.manuscriptcentral.com/botany-pubs Page 15 of 33 Botany
= Alectoria sarmentosa var. laevis Bystrek, Fragm. Florist. Geobot. 8: 202 (1962).
Alectoria sorediosa (Lång ex Räs.) McMullin & Lendemer comb. nov. Mycobank # 815129
≡ Alectoria sarmentosa f. sorediosa Lång ex Räs., Med. Soc. Fauna Fl. Fenn. 45 : 123 (1919). (1921). ≡ Alectoria sarmentosa var. sorediosa (Lång ex Räs.) DR., Svensk Bot. Tidskr. 18 : 145 (1924). ≡ Bryopogon sorediosus (Lång ex Räs.) Gyeln., Feddes Repert. 38 : 245 (1935).
= Alectoria sarmentosa f. sorediata Lynge, Norske Vid. Akad. Oslo, I, Mat Nat. KI. 1921( 7): 216. ≡ Alectoria ochroleuca var. sorediata (Lynge) Gyeln., Nyt Mag. Naturv. 70 : 47 (1932). ≡ Alectoria ochroleuca f. sorediata (Lynge) Mot., Fl. Polska, Porosty 5(2): 99 (1962).
= Alectoria sarmentosa var. soralifera B. de Lesd., Bull. Soc. Bot. France 87 : 139 (1940), nom. inval. (Art. 32).
= Alectoria albida Räs., Ann. Bot. Soc. Zool. Bot. Fenn. "Vanamo" 21 (16): 1 (1946).
Alectoria vancouverensis (Gyeln.) Brodo & D. Hawksw. , Oper. bot. 42 : 75 (1977)
≡ Bryopogon vancouverensisDraft Gyeln., Feddes Repert. 38 : 245 (1935).
Alectoria vexillifera (Nyl.) Stizenb. , Annln K. K. naturh. Hofmus. Wien 7: 122 (1892)
≡ Alectoria ochroleuca ssp. vexillifera Nyl., in Kihlman, Med. Soc. Fauna Fl. Fenn. 18 : 48 (1891). ≡ Alectoria vexillifera (Nyl.) Stiz., Ann. K.K. Naturhist. Hofmus. Wien 7: 122 (1892). ≡ Alectoria cincinnata var. vexillifera (Nyl.) Räs., Ann. Acad. Sci. Fenn., ser. A, 34 (4): 22 (1931). ≡ Alectoria cincinnata f. vexillifera (Nyl.) Savicz, Lichenotheca Ross. 4 no. 33 (1935). ≡ Bryopogon vexilliferus (Nyl.) Gyeln., Feddes Repert. 38 : 246 (1935). ≡ Alectoria sarmentosa var. cincinnata f. vexillifera (Nyl.) Magnusson, Förteckn. ö. Skand. Växt. 4: 68 (1936). ≡ Alectoria sarmentosa ssp. vexillifera (Nyl.) D. Hawksw., Taxon 19 : 241 (1970).
= Alectoria cincinnata f. fasciata Sern., Svensk Bot. Tidskr. 1: 178 (1907).
= Evernia ochroleuca var. cincinnata Fr., Lich. Eur. Ref. : 22 (1831). ≡ Cornicularia ochroleuca var. cincinnata (Fr.) Schaer., Enum. Crit. Lich. Eur. : 5 (1850). ≡ Alectoria ochroleuca var. cincinnata (Fr.) Nyl., Syn. Lich. 1: 282 (1858 60). ≡ Alectoria ochroleuca f. cincinnata (Fr.) Fellm., Lich. Arct. no. 53 (1863). ≡ Alectoria sarmentosa var. cincinnata (Fr.) Nyl., Flora, Jena 52 : 444 (1869). ≡ Bryopogon sarmentosus var. cincinnatus (Fr.) Müll. Arg., Flora, Jena 72 : 362 (1889). ≡ Alectoria cincinnata (Fr.) Lynge, Norsk Vid. Akad. Oslo, I, Mat Nat. KI. 1921 (7): 217 (1921). ≡ Bryopogon cincinnatus (Fr.) Gyeln., Feddes Repert. 38 : 246 (1935).
= Alectoria ochroleuca f. tenuior Cromb., F. Bot., Lond. 10 : 232 (1872). ≡ Bryopogon ochroleucas var. tenuior (Cromb.) Gyeln., Feddes Repert. 38 : 248 (1935).
15
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 16 of 33
An updated key to the species of Alectoria in North America is provided that reflects the changes resulting from our study.
Key to the species of Alectoria in North America
1a. Thallus isidiate or sorediate...... 2
2a. Thallus sorediate, isidia absent; on both coasts...... A. sorediosa 2b. Thallus isidiate, soredia absent; California to British Columbia...... A. imshaugii
1b. Isidia and soredia absent...... 3
3a. Medulla C+ red (olivetoric acid)...... 4
4a. Thallus yellow green, usually pendant; medulla dense and fibrous; at low elevations from California to British Columbia...... A. vancouverensis 4b. Thallus straw yellow, usually subpendant; medulla loose; at high elevations in Mexico...... A. mexicana
3a. Medulla C ...... 5
5a. Terricolous or saxicolous (rarely on shrubs) in arctic alpine environments...... 6
6a. Branches tetrete and smooth, not becoming dorsiventral...... 7
7a. BranchDraft tips darkening; medulla usually KC– and CK+ yellow (diffractic acid), rarely KC+ red (alectoronic acid); very common...... A. ochroleuca 7b. Branch tips not darkening; medulla usually KC+ red (alectoronic acid), never CK+ yellow; possibly representing a form of A. vexillifera with narrow branches; rare...... A. sarmentosa
6b. Branches flat, foveolate, and dorsiventral; medulla usually KC+ red (alectoronic acid); common...... A. vexillifera
5b. Corticolous or saxicolous, not occurring in arctic alpine environments...... 8
8a. In eastern North America...... 9
9a. Medulla loose and cottony, usually KC+ red (alectoronic acid); thallus yellow green, pendant, branches typically straight; branch width usually consistent and not appearing lumpy; Labrador to New England...... A. sarmentosa 9b. Medulla dense to somewhat loose, usually KC ; thallus gray green to yellow green, subpendant, branches usually recurved; branch width often variable and appearing lumpy; Appalachian Mountains, New England to Tennessee...... A. fallacina
8b. In western North America...... 10
10a. Thallus densely tufted (caespitose) to somewhat subpendant, <8( 15) cm long; apothecia common; Mexico to Washington State...... A. lata
16
https://mc06.manuscriptcentral.com/botany-pubs Page 17 of 33 Botany
10b. Thallus pendant, <20(to >100) cm long; apothecia rare...... 11
11a. Medulla loose and cottony; at low and high elevations from California to Alaska; very common...... A. sarmentosa 11b. Medulla dense and fibrous; at low elevations from California to British Columbia; rare chemotype lacking olivetoric acid (Brodo & Hawksworth 1977) ...... A. vancouverensis
Draft
17
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 18 of 33
Acknowledgements
We are grateful acknowledge Bruce McCune, Jason Hollinger, Trevor Goward, and the New York Botanical Garden for specimen loans. This study was supported by grants from the Canadian Foundation for Innovation and the Natural Sciences and Engineering Research Council of Canada. Lendemer’s participation in this study was part of NSF Awards 1542639 and 1145511.
Draft
18
https://mc06.manuscriptcentral.com/botany-pubs Page 19 of 33 Botany
References
Abbott, R.J., Smith, L.C., Milne, R.I., Crawford, R.M., Wolff, K., and Balfour, J. 2000. Molecular analysis of plant migration and refugia in the Arctic. Science 289 : 1343–1346. doi:10.1126/science.289.5483.1343.
Ahlner, S. 1948. Utbredningstyper bland nordiska barrträdslavar. Acta Phytogeogr. Suec. 22 : 1 257.
Akaike, H. 1973. Information theory and an extension of the maximum likelihood principle. In Selected Papers of Hirotugu Akaike. Edited by B. N. Petrov & F. Csaki F. Proceedings of the 2nd International Symposium on Information Theory. Akademiai Kiado, Budapest. pp. 267–281.
Beatty, G.M., and Provan, J. 2010. Refugial persistence and postglacial recolonization of North America by the cold tolerant herbaceousDraft plant Orthilia secunda . Mol. Ecol. 19 : 5009−5021. doi:10.1111/j.1365 294X.2010.04859.x.
Brochmann, C., and Brysting, A.K. 2008. The Arctic – an evolutionary freezer? Plant Ecol. Divers. 1: 181–195. doi:10.1080/17550870802331904.
Brochmann, C., Brysting, A.K., Alsos, I.G., Borgen, L., Grundt, H.H., Scheen, A.C., and Elven, R. 2004. Polyploidy in arctic plants. Biol. J. Linn. Soc. 82 : 521–536. doi:10.1111/j.1095312.2004.00337.x.
Brodo, I.M., and Hawksworth, D.L. 1977. Alectoria and allied genera in North America. Opera Bot. 42 :1 164.
Brodo, I.M., Sharnoff, S.D., and Sharnoff, S. 2001. Lichens of North America. Yale University Press, New Haven, Connecticut. 795 pp.
Brubaker, L.B., Anderson, P.M., Edwards, M.E., and Lozhkin, A.V. 2005. Beringia as a glacial refugium for boreal trees and shrubs: new perspectives from mapped pollen data. J. Biogeogr. 32 : 833–848. doi:10.1111/j.1365 2699.2004.01203.x.
19
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 20 of 33
Brunsfeld, S.J., and Sullivan, J. 2005. A multi compartmented glacial refugium in the northern Rocky Mountains: evidence from the phylogeography of Cardamine constancei (Brassicaceae). Conserv. Genet. 6: 895–904. doi:10.1007/s10592 005 9076 7.
Buaruang, K., Scharnagl, K., Divakar, P., Leavitt, S.D., Crespo, A., Nash, T.H., Manoch, L., Lücking, R., and Lumbsch, H.T. 2015. Molecular data support Pseudoparmelia as a distinct lineage related to Relicina and Relicinopsis (Ascomycota, Lecanorales ). Lichenologist 47 (1): 43 49. doi:10.1017/S0024282914000577.
Crespo, A., Kauff, F., Divakar, P.K., del Prado, R., Perez Ortega, S., de Paz, G.A., Ferencova, Z., Blanco, O., Roca Valiente, B., Núñez Zapata, J., Cubas, P., Argüello, A., Elix, J.A., Esslinger, T.L., Hawksworth, D.L., Millanes, A.M., Molina, M.C., Wedin, M., Ahti, T., Aptroot, A., Barreno, E., Bungartz, F., Calvelo, S., Candan, M., Cole, M.J., Ertz, D., Goffinet, B., Lindblom, L., Lücking, R., Lutzoni, F., Mattsson, J. E., Messuti, M.I., Miadlikowska, J., Piercey Normore,Draft M., Rico, V.J., Sipman, H., Schmitt, I., Spribille, T., Thell, A., Thor, G., Upreti, D.K., and Lumbsch, H.T. 2010a. Phylogenetic generic classification of parmelioid lichens (Parmeliaceae, Ascomycota) based on molecular, morphological and chemical evidence. Taxon 59 : 1735 1753.
Crespo, A., Ferencova, Z., Pérez Ortega, S., Elix, J.A., and Divakar, P.K. 2010b. Austroparmelina, a new Australian lineage in parmelioid lichens (Parmeliaceae, Ascomycota). Syst. Biodivers. 8(2): 209 221.
Culberson, C.F., and Kristinsson, H. 1970. A standardized method for the identification of lichen products. J. Chromatogr. 46 : 85 93. doi:10.1016/S0021 9673(00)83967 9.
Dahl, E. 1950. Studies in the macrolichen flora of southwest Greenland. Meddel. om Gronland 150 (2): 1 176.
DeChaine, E.G., Wendling, B.M., and Forester, B.R. 2014. Integrating environmental, molecular, and morphological data to unravel an ice age radiation of arctic alpine Campanula in western North America. Ecol. Evol. 20 (4): 3940–3959. doi:10.1002/ece3.1168.
20
https://mc06.manuscriptcentral.com/botany-pubs Page 21 of 33 Botany
DeChaine, E.G., Forester, B.R, Schaefer, H., and Davis, C.C. 2013. Deep genetic divergence between disjunct refugia in the arctic alpine King’s Crown, Rhodiola integrifolia (Crassulaceae). PLoS ONE 8:e79451. doi:10.1371/journal.pone.0079451.
de Paz, G.A., Lumbsch, H.T., Cubas, P., Elix, J.A., and Crespo, A. 2010a. The genus Karoowia (Parmeliaceae, Ascomycota) includes unrelated clades nested within Xanthoparmelia . Aust. Syst. Bot. 23 : 173 184. doi:10.1071/SB09055.
de Paz, G.A., Lumbsch, H.T., Cubas, P., Elix, J.A., and Crespo, A. 2010b. The morphologically deviating genera Omphalodiella and Placoparmelia belong to Xanthoparmelia (Parmeliaceae). Bryologist 113 (2): 376 386. doi:http://dx.doi.org/10.1639/0007 2745 113.2.376.
Del Prado, R., Blanco, O., Lumbsch, H.T., Divakar, P.K., Elix, J.A., Molina, M.C., Crespo, A. 2013. Molecular phylogeny and historical biogeography of the lichen forming fungal genus Flavoparmelia (Ascomycota:Draft Parmeliaceae). Taxon 62 (5): 928 939. doi:http://dx.doi.org/10.12705/625.22.
Del Prado, R., Cubas, P., Lumbsch, H.T., Divakar, P.K., Blanco, O., de Paz, G.A., Molina, M.C., and Crespo, A. 2010. Genetic distances within and among species in monophyletic lineages of Parmeliaceae (Ascomycota) as a tool for taxon delimitation. Mol. Phylogenet. Evol. 56 : 125 133. doi:10.1016/j.ympev.2010.04.014.
Divakar, P.K., Crespo, A., Núñez Zapata, J., Flakus, A., Sipman, H.J., Elix, J.A., and Lumbsch, H.T. 2013. A molecular perspective on generic concepts in the Hypotrachyna clade (Parmeliaceae, Ascomycota). Phytotaxa 132 (1): 21 38. doi:10.11646/phytotaxa.132.1.2.
Divakar, P.K., Lumbsch, H.T., Ferencova, Z., Del Prado, R., and Crespo, A. 2010. Remototrachyna, a newly recognized tropical lineage of lichens in the Hypotrachyna clade (Parmeliaceae, Ascomycota), originated in the Indian subcontinent. Am. J. Bot. 97 (4): 579 590. doi:10.3732/ajb.0900140.
Elix, J.A., Blanco, O., and Crespo, A. 2010. Two segregates from Flavoparmelia rutidota sens. lat. (Parmeliaceae, lichenized Ascomycota) in Australia. Australas. Lichenol. 67 : 10 13.
21
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 22 of 33
Gardes, M., and Bruns, T.D. 1993. ITS primers with enhanced specificity for Basidiomycetes Application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113 118. doi: 10.1111/j.1365 294X.1993.tb00005.x.
Godbout, J., Fazekas, A., Newton, C.H., Yeh, F.C., and Bousquet, J. 2008. Glacial vicariance in the Pacific Northwest: evidence from a lodgepole pine mitochondrial DNA minisatellite for multiple genetically distinct and widely separated refugia. Mol. Ecol. 17 : 2463–2475. doi:10.1111/j.1365 294X.2008.03761.x.
Halonen, P., Myllys, L., Velmala, S., and Hyvärinen, H. 2009. Gowardia (Parmeliaceae) a new alectorioid lichen genus with two species. Bryologist 112 (1): 138 146. doi:http://dx.doi.org/10.1639/0007 2745 112.1.138.
Hawksworth, D.L. 1972. Regional studies in Alectoria (Lichenes) II. The British species. Lichenologist 5: 181 261. doi:http://dx.doi.org/10.1017/S002428297Draft 200026X. Hawksworth, D.L. 1973. Ecological factors and species delimitation in the lichens. In Taxonomy and Ecology. Edited by Heywood, V.H. Systematics Association Special Volume No. 5. Academic Press, London, pp. 31–69.
Huelsenbeck, J.P., and Ronquist, F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17 : 754–755.
Hunt Institute for Botanical Documentation. 2015. BPHOnline [online]. A Research Division of Carnegie Mellon University, Pittsburgh, Pennsylvania. Available from http://fmhibd.library.cmu.edu/fmi/iwp/cgi? db=BPH_Online& loadframes [Accessed 29 September 2015].
James, P.W. 1965. A new check list of British lichens. Lichenologist 3: 95 153. doi:http://dx.doi.org/10.1017/S0024282965000130.
Katoh, K., and Standley, D.M. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30 : 772 780. doi:10.1093/molbev/mst010.
Krog, H. 1968. The Macrolichens of Alaska. Norsk Polarinst. Skr. 144 : 1 180.
22
https://mc06.manuscriptcentral.com/botany-pubs Page 23 of 33 Botany
Leavitt, S.D., Esslinger, T.L., Hansen, E.S., Divakar, P.K., Crespo, A., Loomis, B F., and Lumbsch, H.T. 2014. DNA barcoding of brown Parmeliae (Parmeliaceae) species: A molecular approach for accurate specimen identification, emphasizing species in Greenland. Org. Divers. Evol. 14 (1): 11 20. doi:10.1007/s13127 013 0147 1.
Lendemer, J.C. 2015. Parmotrema internexum (Lecanorales: Parmeliaceae): an overlooked macrolichen in southeastern North America highlights the value of basic biodiversity research. Bryologist 118 : 130 144. doi:http://dx.doi.org/10.1639/0007 2745 118.2.130.
Lendemer, J.C. 2011. A review of the morphologically similar species Fuscidea pusilla and Ropalospora viridis in eastern North America. Opusc. Philolichenum 9: 11–20.
Lendemer, J.C., and Hodkinson, B.P. 2010. A new perspective on Punctelia subrudecta (Parmeliaceae) in North America: previously rejected morphological characters corroborate molecular phylogenetic evidence and provide insight into an old problem. Lichenologist 42 (4): 405 421. doi:Draft http://dx.doi.org/10.1017/S0024282910000101.
Lendemer, J.C., and Ruiz, A.M. 2015. Molecular data confirm morphological variability the widespread foliose lichen Canoparmelia carolinana (Parmeliaceae). Castanea 80 (1): 29 36.
Maddison, W.P. and Maddison, D.R. 2015. Mesquite: a modular system for evolutionary analysis [online]. Version 3.02. Available from http://mesquite project.org [accessed 12 August 2015].
Mark, K., Saag, L., Saag, A., Thell, A., and Randlane, T. 2012. Testing morphology based delimitation of Vulpicida juniperinus and V. tubulosus (Parmeliaceae) using three molecular markers. Lichenologist 44 (6): 757 772. doi:http://dx.doi.org/10.1017/S0024282912000448.
Mason Gamer, R.J., and Kellogg, E.A. 1996. Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Syst. biol. 45 (4): 524 545. doi:10.1093/sysbio/45.4.524.
23
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 24 of 33
Miadlikowska, J., Kauff, F., Högnabba, F., Oliver, J.C., Molnár, K., Fraker, E., Gaya, E., Hafellner, J., Hofstetter, V., Gueidan, C., Otálora, M.A.G., Hodkinson, B., Kukwa, M., Lücking, R., Björk, C., Sipman, H.J.M., Burgaz, A.R., Thell, A., Passo, A., Myllys, L., Goward, T., Fernández Brimem, S., Hestmark, G., Lendemer, J.C., Lumbsch, H.T., Schmull, M., Schoch, C.L., Sérusiaux, E., Maddison, D.R., Arnold, A.E., Lutzoni, F., and Stenroos, S. 2014. A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Mol. Phylogenet. Evol. 79 : 132–168. http://dx.doi.org/10.1016/j.ympev.2014.04.003.
Motyka, J. 1960. De speciebus generis Alectoria Ach. minus cognitis et. novis. Fragm. Florist. Geobot. 6: 441 452.
Motyka, J. 1964. The North American species of Alectoria . Bryologist 67 : 1 44. doi:10.2307/3241181. Draft Myllys, L., Velmala, S., Lindgren, H., Glavich, D., Carlberg, T., Wang, L.S., and Goward, T. 2014. Taxonomic delimitation of the genera Bryoria and Sulcaria , with a new combination Sulcaria spiralifera introduced. Lichenologist 46 : 737 752.
doi: http://dx.doi.org/10.1017/S0024282914000346.
Nelsen, M.P., Thell, A., Leavitt, S.D., Hampton Miller, C.J., and Lumbsch, H.T. 2013. A reappraisal of Masonhalea (Parmeliaceae, Lecanorales) based on molecular and morphological data. Lichenologist 45 (6): 729 738. doi:http://dx.doi.org/10.1017/S0024282913000509.
Nelson, P.R., Kepler, R., Walton, J., Fankhauser, J., Nelson, L., and Song, W.L. 2012. Parmelina yalungana resurrected and reported from Alaska, China and Russia. Bryologist 115 (4): 557 565. doi:http://dx.doi.org/10.1639/0007 2745 115.4.557.
Nylander, J.A.A. 2004. MrModeltest 2. Program distributed by the author. Evolutionary Biology Centre, Uppsala.
Rambaut, A. 2009. FigTree: tree figure drawing tool. Version 1.3.1. 2006–2009.
24
https://mc06.manuscriptcentral.com/botany-pubs Page 25 of 33 Botany
Ratnasingham, S., and Hebert, P.D. 2007. BOLD : The Barcode of Life Data System (http://www.barcodinglife.org). Mol. Ecol. Notes 7: 355–364. doi: 10.1111/j.1471 8286.2007.01678.x
Saag, L., Mark, K., Saag, A., and Randlane, T. 2014. Species delimitation in the lichenized fungal genus Vulpicida (Parmeliaceae, Ascomycota) using gene concatenation and coalescent based species tree approaches. Am. J. Bot. 101 (12): 2169 2182. doi:10.3732/ajb.1400439.
Smithsonian Libraries. 2015. Taxonomic Literature II [online]. Available from http://www.sil.si.edu/digitalcollections/tl 2/search.cfm [Accessed 29 September 2015].
Stamatakis, A. 2006. RAxML VI HPC: Maximum likelihood based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22 : 2688–2690. doi: 10.1093/bioinformatics/btl446.Draft Tavaré, S. 1986. Some probabilistic and statistical problems in the analysis of DNA sequences. Lec. Math. Life Sci. 17 :57 86.
Velmala, S., Myllys, L., Goward, T., Holien, H., and Halonen, P. 2014. Taxonomy of Bryoria section Implexae (Parmeliaceae, Lecanoromycetes) in North America and Europe, based on chemical, morphological and molecular data. Ann. Bot. Fenn. 51 : 345 371. doi:http://dx.doi.org/10.5735/085.051.0601.
Wang, L.S., Liu, D., Shi, H.X., Zhang, Y.Y., Ye, X., Chen, X.L., and Wang, X.Y. 2015. Alectoria spinosa , a new lichen species from Hengduan Mountains, China. Mycosphere 6(2): 159–164. doi:10.5943/mycosphere/6/2/6.
Wen, J. 1999. Evolution of eastern Asian and eastern North American disjunct distributions of flowering plants. Annu. Rev. Ecol. Evol. S. 30 : 421–455.
White, T.J., Bruns, T., Lee, S., and Taylor, J.W. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications. Edited by Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. Academic Press, New York. pp. 315 322.
25
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 26 of 33
Zoller, S., Scheidegger, C., and Sperisen, C. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen forming ascomycetes. Lichenologist 31 : 511–516. doi: http://dx.doi.org/10.1017/S0024282999000663.
Draft
26
https://mc06.manuscriptcentral.com/botany-pubs Page 27 of 33 Botany
TABLES
Table 1. GenBank accession numbers and collection details for all specimens used in this study. Newly generated sequences have bolded accession numbers. Herbarium acronyms follow Index Herbariorum (http://sciweb.nybg.org/science2/IndexHerbariorum.asp). GenBank Accession Numbers Taxon Laboratory Code Collection Details nrITS Mcm7 mtSSU A. fallacina TL021 E04 Tripp 3447 (NY), Tennessee, U.S.A. XXX XXX N/A A. fallacina TL023 C04 Lendemer 32980 (NY), North Carolina, U.S.A. XXX XXX N/A A. fallacina TL024 B04 Lendemer 32951 (NY), North Carolina, U.S.A. N/A XXX N/A A. imshaugii TL002 G01 Alphandary & Meglio s.n. (OSC), Oregon, U.S.A. XXX XXX XXX A. imshaugii TL030 Goward 05 32 (personal herbarium), British Columbia, Canada EU282496 KJ948003 N/A A. imshaugii TL031 Björk 15571 (UBC), Washington, U.S.A. KJ947931 N/A N/A A. imshaugii TL032 Björk 16672 (UBC), Washington, U.S.A. KJ947932 KJ948004 N/A A. ochroleuca TL007 A01 Talbot AGA6 30 (OAC), British Columbia, Canada N/A XXX N/A A. ochroleuca TL033 Keihas 667 (OULU),Draft Norður Island, Iceland KJ947933 KJ948005 N/A A. ochroleuca TL034 Uotila 49194 (H), Murmansk Region, Russia N/A KJ948006 N/A A. ochroleuca TL045 Lutzoni & Miadlikowska 07.04.03 6 (DUKE), Québec, Canada HQ650597 N/A N/A A. ochroleuca TL046 Wedin 6542 (UPS), Sweden, Harjedalen N/A KF562163 N/A A. ochroleuca TL049 Wedin s.n. (BM), Austria DQ979997 N/A N/A A. ochroleuca TL050 Feuerer & Thell s.n. (HBG), Austria AF451735 N/A N/A A. ochroleuca TL051 Stenroos 5579 (TUR), Tierra del Fuego, Argentina AF451734 N/A N/A A. sarmentosa TL004 D01 McMullin 8352 (OAC), British Columbia, Canada N/A XXX N/A A. sarmentosa TL008 H02 McMullin 8368 (OAC), British Columbia, Canada XXX N/A N/A A. sarmentosa TL009 G02 McMullin 8367 (OAC), British Columbia, Canada XXX XXX N/A A. sarmentosa TL010 F02 McMullin 8354 (OAC), British Columbia, Canada XXX XXX XXX A. sarmentosa TL012 D02 McMullin 8356 (OAC), British Columbia, Canada XXX XXX N/A A. sarmentosa TL015 G03 McMullin 7123 (OAC), New Brunswick, Canada XXX XXX XXX A. sarmentosa TL017 A03 McMullin 8362 (OAC), British Columbia, Canada XXX XXX XXX A. sarmentosa TL018 H04 McMullin 8359 (OAC), British Columbia, Canada XXX XXX XXX A. sarmentosa TL019 G04 McMullin 8361 (OAC), British Columbia, Canada XXX XXX N/A A. sarmentosa TL020 F04 Lendemer 27785 A (NY), New Brunswick, Canada XXX XXX XXX A. sarmentosa TL035 Halonen s.n. (OULU), Oulun Pohjanmaa, Finland EU282494 KJ948007 N/A
27
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 28 of 33
A. sarmentosa TL036 Goward 05 38 (personal herbarium), British Columbia, Canada EU282495 KJ948008 N/A A. sarmentosa TL047 Spribille s.n. , Canada JN009706 JN009737 N/A A. sarmentosa TL048 Wedin 6350 (UPS), Sweden DQ979998 N/A N/A A. sarmentosa TL052 Articus 707 (UPS), British Columbia, Canada AJ748111 N/A N/A A. sorediosa TL005 C01 McMullin 9433 (OAC), California, U.S.A. N/A XXX N/A A. sorediosa TL006 B01 McMullin 8396 (OAC), British Columbia, Canada N/A XXX N/A A. spiculatosa TL043 11 32085 (KUN–L), Yunnan, China KM042887 N/A N/A A. spiculatosa TL044 11 32083 (KUN–L), Yunnan, China KM042886 N/A N/A A. vancouverensis TL011 E02 McMullin 8353 (OAC), British Columbia, Canada XXX XXX XXX A. vancouverensis TL016 D03 McMullin 8358 (OAC), British Columbia, Canada N/A XXX XXX A. vancouverensis TL039 Halonen s.n. (OULU), Oulun Pohjanmaa, Finland EU282498 KJ948011 N/A A. vancouverensis TL040 Goward 01 810 (personal herbarium), British Columbia, Canada EU282497 KJ948012 N/A A. vexillifera TL001 H01 Hollinger 0009 (personal herbarium), British Columbia, Canada N/A XXX N/A A. vexillifera TL003 E01 Goward 06 1622A (personalDraft herbarium), British Columbia, Canada N/A XXX XXX A. vexillifera TL037 Halonen s.n. (OULU), Oulun Pohjanmaa, Finland EU282493 KJ948009 N/A A. vexillifera TL038 Goward 01 542 (personal herbarium), British Columbia, Canada EU282492 KJ948010 N/A G. nigricans TL013 B02 McMullin 9697 (OAC), Québec, Canada N/A XXX XXX G. nigricans TL041 Hyvärinen s.n. (OULU), Inarin Lappi, Finland EU282499 KJ948083 N/A G. nigricans TL042 Virtanen s.n. (OULU), Enontekiön Lappi, Finland EU282501 KJ948084 N/A G. nigricans TL054 Wedin 7297 (UPS), Troms, Norway N/A KF562165 N/A G. nigricans TL055 Lundqvist 8377 (UPS), Sweden DQ979996 N/A N/A G. nigricans TL056 Kumpula, Strengell & Moilanen s.n. (OULU), Nenetsia, Russia EU282500 N/A N/A
28
https://mc06.manuscriptcentral.com/botany-pubs Page 29 of 33 Botany
Table 2. Primer sequences for each gene region and reaction profiles for the PCR.
Region Primer pair Primer sequence (5̕′ to 3′) Thermocycling conditions ITS ITS1F (Gardes and Bruns, 1993) CTTGGTCATTTAGAGGAAGTAA Hot start of 94°C for 2 min; 40 cycles of 94°C for 30 s, ITS4 (White et al., 1990) TCCTCCGCTTATTGATATGC 50°C for 30 s, 72°C for 1 min; extension of 72°C for 5 min, hold 4°C indefinitely.
Mcm7 Mcm7_RADS_F GCGARATATTTCARCCTGTCAC Hot start of 94°C for 2 min; (R. Steeves, unpublished) 40 cycles of 94°C for 30 s, Mcm7_RADS_R CGCATTCCGTCRCCCATTTC 58°C for 30 s, 72°C for 1 (R. Steeves, unpublished) min; extension of 72°C for 5 min, hold 4°C indefinitely.
mtSSU mitSSU1 (Zoller et al. 1999) AGCAGTGAGGAATATTGGTC Hot start of 94°C for 3 min; 35 cycles of 94°C for 30 s, mitSSU3R (Zoller et al. 1999) ATGTGGCACGTCTATAGCCC 52°C for 1 min, 72°C for 1 min; extension of 72°C for 7 min, hold 4°C indefinitely.
Draft
29
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 30 of 33
FIGURES
Figure 1. Phylogeny of Alectoria illustrating the position of A. fallacina with Gowardia nigricans selected as the outgroup, inferred from combined ITS and Mcm7 sequence data and displayed as the most likely tree. Maximum likelihood support values >50 and Bayesian Inference posterior probabilities >0.7 are displayed, respectively, above or below each branch. Bolded branches have support values >70% (ML) and >0.95 (BI).
Figure 2. A E) Alectoria sarmentosa group. A) A. imshaugii , scale = 1 cm, Alphandary & DiMeglio s.n. (OSC). B) A. sarmentosa, scale = 1 cm, McMullin 7952 (OAC). C) A. sorediosa , scale = 7 mm, McMullin 8369 (OAC). D) A. vancouverensis , scale = 9 mm, McMullin 8358 (OAC). E) A. vexillifera , scale = 5 mm, Hollinger 0009 (personal herbarium) . F) A. fallacina , scale = 1 cm ( Lendemer 32980 , NY).
Draft
30
https://mc06.manuscriptcentral.com/botany-pubs Page 31 of 33 Botany
Draft
187x203mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/botany-pubs Botany Page 32 of 33
Draft
177x199mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/botany-pubs Page 33 of 33 Botany
Appendix
Additional specimens of A. sarmentosa examined. CANADA. New Brunswick . Charlotte Co., Lepreau Parish: New River Beach Provincial Park, Barnaby Head hiking trail, between Raspberry Cove and Chitticks Beach, 29 Apr 2011, McMullin 7423 (OAC). Nova Scotia . Queens Co. Kejimkujik National Park, Sea Side Adjunct, 22 Nov 2011, McMullin 7952 (OAC)
Additional specimens of A. fallacina examined. U.S.A. North Carolina . Burke Co. Blue Ridge Mountains, Linville Falls, 14 June 1936, Welch 2524 (NY). Sevier Co. Great Smoky Mountains National Park, Mount Le Conte, 1972, Dey 3255 (NY). Swain Co. Great Smokey Mountains National Park, Mount Collins, Appalachian Trail, 1972, Dey 2801 (NY). Swain Co. Great Smokey Mountains National Park, Heintooga Balsam Mountain Road, July, 2003, Dey 31273 (NY). Yancey Co. Black Mountains, Mount Mitchell, 1973, Dey, 5993 (NY) and 5997 (NY).
Draft
https://mc06.manuscriptcentral.com/botany-pubs