Abstract Jacobson, Alana Lynn

ABSTRACT

JACOBSON, ALANA LYNN. Tomato spotted wilt virus (TSWV) in North Carolina: Characterizing the Vector Competence of Thrips tabaci and Investigating the Use of Cyantraniliprole for Reducing Transmission of TSWV by Frankliniella fusca and Frankliniella occidentalis. (Under the direction of George G. Kennedy.)

Tomato spotted wilt virus (TSWV), is a thrips transmitted plant virus that ranks among the most economically important insect-vectored plant viruses worldwide. In the Southeastern U.S. this virus causes economic losses in many crops, including tobacco, pepper, tomato, and peanut. In North Carolina the two primary thrips vectors implicated in primary and secondary spread of TSWV, respectively, are Frankliniella fusca Hinds and F. occidentalis Pergande. The role of the third vector species, Thrips tabaci Lindeman, in the epidemiology of TSWV in NC is unknown. T. tabaci has not been thought to contribute significantly to virus spread due to its localized importance as a vector in other parts of the world and documented variation in vector competence that exists among different populations. T. tabaci populations that efficiently transmit TSWV have been observed in the U.S.; however, the extent of variation in transmission efficiency that exists among NC populations is unknown. To better characterize the competence of NC populations of T. tabaci to transmit TSWV, T. tabaci collected at multiple locations in NC during 2010 were tested for their ability to transmit multiple TSWV isolates that were collected from the same locations. Results showed that vector competence of T. tabaci isofemale lines varied among TSWV isolates in a manner that was isolate specific. Moreover, transmissibility of isolates varied in a manner that was specific to T. tabaci isofemale line. On average transmission rates of the TSWV isolates were higher when they were transmitted by thrips collected from the same location, which suggests local adaptation between the thrips and the TSWV isolates. To better understand the role of the virus and thrips in this observed variation, a population genetic study of thrips populations was conducted, which included individuals from T. tabaci isofemale lines used in the transmission study. Microsatellite and mitochondrial COI DNA markers were used to examine population structuring in T. tabaci across NC, and the variation in TSWV transmission phenotypes among different clonal groups of T. tabaci. Geographic structuring of T. tabaci occurred across the locations sampled, and the distribution of clonal groups suggests that dispersal occurs among three of the four locations where thrips populations were collected. In addition, analysis of the probability of TSWV transmission by T. tabaci in relation to a specific ‘clonal assignment’ of individual thrips, based on microsatellite allele frequencies, suggests that the interaction of specific thrips genotypes with specific virus isolates is a better predictor of of TSWV transmission by T. tabaci than sympatry. In a separate study, the potential of cyantraniliprole, an anthranilic diamide insecticide, for reducing the spread of TSWV by F. fusca and F. occidentalis was investigated in a greenhouse study. Transmission of TSWV by F. fusca to Capsicum annuum L. seedlings was reduced in plants treated with Cyazypyr™, but transmission of TSWV by F. occidentalis was not. Mortality of F. fusca at 3 days post treatment did not differ significantly on excised foliage of cyantraniliprole treated and control plants, but feeding injury was significantly less on treated foliage. Overall, results indicate that T. tabaci has the potential to contribute to TSWV spread in NC; however, the role of T. tabaci in the epidemiology of TSWV can be expected to vary depending on the specific vector -virus isolate combinations that are present. In addition, cyantraniliprole may be a useful tool for TSWV management programs, and further studies investigating its potential to decrease TSWV incidence are warranted.

Tomato spotted wilt virus (TSWV) in North Carolina: Characterizing the Vector Competence of Thrips tabaci and Investigating the Use of Cyantraniliprole for Reducing Transmission of TSWV by Frankliniella fusca and Frankliniella occidentalis

by Alana Lynn Jacobson

A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy

Entomology

Raleigh, North Carolina

2012

APPROVED BY:

______George G. Kennedy Hannah J. Burrack Committee Chair

______Edward Vargo Christopher Gunter

BIOGRAPHY

Thrips, ‘tiny slender insects with fringed wings’, were the center of Alana Jacobson’s focus while pursuing a Ph.D. researching onion thrips’ role in the epidemiology of a Tomato spotted wilt virus in North Carolina. Born and raised in Phoenix, Arizona, she developed an interest in entomology and insect pest management in an agricultural biotechnology class and through her participation in the FFA Entomology Contest during high school. The experiences she gained through these programs fueled her desire to continue her studies at New Mexico State University where she received a B.S in Agricultural Biology and a B.A. in Spanish. In addition to class work, she was employed in departmental laboratories, gained valuable research experience in nematology and entomology, and participated in a year-long study abroad program in Mexico. In 2005 she moved to West Point, IN and spent the next three years completing a M.S. in Entomology at Purdue University investigating insecticide resistance in the corn earworm. The next leg of Alana’s eastward journey brought her to her current position here at NC State working under the direction of George Kennedy on insect vectored plant diseases. Upon completion of her Ph.D. she looks forward to entering a career researching and solving contemporary pest management problems. In her free time she enjoys horseback riding, hunting, quilting, and looking for cool rocks.

ACKNOWLEDGMENTS

The past four years have been great, mainly because of the wonderful people who have been part of my life, and who have helped me through this challenging and exciting time. First, I would like to thank my advisor, George Kennedy, for giving me the opportunity to work on this exciting and diverse project. You are an exemplary mentor, a good friend, and I have learned so much working with you on this project. Input from my committee members, Hannah Burrack, Ed Vargo, and Chris Gunter, has also been invaluable to the success of this project and enabled me to apply for, and attain postdoctoral funding. Dr. Gunter, thank you for your input and encouragement throughout this entire project. Dr. Vargo, thank you for your advice and support, especially during the population genetic study. Dr. Burrack, thank you for your advice, encouragement, friendship, and many conversations, but most of all, thanks for introducing me to Wisconsin cheese curds. Next I would like to thank the numerous people around our lab and the department who have helped with various aspects of this project: Carol Berger for teaching me the ropes of thrips rearing, TSWV isolate maintenance, and for being the one person in the lab I could always talk into a doughnut or milkshake run; Damon D’Ambrosio for his invaluable help with thrips colony maintenance, for help conducting numerous research projects in the lab (there are too many to list), his quick wit and dry sense of humor; Dan “the thrips-ID man” Grist for his help with slide mounting and thrips identification; Amanda Beudoin and Shannon Morsello for helping me get started on my lab work and advising me on classes; Warren Booth for helping me with various aspects of conducting molecular work and analyzing data; Paul Labadie for his help with lab work during the population genetics study; Mark Abney for his help and insights, good conversation, and for giving me the opportunity to practice shooting moving targets; Fred Gould for his comments and feedback on my grant proposal; Joy Smith and Consuello Arellano for their help with statistical analyses; and most importantly, Gene Dupree, Pat Bachelor, Jean Carter and Joyce Taylor, the four people who were really running the department.

iii

I am also thankful for the many friends who have helped balance my life, and provided encouragement and pleasant distractions from the demands of grad school. A special thanks goes to Diane Silcox for her friendship, beagle-sitting, the numerous meals she cooked for me, and late-night help with thrips wrangling on several occasions; Kelly Oten for fiestas; and Eleanor Spicer for many successful days. I am also grateful to Linda and Jeff Mullen for giving me the opportunity to ride horses at their farm, and for all of the Carousel Farms Crew, especially Cindy Gammon, Mennette Price, Rhonda and Christian Chalmers, Brooke Biddle, Meg Tucker, Darby Hollenbach, Remy Metzger, Meghan Giles, Dana and Teresa Jones, Weldon Gammon, and Danny Young. Last but not least, thank you to my family and friends back home for their encouragement and support throughout my career as a student. I love you all.

TABLE OF CONTENTS

LIST OF TABLES ...... vi LIST OF FIGURES ...... vii LITERATURE REVIEW ...... 1 References ...... 10 CHAPTER 1: CHARACTERIZING THE VARIATION IN TRANSMISSION OF Tomato spotted wilt virus BY Thrips tabaci USING MULTIPLE VIRUS ISOLATES AND ISOFEMALE LINES. Abstract ...... 17 Introduction ...... 17 Methods and Materials ...... 19 Results and Discussion ...... 22 References ...... 25 CHAPER 2: GENOME SIZE AND PLOIDY IN THYSANOPTERA, THRIPIDAE Abstract ...... 44 Introduction ...... 44 Methods and Materials ...... 46 Results and Discussion ...... 47 References ...... 51 CHAPTER 3: THE POPULATION GENETIC STRUCTURE OF NORTH CAROLINA POPULATIONS OF Thrips tabaci Abstract ...... 56 Introduction ...... 56 Methods and Materials ...... 59 Results ...... 64 Discussion ...... 66 References ...... 69 CHAPTER 4: THE EFFECT OF THREE RATES OF CYANTRANILIPROLE ON THE TRANSMISSION OF TOMATO SPOTTED WILT VIRUS BY Frankliniella occidentalis AND Frankliniella fusca (THYSANOPTERA: THRIPIDAE) TO Capsicum annuum. Abstract ...... 84 Introduction ...... 84 Methods and Materials ...... 86 Results and Discussion ...... 90 References ...... 94 SUMMARY AND CONCLUSIONS ...... 100 References ...... 102

LIST OF TABLES

CHAPTER 1: CHARACTERIZING THE VARIATION IN TRANSMISSION OF Tomato spotted wilt virus BY Thrips tabaci USING MULTIPLE VIRUS ISOLATES AND ISOFEMALE LINES.

Table 1. Collection information for Thrips tabaci isofemale lines used in the transmission experiments ...... 37 Table 2. Tomato spotted wilt virus isolate sample collection information ...... 38 Table 3. Mean proportion of indicator leaf discs infected with Tomato spotted wilt virus (TSWV) for each Thrips tabaci isofemale line-Tomato spotted wilt virus isolate combination, and means for each isolate and isofemale line. Standard error is given in parenthesis and the number of individuals tested for each isofemale line-isolate combination, N, is given ...... 39

CHAPER 2: GENOME SIZE AND PLOIDY IN THYSANOPTERA, THRIPIDAE

Table 1. Flow cytometry genome size estimates and ploidy determinations for three thrips species ...... 54

CHAPTER 3: THE POPULATION GENETIC STRUCTURE OF NORTH CAROLINA POPULATIONS OF Thrips tabaci

Table 1. Thrips tabaci sample information ...... 78 Table 2. Microsatellite loci primer information ...... 81 Table 3. Pairwise FST and pairwise distances (km) between four NC populations of T. tabaci ...... 82

CHAPTER 4: THE EFFECT OF THREE RATES OF CYANTRANILIPROLE ON THE TRANSMISSION OF TOMATO SPOTTED WILT VIRUS BY Frankliniella occidentalis AND Frankliniella fusca (THYSANOPTERA: THRIPIDAE) TO Capsicum annuum.

LIST OF FIGURES

CHAPTER 1: CHARACTERIZING THE VARIATION IN TRANSMISSION OF Tomato spotted wilt virus BY Thrips tabaci USING MULTIPLE VIRUS ISOLATES AND ISOFEMALE LINES.

Figure 1. Map of collection locations for Thrips tabaci individuals and Tomato spotted wilt virus isolates ...... 28 Figure 2. A subsample of vector-isolate pairing tested in transmission experiments showing that a large amount of variation exists in the ability of Thrips tabaci isofemale lines from North Carolina to transmit different Tomato spotted wilt virus isolates to indicator leaf discs in transmission assays ...... 29 Figure 3. Mean(standard error) proportion of Thrips tabaci that transmitted Tomato spotted wilt virus to indicator plants in sympatric vector- isolate pairings versus allopatric vector-isolate pairings were significantly different (P=0.0143) ...... 30 Figure 4. Variation in vector competence among Thrips tabaci isofemale lines collected from Jackson Springs ...... 31 Figure 5. Variation in vector competence among Thrips tabaci isofemale lines collected from Faison ...... 32 Figure 6. Variation in vector competence among Thrips tabaci isofemale lines collected from Candor ...... 33 Figure 7. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Jackson Springs ...... 34 Figure 8. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Cove City ...... 35 Figure 9. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Apex ...... 36

CHAPTER 3: THE POPULATION GENETIC STRUCTURE OF NORTH CAROLINA POPULATIONS OF Thrips tabaci

Figure 1. Map of North Carolina collection sites for the four Thrips tabaci populations that were used in the population genetic study ...... 73 Figure 2. Phylogenetic tree constructed from mitochondrial DNA sequences from four North Carolina T. tabaci populations using the Neighbor-joining method. Nonparametric bootstrap values are shown above branches ...... 74 Figure 3. Minimum spanning network calculated with mitochondrial COI sequences using TCS 1.2 1. Haplotypes of thelytokous and arrhenotokous North Carolina Thrips tabaci are shown in grey and white, respectively. Boxes grouping haplotypes indicate networks

vii

identified with 90% probability of parsimony ...... 75 Figure 4. Principle component analysis of the two primary components of pairwise genetic distances calculated for four North Carolina populations of T. tabaci at 12 microsatellite loci using distance methods of Bruvo et al. (2004) ...... 76 Figure 5. Scatter plot of transformed pairwise FST values and pairwise geographic distances between North Carolina populations of T. tabaci with regression line, R2 value and P value from a Mantel’s test for isolation by distance ...... 77

viii

LITERATURE REVIEW

Tospoviruses and Tomato spotted wilt virus

Thrips (Thysanoptera: Thripidae)-vectored viruses in the genus Tospovirus, the only plant- infecting members of the family Bunyaviridae, are rapidly emerging, worldwide threats to a diversity of crops (Whitfield et al. 2005, Pappu et al 2009, Plyusnim et al. 2012). Tospovirus intraspecific diversity, including rapid development of resistance breaking (RB) strains, is well known and emergence of new tospoviruses is a serious concern. Eight Tospovirus species have been confirmed and an additional 16 emerging genotypes have been identified (Plyusnim et al. 2012). Tomato spotted wilt virus (TSWV), the type member of the genus, ranks among the 10 most damaging plant viruses and causes an estimated global crop loss of over $1 billion (US) annually (Prins and Goldbach 1998). Since its introduction to the US in the mid-1980’s TSWV has resulted in extensive losses in tomato, pepper, peanut, potato, tobacco and flowering ornamentals in Alabama, Florida, Georgia, North Carolina, Louisiana, South Carolina, and Texas (Stewart et al. 1989, Greenough et al. 1990, Chamberlin et al. 1992, Hobbs et al. 1993, Johnson et al. 1995). In tobacco, tomato and pepper, TSWV can reduce marketable yields by more than 50%, rendering fields non-harvestable. In fresh market tomato, the problem is particularly severe because mature green fruit are harvested and the irregular ripening caused by TSWV does not appear until the fruit ripen following treatment with ethylene. TSWV is firmly established throughout NC and is most problematic in the tobacco and vegetable production areas of the coastal plain, and mountain and piedmont tomato production areas. Losses in NC have varied among years and locations; in some years they have been dramatic, with more than 25% of plants infected in numerous pepper and tomato fields, and in some cases more than 70% of plants. In several areas, losses in excess of 50% were observed in 2007. During 2007, infection levels in banana peppers in southern Sampson and Duplin Counties, NC were 20 % to 60%. In tobacco TSWV reduces yield by killing young plants and reducing the uniformity, yield, and leaf quality of infected plants that are not killed. Stand losses of greater than 50% have occurred in NC tobacco fields and since 2000 losses have ranged from several million to ca. 45 million dollars per year and

statewide losses of 6.3% have been recorded in flue-cured tobacco (Yancy 2002, Wilkinson 2005, Southern et al. 2007). There have also been isolated instances of severe losses in cabbage and potato.

Thrips Vectors of Tospoviruses

Thrips are major economic pests of many important crops grown worldwide in addition to vectoring topoviruses. Feeding damage by thrips causes injury to crops by stunting and/or retarding plant growth, which leads to yield reductions, cosmetic damage, and/or contamination by presence of insects and their feces. There are approximately 7,400 described species of thrips; however, only 14 thrips species serve as tospovirus vectors internationally;12 transmit known tospovirus species, and two species transmit emerging genotypes (Whitfield et al. 2005). Worldwide, western flower thrips (WFT), Frankliniella occidentalis Pergande, is considered the primary vector of concern because of its large plant host and geographic range and its ability to transmit multiple tospoviruses (Riley et al. 2011). In the U.S. F. fusca Hinds, F. bispinosa Morgan and Thrips tabaci Lindeman are also important tospovirus vectors. There are ten reported vectors of TSWV, but only three are present in NC: T. tabaci, F. fusca, and F. occidentalis. Thrips vectors transmit TSWV to healthy plants only after acquiring the virus by feeding as first instars on an infected plant (Van de Wetering et al. 1996). After ingestion, the virus moves into the midgut epithelium where it initiates replication. Next, the virus passes into the muscle cells surrounding the midgut and continues to spread to the salivary glands via cell to cell movement (Assis Filho et al. 2002). The virus must reach the salivary gland of the thrips in order to be transmitted during thrips feeding (Kritzman et al. 2002). Late instars and non-infectious adults that feed on infected plants are unable to transmit the virus (Wijkamp et al 1996). Also, because the virus is not passed from adults to offspring via the egg, each generation of thrips must re-acquire the virus. Only plants that are infected with TSWV and produce significant populations of infectious thrips

serve as sources for the spread of TSWV (Wijkamp et al. 1995, Peters et al. 1996, Ullman et al. 1997).

Thrips tabaci as a Vector of Tospoviruses

Thrips tabaci was the first thrips discovered to transmit TSWV, and is an important vector of TSWV in tobacco production systems in Europe (Jenser et al. 2003, Chatzivassiliou 2008) and Tasmania (Wilson 1997). The vector status of T. tabaci, however, has recently been questioned due to the variation that exists among different populations in the ability to transmit different isolates of TSWV (Chatzivassiliou et al. 2002). In the U.S. and Europe both poorly and efficiently transmitting populations are found, sometimes in the same region (Chatzivassiliou et al. 2002, Cabrera-La Rosa and Kennedy 2007). Populations of T. tabaci in Brazil and Canada did not transmit TSWV in laboratory assays (Paliwal 1974, Paliwal 1976, Nagata et al. 2004). In Greece, six populations collected from leek transmitted a single isolate of TSWV with different efficiencies ranging from 2-22% (Chatzivassiliou et al. 2002). Results from two different studies in the U.S. examining vector competence of populations from NY and NC found infection rates ranging from 0-57% in controlled experiments (Cabrera-La Rosa and Kennedy 2007). The variation in vector competence of T. tabaci has been widely attributed to the presence of at least two subspecies groups that vary in their ability to transmit TSWV (Zawirska 1976). Recent studies examining mitochondrial cytochrome oxidase subunit I DNA sequence variation provide evidence for the presence of at least three subspecies groups that vary by host plant preference (Brunner et al. 2004) and reproductive mode (Toda and Murai 2007). However, a comparison of TSWV transmission rates between these groups has never been conducted. Studies of population level differences in T. tabaci are also lacking. Populations can vary in their ability to transmit viruses and host plant preference, and how these populations are distributed through space and time can be expected to affect the spread and persistence of these economically important traits (Caprio and Tabashnik

1992). In addition, nothing is known about the mechanisms and interactions responsible for transmission of TSWV by T. tabaci. Thrips tabaci populations collected from Weeksville, NC and northern Pasquotank County, NC transmitted a TSWV isolate (designated Parker) collected from potato in northern Pasquotank County, NC to indicator plants at efficiencies of 5% and 43%, respectively (Cabrera-La Rosa and Kennedy 2007). Cabrera-La Rosa and Kennedy (2007) also characterized the transmission phenotypes of offspring from reciprocal and backcrosses between a poor and efficiently transmitting population (5% and 57% infection rates in indicator plants, respectively). They concluded that the ability of an individual to transmit TSWV was under genetic control and was inherited as a recessive trait. T. tabaci populations capable of transmitting TSWV at a rate of 43% may play an important role in TSWV outbreaks in susceptible crops, however, the distribution and abundance of these transmitting populations and their contribution to the spread of TSWV in NC remains unknown. In addition, nothing is known about the dispersal and movement of T. tabaci on a larger scale. Studies conducted to examine insecticide resistance in T. tabaci on a regional scale showed resistance problems to be a localized phenomenon that was dependent upon specific field conditions, and not consistent with regional cropping practices (Shelton et al. 2003). This suggests that these thrips populations may not disperse far. The tendency of T. tabaci populations capable of transmitting TSWV to disperse and spread both virus and their genes for vector efficiency may have important implications for their role in the epidemiology of TSWV.

Epidemiology of TSWV in North Carolina

TSWV is endemic and occurs throughout the landscape, due to the broad host ranges of TSWV and its thrips vectors (Latham & Jones 1997, Ochoa-Matinez et al. 1999, Groves et al. 2001, 2003, Kahn et al. 2005). Winter annual weeds serve as overwintering reservoirs of TSWV and sites of thrips population increase. Subsequent spread of TSWV among winter weeds in late winter and early spring results in an increase in the abundance of infected

plants that serve as sources for spread of TSWV into susceptible crops and summer weed hosts in spring (Groves et al. 2001b, 2003, Morsello and Kennedy 2009). Primary spread of TSWV from non-crop hosts to susceptible crops by F. fusca in spring accounts for most early season spread and economic loss in tobacco, pepper, and tomato crops in NC (Groves et al. 2002, 2003). Crop plants that are infected early in the season are not likely to produce any marketable yield (Chaisuekul & Riley 2005). Although secondary spread of TSWV is not thought to occur in some crops such as tobacco due to the absence of reproducing populations on tobacco, during the summer large populations of F. occidentalis can develop within pepper and tomato crops following bloom, and can cause significant later-season spread of TSWV that results in irregular ripening of fruit and suppresses marketable yield (Beaudoin 2011). In the fall, TSWV is spread from summer hosts to winter weed hosts by F. fusca and F. occidentalis dispersing from infected summer hosts when they senesce. This dispersal event occurs in late October and early November in NC. Frankliniella fusca, and F. occidentalis are considered the primary vectors for TSWV epidemics in NC (Groves et al. 2001a,b 2002). T. tabaci is not considered to contribute significantly to TSWV epidemics in NC due to the localized and inconsistent presence of T. tabaci populations. However, numerous years of thrips trapping data show that T. tabaci are caught in numbers similar to those of other vector species in some locations in some years (Morsello et al. 2008). The role of T. tabaci in the epidemiology of TSWV in NC has not been investigated.

Management of TSWV

Current management plans to reduce spread of tospoviruses are most effective when multiple techniques are used, including properly timed insecticide applications, mulches, and resistant varieties (Gent et al. 2006, Chatzivassiliou 2008, Diaz-Montano et al. 2011); however, reducing virus spread is complicated. No single method is effective at reducing tospovirus incidence, and the success of each method is variable. The main management tactic in use for TSWV in tomato, pepper and peanut is planting disease resistant cultivars. Resistant cultivars

are popular as they require no additional production costs. Currently, tomato and pepper cultivars resistant to TSWV are based on a single gene; Sw5 gene in tomato and tsw gene in pepper. However, many of the TSWV-resistant cultivars have horticultural characteristics that make them less desirable than susceptible traditional hybrids. Unfortunately, the prolonged usefulness of these cultivars is in jeopardy because resistance breaking strains of TSWV have been identified in NC and in several parts of the world where Sw5-containing tomato and tsw-containing pepper varieties are grown (Roggero et al. 2002, Aramburu 2003, Thomas-Carrol and Jones 2003, Margaira et al. 2004, Moyer and Kennedy, unpublished). TSWV resistance in peanut, which is genetically more complex and referred to as “field resistance,” has been more durable, with no reports of resistance breaking (Culbreath and Srinivasan 2011). Aluminized reflective mulch was reported to be effective in reducing thrips and TSWV in tomato and pepper in the southern USA (Greenough et al. 1990). These UV- reflective mulches have been very effective in reducing early season thrips populations and TSWV in tomato and have shown promise in pepper, decreasing the incidence of TSWV infections in tomato by 40-60% compared to black plastic mulch (Reitz et al. 2003, Momol et al. 2004). However these mulches are more expensive (~$240/acre more) than black plastic mulch, and also delay soil warming in spring, which may slow crop development and delay harvest (Riley and Pappu 2004). Due to the higher costs and disposal issues of some of these mulches, and their failure to provide complete control of thrips/TSWV, their value as a sole management tactic is debatable. Reducing spread of TSWV by using insecticides to control vectors has generally been of limited value. It is not practical to control vector populations on weed hosts, and although growers have increased insecticide applications targeting thrips, insecticides applied to crops often do not kill thrips quickly enough to prevent virus transmission (due to the short inoculation time). Soil applications of imidacloprid to transplants prior to setting, as a transplant drench, or through drip irrigation are routinely used in tobacco, tomato, and pepper production to reduce spread of TSWV. Imidacloprid has antifeedant and anti-settling effects on F. fusca when taken up systemically by plants (Joost and Riley 2005, Riley 2006a), and

reduces the rate of TSWV transmission by reducing the frequency of probing (Groves et al. 2001a, Coutts and Jones 2005). However, imidacloprid does not have this effect on F. occidentalis (Joost and Riley 2005, Riley 2006a), and there is some evidence that imidacloprid and other neonicotinoids may enhance populations of F. occidentalis in tomato (J.F. Walgenbach, unpublished data). F. occidentalis is tolerant to many currently registered insecticides, and pyrethroid and other broad spectrum insecticides commonly used to control fruit feeding insects can induce outbreaks of F. occidentalis by interfering with natural- occurring biological control (Jones et al. 2004). A new class of compounds that are promising for disease management due to their antifeedant effects on insects are the anthranilic diamides. This new class of insecticides represents a novel mode of action (IRAC MOA Group 28) targeting ryanodine receptors in insect muscle cells (IRAC 2007, Sattelle et al. 2008). Cyantraniliprole, a second generation anthranilic diamide, is reported to be active against sucking insects, which include many plant virus vectors (Burt and Karr 2008, Sattelle et al. 2008). Greenhouse and field studies have shown that treatments of cyantraniliprole reduce virus incidence of thrips and whitefly transmitted viruses (Castle et al 2009, Palumbo 2010, Stansly 2010, Jacobson and Kennedy 2011). Because few chemical options exist for suppressing virus spread, cyantraniliprole could be a very valuable tool in TSWV management. To date, TSWV research has yielded information about life stages and timing involved in TSWV acquisition and transmission by thrips vectors, environmental factors responsible for the spread and distribution of virus and vectors in the landscape, and the relative importance of management options available to reduce virus incidence in agricultural crops. However, much remains to be discovered regarding mechanisms involved in viral infection and spread within thrips vectors, specificity of vector-virus interactions within and among both thrips vector species and Tospovirus species, and continued efforts are needed to improve management of these viruses. The purpose of this research is to examine the potential role of genetic variation in T. tabaci and among TSWV isolates in determining the role of T. tabaci in the epidemiology and spread of TSWV in NC production agriculture systems, and to investigate vector-virus interactions responsible for vector competence of T.

tabaci to transmit TSWV. In addition, the potential for cyantraniliprole to reduce TSWV transmission by F. fusca and F. occidentalis is examined.

REFERENCES

Aramburu, J., and Martí, M. (2003) The occurrence in north-east Spain of a variant of Tomato spotted wilt virus (TSWV) that breaks resistance in tomato (Lycopersicon esculentum) containing the Sw-5 gene. Plant Pathol. 52: 407-407.

Beaudoin A.L.B. (2011) Temporal and spatial patterns of thrips dispersal in relation to the epidemiology of tomato spotted wilt virus. PhD Thesis, North Carolina State University.

Burt, A., Karr, D., 2008. DuPont and Syngenta enter into crop protection technology exchange. http://vocuspr.vocus.com/VocusPR30/Newsroom/Query.aspx?SiteName=DuPontNew&Entit y=PRAsset&SF_PRAsset_PRAssetID_EQ=110201&XSL=PressRelease&Cache=

Cabrera-La Rosa, J.C. and Kennedy, G.G. (2007) Thrips tabaci and tomato spotted wilt virus: inheritance of vector competence. Entomol. Exp. App. 124: 161-166.

Castle, S., Palumbo, J., and Prabhaker, N. (2009) Newer insecticides for plant virus disease management. Virus Res. 141: 131-139.

Chaisuekul, C. and Riley, D.G. (2005). Host plant, temperature and photoperiod effects on ovipositional preference of Frankliniella occidentalis and Frankliniella fusca (Thysanoptera: Thripidae). Hort. Entomol. 98(6): 2107-2113.

Chamberlin, J.R., Todd, J.W., Beshear, R.J., Culbreath, A.K. and Demski, J.W. (1992) Overwintering hosts and wing form of thrips, Frankliniella spp., in Georgia (Thysanoptera: Thripidae): Implications for management of spotted wilt disease. Environ. Entomol. 21: 121- 128.

Chatzivassiliou, E.K., Peters, D., and Katis, N.I. (2002) The efficiency by which Thrips tabaci populations transmit Tomato spotted wilt virus depends on their host preference and reproductive strategy. Phytopath. 92: 603-609.

Chatzivassiliou, E.K. (2008) Management and spread of Tomato spotted wilt virus in tobacco crops with insecticides based on estimates of thrips infestation and virus incidence. Plant Dis. 92: 1012-1020.

Coutts B.A., and Jones, R.A.C. (2005) Suppressing spread of Tomato spotted wilt virus by drenching infected source or healthy recipient plants with neonicotinoid insecticides to control thrips vectors. Ann. Appl. Biol. 146: 95-103.

Culbreath, A.K. and Srinivasan, R. (2011) Epidemiology of spotted wilt disease of peanut caused by Tomato spotted wilt virus in the southeastern U.S. Virus Res. 159(2): 101-9.

Diaz-Montano, J., Fuchs, M., Nault, B.A., Fail, J., and Shelton, A.M. (2011) Onion thrips (Thysanoptera: Thripidae): A global pest of increasing concern in onion. J. Econ. Entomol. 104: 1-13. de Assis, F.M., Naidu, R.A., Deom, C.M., and Sherwood, J.L. (2002) Dynamics of Tomato spotted wilt virus replication in the alimentary canal of two thrips species. Phytopathol. 92: 729-733.

Edelson, J.V., Cartwright, B., and Royer, T.A. (1986) Distribution and impact of Thrips tabaci (Thysanoptera: Thripidae) on onion. J. Econ. Entomol. 79: 502-505.

Gent, D.H., du Toit, L.J., Fichtner, S.F., Mohan, S.K., Pappu, H.R., and Schwartz, H.F. (2006) Iris yellow spot virus: An emerging threat to onion bulb and seed production. Plant Dis. 90: 1468-1480.

Greenough, D.R., Black, L.L., and Bond, W.P. (1990) Aluminum-surfaced mulch: an approach to the control of tomato spotted wilt virus in solanaceous crops. Plant Dis. 74: 805- 808.

Groves, R.L., Sorenson, C.E., Walgenbach, J.F. and Kennedy, G. G. (2001a) Effects of imidacloprid on transmission of tomato spotted wilt tospovirus to pepper, tomato and tobacco by Frankliniella fusca Hinds (Thysanoptera: Thripidae). Crop Prot. 20: 439-445.

Groves, R.L., Walgenbach, J.F., Moyer, J.W., and Kennedy, G.G. (2001b) Overwintering of Frankliniella fusca Hinds (Thysanoptera: Thripidae) on winter annual weeds infected with tomato spotted wilt tospovirus (TSWV) and patterns of movement of TSWV into susceptible hosts. Phytopathol. 91: 891-899.

Hobbs, H.A., Black, L.L., Story, R.N., Valverde, R.A., Bond, W.P., Gatti Jr., J.M., Schaeffer, D.O., and Johnson, R.R. (1993) Transmission of tomato spotted wilt virus from pepper and three weed host by Frankliniella fusca. Plant Dis. 77(8): 797-799.

Insecticide Resistance Action Committee (IRAC). (2007) IRAC mode of action classification Version5.3.http://www.iraconline.org/documents/IRAC%20MoA%20Classification%20v5_3 .pdf

Jenser, G., Gáborjányi, R., Szénási, A., Almási, A., and Grasselli, M. (2003) Significance of hibernated Thrips tabaci Lindeman (Thysann., Thripidae) adults in the epidemic of tomato spotted wilt virus. J. App. Entomol. 127: 7-11.

Johnson, R.R., Black, L.L., Hobbs, H.A., Valverde, R.A., Story, R.N., and Bond, W.P. (1995) Association of Frankliniella fusca and three winter weeds with Tomato spotted wilt virus in Louisiana. Plant Dis. 79: 572-576.

Jones, T., Scott-Dupree, C., Harris, R., Shipp, L. and Harris, B. (2004) Efficacy of spinosad against western flower thrips, Frankliniella occidentalis, and its impact on associated biological control agents on greenhouse cucumber in southern Ontario. Pest Manag. Sci. 61: 179-185.

Joost, P. H., and Riley, D.G. (2005) Imidacloprid effects on probing and settling behavior of Frankliniella fusca and Frankliniella occidentalis (Thysanoptera: Thripidae) in tomato. J. Econ. Entomol. 98: 1622-1629.

Kahn, N.D., Walgenbach, J.F., and Kennedy, G.G. (2005) Summer weeds as hosts for Frankliniella occidentalis and Frankliniella fusca (Thysanoptera: Thripidae) and as reservoirs for Tomato spotted wilt Tospovirus in North Carolina. J. Econ. Entomol. 98:1810- 1815.

Kritzman, A., Gera, A., Raccah, B., van Lent, J.W.V., and Peters, D. (2002) The route of tomato spotted wilt virus inside the thrips body in relation to transmission efficiency. Archives of Virol. 147: 2143-5156.

Latham, L.J. and Jones, R.A.C. (1997) Occurrence of tomato spotted wilt tospovirus in native flora, weeds, and horticultural crops. Aust. J. Agric. Res. 48: 359-369.

Margaria, P., Cluffo, M., and Turina, M. (2004) Resistance breaking strain of Tomato spotted wilt virus (Tospovirus: Bunyaviridae) on resistant pepper in Almeria, Spain. Plant Pathol. 53: 795.

Momol, M.T., Olson, S.M., Funderburk, J.E., and Stavisky, J.. (2004) Integrated management of tomato spotted wilt on field-grown tomatoes. Plant Dis. 88: 882-890.

Morsello, S.C. (2007) The Role of Temperature and Precipitation on Thrips Populations in Relation to the Epidemiology of Tomato Spotted Wilt Virus. PhD Thesis, North Carolina State University.

Morsello, S.C., Groves, R.L., Nault, B.A. and Kennedy, G.G.. (2008) Temperature and precipitation affect seasonal populations of dispersing tobacco thrips, Frankliniella fusca and onion thrips, Thrips tabaci, (Thysanoptera: Thripidae) caught on sticky traps. Environ. Entomol. 37: 79-86.

Morsello, S. and Kennedy, G.G. (2009) Spring temperature and precipitation affect tobacco thrips, Frankliniella fusca (Thysanoptera: Thripidae) population growth and Tomato spotted wilt virus within patches of the winter weed Stellaria media. Entomol. Exp. Appl. 130: 138- 148.

Nagata, T., Almeida, A.C.L., Resende, R. de O., and de Avila, A.C. (2004) The competence of four thrips species to transmit and replicate four tospoviruses. Plant Pathol. 53: 136-140.

Nault, B.A., Shelton, A.M., Gangloff-Kaufmann, J.L., Clark, M.E., Werren, J.L., Cabrera- LaRosa, J.C., and Kennedy, G.G. (2006) Reproductive modes in onion thrips (Thysanoptera: Thripidae) populations from New York onion fields. Environ. Entomol. 35: 1264-1271.

Ochoa Martinez, D.L., Zavaleta-Mejia, E., Mora-Aguilera, G., and Johansen, R.M. (1999) Implications of weed composition and thrips species for the epidemiology of tomato spotted wilt in chrysanthemum (Dendranthema grandiflora). Plant Pathol. 48:707-717.

Paliwal, Y.C. (1974) Some properties and thrips transmission of tomato spotted wilt virus in Canada. Can. J. Bot. 52: 1177-82.

Paliwal, Y.C. (1976) Some characteristics of the thrips vector relationships of tomato spotted wilt virus in Canada. Can. J. Bot. 54: 402-405.

Palumbo, J.C. (2010) Control of sweetpotato whitefly and CYSDV incidence with foliar and soil insecticides on cantaloupes. AMT. 35(E5): 1-2.

Pappu, H.R., Jones, R.A.C and Jain, R.K. (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Res. 141(2, Sp. Iss. SI): 219-236.

Peters, D. and Goldbach, R. (1995) The biology of tospoviruses. In R. P. Singh, U. S. Singh., K. Kohmoto [eds], Pathogenesis and host specificity in plant diseases, vol III. Viruses and viroids. Pergamon, Oxford, United Kingdom. pp199-210.

Plyusnin, A., Beaty, B.J., Elliot, R.M., Goldbach, R., Kormelink, R., Lundkvist, A, Schmaljohn, C.S., and Tesh, R.B. (2012) Bunyaviridae In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of viruses, E.L. A.M.Q. King, M.J. Adams, and E.B. Carstens., Editors. Elsevier Inc., San Diego, CA. pp. 725-741.

Prins, M. and Goldbach, R. (1998) The emerging problem of tospovirus infection and nonconventional methods of control. Trends Microbiol. 6(1): 31-35.

Reitz, S. R., Yearby, E. L., Funderburk, J. E., Stavisky, J., Momol, M. T., and Olson, S. M. (2003) Integrated management tactics for Frankliniella thrips (Thysanoptera: Thripidae) in field-grown peppers. J. Econ. Entomol. 96: 1201-1214.

Riley, D.G. and Pappu, H. (2004) Tactics for management of thrips (Thysanoptera: Thripidae) and Tomato spotted wilt virus in tomato. J. Econ. Entomol. 97: 1648-1658.

Riley, D.G., Joseph, S.V., Srinivasan, R., and Diffie, S. (2011) Thrips Vectors of Tospoviruses. J. Integrated Pest Manage. 1(2): 1-10.

Riley, D. G. (2006) Effect of imidacloprid on the settling behavior of Frankliniella occidentalis and Frankliniella fusca (Thysanoptera: Thripidae) on tomato and peanut. J. Entomol. Sci. 42(1): 74-83.

Roggero, P., Masenga, V., and Tavella, L. (2002) Field isolates of Tomato spotted wilt virus overcoming resistance in pepper and their spread to other hosts in Italy. Plant Dis. 96: 950- 954.

Sattelle, D.B., Cordova, D., and Cheek, T.R. (2008) Insect ryanodine receptors: molecular targets for novel control chemicals. Invert. Neurosci. 8: 107-119.

Shelton, A.M. and North, R.C. (1986) Species composition and phenology of Thysanoptera within field crops adjacent to cabbage fields. Environ. Entomol. 15: 513-519.

Southern, P.S., Sorenson, C.E., Mila, M., and Melton, T.A. (2007) Tomato spotted wilt. Flue- cured Tobacco Guide 2007. http://ipm.ncsu.edu/Production_Guides/Flue- Cured/2007/chptr11.pdf

Stansly, P.A. (2010) Effect of rate and application method of cyazypyr (HGW86) on control of silverleaf whitefly and southern armyworm in staked tomato, 2009. AMT. 35(E43): 1-3.

Stewart, J.W., Cole, C., Lummus, P. (1989) Winter survey of thrips (Thysanoptera: Thripidae) from certain suspected and confirmed hosts of Tomato spotted wilt virus in south Texas USA. J. Entomol. Sci. 24(3): 392-401.

Thomas-Carroll, M.L., and Jones, R.A.C. (2003) Selection, biological properties and fitness of resistance-breaking strains of Tomato spotted wilt virus in pepper. Ann. Appl. Biol. 142: 235-243

Ullman, D.E, Sherwood, J.L., German, T.L. (1997) Thrips as vectors of plant pathogens. In (ed.) T. L. Lewis, Thrips as Crop Pests, CAB International, London, UK. pp. 539-566.

Van De Wetering, Fennet, R. Goldbach, D. Peters. (1996) Tomato spotted wilt tospovirus ingestion by first instar larvae of Frankliniella occidentalis is a prerequisite for transmission. Phytopathol. 86(9): 900-905.

Whitfield, A.E., Ullman, D.E., and German, T.L. (2005) Tospovirus-thrips interactions. Annual Rev. Phytopathol. 43: 459-489.

Wilkinson, W.C. (2005) Effects of stand loss, planting date, and replanting method on yield and quality of flue-cured tobacco. M.S. Thesis, North Carolina State University, Raleigh, NC.

Wijkamp, I., Almarza, N., Goldbach, R., Peters, D. (1995) Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathol. 85: 1069-1074.

Wijkamp, I., Goldbach, R. and Peters, D. (1996) Propagation of Tomato spotted wilt virus in Frankliniella occidentalis does neither result in pathological effects nor in transovarial passage of the virus. Entomol. Exp. Appl. 81: 285-292.

Yancy Jr., C.H. (2002) Progress being made against TSWV. Southeast Farm Press. http://southeastfarmpress.com/mag/farming_progress_made_against/

Zawirska, I. (1976) Untersuchungen uber zwei biologische Typen von Thrips tabaci Lind. (Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopath. Plant Prot. 12: 411-422.

CHAPTER 1

Characterizing the variation in transmission of Tomato spotted wilt virus by Thrips tabaci using multiple virus isolates and isofemale lines.

Abstract

The ability of 21 Thrips tabaci isofemale lines to transmit multiple Tomato spotted wilt virus (TSWV) isolates was quantified to examine the roles of virus isolate, thrips and vector-virus interactions in transmission efficiency of TSWV by T. tabaci. In addition, transmission rates between sympatric and allopatric vector-isolate pairings were analyzed. TSWV infection rates in indicator plants were variable in these experiments. Transmission of TSWV by each isofemale line was isolate specific, and transmissibility of each isolate was isofemale line specific. Results show that both thrips and virus isolates were important factors underlying transmission of TSWV by T. tabaci, and higher transmission rates were seen among sympatric isofemale line-isolate pairings.

Introduction

Tomato spotted wilt virus (TSWV) is a persistently propagative, thrips-transmitted, plant virus reported to infect over 900 different plant species including many economically important agricultural crops. During the 1980s significant spread of TSWV occurred globally due to transport of infected material and vector species (Peters et al. 1996, Pappu et al 2009, Sherwood et al. 2000). It is currently ranked among the top ten most economically important plant viruses worldwide and is estimated to cause >$1billion in crop losses worldwide every year (Prins and Goldbach 1998). TSWV has been present in the southeastern USA, including North Carolina, since the 1980s, and frequently causes significant losses in tobacco, peanut, pepper, tomato, and potato (Culbreath et al. 1991, Pappu et al. 2009). At least 10 thrips species are reported vectors of TSWV, but only three of these vectors are present in NC: Thrips tabaci Lindeman, Frankliniella fusca Hinds and F. occidentalis Pergande. Research on TSWV in the southeastern US has focused on F. fusca and F. occidentalis as vectors and has yielded important information about the epidemiology of the virus in NC (Groves et al 2001, 2002, 2003).

T. tabaci has not been regarded as an important vector of TSWV in NC due to the localized and inconsistent presence of T. tabaci populations in NC agroecosystems. However, numerous years of thrips trapping data show that in some years, and in some locations where TSWV occurs, T. tabaci are caught in numbers similar to those of other vector species (Morsello et al. 2008). In addition, extensive variation in the abilityof T. tabaci to transmit TSWV has been observed worldwide (Paliwal 1973, Paliwal 1976, Lemetty and Lindqvist 1993, Trjapitzin 1995, Wijkamp et al. 1995, Chatzivassiliou et al. 2002, Jenser et al. 2003, Nagata et al. 2004, Cabrera-La Rosa and Kennedy 2007, Chatzivassiliou 2008). Despite this variation T. tabaci is the primary vector of TSWV in tobacco production systems in Eastern Europe (Lemetty and Lindqvist 1993, Trjapitzin 1995, Chatzivassiliou et al. 2002, Jenser et al. 2003, Chatzivassiliou 2008). Variation in transmission efficiency exists among populations of T. tabaci from NC and NY (Cabrera-La Rosa and Kennedy 2007; Jacobson and Kennedy, unpublished data), although the extent of variation has not been well characterized. In addition, variation exists in the transmission of different isolates by individual populations of T. tabaci (Chatzivassiliou et al. 1998, Tedeschi et al. 2001, Jacobson and Kennedy, unpublished data). To date, no transmission studies have been conducted with multiple TSWV isolates and multiple T. tabaci populations to quantify the relative importance of vector and virus determinants underlying transmission of TSWV by T. tabaci. A genetic basis for transmission has been identified in both TSWV and T. tabaci. Genetic backcross experiments between poor and efficiently transmitting populations of T. tabaci show that the ability of an individual to transmit TSWV is under genetic control and is inherited as a recessive trait in the populations tested (Cabrera-La Rosa and Kennedy 2007). Viral proteins underlying thrips-TSWV interactions critical for transmission to occur have also been identified (Sang-Hoon et al. 2005, Whitfield et al. 2005). The results of these studies suggest that genetic variation of thrips populations, virus isolates, or both thrips and isolates are important factors underlying the localized importance of this species as a vector of TSWV. The importance of compatible host and parasite genetics that result in infection are well documented for plant and mammalian pathosystems (Lambrechts et al. 2006,

Greischar and Koskella 2007, and references therein). In these systems gene-for-gene or matching-allele interactions that govern infectious interactions between hosts and parasites may result from local adaptation between sympatric host and parasite populations. Local adaptation driven by vector genetics appears to be a factor driving dynamics of disease epidemics and evolution of insect-vectored viruses, such as dengue viruses transmitted by mosquitoes (Moudy et al. 2007, Lambrechets et al. 2009) and whitefly transmitted begomoviruses (Simón et al. 2003). This study is motivated by our specific need to understand the potential of T. tabaci as a vector in NC, and by the larger need to understand T. tabaci-TSWV interactions that underlie the importance of T. tabaci as a vector worldwide. Therefore, the objectives of this study are two-fold. The first objective is to quantify variation in transmissibility of TSWV isolates by T. tabaci, and the efficiency of T. tabaci to transmit isolates of TSWV in NC. The second objective is to investigate the possibility that genetic interactions and local adaptation are responsible for the localized nature of this species as a vector of TSWV. T. tabaci collected from multiple locations in NC were used to establish isofemale lines that were tested for their ability to transmit multiple TSWV isolates collected at the same and different locations as the thrips. The data generated from these experiments were then analyzed to examine potential effects of TSWV isolate, T. tabaci isofemale line, and sympatry versus allopatry on transmission rate of TSWV to indicator leaf discs.

Materials and Methods

Thrips Populations Thrips tabaci individuals were collected from cultivated and weed plant hosts at 9 different locations in North Carolina in 2010 (Figure 1). Field collected thrips were kept separate, and individual females were used to establish isofemale lines; all individuals in an isofemale line originated from one female (Table 1). After three generations in the laboratory, offspring from each isofemale line were used in the transmission experiments. A total of 21 isofemale lines were established from females collected in 2010. All but two of the field collected

female thrips used to initiate isofemale lines were thelytokous; virgin GJ3 and MHC-2 females, produced all male F1 offspring. However, these lines stopped producing males and began producing all female offspring parthenogenetically before experiments were initiated. In addition, an isofemale line from a T. tabaci laboratory colony collected in 2009 and capable of transmitting TSWV in preliminary experiments was initiated and included in these experiments (Jacobson and Kennedy, unpublished data).

TSWV Isolates and Source Plants for Transmission Experiments An isolate collected in 2009 that was capable of being transmitted by T. tabaci in preliminary experiments was included in these experiments. This isolate was maintained in the greenhouse on Emilia sonchifolia using alternating rounds of mechanical inoculation and transmission with T. tabaci. In addition, multiple TSWV isolates were collected from seven of the same locations as the thrips in 2010 (Figure 1, Table 2). A single field-collected leaf of an infected plant was used as source material to mechanically inoculate TSWV into Emilia sonchifolia seedlings at the second true leaf stage (Ullman 1992). Inoculation buffer (10mM

Tris-HCl, pH 7.8, 10mM Na2SO3, 0.1% cysteine-HCl) was used in all mechanical inoculations. Infected plants were then allowed to grow for 4-6 weeks in the greenhouse at which time they were used as source material to inoculate the E. sonchifolia seedlings that were used in the transmission experiments. All infected seedlings from the second mechanical inoculation were transplanted into individual pots, placed into thrips-proof screen cages made of 100 micron screen (Midwest Filter Corp., Lake Forest, IL) and allowed to grow for 2-3 weeks in the greenhouse before they were used in experiments. A total of 14 isolates were used in these experiments. Disease-free E. sonchifolia leaf discs were used as indicator plants in the transmission experiments. All of these plants were grown in thrips-proof greenhouses under normal daylight until they were used in the experiments. Leaf discs were cut from leaves of mature plants with a #7 cork borer and placed into 50 mm x 9 mm petri dishes with tight fit lids (Becton, Dickinson and Company, Mississauga, Ontario, Canada) that were lined with moist filter paper. Leaf discs were cut the same day they were infested with thrips.

Transmission of TSWV by Thrips tabaci A total of 89 isolate x isofemale line combinations were tested. Due to the size of these experiments, this protocol was repeated five times; 2-3 isolates were used with multiple isofemale lines during each time period. Each isofemale line was characterized for its ability to transmit 1-5 of the other isolates collected, depending upon availability of thrips and TSWV infected plants. All but three isofemale lines were tested for their ability to transmit the isolate collected from the same location as the thrips that was used to establish the isofemale line. In the case of these three exceptions, no sympatric virus isolate was collected. TSWV infected E. sonchifolia plants individually housed in a thrips-proof sleeve cage were each infested with 5 adult females from a single isofemale line. A total of five TSWV infected plants were infested with thrips from each isofemale line. These plants were kept in a climate controlled room at 25°C with 50% RH and a 14:10 L:D cycle. Females were allowed to feed and reproduce on the plant for 11-12 days, after which the leaves of the plants were removed and placed into a small cup with uninfected cabbage. 1-2 days after the offspring eclosed to adults they were confined individually with disease-free E. sonchifolia leaf discs (described above) and held at 25°C for 48 hours. At least 10 individuals from an isofemale line were used to test for transmission of TSWV. If adults were not collected the 1st day, another attempt to collect adults occurred 3 days later. No adults were collected after that to avoid collecting offspring that did not have a sufficient acquisition access period. Each adult collected was confined with a single E. sonchifolia leaf disc for 48 hours after which the adult was removed. The leaf discs were held another 3 days before being tested for TSWV with DAS-ELISA (Agdia, Inc., Elkhart, IN, USA). Four negative controls (uninfected Emilia sonchifolia), 2 negative buffer controls and one positive control were included in each ELISA plate. Samples with a reading higher than the mean + 4 standard deviations from the control samples were considered to be TSWV positive.

Data Analysis Mean transmission rates were calculated for 89 isolate-isofemale line combinations, each isofemale line, and each isolate. The effects of virus isolate and isofemale line were

examined for 88 isolate-isofemale line combinations, and were also examined by location where multiple isofemale lines and/or isolates were collected. Transmission data for MHC-2 was excluded from these analyses because this isofemale line was not tested for its ability to transmit more than one isolate. The probability of TSWV transmission based on virus isolate, isofemale line, and their interaction was then analyzed using Proc Glimmix (SAS Institute, Cary, NC). An additional model was then run with virus isolate, isofemale line and sympatry variables as main effects to test for significant differences between sympatric TSWV isolate- isofemale lines (collected from the same location) versus allopatric TSWV isolate-isofemale lines (collected from different locations).

Results and Discussion

A large amount of variation in TSWV transmission was observed among the 20 isofemale lines tested for their ability to transmit 2-10 isolates (Table 3, Figure 2). The overall mean proportion of TSWV infected leaf discs for all transmission assays was 0.10, but ranged from 0-0.55 for different isolate-isofemale line combinations. Transmission rates for some isolate- isofemale line combinations were zero, however, every isofemale line transmitted at least one of the isolates, and each isolate was transmitted by multiple isofemale lines. Up to 18 fold differences were observed in the proportion of infected leaf discs resulting among transmission of multiple isolates within a single isofemale line. Similar variation was observed for virus isolates; up to 45 fold differences were observed in the proportion of infected leaf discs when a single isolate was transmitted by different isofemale lines. The statistical analysis examining the effects of isolate, isofemale line, and their interaction on the probability of TSWV transmission showed that the effects of isofemale line were not statistically significant (P=0.0964), but the effects of isolate (P<0.0001) and the interaction of isolate and isofemale line (P=0.011) were both significant. To further investigate the significant interaction between thrips isofemale lines and virus isolates, another analysis was conducted that replaced the interaction term with the variable sympatry, that defined vector-virus pairings as sympatric or allopatric. The results of this analysis

showed that virus isolate (P<0.0001), isofemale line (P<0.0001) and sympatry (P=0.0012) were all statistically significant, and that on average sympatric vector-virus pairing resulted in higher transmission than allopatric pairings (Figure 3). These results indicate that the interaction of T. tabaci and isolate genetic determinants underlie successful transmission of TSWV by T. tabaci. In addition, higher transmission rates in sympatric vector-virus pairings suggest that local adaptation may be occurring between T. tabaci and TSWV isolates. The effect of isolate, isofemale line and their interaction was also examined by location where multiple isolates or isofemale lines were collected. Multiple isofemale lines were collected from Jackson Springs (SH-isofemale lines), Candor (GJ-isofemale lines) and Faison (Cot-isofemale lines) (Table 1). The effect of isolate (P<0.0001) and the interaction of isolate and isofemale line (P=0.0106) were significant among isofemale lines collected from Jackson Springs (Figure 4), and the effect of isofemale line (P=0.0011) and the interaction of isolate and isofemale line (P=0.0190) were significant among isofemale lines collected from Faison (Figure 5), but no variables were significant for Candor (Figure 6). Multiple isolates were collected from Cove City (Am- and SR3- isolates), Jackson Springs (SH-isolates), and Apex (Ap-isolates) (Table 2). The effects of isofemale line were significant among isolates collected from Jackson Springs (P=0.0130) (Figure 7), and the effects of isolate (P=0.0246) and the interaction term (P=0.0092) were significant among isolates collected from Cove City (Figure 8), but no variables were significant at Apex (Figure 9). The high level of statistical significance of isolate, isofemale line, and their interaction was not always seen when comparing either the transmission of isolates collected from the same location, or the ability to transmit TSWV among isofemale lines collected from the same location, probably due to the reduced sample sizes within location. However, significant effects and interactions among isolates and isofemale lines that support the importance of vector-virus interactions were observed at most of these locations. The results from this study corroborate results from previous studies that show a large amount of variation in vector competence of T. tabaci occurring among different populations (Paliwal 1973, Paliwal 1976, Lemetty and Lindqvist, 1993, Trjapitzin 1995, Wijkamp et al. 1995, Chatzivassiliou,et al. 2000, Jenser et al. 2003, Nagata et al. 2004, Cabrera-La Rosa

and Kennedy 2007, Chatzivassiliou 2008). However, this is the first study to examine this variation using more than two TSWV isolates, and with isofemale lines instead of colonies, that vary in genetic composition, to better characterize the observed variation in transmission. The results of this study show that the vector competence of T. tabaci varied, and was isolate specific. Similarly, the transmissibility of the isolates by T. tabaci varied, and was isofemale line specific. The interaction between virus isolates and isofemale lines was an important factor in TSWV transmission, and on average higher transmission rates were seen among sympatric TSWV isolate-isofemale lines versus allopatric TSWV isolate-isofemale lines, which is suggestive of local adaptation between virus and vector. If local adaptation is occurring, it is possible that this effect is not seen in all sympatric vector-virus pairings due to interactions occurring with the other two TSWV vectors, F. fusca and F. occidentalis. The importance of T. tabaci as a vector of TSWV, therefore, is going to be dependent upon the thrips and viral populations present in any given area. A better understanding of breeding and population structure of T. tabaci may provide valuable insights on the abundance and distributions of populations that vary in their ability to transmit TSWV. In addition, the specificity of T. tabaci-TSWV isolate interactions underlying transmission provide a good model system for characterizing thrips vector components associated with vector competence. Future studies in these areas will provide fundamental information that will improve our understanding of insect vectored viruses, and aid in the development of TSWV management programs where T. tabaci is present.

REFERENCES

Beaudoin, A.L.P. (2011) Temporal and spatial patterns of thrips dispersal in relation to the epidemiology of tomato spotted wilt virus. Ph.D. dissertation, North Carolina State University.

Cabrera-La Rosa, J.C. and Kennedy, G.G. (2007) Thrips tabaci and tomato spotted wilt virus: inheritance of vector competence. Entomol. Exp. App. 124: 161-166.

Culbreath, A.K., Csinos, A.S., Bertrand, P.F., and Demski, J.W. (1991) Tomato spotted wilt virus epidemic in flue-cured tobacco in Georgia. Plant Dis. 75: 483–485.

Chatzivassiliou E.K., Katis N.I. and Peters D. (1998) Transmission of tomato spotted wilt virus (TSWV) by Thrips tabaci grown on tobacco or non-tobacco crops. Pages 59-62 in: Recent Progress in tospovirus and thrips research. Peters, D. and Goldbach, R.W. (eds), Proceedings of the Fourth International Symposium on Tospovirus and thrips in floral and vegetable crops, Wageningen, The Netherlands.

Greischar, M.A. and Koskella, B.K. (2007) A synthesis of experimental work on parasite local adaptation. Ecol. Letters. 10: 418-434.

Groves, R.L., Walgenbach, J.F., Moyer, J.W., and Kennedy, G.G. (2001) Overwintering of Frankliniella fusca (Thysanoptera: Thripidae) on winter annual weeds infected with Tomato spotted wilt virus and patterns of virus movement between susceptible weed hosts. Phytopathol. 91: 891-899.

Groves, R.L., Walgenbach, J.F., Moyer, J.W., and Kennedy, G.G. (2002) The role of weed hostsand tobacco thrips, Frankliniella fusca, in the epidemiology of Tomato spotted wilt virus. Plant Dis. 86: 573-582.

Groves, R.L., Walgenbach, J.F., Moyer, J.W., and Kennedy, G.G. (2003) Seasonal dispersal patterns of Frankliniella fusca (Thysanoptera: Thripidae) and tomato spotted wilt virus occurrence in central and eastern North Carolina. J. Econ. Entomol. 96: 1-11.

Lambrechts, L., Fellous, S., and Koella, J.C. (2006) Coevolutionary interactions between host and parasite genotypes. Trends Parasitol. 22: 12-16.

Lambrechts, L., Chevillon, C., Albright, R.G., Thaisomboonsuk, B., Richardson, J.H., Jarman, R.G. and Scott, T.W. (2009) Genetic specificity and potential for local adaptation between dengue viruses and mosquito vectors. BMC Evol. Biol. 9: 160.

Lemmety, A. and Lindqvist, I. (1993) Thrips tabaci (Lind.) (Thysanoptera: Thripidae) another vector for tomato spotted wilt virus in Finland. Agric. Sci. Finl. 2, 189-194.

Moudy, R.M., Meola, M.A., Morin, L.L., Ebel, G.D. and Kramer, L.D. (2007) A newly emergent genotype of West Nile virus is transmitted earlier and more efficiently by Culex mosquitoes. Am J. Trop. Med. Hyg. 77: 365–370.

Morsello, S.C., Groves, R.L., Nault, B.A. and Kennedy, G.G. (2008) Temperature and precipitation affect seasonal patterns of dispersing tobacco thrips, Frankliniella fusca, and onion thrips, Thrips tabaci (Thysanoptera: Thripidae) caught on sticky traps. Environ. Entomol. 37: 79-86.

Morsello, S.C. and Kennedy, G.G. (2009) Spring temperature and precipitation affect tobacco thrips, Frankliniella fusca (Thysanoptera: Thripidae) population growth and Tomato spotted wilt virus within patches of the winter weed Stellaria media. Entomol. Exp. Appl. 130: 138-148.

Nagata, T., Almeida, A.C.L., Resende, R. de O., and de Avila, A.C. (2004) The competence of four thrips species to transmit and replicate four tospoviruses. Plant Pathol. 53: 136-140.

Paliwal, Y.C. (1974) Some properties and thrips transmission of tomato spotted wilt virus in Canada. Can. J. Bot. 52: 1177-82.

Paliwal, Y.C. (1976) Some characteristics of the thrips vector relationships of tomato spotted wilt virus in Canada. Can. J. Bot. 54: 402-405.

Pappu, H.R., Jones, R.A.C., and Jain, R.K. (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes and challenges aheae. Virus Res. 141: 219-236.

Peters, D., Wijkamp, I., van de Wetering, F., and Goldbach, R. (1995) Vector relationships in the transmission and epidemiology of topspoviruses. International symposium on tospoviruses and thrips of floral and vegetable crops. Acta Horticulturae. 431: 29-43.

Prins, M. and Goldbach, R. (1998) The emerging problem of tospovirus infection and nonconventional methods of control. Trend in Microbiol. 6: 31-35.

Sang-Hoon, S., McNulty, B.C., Kennedy, G.G., and Moyer, J.W. (2005) Viral genetic determinants for thrips transmission of Tomato spotted wilt virus. Proc. Natl. Acad. Sci. U. S. A. 102: 5168-5173.

Sherwood JL, German TL, Moyer JW, Ullman DE, Whitfield AE, 2000. Tospoviruses. In: MaloyOC, MurrayTD, eds. Encyclopedia of Plant Pathology. New York, USA: John Wiley & Sons, 1034–40.

Símon, B., Cenis, J.L., Beitia, F., Khalid, S., Moreno, I.M., Fraile, A., and García-Arenal, F. (2003) Genetic structure of field populations of Begomoviruses and of their vector Bemisis tabaci in Pakistan. Phytopathol. 93: 1422-1429.

Tedeschi, R., Ciuffo, M., Mason, G., Roggero, P., and Tavella, L. (2001) Transmissibility of four tospoviruses by a thelytokous population of Thrips tabaci from Liguria, northwestern Italy. Phytoparasitica. 29: 37-45.

Trjapitzin, S.V. (1995) Biological control of Thrips tabaci on tobacco seedlings in Ukraine. In: Parker, B. L., Skinner, M. & Lewis, T. (eds.) Thrips Biology and Management. Plenum Press.

Ullman, D.E., Cho, J.J., Mau, R.F.L., Westcot, D.M., and Custer, D.M. (1992) A midgut barrier to tomato spotted wilt virus acquisition by adult western flower thrips. Phytopathol. 82: 1333-1342.

Whitfield, A.E., Ullman, D.E., and German, T.L. (2005) Tospovirus-thrips interactions. Annu. Rev. Phytopathol. 43: 459-489.

Wijkamp, I., Almarza, N., Goldbach, R., Peters, D. (1995) Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathol. 85: 1069-1074.

Figure 1. Map of collection locations for Thrips tabaci individuals and Tomato spotted wilt virus isolates .

10 Week SH72 SH68

Percentage Transmission Percentage SH63 5 SH2 Kin1 Kin 0 IPOC Isofemale Line SR3-1 Am-1 Kin09 Kin Apex SH3 SH2 Ap-2 Ap-3 TSWV Isolate

Figure 2. A subsample of vector-isolate pairing tested in transmission experiments showing that a large amount of variation exists in the ability of Thrips tabaci isofemale lines from North Carolina to transmit different Tomato spotted wilt virus isolates to indicator leaf discs in transmission assays.

Figure 3. Mean (standard error) proportion of Thrips tabaci that transmitted Tomato spotted wilt virus to indicator plants in sympatric vector-isolate pairings versus allopatric vector- isolate pairings were significantly different (P=0.0143).

30 SH2

20 SH63 SH68 10 SH72

Percentage Transmission Percentage 0

Isolate

Figure 4. Variation in vector competence among Thrips tabaci isofemale lines collected from Jackson Springs.

50 45

35 30 Cot1-2 25 Cot1-8 20 Cot2-1 15 Cot2-2 10 Cot2-4

5 Percentage Transmission Percentage 0 GJ Cot-P Average Isolate

Figure 5. Variation in vector competence among Thrips tabaci isofemale lines collected from Faison.

20 18

16 14 12 GJ3 10 GJ4 8 GJ6 6 4 GJ7

2 Percentage Transmission Percentage 0 GJ Cot-P Average Isofemale Line

Figure 6. Variation in vector competence among Thrips tabaci isofemale lines collected from Candor.

30 SH-2 20 SH-3 10 SH-P

0 Percentage Transmission Percentage

Isofemale Line

Figure 7. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Jackson Springs.

20 15 SR3-1 10 SR3-3 5 Am-1

0 Percentage Transmission Percentage

Isofemale Line

Figure 8. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Cove City.

15 Ap-1 10 Ap-2 5 Ap-3 Ap-4

0 Percentage Transmission Percentage

Isofemale Line

Figure 9. Variation in transmissibility among Tomato spotted wilt virus isolates collected from Apex.

Table 1. Collection information for Thrips tabaci isofemale lines used in the transmission experiments. Isofemale Line Location Host Year Reproductive Mode Apex Apex, NC Allium cepa L. 2010 Thelytokous SR3-1 Cove City, NC Allium cepa L. 2010 Thelytokous IPOC Cove City, NC Allium cepa L. 2010 Thelytokous KIN-09 Kinston, NC Allium cepa L. 2009 Thelytokous KIN-1 Kinston, NC Allium cepa L. 2010 Thelytokous SH2 Jackson Springs, NC Secale cereale L. 2010 Thelytokous SH63 Jackson Springs, NC Allium cepa L. 2010 Thelytokous SH68 Jackson Springs, NC Allium cepa L. 2010 Thelytokous SH72 Jackson Springs, NC Raphanus raphanistrum 2010 Thelytokous COT1-2 Faison, NC Raphanus raphanistrum 2010 Thelytokous COT1-8 Faison, NC Raphanus raphanistrum 2010 Thelytokous COT2-1 Faison, NC Raphanus raphanistrum 2010 Thelytokous COT2-2 Faison, NC Allium cepa L. 2010 Thelytokous COT2-4 Faison, NC Brassica oleracea L. 2010 Thelytokous GJ3 Candor, NC Brassica oleracea L. 2010 Arrhenotokous GJ4 Candor, NC Raphanus raphanistrum 2010 Thelytokous GJ6 Candor, NC Allium spp. 2010 Thelytokous GJ7 Candor, NC Allium cepa L. 2010 Thelytokous WEEK Weeksville, NC Allium cepa L. 2010 Thelytokous MHC1 Fletcher, NC Allium cepa L. 2010 Thelytokous MHC2 Fletcher, NC Brassica spp. 2010 Arrhenotokous

Table 2. Tomato spotted wilt virus isolate sample collection information. Isolate Location Host Year Ap-1 Apex, NC Solanum lycopersicum 2010 Ap-2 Apex, NC Solanum lycopersicum 2010 Ap-3 Apex, NC Solanum lycopersicum 2010 Ap-4 Apex, NC Solanum lycopersicum 2010 SR3-1 Cove City, NC Nicotiana tabacum 2010 SR3-2 Cove City, NC Nicotiana tabacum 2010 SR3-3 Cove City, NC Nicotiana tabacum 2010 Am-1 Cove City, NC Nicotiana tabacum 2010 KIN-09 Kinston, NC Nicotiana tabacum 2009 KIN-1 Kinston, NC Nicotiana tabacum 2010 SH-1 Jackson Springs, NC Nicotiana tabacum 2010 SH-2 Jackson Springs, NC Nicotiana tabacum 2010 SH-3 Jackson Springs, NC Nicotiana tabacum 2010 SH-P Jackson Springs, NC Capsicum annuum 2010 COT-P Faison, NC Capsicum annuum 2010 GJ Candor, NC Solanum lycopersicum 2010

Table 3. Mean proportion of indicator leaf discs infected with Tomato spotted wilt virus (TSWV) for each Thrips tabaci isofemale line-Tomato spotted wilt virus isolate combination, and means for each isolate and isofemale line. Standard error is given in parenthesis and the number of individuals tested for each isofemale line-isolate combination, N, is given. Isolate Thripsǂ Ap-1 Ap-2 Ap-3 Ap-4 SR3-1 SR3-3 Am-1 Kin09 Kin SH-2 SH-3 SH-P GJ Cot-P Total Line Apex --- 0.05 † ------0.10 0.06 0 0 0.06 0.05 ------0.04 (0.05) (0.04) (0.03) (0) (0) (0.03) (0.03) (0.01) N=20 N=58 N=66 N=56 N=65 N=79 N=110 N=454 SR3-1 0.03 ------0.06 --- 0.08 0.03 0 0 --- 0.11 ------0.05 (0.02) (0.03) (0.03) (0.03) (0) (0) (0.06) (0.01) N=79 N=50 N=61 N=36 N=17 N=36 N=27 N=306 IPOC --- 0 0.06 ------0.07 0.20 0 0.08 0.13 0.03 ------0.12 (0) (0.03) (0.03) (0.05) (0) (0.03) (0.06) (0.02) (0.06) N=11 N=53 N=54 N=65 N=14 N=67 N=13 N=67 N=344 KIN09 --- 0.06 ------0.15 0.06 0.08 0.13 --- 0.10 ------0.02 (0.03) (0.05) (0.03) (0.03) (0.04) (0.04) (0.07) N=250 N=52 N=50 N=72 N=55 N=52 N=531 KIN1 ------0.02 ------0.08 0.21 0.11 0.08 --- 0.01 ------0.02 (0.02) (0.04) (0.05) (0.05) (0.03) (0.01) (0.06) N=49 N=42 N=66 N=35 N=84 N=68 N=344 SH2 --- 0.20 0.06 --- 0.03 0.06 0.21 0.03 0.15 0.17 0.16 0.55 ------0.13

Table 3. Continued (0.12) (0.03) (0.02) (0.02) (0.07) (0.02) (0.05) (0.03) (0.03) (0.07) (0.01) N=10 N=54 N=78 N=141 N=28 N=70 N=54 N=120 N=131 N=52 N=738 SH63 0.08 --- 0.10 0.21 0.08 0.10 0.25 --- 0.06 --- 0.05 ------0.12 (0.03) (0.04) (0.05) (0.03) (0.03) (0.06) (0.03) (0.04) (0.01) N=85 N=27 N=60 N=78 N=102 N=51 N=54 N=21 N=478 SH68 ------0.04 ------0.06 --- 0 0.17 0.07 0.02 0.28 ------0.10 (0.02) (0.05) (0) (0.05) (0.05) (0.02) (0.07) (0.02) N=62 N=17 N=13 N=48 N=40 N=42 N=39 N=261 SH72 ------0.20 0.10 ------0.12 (0.09) (0.04) (0.04) N=20 N=63 N=83 COT1-2 ------0.45 0.12 0.28 (0.07) (0.04) (0.05) N=51 N=52 N=103 COT1-8 ------0.12 0.17 0.14 (0.04) (0.05) (0.03) N=48 N=53 N=101 COT2-1 ------0.03 0.06 0.04 (0.02) (0.03) (0.02) N=51 N=54 N=105 COT2-2 ------0 0.02 0.01

Table 3. Continued (0) (0.02) (0.01) N=38 N=56 N=94 COT2-4 ------0.19 0.06 0.12 (0.05) (0.03) (0.03) N=59 N=51 N=110 GJ3* ------0.15 0.02 0.09 (0.05) (0.02) (0.03) N=34 N=53 N=87 GJ4 ------0.18 0 0.10 (0.06) (0) (0.04) N=34 N=25 N=59 GJ6 ------0 0.04 0.02 (0) (0.03) (0.01) N=52 N=47 N=99 GJ7 ------0.13 0.02 0.08 (0.05) (0.02) (0.03) N=52 N=47 N=99 WEEK --- 0.13 0 ------0.12 0.06 0.04 0.04 --- 0.14 ------0.08 (0.05) (0) (0.04) (0.05) (0.02) (0.03) (0.05) (0.01) N=47 N=52 N=75 N=17 N=69 N=49 N=42 N=351 MHC1 ------0.13 0 0.08

Table 3. Continued (0.07) (0) (0.04) N=23 N=17 N=40 *MHC2 ------0.28 --- 0.28 (0.05) (0.05) N=43 N=43 Total (0.02) (0.02) (0.01) (0.03) (0.02) (0.01) (0.02) (0.01) (0.01) (0.02) (0.01) (0.05) (0.01) (0.01) (0.01) N=164 N=338 N=297 N=110 N=156 N=622 N=442 N=346 N=512 N=252 N=560 N=91 N=485 N=455 N=4830 0.05 0.09 0.05 0.15 0.05 0.09 0.14 0.04 0.08 0.12 0.08 0.44 0.12 0.06 0.10 ǂIsofemale line started from field collected Thrips tabaci *Arrhenotokous isofemale lines †Bold values indicate sympatric isolate-isofemale line pairings

CHAPTER 2

Genome size and ploidy in Thysanoptera, Thripidae.

Abstract

Flow cytometry was used to study the genome sizes and ploidy levels for three thrips species (Thysanoptera: Thripidae): Frankliniella occidentalis Pergande, F. fusca Hinds, and Thrips tabaci Lindeman. These three species are economically important agricultural pests that injure crops with their feeding and are vectors of tospoviruses. Male and female F. fusca have a genome size of 392 and 409.8 Mb, whereas F. occidentalis males and females had smaller genomes that were 374.4 Mb and 343.7 Mb, respectively. Male F. occidentalis and F. fusca were haploid and females diploid. Five isofemale lines of T. tabaci initiated from parthenogenetic, thelytokous females collected from different locations in North Carolina were included in this study; no males were available to include in this study. One isofemale line was diploid with a genome size of 282.5 Mb and the other four had an average genome size of 476.3 Mb, which is consistent with evidence from microsatellite data of diploidy and polyploidy, respectively, in these same five thelytokous lines. This is the first study to produce genome size estimates for Thysanopteran species, and report polyploidy in T. tabaci populations.

Introduction

The insect order Thysanoptera is comprised of approximately 7,400 species of thrips (Mound, 2005), characterized by their small size (adults are 0.5-3 mm long) and the presence of finge cilia on their wings. This order of insects is composed of two suborders, Tubulifera and Terebrantia, containing one and eight families, respectively (Mound, 2005). Within the Thysanoptera the most common mode of reproduction is through a haplodiploid sex- determination system, where males are haploid and derived from unfertilized eggs through arrhenotokous parthenogenesis, and females diploid and produced biparentally. All female thelytokous (where females are produced parthenogenetically from unfertilized eggs) populations are also known to occur. The majority of thrips are phytophagous (plant feeding) and include many economically important pests of agricultural crops (Lewis 1997).

Additionally, several species are reported to feed on fungus, pollen, or are predacious on other thrips and small arthropods (Milne and Walter 1997, Milne and Walter 1998, Agrawal et al. 1999), while others are considered ectoparasites (Izzo et al. 2002). In Australia 21 tubuliferan species induce gall production on Acacia trees, and six of these species are eusocial with a morphologically distinct soldier caste, making them the only group of insects other than Hymenoptera that exhibit both haplodiploidy and eusociality (Crespi 1992, Crespi and Mound 1997, Kranz et al. 1999). In Terebrantia, only ten species in the family Thripidae are the sole vectors of plant infecting tospoviruses that cause annual losses of over $1 billion US worldwide (Prins and Goldbach 1998, Whitfield et al. 2005, Pappu et al. 2009). The range of diversity exhibited by these species and their economic impacts on global agriculture have resulted in thrips being targeted for genome sequencing efforts to study both specific traits of economic importance, and for inclusion in large scale comparative studies across taxa (Robinson 2010, Gregory 2012). Genome size determination for candidate species is an important first step used to inform sequencing efforts, and is valuable information for the study of genome evolution, phylogenetics, cytogenetics, and speciation both within Insecta and across the tree of life (Kraaijeveld 2010, Loxdale 2010, Gregory 2012). To date, of the ca. 1 million described insect species (Grimaldi and Engel 2005), genome size estimates are available for only 968 species (Gregory et al. 2012). From these estimates, genome size trends in relation to metamorphosis have emerged in Insecta. Holometabolous insects, those that undergo distinct egg, larval, pupal and adult life stages, exhibit constrained genome sizes that rarely exceed 2,000 Mb, whereas, hemimetabolous insects, which have immature lifestages similar in appearance to the adult, exhibit genome sizes that range from 105-7,752 Mb (Hanrahan and Johnston 2011, Gregory et al. 2012). Increasing the number of genome size estimates available for insects and other taxonomic groups across the tree of life is an important endeavor needed to provide information resources required to advance the field of evolutionary genomics. To date, no genome size estimates are available for any Thysanopteran species (Hanrahan and Johnston 2011, Gregory 2012). This study represents an initial step towards generating genome size and ploidy information for members of Thysanoptera. The three

thrips species selected for this study, Frankliniella occidentalis Pergande, F. fusca Hinds and Thrips tabaci Lindeman, are important pests of many field and greenhouse crops worldwide, are three of the ten reported vectors of tospoviruses, and are targeted for sequencing efforts to study virus transmission and insecticide resistance (Rotenberg and Whitfield 2010). In addition, observations of more than two alleles occurring at codominant microsatellite loci during development of population genetic markers have suggested the possibility that some populations of T. tabaci are polyploid (Jacobson 2012). In an initial screening of 12 microsatellite loci in 40 T. tabaci individuals collected from North Carolina more than two alleles per locus were consistently seen in multiple individuals at multiple loci. Polyploidy has not been documented for any thrips species; however, Bournier (1956) suspected that Heliothrips haemorrhoidalis Bouché (Terebrantia, Thripidae) is triploid because this species has 21 chromosomes. Determination of ploidy levels is needed to assist with development of microsatellite markers that will be used in future population genetic studies. The specific objectives of this study are to 1) determine the genome size of F. occidentalis, F. fusca and T. tabaci; 2) confirm haplodiploidy in F. occidentalis and F. fusca males and females; 3) determine ploidy levels of T. tabaci isofemale lines.

Materials and Methods

Insect Samples Adult male and female thrips used in this study were obtained from laboratory colonies. Live thrips were flash frozen in liquid nitrogen and stored at -80°C untile analysis. Colonies of F. fusca originally collected in 1995 from peanut (Arachis hypogaea L.) at the Peanut Belt Research Station in Lewiston, NC, and F. occidentalis collected in Hawaii were maintained on Phaseolus vulgaris L. bean pods in controlled environments at 24 °C with ca. 60% RH and a photoperiod of 14:10. T. tabaci from five separate isofemale lines, each of which was initiated from a single female collected from geographically separate locations in North Carolina, were used for this species. Because reproduction in each of these isofemale lines was by thelytokous parthenogenesis, in which all female offspring are produced asexually,

only female offspring were available for this study. Colonies of T. tabaci were reared on Brassica oleracea L. in environmental chambers at 23°C and a photoperiod of 14:10. Individual females used to initiate isofemale lines were collected from the following locations and host plants: NCSU Sandhills Research Station in Jackson Springs, NC from rye (Secale cereale L.) (SH2) and wild onion (Alliums spp) (SH63); from onion (Allium cepa L.) in Candor, NC (GJ3); from wild onion in Cove City, NC (IPOC), and from onion at the NCSU Kinston Agricultural Research Station in Kinston, NC (KIN-1).

Flow Cytometry Genome size and ploidy levels were determined using flow cytometry of propidium iodide- stained nuclei after Hare and Johnston 2011. Heads were dissected from thrips adults that had been flash frozen in liquid nitrogen. The heads were then placed in ice-cold Galbraith buffer, ground using a Kontes Dounce tissue grinder, and filtered through a 20-µm mesh. Nuclei were then stained with 25µg/ml propidium iodide for 0.5 hours. The mean fluorescence of stained nuclei was quantified using a Partec CyFlow with a solid-state laser emitting 532 nm. Experiments were replicated five times for females of F. occidentalis and F. fusca, and 2 or 3 times for each T. tabaci isofemale line. The standard used for the F. fusca, F. occidentalis and T. tabaci samples was Drosophila virilis (1C = 328Mb). The position of the 2C sample peak relative to the 2C standard peak was verified by running at least one insect of each species without a standard. To determine the total quantity of DNA in the sample, the ratio of the mean fluorescence of the 2C peak of the sample to the mean fluorescence of the 2C peak of the standard was calculated, and this ratio was multiplied by the 1C amount of DNA in the standard, where 1C refers to the average amount of DNA in a gamete.

Results & Discussion

The genome size estimates for the three thrips species and their associated ploidy levels are given in Table 1. The average genome size of 1C = 394.5 Mb (female) and 383.2 Mb (male) observed here contrasts starkly with the average for hemimetabolous insects, 1C =

3,205 Mb (Hanrahan and Johnston 2011). However, it fits within the range for Insecta, 105 Mb - 7,752 Mb, for closely related Phthiraptera (lice), and in distantly related Orthoptera (crickets and grasshoppers), respectively (Hanrahan and Johnson 2011). Diploid T. tabaci had the smallest genome size estimate (1C = 282.5 Mb), followed by F. occidentalis (1C = 343.7 Mb), F. fusca (1C = 409.8 Mb) and tetraploid T. tabaci (476.3 Mb), each incrementally increasing by approximately 60-70 Mb. Thrips genome size estimates are similar to those of Aphididae (Aphids) (407 Mb), which represent the smallest in the order Hemiptera (true bugs, hoppers, cicadas, aphids) and are believed to be a sister group to Thysanoptera (Grimaldi et al. 2004, Hanrahan and Johnson 2011). Two genome size estimates were produced for T. tabaci, one for diploids and one for tetraploids. Of the five T. tabaci isofemale lines examined for ploidy level, only the Iso-5 strain appears to be diploid. The other T. tabaci isofemale lines had larger genomes that were almost all identical. It is expected that a genome wide duplication event causing polyploidy would increase DNA amount proportionally with ploidy level compared to the diploid genome. Interestingly, the larger genomes were 1.69 times larger than the diploid, which would be between a triploid and a tetraploid. Genome size reductions following the formation of polyploidy lines have been well documented in plants, but have been little studied in the animal kingdom (Leitch and Bennett 2004). In Insecta relationships between ploidy level and genome size are only available for one species, Bacillus atticus carius (Phasmida: Phasmatidae), for which the ratio of the genome size between diploid and triploid lines is 1.5, which is consistent with a proportional increase in ploidy and genome size (Nomark 1996, Gregory et al. 2012). Non-linear relationships between ploidy level and DNA content, however, have been observed in amphibian and fish species whose ploidy levels are often greater than 4n, which suggests genome reductions may occur outside of the plant kingdom (Mabel et al. 2011). It is possible that T. tabaci is an ancient tetraploid that may have undergone a genome reduction and lost 90 Mb of DNA. Future genomic sequencing efforts involving T. tabaci will help to identify the nature of genome duplication and reduction events in this species.

Genome size estimates alone are not sufficient evidence of polyploidy; therefore, flow cytometry results were compared to the microsatellite allele profiles for parthenogenetically produced sisters of the thelytokous individuals used in the flow cytometry analysis. The flow cytometry results of ploidy for T. tabaci are consistent with observations from microsatellite marker development. A maximum of three bands per individual were observed at 7 microsatellite loci for each of the four tetraploid isofemale lines (consistent with polyploidy), while a maximum of 2 bands per individual were observed at these same loci for the diploid isofemale line (consistent with diploidy). The additional bands observed in isofemale lines were not considered to result from microsatellite stutter bands. In addition, preliminary data for 40 T. tabaci individuals collected in North Carolina at 12 microsatellite loci produced a maximum of 2, 3, and 4 alleles per individual (Jacobson and Booth unpublished data). Although only thelytokous individuals were available for use in the flow cytometry study, both thelytokous and arrhenotokous individuals were included in the microsatellite analyses. More than 2 alleles per locus were observed in individuals with both reproductive modes. Additional studies are needed to evaluate variation in genome size and ploidy in T. tabaci from different geographic areas as well as in arrhenotokous populations and males. Although uncommon, rare matings between parthenogenetic and sexual populations can occur, and where they do, breeding structure can influence the establishment and persistence of polyploid lines (Schneider et al. 2003, Jakovlić and Gui 2011, Crespo-López et al. 2007). Nothing is known about the breeding structure of T. tabaci populations, the scale of gene flow, or whether or not gene flow occurs between individuals of different reproductive modes. This is the first report of polyploidy in T. tabaci, and the first account of variation in ploidy level among thrips populations. Polyploidy in T. tabaci is especially interesting due to the large amount of inter- and intra- population variation already described for this species in relation to host plant races (Chatzivassiliou 2002, Brunner et al. 2004), transmission of Tomato spotted wilt tospovirus (Chatzivassiliou 2002, Cabrera-La Rosa and Kennedy 2007), insecticide resistance patterns (Shelton at al. 2003), and the existence of arrhenotokous and thelytokous parthenogenesis(Kendall and Capinera 1990, Jenser et al. 2006, Nault et al.

2006). In the animal kingdom polyploidy is commonly associated with parthenogenesis, and can serve as a mechanism for population isolation, drive evolutionary changes and species divergence, and has been used to explain geographic patterns of population variation and range expansion in other insect species (Lundmark and Saura 2006, Ghiselli et al. 2007). The prevalence of polyploidy in T. tabaci in relation to reproductive mode and geographic range may provide additional insights into the evolutionary impact of polyploidy. The prevalence of polyploidy in Thysanoptera is unknown, but it is possible that other polyploid species exist; based on chromosome number, parthenogenetic reproduction, and because polyploidy is assumed to be rare and therefore has not been considered in thrips studies. Other available information regarding genomic size variation among Thysanopterans comes from cytological studies examining chromosome number and karyotypes for six Tubulifera species in the family Phlaeothripidae and fourteen terebrantian species in the family Thripidae (Pomeyrol 1929, Prussard-Radulesco 1930, Bournier 1956, Risler and Kempter 1961, Brito et al. 2010). Distinct chromosomal differences were observed between Phlaeothripidae and Thripidae, with chromosome number being greater and chromosome size being smaller in the latter than the former. In addition, the reports of four distinct chromosome numbers for the species H. haemorrhoidalis (Terebrantia, Thripidae) (Pomeyrol 1929, Prussard-Radulesco 1930, Bournier 1956), and identification of distinct karyotypes for Gynaikothrips uzeli Zimmerman (Tubulifera, Phlaeothripidae) (Brito et al. 2010) suggest the presence of species complexes for members of both suborders of Thysanoptera. Future evaluations of the genome size, organization and ploidy in Thysanoptera are likely to yield valuable information on the evolution and diversity of thrips, as well as provide important comparisons to address broader evolutionary questions regarding the evolution of reproductive behavior, haplodiploidy, eusociality, virus transmission and invasion biology.

REFERENCES

Agrawal, A.A., Kobayashi, C., and Thaler, J.S. (1999) Influence of prey availability and induced host-plant resistance on omnivory by western flower thrips. Ecol. 80: 518-523.

Bournier, A. (1956) Contribution à l’etude de la parthènogenése des Thysanoptères et sa cytology. Arch. Zool. Exp. Gén. 93: 220-317.

Brito, R.O., Affonso, P.R.A.M., and Silva, J.C. Jr. (2010) Chromosomal diversity and phylogenetic inferences concerning thrips (Insecta, Thysanoptera) in a semi-arid region of Brazil. Gen. Mol. Res. 9: 2230-2238.

Brunner, P.C., Chatzivassiliou, E.K., Katis, N.I., and Frey, J.E. (2004) Host associated genetic differentiation in Thrips tabaci (Insecta: Thysanoptera), as determined from mtDNA sequence data. Heredity. 93: 364-370.

Cabrera-La Rosa, J.C. and Kennedy, G.G. (2007) Thrips tabaci and tomato spotted wilt virus: inheritance of vector competence. Entomol. Exp. App. 124: 161-166.

Crespi, B.J. (1992) Eusociality in Australian gall thrips. Nature 359: 724-726.

Crespo-López, M.E., Pala, I., Duarte, P.L., Dowling, T.E., and Coelho, M.M. (2007) Genetic structure of the diploid-polyploid fish Squalius alburnoides in southern Iberian basins Tejo and Guadiana, based on microsatellites. J. Fish Biol. 71: 426-436.

Ghiselli, F., Milani, L., Scali, V., and Passamonti M. (2007) The Leptynia hispanica species complex (Insecta Phasmida): polyploidy, parthenogenesis, hybridization and more. Mol. Ecol. 16: 4256-4268.

Gregory, T.R. (2012) Animal genome size database. http://www.genomesize.com

Grimaldi, D., Shmakov, A., and Fraser, N. (2004) Mesozoic thrips and early evolution of the order Thysanoptera (Insecta). J. Paleont. 78: 941-952.

Grimaldi, D.A., and Engel, M.S. (2005) Evolution of the insects. Cambridge University Press, Cambridge.

Hanrahan, S.J. and Johnson, J.S. (2011) New genome size estimates of 134 species of arthropods. Chromosome Res. 19: 809-823.

Hare, E.E. and Johnston, J.S. (2011) Genome size determination using flow cytometry of propidium iodide-stained nuclei. In Molecular Methods for Evolutionary Genetics. Series: Methods in Molecular Biology, Vol. 772 Orgogozo, Virginie; Rockman, Matthew V. (Eds.) 1st Edition, 470 pp.

Izzo, R.J., Pinent, S.M.J. and Mound, L.A. (2002) Aulacothrips dictyitus (Heterothripidae), the first ectoparasitic thrips (Thysanoptera). Fla. Entomol. 85: 281-283.

Jacobson, A.L. 2012. Tomato spotted wilt virus (TSWV) in North Carolina: characterizing the vector competence of Thrips tabaci and investigating the use of cyantraniliprole for reducing transmission of TSWV by Frankliniella fusca and Frankliniella occidentalis. Ph.D. Thesis, North Carolina State University.

Jakovlić, I. and Gui, J-F. (2011) Recent invasion and low level of divergence between diploid and triploid forms of Carassius auratus complex in Croatia. Genetica. 139: 789-804.

Jenser, G., Lipcsei, S., Szénási, A. and Hudák, K. (2006) Host range of the arrhenotokous populations of Thrips tabaci (Thysanoptera: Thripidae). Acta Phyopathologica et Entomologica Hungarica. 41: 297-303.

Kendall, D.M. and Capinera, J.L. (1990) Geographic and temporal variation in the sex ratio of onion thrips. Southwestern Entomol. 15: 80-88.

Kraaijeveld, K. (2010) Genome size and species diversification. Evol. Biol. 37: 227-233.

Kranz, B.D., Schwartz, M.P., Mound, L.A., and Crespi, B.J. (1999) Social biology and sex ratios of the eusocial gall-inducing thrips Kladothrips hamiltoni. Ecol. Entomol. 24: 432-442.

Leitch, I.J. and Bennett, M.D. (2004) Genome downsizing in polyploidy plants. Biol. J. Linn. Soc. 82: 651-663.

Loxdale, H.D. (2010) Rapid genetic changes in natural insect populations. Ecol. Entomol. (Suppl. 1) 35: 155-164.

Lundmark, M and Saura, A. (2006) Asexuality alone does not explain the success of clonal forms in insects with geographical parthenogenesis. Hereditas 143: 23-32.

Mabel, B.K., Alexandrou, M.A., and Taylor, M.I. (2011) Genome duplication in amphibians and fish: an extended synthesis. J. Zool. 284: 151-182.

Mine, M. and Walter, G.H. (1997) The significance of prey in the diet of the phytophagous thrips, Frankliniella schultzei. Ecol. Entomol. 22: 74-81.

Mine, M. and Walter, G.H. (1998) Significance of mite prey in the diet of onion thrips Thrips tabaci Lindeman (Thysanoptera: Thripidae). Aust. J. Entomol. 37: 120-124.

Mound, L.A. (2005) Thysanoptera (thrips) of the world - a checklist. http://www.ento.csiro.au/thysanoptera/worldthrips.php

Normark, B.B. (1996) Polyploidy of parthenogenetic Aramigus tessellatus (Say) (Coleoptera: Curculionidae). Coleopterists Bulletin 50: 73-79.

Pappu, H.R., Jones, R.A.C., and Jain, R.K. (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Res. 141: 219- 236.

Pomeyrol, R. (1929) La parthenogenesis dês thysanoptères. Bull Biol. Fr. Belg. 62: 3-12.

Prins, M., and Goldbach, R. (1998) The emerging problem of tospovirus infection and nonconventional methods of control. Trends in Microbiol. 6: 31-35.

Prussard-Radulesco, E. (1930) Recherches biologiques et cytologiques sur quelques thysanoptères. Ann. Epiphyties 16:103-188.

Risler, H. and Kempter, E. (1961) Die haploidie der männchen und die endopolyploidie en einigen geweben Haplothrips (Thysanoptera). Chromosoma 12: 351-361.

Robinson, G.E., Hackett, K.J., Brown, S.J., Edwards, O.R., Purcell-Miramontes, M., Evans, J.D., Goldsmith, M.R., Le, K., Lagerblad de Oliveira, P., Lawson, D., Niehuis, O., Okamuro, J., Robertson, H.M., and Tagu, D. (2012) i5K Insect and other arthropod sequencing initiative. http://arthropodgenomes.org/wiki/i5K

Schneider, M.V., Driessen, G., Beukeboom, L.W., Boll, R., van Eunen, K., Selzner, A., Talsma, J. and Lapchin, L. (2003) Gene flow between arrhenotokous and thelytokous populations of Venturia canescens (Hymenoptera). Heredity. 90: 260-267.

Shelton, A.M., Nault, B.A., Plate, J., and Zhao, J.-Z. (2003) Regional and temporal variation in susceptibility to λ-cyhalothrin in onion thrips, Thrips tabaci (Thysanoptera: Thripidae), in onion fields in New York. J. Econ. Entomol. 96: 1843-1848.

Whitfield, A.E., Ullman, D.E., and German, T.L. (2005) Tospovirus-thrips interactions. Annu. Rev. Phytopathol. 43: 459-489.

Table 1. Flow cytometry genome size estimates and ploidy determinations for three thrips species. Species Sex N1 Average 1C Standard Ploidy Genome Size Error Frankliniella occidentalis F 5 343.7 Mb 2.4 Diploid M 4 374.4 Mb 18.5 Haploid Frankliniella fusca F 5 409.8 Mb 4.9 Diploid M 1 392.0 Mb - Haploid Thrips tabaci – Iso-1 F 2 483.5 Mb 0.3 Tetraploid Thrips tabaci – Iso-2 F 3 480 Mb 2.0 Tetraploid Thrips tabaci – Iso-3 F 3 472 Mb 3.9 Tetraploid Thrips tabaci – Iso-4 F 2 470 Mb 0.6 Tetraploid Average T. tabaci tetraploid 10 476.3 Mb 3.3 Thrips tabaci – Iso-5 F 3 282.5 Mb 2.8 Diploid 1N is the number of individuals examined.

CHAPTER 3

The population genetic structure of North Carolina populations of Thrips tabaci

Abstract

The population genetic structure of Thrips tabaci individuals collected from four different locations in North Carolina was examined using mitochondrial cytochrome oxidase subunit one genetic markers (mtCOI) and microsatellite markers. Genetic divergence of mtCOI sequences, geographic structuring of populations, abundance and distribution of clonal groups, and the abundance and distribution of diploids and tetraploids among these populations were analyzed. Additionally, data obtained from a previous study on variation in transmission of Tomato spotted wilt virus (TSWV) among isofemale lines initiated with individuals used in this population genetic study were reanalyzed to examine the contribution of thrips genetic structure to variation in transmission using clonal assignments as one independent variable in a model describing variation in transmission efficiency of TSWV. Population genetic structure of T. tabaci in NC is discussed, along with the potential implications of population structuring on the role of T. tabaci as a vector of TSWV.

Introduction

Thrips tabaci Lindeman, is a polyphagous insect species reported to feed upon more than 300 plant species comprising more than 25 plant families, including many vegetable, fruit and field crops (Lewis 1997, Diaz-Montano et al. 2011). T. tabaci is also a vector of two important plant infecting Tospoviruses (Genus: Tospovirus Family: Bunyaviridae), Tomato spotted wilt virus (TSWV) and Iris yellow spot virus (IYSV). In nature tospoviruses are transmitted exclusively by only ten of approximately 7,400 described thrips species (Pappu et al. 2009). Worldwide, T. tabaci is the sole vector of IYSV, which is responsible for an estimated U.S. $60-90 million in onion crop losses in the western U.S. (Gent et al. 2006), and is one of ten reported thrips vectors of TSWV, estimated to cause over U.S. $1 billion in crop losses annually worldwide (Prins and Goldbach 1998, Pappu et al. 2009). T. tabaci was the first species reported to transmit TSWV and was believed to be the primary vector until transmission studies revealed that a large amount of variation exists in

its competence as a vector of TSWV. Brazilian and Canadian populations of T. tabaci did not transmit TSWV in transmission assays (Paliwal 1974, Paliwal 1976, Nagata et al. 2004), whereas in Europe both poor and efficiently transmitting populations are found, sometimes in the same area (Chatzivassiliou et al. 2002). Despite this variation T. tabaci is the primary vector of TSWV in tobacco and vegetable production systems, in Europe and Tasmania, respectively (Lemmetty and Lindquist 1993, Wilson 1997, Chatzivassiliou et al. 2002, Jenser et al. 2003, Chatzivassiliou 2008). In the USA T. tabaci is not reported as a primary vector of TSWV, however, both poor and efficiently transmitting populations have been observed (Cabrera LaRosa and Kennedy 2007). Variation in transmission efficiency by T. tabaci populations has long been attributed to the identification of sub-species groups that vary in their ability to transmit TSWV. In addition, these groups have been shown to exhibit different modes of parthenogenetic reproduction, and have different host ranges (Zawirska 1976, van de Wetering et al. 1999, Chatzivassiliou et al. 2002). Zawirska (1976) concluded there are two sub-species of T. tabaci, one exhibiting arrhenotokous parthenogenesis that is found on tobacco and capable of transmitting TSWV, the other exhibiting thelytokous parthenogenesis that is not found on tobacco and not capable of transmitting TSWV. Two recent studies examining mitochondrial cytochrome oxidase subunit one (mtCOI) sequence variation have provided evidence for at least three sub-species groups based on host plant (leek versus tobacco) (Brunner et al. 2004), or reproductive mode (male producing and thelytokous populations) (Toda and Murai 2007). It remains unknown whether or not ongoing gene flow occurs among these groups. Although inherent differences in the ability of different sub-species groups and their distributions can play an important role in TSWV disease epidemics the association of efficient transmitters, inefficient transmitters, and non-transmitters with T. tabaci subspecies is not clear. Poor and efficient transmission rates have been observed in both arrhenotokous and thelytokous populations collected from multiple host plants (Paliwal 1974, 1976, Wijkamp et al. 1995, Chatzivassiliou et al. 1999, 2002, Nagata et al. 2004, Cabrera La-Rosa and Kennedy 2007, Jacobson 2012 chapter 1) but no studies have directly compared transmission efficiency among T. tabaci individuals characterized by subspecies groups. Additionally, it has been

shown that a large amount of variation in transmission exists within purely inbred isofemale lines initiated from individual parthenogenetic females collected from the same location (Jacobson 2012 chapter 1). All of this suggests that defining T. tabaci as a TSWV vector by subspecies designation alone is not sufficient for understanding the potential of this vector in disease epidemics. Population-level differences, and, in asexually reproducing organisms clonal diversity, have also improved our understanding of virus transmission traits in insect populations (Bird et al. 1978, Tabachnik and Black 1995, Terradot et al. 1999, Símon et al. 2003, Tsetsarkin et al. 2007, De Barro et al. 2011,). The ability of T. tabaci to transmit TSWV was shown to be under genetic control and inherited as a recessive trait in a genetic backcross experiment between poor and efficiently transmitting populations (Cabrera-La Rosa and Kennedy 2007). If TSWV transmitting T. tabaci from previous studies are generalized based on host plant and reproductive mode, it would also appear that within each of the three T. tabaci subspecies groups vector genetics conferring ability to transmit isolates of TSWV exists. Additionally, there is evidence that efficient transmission of TSWV by T. tabaci is specific to certain isolate and thrips population combinations, and is more commonly observed when the tested TSWV isolate and thrips combinations were collected from the same location (Jacobson 2012 chapter 1). Because TSWV transmission is under genetic control, variable among populations, and possibly influenced by local virus-vector interactions (Chatzivassiliou et al. 2002, Stumpf and Kennedy 2005, 2007), a better understanding of T. tabaci as a vector of TSWV may be gained by examining the population genetic structure of this species. Understanding the population genetics of this species would also provide important information about breeding structure, the scale on which gene flow can occur, and whether or not gene flow occurs among different subspecies groups. The objectives of this study were to characterize the population genetic structure of T. tabaci collected from four different locations in North Carolina using mtCOI sequences and microsatellite markers. Isofemale lines established from parthenogenetically reproducing field collected females that were previously characterized for both reproductive mode type and their ability to transmit TSWV were used in this study (Jacobson 2012 chapter 1). In

addition to characterizing population structure, clonal assignments based on allele similarities of microsatellite loci were incorporated into statistical models describing the relationships between isolate and thrips to test for the significance of thrips clones in transmission efficiency. Based on previously observed variation in vector competence, it was hypothesized that NC populations of T. tabaci are geographically structured across the sampled region, and that clonal assignments may help explain TSWV transmission by T. tabaci.

Materials and Methods

Insect Collection Thrips tabaci individuals were collected from cultivated and weed plant hosts at different locations in North Carolina during May and June of 2010 (Table 1, Figure 1). Individuals from the only four field sites where at least eight individuals were collected were included in this study (Table 1). Field collected individuals were kept separate, and parthenogenetic females were used to establish 37 isofemale lines. The offspring of these females were then divided into three groups. One group of virgin females was used to characterize reproductive mode based on the sex of their offspring: parthenogenetically, thelytokous individuals produce only females, arrhenotokous individuals produce only males, and deuterotokous individuals produce males and females. The second subgroup was used in TSWV transmission assays (Jacobson 2012 chapter 1). The third group was stored at -20°C in 95% ethanol until they were used in this population genetic analysis. Therefore, the individuals included in this study include a subsample of individuals from parthenogenetic, isofemale lines previously characterized for their ability to transmit 2-4 isolates of TSWV collected from NC (Jacobson 2012 chapter 1). Twelve of these isofemale lines came from one of the four populations used in the genetic analysis. Infection rates in indicator leaf discs for this subgroup ranged from 0-45%. The majority of these individuals were thelytokous and high transmission rates were observed for both arrhenotokous and thelytokous isofemale lines. All isofemale lines were able to transmit at least one of the TSWV isolates. Isofemale lines were

reared in isolation from each other and no more than two generations separated the individuals used in the transmission study and the individuals used in the population genetic study.

DNA extraction and molecular screening The sex of thrips originating from an arrhenotokous female was determined visually under a compound light microscope and recorded for each individual before DNA extraction. Total genomic DNA was extracted from individual thrips using the DNeasy® Blood and Tissue Kit (QIAGEN, Valencia, CA) according to manufacturer’s instructions. DNA was eluted in 30µl of AE buffer.

Mitochondrial DNA sequencing and analysis From the sampled populations, a subset of individuals were amplified for a 629-bp fragment of the mitochondrial cytochrome oxidase I (COI) gene using primers LepF1 (5′- ATTCAACCAATCATAAAGATATTGG-3′) and LepR1 (5′- TAAACTTCTGGATGTCCAAAAAATCA-3′) (Hajibabaei et al. 2006, Hebert et al. 2004). Polymerase chain reactions (PCRs) were performed in 25 µl volumes containing: 1X PCR buffer, 2 mM MgCl2, 100 µM dNTPs, 3 pM of each primer, 0.5 U Taq DNA polymerase

(Bioline, Taunton, MA), 2 µl of DNA, and ddH2O to 25 µl. PCR cycling conditions were comprised of an initial denaturation stage of 1 min at 94°C, followed by 35 cycles each consisting of 1 min at 94°C, 1.5 min at 45°C, and 1.5 min at 72°C, with a final elongation step at 72°C for 5 minutes, carried out using a PTC-200 thermal cycler (MJ Research Inc.). PCR products were visualized on a 2.5% agarose gel to confirm samples contained a single band, and 5 µl of PCR product was subsequently purified using the ExoSAP-IT PCR purification kit (USB Corporation, OH, USA) and bidirectionally sequenced following the methodology outlined in Copren et al. (2005). Mitochondrial COI sequence alignments were performed using the Vector NTI Advance 10 program (Invitrogen, Carlsbad, CA). Phylogenetic relationships were examined using Molecular Evolutionary Genetics Analysis (MEGA), Version 4 (Tamura et al. 2007).

Neighbor-joining (NJ), UPGMA, and Minimum Evolution analyses in which all characters were equally weighted and 10,000 bootstrap replicated were conducted. Minimum spanning networks were also constructed to examine the evolutionary relationship between the mtDNA sequences using the program TCS 1.21 (Clement et al. 2000).

Microsatellite development and analysis From five T. tabaci specimens, selected from geographically distant sampling locations, DNA was extracted using the DNEasy Blood & Tissue kit (Qiagen, Valencia, CA). DNA quality and concentration from each specimen were determined using the BioSpec-nano spectrophotometer (Shimadzu Scientific Instruments, Columbia, MD). Pooled DNA from the five specimens was then subjected to shotgun sequencing using the Roche 454 Genome Sequencer FLX (Roche Applied Science, Penzberg, Germany) with the Titanium Sequencing kit XLR 70, performed at the Genomic Sequencing Laboratory located at the North Carolina State University. Sequencing was performed on a 1/16 GS-FLX PTP. A total of 97,611 reads were obtained with an average read length of 354 bp and a total of 34,514,909 bp. Using MSATCOMMANDER version 0.8.2 (Faircloth 2008), all unassembled sequences were screened for di-, tri-, and tetranucleotides using default settings within the program. Primers were designed using the PRIMER3 software (Rozen and Skaletsky 2000), implemented within the MSATCOMMANDER program, and tagged with a 19 base pair (bp) M13 forward label (CACGACGTTGTAAAACGAC). Amplification products were chosen to be within a 100 to 400 bp range (including M13 tag), with an optimal annealing temperature of 59oC (range 57oC – 63oC), an optimal GC content of ~ 50%, low levels of self- or pair-complementarity, and a maximum stability of 8.0 (Faircloth 2008). Following the removal of duplicate sequences, a total of 879 sequences were found to contain tandem repeats within the desired criteria with sufficient flanking region for primer design: 352 di-, 304 tri-, and 222 tetra-nucleotide microsatellites with at least 10, 5, and 5 repeats, respectively. Of these, 52 primer pairs were tested with 11 selected for microsatellite analysis (Table 2).

Primer pairs were optimized using 10 individual T. tabaci. PCRs were carried out in

12 μl total volumes, each containing 1 × PCR buffer, 1.75 mM MgCl2, 100 mM dNTPs, ~20 ng DNA template, 0.5U Apex Taq DNA polymerase (Genesee Scientific, San Diego, CA), and ddH2O to 12 μl. Primer concentration varied between 0.10 and 0.15µM (Table 2) with the forward primer end-labeled with an M13F-29/IRD700 or 800 IRDye tag (Li-Cor Inc., Lincoln, NE). PCR cycling conditions were comprised of an initial denaturation stage of 3 min at 95ºC, followed by 29 cycles consisting of 30 s denaturation at 95ºC, 30 s at optimal annealing temperature of 59ºC, and 30 s extension at 72ºC. Following PCR, 5 μl of stop solution (95% formamide, 20 mm EDTA, bromophenol blue) was added to each reaction. Reactions were subsequently denatured at 95ºC for 4 min prior to loading onto a 25 cm 6% polyacrylamide gel, using either 50 – 350 bp or 50 – 700 bp IRDye standards (Li-Cor Inc., Lincoln, NE) for accurate product sizing. Results were analyzed using the GeneProfiler software (Scanalytics, Inc., BD Biosciences Bioimaging, Rockville, MD). Clonality and polyploidy of NC T. tabaci populations had to be considered during microsatellite analyses. The T. tabaci individuals used in this study exhibited arrhenotoky and thelytoky, and females from NC were shown to be both diploid and tetraploid during microsatellite marker development for this project (Jacobson 2012 chapter 2). Ploidy could not be determined for the specific individuals included in this study because storage of the thrips in 95% ethanol was not compatible with flow cytometry methods used for ploidy determination. However, it was shown that the maximum number of alleles observed with the microsatellite markers used in this study did provide reliable estimates of ploidy (Jacobson 2012 chapter 2). The R program Polysat (Clark and Jasieniuk 2011) was used for analysis because it can handle samples of mixed ploidy, provides methods to estimate allele copy number in partial heterozygote polyploids, and calculates clonal diversity statistics. Ploidy estimates were generated based on maximum allele copy number. Female individuals exhibiting a maximum of two alleles across all loci were characterized as diploid and individuals with more than two bands at any locus were characterized as tetraploid. Males included in this study had a maximum of one allele per locus. Pairwise genetic Bruvo distances were then

calculated using the method described by Bruvo et al. (2004). This pairwise genetic distance matrix was then used to perform a principle component analysis (PCA) to examine population structuring by plotting the first two principle components. Groups of asexually related individuals were assigned to clonal groups using the Bruvo distance matrix. A distance measure of 0.2 was used for these assignments based on the histogram of the distribution of genetic Bruvo distances. Allele frequencies were then estimated using the simpleFreq function and pairwise FST values calculated based on the methods of Nei (1973).

Isolation by distance was also calculated based on pairwise FST and distance matrices in Genepop using the isolde suboption with a Mantel’s test with 1000 permutations, log transformations of distance and F/(F-1)-statistics (Raymond and Rousset 1995).

Population Structure and TSWV Transmission A previous TSWV transmission study conducted with individuals from the same isofemale line showed that isolate, isofemale line and their interaction were statistically significant effects describing the probability of successful transmission of TSWV (Jacobson 2012 chapter 1). Additionally, higher transmission rates were seen among sympatric TSWV isolate-isofemale lines (collected from the same location) versus allopatric TSWV isolate- isofemale lines (collected from different locations). These results indicate that both viral and thrips genetic components underlie successful transmission of TSWV by T. tabaci, and suggest that local adaptation may be occurring between TSWV isolates and thrips. To further investigate the virus-vector relationship between TSWV isolates and T. tabaci, the analysis of TSWV transmission was re-run using 12 isofemale lines that came from one of the four populations used in the genetic analysis individuals for which both clonal assignments and TSWV transmission data were available, along with two additional isofemale lines, one from Kinston, NC and one from Cove City, NC, for which transmission and microsatellite clone assignment information was available. Not enough transmission data were available for the Fletcher isofemale line to include it in this analysis. Models were run using Proc Glimmix (SAS Institute, Cary, NC). The mtCOI haplotypes were not included in this analysis because not enough data were available for arrhenotokous individuals to make a proper comparison.

Results

Genetic Analysis NJ, UPGMA, and Minimum Evolution phylogenetic methods employed in MEGA produced identical tree topologies (Figure 2). The individuals in these populations were subdivided into two groups that corresponded with their reproductive mode. Group one was comprised of all of the thelytokous individuals and group two was comprised of the arrhenotokous individuals. Within group sequence divergence estimates for groups one and two were 0.23% (±0.10%) and 0.16% (±0.08%), respectively. Overall mean sequence divergence estimates among samples were 1.74% (±0.36%), whereas between group mean sequence divergence was 3.42% (±0.72%). Minimum spanning networks generated with TCS produces two main subdivisions between thelytokous and arrhenotokous individuals (Figure 3). The thelytokous individuals cluster together and are connected to each other by a maximum of six mutational steps. The arrhenotokous individuals also cluster together and are connected to each other by a maximum of 4 mutational steps. Arrhenotokous and thelytokous individuals, however, are separated by a minimum of 18 mutational steps, which supports the results from the phylogenetic analysis, and the previous analysis of Brunner et al. (2004) that shows a sufficientlylarge amount of genetic variation to suggest these groups represent different subspecies or biotypes.

Population Genetic Analysis All of the individuals collected from Apex, Jackson Springs, and Faison exhibited thelytokous parthenogenesis, and all of the individuals from Fletcher exhibited arrhenotokous parthenogenesis. A total of 17 clonal groups were identified from these four populations (Table 1). No arrhenotokous individual belonged to the same clonal group as a thelytokous individual, and both diploid and tetraploid individuals were found in the same clonal groups. Both diploid and tetraploid females were found in Faison, Jackson Springs and Fletcher collection sites, whereas only tetraploids were collected from Apex. Males from Fletcher

included in the study appeared to be haploid, however, ploidy has not formally been determined for male T. tabaci. Mean allelic richness was 4 alleles/loci, and ranged from 3-6 when analyzed per locus and per population. The principle component analysis conducted on the first two principle components of the genetic distance matrix calculated with the Bruvo distance measure (Figure 4), pairwise

FST (Table 3) and clonal assignments (Table 1) all suggest that populations are geographically structured across NC and that migration of individuals occurs among some of the locations. Individuals from Fletcher form 10 unique clonal groups that cluster together in the PCA analysis, and appear to be genetically isolated from the other populations. Three different clonal groups were identified from Apex, and form a tight cluster with each other and separate from the other populations, with the exception of one individual. Individuals from Faison, four individuals from Jackson Springs, and one individual from Apex cluster as a group and belong to the same clonal assignment. The remaining individuals from Jackson

Springs form a loose cluster comprised of individuals from three clonal groups. Pairwise FST values are also higher between populations that do not cluster close together in the PCA analysis, which supports the overall pattern of geographic structuring (Table 3). Although neighboring populations appear to be more genetically similar to each other than geographically distant ones in the PCA, the test for isolation by distance was not significant (r2=0.2441, P=0.1970) (Figure 5).

Population Structure and TSWV Transmission The probability of TSWV transmission based on the variables ‘virus isolate‘, ‘isofemale line’ and ‘sympatry’ was re-analyzed to further investigate the role of thrips genetic components in the transmission of TSWV by including genetic variables for clonal group calculated from microsatellite marker data. First, previously used statistical models were re- run on the subsample of isofemale lines that were included in the population genetic analysis (Jacobson 2012 chapter 1). These analyses showed that the main effect of ‘isofemale line’ (P=0.0552) was not significant, but ‘virus isolate’ (P<0.0001), and the interaction term, ‘isofemale line x virus isolate’ (P=0.0070), were statistically significant with this subgroup.

When the variable ‘sympatry’, replaced the interaction term in this model to investigate whether this interaction was significant among virus isolates and thrips isofemale lines that occur in the same location, ‘virus isolate’ (P<0.0001) and ‘isofemale line’ (P<0.0001) were significant, but ‘sympatry’ (P=0.4436) was not significant. When ‘isofemale line’ was replaced with ‘clone assignment’ as the variable to model thrips role in transmission, ‘clone assignment’ (P<0.0001) and ‘virus isolate’ (P<0.0001) were significant main effects, but ‘sympatry’ was not (P=0.9577). When ‘clone assignment’ (P <0.0001), ‘virus isolate’ (P <0.0001) and their interaction term (p=0.0399) were included in the model, however, all three terms were statistically significant. These results highlight the importance of interactions between specific T. tabaci clonal types and specific TSWV isolates underlying transmission of TSWV by T. tabaci.

Discussion

The first objective of this study was to characterize the population genetic structure of T. tabaci collected from four different locations in NC using mtCOI sequences and microsatellite markers. The results of the mtCOI sequence analysis supports previous evidence for the existence of subspecies or biotype groups within this species (Brunner et al. 2004, Toda and Murai 2007), and shows that two genetically distinct groups are present in NC (Figure 2). The minimum spanning haplotype networks also show strong differentiation between reproductive types (Figure 3) and support the results of the phylogenetic analysis. This is the first study to examine the population genetic structuring of T. tabaci populations using microsatellite markers. Microsatellite markers revealed genetic structure among the four NC populations that corresponded to geographic locations where the populations were collected. Pairwise FST values ranged from 0.06-0.20 indicating moderate genetic differentiation between all populations (Table 3). The PCA and clonal assignments suggest that arrhenotokous and thelytokous populations are reproductively isolated from each other because arrhenotokous and thelytokous populations do not cluster together or share clonal types. Isolation by distance, however, was not significant among these populations

(Figure 5). These results could be due to a small population sample size, and could also be confounded by another geographic barrier. North Carolina is comprised of three geographic regions that vary in climate and topography, the mountains, the piedmont and the coastal region. Clonal admixture only occurred among the three thelytokous populations that were collected in the central piedmont and coastal region. These three populations were separated by 142 km or less, suggesting that dispersal occurs at this distance. The arrhenotokous population was collected in a field located in the Appalachian Mountains, therefore, two potential geographic barriers to dispersal and gene flow exist between the thelytokous and arrhenotokous populations: the mountains, and the 261-402 km distance that separate them. Additional studies of population structure should be conducted where thelytokous and arrhenotokous individuals coexist to further investigate breeding structure of local populations and the potential for interbreeding between different species groups. The discovery of polyploidy in T. tabaci populations during microsatellite marker development was unexpected, and is the first report of polyploidy in Thysanoptera (Jacobson 2012 chapter 2). Because of this, our sample collection, storage, and processing methodology only allowed for the determination of ploidy and allele dosage in these populations using estimation methods. Based on these methods, all populations sampled contained tetraploid individuals, and three of the populations were comprised of both diploid and tetraploid individuals. Polyploidy, although rare, is commonly associated with asexually reproducing organisms. Both clonality and polyploidy have been thought to contribute to the successful spread and establishment of individuals into new habitats. Geographical parthenogenesis is a term coined to describe the observation that asexual individuals of a species tend to be better able to establish themselves in marginal habitats (Vandel 1928). Research examining the effects of both clonality and polyploidy among arthropods showed that in some species the abundance and distribution of clones is better described when geographic patterns of polyploidy are examined alone, or with geographical parthenogenesis (Lundmark and Saura 2006). Thelytokous T. tabaci are more common worldwide; males and arrhenotokous populations are rarely reported in the literature, and nothing is known about the abundance and distribution of polyploids. Although this genetic analysis does not suggest that genetic

structuring occurs as a result of polyploidy in the NC populations samples, tetraploidy was almost twice as common in these populations, and may be contributing to the successful establishment of clones in some areas. More research is needed to address questions regarding the presence and distribution of polyploidy, and what it means in terms of variation in physiology, reproductive biology, population structure, genetic diversity, adaptation, clonal radiation, and the propagation and expression of economically important traits. The premise of this study to relate T. tabaci population structure to transmission efficiency of TSWV was born from observations that thrips and TSWV isolate, when grouped by location, were both significant explanatory variables in accounting for variation in the probability of TSWV transmission, and that on average transmission rates were higher among sympatric TSWV isolate-thrips pairings. Investigating the probability of TSWV transmission by T. tabaci in relation to a specific ‘clonal assignment’ variable that uses the genetics of individual thrips, rather than using general population definitions such as ‘isofemale line’ that groups thrips transmission phenotypes based on where they were collected, revealed different, yet related, thrips tospovirus interactions. These interactions offer insights into the localized importance of this species as a vector of TSWV. While population level dynamics may be playing a role in local adaptation between TSWV and T. tabaci, suggested by the significance of sympatry in earlier models, ultimately, the interaction of specific thrips genotypes with specific virus isolates appears to be a more important factor underlying transmission of TSWV by T. tabaci. Therefore, when assessing the importance of T. tabaci as a vector of TSWV, efficient transmission more likely depends on specific genotypic interactions between thrips clonal groups and virus isolates than by subspecies group or reproductive mode type. However, subspecies group, reproductive mode, and other life history traits affecting the fitness of these individuals will influence the abundance and distribution of efficient vectors through time and space. A better understanding of thrips population biology and the abundance and distribution of subspecies and clonal groups would augment our understanding of thrips population dynamics and may help to explain patterns of intra-and inter-population variation of economically important traits.

REFERENCES

Bird J., Maramorosch K. (1978) Viruses and virus diseases associated with whiteflies. Adv. Virus Res. 22:55–110

Brunner, P.C., Chatzivassiliou, E.K., Katis, N.I., and Frey, J.E. (2004) Host associated genetic differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined from mtDNA sequence data. Heredity. 93: 364-370.

Bruvo, R., Michiels, N.K., D’Souza, T.G., and Schulenburg, H. (2004) A simple method for the calculation of microsatellite genotype distances irrespective of ploidy level. Mol. Ecol. 13: 2101-2106.

Cabrera-LaRosa, J.C. and Kennedy, G.G. (2007) Thrips tabaci and Tomato spotted wilt virus: inheritance of vector competence. Entomol. Expt Appl. 124: 161-166.

Chatzivassiliou, E. K., Nagata, T., Peters, D., and Katis, N. I. (1999) The transmission of tomato spotted wilt tospovirus (TSWV) by Thrips tabaci Lind. (Thysanoptera: Thripidae) populations originating from leek. Plant Pathol. 48: 700-706

Clark, L.V. and Jasieniuk, M. (2011) POLYSAT: an R package for polyploidy microsatellite analysis. Mol. Ecol. Resour. 11: 562-566.

Clement M, Posada D, Crandall KA (2000) TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9: 1657–1659.

Copren K.A., Nelson, L.J., Vargo, E.L., Haverty, M.I. (2005) Phylogenetic analyses of mtDNA sequences corroborate taxonomic designations based on cuticular hydrocarbons in subterranean termites. Mol. Phylogenet. Evol. 35: 689–700.

De Barro. P,J,, Liu. S-.S., Boykin, L.M. and Dinsdale, A.B. (2011) Bemisis tabaci: A statement of species status. Annu. Rev. Entomol. 56: 1-19.

Diaz-Montano, J., Fuchs, M., Nault, B.A., Fail, J. and Shelton, A.M. (2011) Onion thrips (Thysanoptera: Thripidae): a global pest of increasing concern in onion. J. Econ. Entomol. 104: 1-13.

Faircloth, B. C. (2008) MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specifc primer design. Mol. Ecol. Resour. 8: 92-94.

Gent, D.H., du Toit, L.J., Fichtner, S.F., Mohan, S.K., Pappu, H.R., and Schwartz, H.F. (2006) Iris yellow spot virus: an emerging threat to onion bulb and seed production. Plant Dis. 90: 1468-1480.

Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., and Hebert, P.D.N. (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proc. Natl. Acad. Sci. USA. 103: 968– 971.

Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H., and Hallwachs, W. (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. USA. 101: 14812–14817.

Lemmetty, A., and Lindqvist, I. (1993) Thrips tabaci (Lind.) (Thysanoptera: Thripidae), another vector for tomato spotted wilt virus in Finland. Agric. Sci. Finl. 2:189-194.

Lewis T (ed.). (1997) Thrips as Crop Pests. CABI, Wallingford, UK.

Lundmark, M and Saura, A. (2006) Asexuality alone does not explain the success of clonal forms in insects with geographical parthenogenesis. Hereditas 143: 23-32.

Nagata, T., Almeida, A.C.L., Resende, R. de O., and de Avila, A.C. (2004) The competence of four thrips species to transmit and replicate four tospoviruses. Plant Pathol. 53: 136-140.

Nei, M. (1973) Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. U. S. A. 70: 3321-3323.

Pappu, H.R., Jones, R.A.C., and Jain, R.K. (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes and challenges ahead. Virus Res. 141: 219-236.

Paliwal, Y.C. (1974) Some properties and thrips transmission of tomato spotted wilt virus in Canada. Can. J. Bot. 52: 1177-82.

Paliwal, Y.C. (1976) Some characteristics of the thrips vector relationships of tomato spotted wilt virus in Canada. Can. J. Bot. 54: 402-405.

Prins, M., and Goldbach, R. (1998). The emerging problem of tospovirus infection and nonconventional methods of control. Trends in Microbiol. 6: 31-35.

Raymond, M., and Rousset, F. (1995) GENEPOP Version 1.2: population genetics software for exact tests and ecumenicism. J. Heredity. 86: 248-249.

Rozen, S., and Skaletsky, H. (2000) Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology. 132: 365-386.

Stumpf, C.F., and Kennedy, G.G. (2005) Effects of tomato spotted wilt virus (TSWV) isolates, host plants, and temperature on survival, size, and development time of Frankliniella fusca. Entomol. Exp. Appl. 114: 215-225.

Stumpf, C.F., and Kennedy G.G. (2007) Effects of Tomato spotted wilt virus isolates, host plants, and temperature on survival, size and development of Frankliniella occidentalis. Entomol. Exp. Appl. 123: 139-147.

Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24: 1596–1599.

Terradot, L., Simon, J.-C., Leterme, N., Bourdin, D., Wilson, A.C.C., Ǵauthier, J.-P., and Robert, Y. (1999) Molecular characterization of clones of the Myzus persicae complex (Hemiptera: Aphididae) differing in their ability to transmit the potato leafroll luteovirus (PLRV). Bull. Entomol. Res. 89: 355-363.

Toda, S. and Murai, T. (2007) Phylogenetic analysis based on mitochondrial COI gene sequences in Thrips tabaci Lindeman (Thysanoptera: Thripidae) in relation to reproductive forms and geographic distribution. Appl. Entomol. Zool. 42: 309-316.

Tsetsarkin, K.A., Vanlandingham, D.L., McGee, C.E., and Higgs, S. (2007) Mutation in Chikungunya virus affects vector specificity and epidemic potential. PLoS Patholg. 3(12): 1168. van de Wetering, F., van der Hoek, M., Goldbach, R., Mollema, C., and Peters, D. (1999) Variation in tospovirus transmission between populations of Frankliniella occidentalis (Thysanoptera: Thripidae). Bull. Entomol. Res. 89:579-588.

Vandel, A. (1928) La parthénogénèse geographique. Contribution à l’étude biologique et cytologique de la parthénèse naturelle. Bull. Biol. France Belg. 62: 164-281.

Wijkamp, I., Almarza, N., Goldbach, R., and Peters, D. (1995) Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathol. 85: 1069-1074.

Wilson, C.R. (1997) Incidence of weed reservoirs and vectors of tomato spotted wilt tospovirus on southern Tasmanian lettuce farms. Plant Pathol. 47: 171-176.

Zawirska, I. (1976) Untersuchungen uber zwei biologische Typen von Thrips tabaci Lind. (Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopath. Plant Prot. 12: 411-422.

Figure 1. Map of North Carolina collection sites for the four Thrips tabaci populations that were used in the population genetic study.

Figure 2. Phylogenetic tree constructed from mitochondrial DNA sequences from four North Carolina T. tabaci populations using the Neighbor-joining method. Nonparametric bootstrap values are shown above branches.

Figure 3. Minimum spanning network calculated with mitochondrial COI sequences using TCS 1.2 1. Haplotypes of thelytokous and arrhenotokous North Carolina Thrips tabaci are shown in grey and white, respectively. Boxes grouping haplotypes indicate networks identified with 90% probability of parsimony.

Figure 4. Principle component analysis of the two primary components of pairwise genetic distances calculated for four North Carolina populations of T. tabaci at 12 microsatellite loci using distance methods of Bruvo et al. (2004).

0.3

0.25

0.2

y = 0.052x - 0.1171 Fst)

- r² = 0.2441 0.15

P = 0.1970 Fst/(1 0.1

0.05

0 0 1 2 3 4 5 6 7 ln[Distance (km)]

Figure 5. Scatter plot of transformed pairwise FST values and pairwise geographic distances between NC populations of T. tabaci with regression line, R2 value and P value from a Mantel’s test for isolation by distance.

Table 1. Thrips tabaci samples collection information. Isofemale Reproductive Clonal Location Host Plant Ploidy Line Mode Assignment* Apex-1 Apex, NC Allium cepa L. Thelytokous 4 1 Apex-2 Apex, NC Allium cepa L. Thelytokous 4 2 Apex-4 Apex, NC Allium cepa L. Thelytokous 4 4 Apex-6 Apex, NC Allium cepa L. Thelytokous 4 2 Apex-10 Apex, NC Allium cepa L. Thelytokous 4 2 Apex-11 Apex, NC Allium cepa L. Thelytokous 4 2 Apex-14 Apex, NC Allium cepa L. Thelytokous 4 3 Apex-16 Apex, NC Allium cepa L. Thelytokous 4 2 Cot1-2 Faison, NC Raphanus raphanistrum Thelytokous 4 1 Cot1-3 Faison, NC Raphanus raphanistrum Thelytokous 4 1 Cot1-4 Faison, NC Raphanus raphanistrum Thelytokous 4 1 Cot1-5 Faison, NC Raphanus raphanistrum Thelytokous 2 1 Cot1-6 Faison, NC Allium cepa L. Thelytokous 4 1 Cot1-8 Faison, NC Brassica oleracea L. Thelytokous 4 1 Cot1-10 Faison, NC Brassica oleracea L. Thelytokous 4 1 Cot2-1 Faison, NC Raphanus raphanistrum Thelytokous 4 1

Table 1. Continued Cot2-2 Faison, NC Allium spp. Thelytokous 2 1 Cot2-4 Faison, NC Allium cepa L. Thelytokous 2 1 MHC1 Fletcher, NC Allium cepa L. Arrhenotokous 1 17 MHC2 Fletcher, NC Allium cepa L. Arrhenotokous 2 16 MHC7 Fletcher, NC Allium cepa L. Arrhenotokous 2 6 MHC8 Fletcher, NC Allium cepa L. Arrhenotokous 2 7 MHC9 Fletcher, NC Allium cepa L. Arrhenotokous 4 8 MHC11 Fletcher, NC Allium cepa L. Arrhenotokous 2 12 MHC19 Fletcher, NC Allium cepa L. Arrhenotokous 2 8 MHC33 Fletcher, NC Allium cepa L. Arrhenotokous 2 13 MHC41 Fletcher, NC Allium cepa L. Arrhenotokous 1 5 MHC53 Fletcher, NC Allium cepa L. Arrhenotokous 4 15 SH2 Jackson Springs, NC Brassica spp. Thelytokous 4 1 SH10 Jackson Springs, NC Brassica spp. Thelytokous 4 9 SH28 Jackson Springs, NC Brassica spp. Thelytokous 4 10 SH30 Jackson Springs, NC Brassica spp. Thelytokous 2 1 SH45 Jackson Springs, NC Brassica spp. Thelytokous 2 1 SH63 Jackson Springs, NC Allium spp. Thelytokous 4 14

Table 1. Continued SH68 Jackson Springs, NC Allium spp. Thelytokous 4 9 SH72 Jackson Springs, NC Raphanus sativus var. Thelytokous 2 9 longipinnatus SH75 Jackson Springs, NC Brassica spp. Thelytokous 4 10 *Based on microsatellite marker data

Table 2. Microsatellite loci primer information.

Locus Primer sequences (5' - 3') Repeat µM Allele size motif each range (bp) primer T.tab-6 F: CACGCAAAACACTCTCTCCA (ACAG)11 0.11 172-261 R: AGTGGCGTCTGTGTTGAGAA 0.11 T.tab-20 F: ACCGGAAGCTTTCAAATCG (AGCC)9 0.11 117-257 R: AATAAACCGTCGCGGAGACT 0.11 T.tab-24 F: GTAGAGCAGCACCGATAGGG (AAC)10 0.10 294-320 R: CAGCCAGGACAACAGAGTGA 0.10 T.tab-27 F: AAGGTCAGGCATTGCGTTAT (AAC)8 0.10 312-343 R: TACAAAGCGAGGACTCAGCA 0.10 T.tab-29 F: TTCATTTTGCAGTGGCAACTAT (AAT)13 0.10 273-296 R: GAGTCTGCGTCGTGGATATG 0.10 T.tab-33 F: TCGTGGCATGACTCAAACG (AC)12 0.10 150-184 R: CCTCGGAACAAGGAGCCAG 0.10 T.tab-34 F: TTTGCTGTCCCTCGAAGCG (AC)12 0.10 139-168 R: CGATTCCATGTTTGTCTAAGAGTCC 0.10 T.tab-43 F: GCTCCCGCACCAGAGAATTAC (AC)14 0.10 143-171 R: ACGTTCCTTTGGAGTTCCAGC 0.10 T.tab-47 F: TTCCTCGCGTGCCCTATG (AC)15 0.15 212-234 R: GTCGTGTAGCTGGAAGTGC 0.15 T.tab-48 TCGAACGGCTGGTGTGAAG (AC)16 0.10 192-227 GCGACCATTCGCGGTTC 0.10 T.tab-49 F: CGGACATGCGACATTCACC (AC)17 0.10 276-304 R: CGGAATTCGGAGCGAGCC 0.10

Table 3. Pairwise FST and pairwise distances (km) between four NC populations of T. tabaci*.

Pairwise FST Apex Faison Fletcher JacksonSprings Apex 0.00 Faison 0.17 0.00 Fletcher 0.14 0.20 0.00 JacksonSprings 0.09 0.06 0.13 0.00

Pairwise Distance (km) Apex Faison Fletcher JacksonSprings Apex 0.00 Faison 96.00 0.00 Fletcher 332.00 402.00 0.00 JacksonSprings 90.00 142.00 261.00 0.00 *Reproductive modes: Thelytokous – Apex, Faison, Jackson Springs; Arrhenotokous – Fletcher

A.L. Jacobson and G.G. Kennedy Published in Crop Protection, Vol. 30(4): 512-515

CHAPTER 4

The effect of three rates of cyantraniliprole on the transmission of tomato spotted wilt virus

by Frankliniella occidentals and F. fusca (Thysanoptera: Thripidae) to Capsicum annuum.

Abstract: Tomato spotted wilt virus (TSWV) is a thrips transmitted virus that causes major losses in many crops worldwide. Management of TSWV is complex, requiring multiple preventive measures. Currently, there are few chemical options that control thrips populations before they feed upon and transmit TSWV to crop plants. Cyantraniliprole

(Cyazypyr™) is an anthranilic diamide insecticide currently under development that exhibits anti-feedant properties. Transmission of TSWV by Frankliniella fusca (Hinds) to Capsicum annuum L. seedlings was reduced in plants treated with Cyazypyr™ applied to the soil at the rates of 1.45, 2.90 and 4.41 mg ai/plant. Mortality of F. fusca at 3 days post treatment did not differ significantly on excised foliage of Cyazypyr™ treated and control plants, but feeding injury was significantly less on treated foliage. Transmission of TSWV by

Frankliniella occidentalis (Pergande) was not reduced in plants treated with 4.41 mg ai/plant.

Keywords: anthranilic diamide; cyantraniliprole; antifeedant; thrips; vector.

1. Introduction

Tomato spotted wilt virus (TSWV) is a thrips-transmitted plant virus capable of causing losses of up to 100% in susceptible crops, which include Capsicum annuum L., Lypersicon esculentum L., Nicotiana tabacum L. and Arachis hypogaea L. (Kucharek et al., 2000;

Rosello et al., 1996). At least eight species of thrips have been reported to transmit TSWV, however, in the Southeastern U.S. the primary vectors are Frankliniella fusca (Hinds) and

Frankliniella occidentalis (Pergande) (Eckel et al., 1996; McPherson et al., 1999; Whitfield et al., 2005).

Thrips vectors transmit TSWV in a persistent, propagative manner, and can infect a plant in as little as 5-10 minutes of feeding (Chatzivassiliou, 2005; Wijkamp et al., 1996).

The short inoculation access period makes management of TSWV difficult because most insecticides do not kill or debilitate the thrips vector before virus transmission occurs. The only chemical management options that currently exist include the use of imidacloprid, a neonicotinoid insecticide that alters the feeding behavior of thrips (Groves et al., 2001; Joost and Riley, 2005), acibenzolar-S-methyl, a plant protectant that induces systemic acquired resistance in the plant (Mandal et al., 2008), or phorate, which is believed to induce a plant defense response (Csinos et al., 2001; Groves et al., 2001; Herbert et al., 2007; Riley and

Pappu, 2004). These chemicals, however, reduce virus incidence only when applications are timed properly, and their effectiveness is not equal in all TSWV susceptible crops.

Additional chemistries for TSWV management are desirable because so few options currently exist.

The anthranilic diamide insecticides are a new class of insecticides with a novel mode of action targeting the ryanodine receptors in insect muscle cells (IRAC mode of action classification, group 28) (IRAC, 2007; Sattelle et al., 2008). This group of insecticides possesses antifeedant properties that differ between chemicals and insects (Gonzales-Coloma et al., 1999). Chlorantraniliprole (Rynaxypyr™), the first commercially available anthranilic diamide, registered for use in the USA in 2008, exhibits antifeedant activity against chewing insects (DuPont, 2007). Cyantraniliprole (Cyazypyr™), a new anthranilic diamide currently

under development to control lepidopteran and sucking insects, is reported to be active against a broader spectrum of insects than chlorantraniliprole (Burt and Karr, 2008; PAN,

2008; Sattelle et al., 2008). If Cyazypyr™ acts like other insecticides in this class and causes rapid cessation of feeding in affected organisms, it may decrease transmission of insect- transmitted viruses, including TSWV. In this study the incidence of TSWV transmission by

F. fusca and F. occidentalis to C. annuum seedlings treated with Cyazypyr™ was evaluated.

Additionally, antifeedant properties were investigated by comparing feeding injury and mortality of F. fusca on C. annuum leaves excised from plants treated with Cyazypyr™ and from water-treated plants.

2. Materials and Methods

2.1. Laboratory Maintained Insect Colonies and TSWV Isolates

Colonies of F. fusca and F. occidentalis were maintained on Phaseolus vulgaris L. bean pods in controlled environments at 24 °C with ca. 60% RH and continuous light

(Loomans and Murai, 1997). Viruliferous adults of both species were obtained by placing newly emerged (0-6 hours old), first instars onto TSWV-infected Emilia sonchifolia L. leaves. After 72 hours, the larvae were transferred to 474 ml clear plastic cups (Reynolds

Food Packaging, Richmond, VA) covered with thrips-proof screen (Midwest Filter

Corporation, Elkhart, IN), and were reared to adults on uninfected bean pods (Wijamp et al.,

1995). The TSWV isolate used in these experiments was collected from L. esculentum in

Montgomery County, NC in 2006 and maintained in the greenhouse in E. sonchifolia by transmission with F. fusca.

2.2. Effect of Cyazypyr™ on the Transmission of TSWV

Capsicum annuum seeds were germinated in a thrips and TSWV-free greenhouse.

Four true-leaf stage plants were transplanted to individual 296 ml plastic cups (Solo Cup

Company, Lake Forest, IL) with a 25 mm diameter, round, fine mesh screen on the bottom.

After transplant, 50 ml of insecticide solution or water was applied to the soil of each cup.

Cyazypyr™ SE was tested at three rates: 1.45, 2.90 and 4.41 mg ai per plant; the latter two rates are within a range tested previously in field trials targeting other insect pests of pepper.

Water was used as the control. Each rate of Cyazypyr™ was tested against a control in separate experiments. The highest rate was tested first against both F. fusca and F. occidentalis in separate experiments. Because transmission by F. occidentalis was not affected at the highest rate, the lower rates were tested only on F. fusca. Each experiment was conducted as a randomized complete block design with 4 replications and 10-18 plants per treatment per replicate, depending on availability of adult thrips.

Forty eight hours after the plants had been treated, 5 randomly selected, potentially viruliferous adult thrips were released onto each C. annuum seedling (Wijkamp et al., 1995).

Adults were transferred by placing 5 adults into a 1.5 ml Fisherbrand® microcentrifuge tube

(Fisher Scientific, Pittsburgh, PA) with a paintbrush, and then opening the tube and placing it at the base of the plant. Thrips were contained on the seedling by inverting a plastic cup with

screened bottom over the seedling, and sealing it to the cup containing the plant using parafilm®. Plants were maintained under constant lights at room temperature (25-30 °C).

Foliar applications of Spintor®, SC (Dow AgroSciences LLC, Indianapolis, IN) were made at a rate of 0.022 ml per plant 4 days later to kill the viruliferous adults, and subsequent applications were made 4 and 8 days after the first application to kill any larvae that may have hatched from eggs laid by the adults. On day 8, C. annuum seedlings were transplanted to 102 mm clay pots and maintained in the greenhouse at 18.9 - 36 °C (average low and high temperatures) until they were tested for TSWV.

TSWV infection was confirmed by DAS-ELISA using antisera to the nucleocapsid protein (Agdia Inc., Elkhart, IN), according to manufacturer’s instructions. The first ELISA was conducted 14 days after adults were placed onto plants to confirm early developing infections before early infected seedlings died. At 21-28 days, a second ELISA was conducted on all plants not testing positive in the first ELISA. Optical density readings were made with a THERMOmax® microtiter plate reader (Molecular Devices Corp., Menlo Park,

CA, USA) at 405 nm and were considered positive if the optical density reading was greater than the mean +4 standard deviations of the optical density readings of the non-infected controls on each plate.

Each experiment was analyzed separately using the logistic procedure in SAS (SAS

Institute Inc. 2005) to compare transmission to Cyazypyr™ treated plants with that to untreated control plants. Hosmer and Lemeshow goodness-of-fit values calculated for the logistic regression models were used to determine how well the data fit the calculated model.

Odds ratios comparing the likelihood of TSWV transmission in the control versus the

Cyazypyr™ treatment were tested using Wald Chi Square to determine if the two treatments differed significantly (i.e. odds ratio differed from one) (Davies et al., 1998).

Because the different rates of Cyazypyr™ were tested against water treated controls in separate experiments, a combined analysis of all data was conducted as an incomplete block design using the logistic procedure in SAS to test for significant treatment effects after accounting for effects of block and experiment on transmission rates. Hosmer and Lemeshow goodness-of-fit values were calculated to test significance of the logistic regression model.

Contrast statements were used to conduct pair-wise comparisons between treatments using

Wald Chi Square tests of odds ratios.

2.3. Feeding Damage and Mortality Assessment

An additional experiment was conducted to assess whether F. fusca produced fewer feeding scars and sustained higher mortality on foliage of plants treated with Cyazypyr™ than on foliage of control plants. Forty-eight hours after treatment, whole leaves of approximately the same size were removed from 5 water-treated and 5 C. annuum seedlings treated with 4.41 mg ai Cyazypyr™/plant and placed individually into 50 x 9 mm BD

Falcon™ tight fit Petri dish (BD Biosciences, San Jose, CA) lined with moist filter paper.

Ten adult F. fusca were placed in each Petri dish. Mortality was assessed after three days by counting dead and living adults in each Petri dish. Antifeedant effects were assessed by visually examining the abaxial and adaxial surfaces of each leaf under a dissecting microscope and estimating the percentage of total leaf surface area that was scarred by thrips

feeding. Each experiment contained five replicates of each treatment, and experiments were repeated four times. Feeding damage and mortality were compared using SAS one-sided t- test procedures (SAS Institute Inc., Cary, NC) to test the hypotheses that feeding injury was less and mortality greater on Cyazypyr™ treated plants.

3. Results and Discussion

Soil applications of Cyazypyr™ applied at 1.45, 2.90 and 4.41 mg ai per plant to C. annuum seedlings significantly reduced the transmission of TSWV by F. fusca when compared to the water-treated control (Table 1). The odds of TSWV transmission to water- treated pepper plants were ca. 19 times greater than to plants treated with Cyazypyr™ at 4.41 mg ai per plant. In experiments testing lower rates of Cyazypyr™, TSWV transmission to control plants was 2.5 and 2.7 times more likely than to plants treated with Cyazypyr™ at

2.90 and 1.45 mg ai per plant, respectively. Transmission of TSWV by F. occidentalis was not significantly reduced in the plants treated with Cyazypyr™ at 4.41 mg ai per plant compared to the control (Table 1). Therefore, transmission of TSWV by this vector was not tested at the lower doses of Cyazypyr™.

In the combined analysis that compared the three rates of Cyazypyr™ and the water- treated control to each other in the experiments with F. fusca (Table 2), odds of transmission to the control plants were 2.43 and 20.82 times greater than for plants treated with

Cyazypyr™ at the 1.45 and 4.41 mg ai per plant rates (P=0.0361 and P<0001, respectively).

The odds ratio for transmission to control plants vs. the 2.90 mg ai per plant rate of

Cyazypyr™ was 2.46 and approached statistical significance (P=0.0509). Odds of transmission to plants treated with the 1.45 and 2.90 mg ai per plant rates of Cyazypyr™ were ca. 8.5 times greater than for plants treated with the high rate (P<0.004). Odds of transmission to plants treated at the 1.45 and 2.90 mg ai per plant rates did not differ significantly.

A comparison of the estimated percentage of feeding injury caused by F. fusca on leaves from treated and control plants showed significantly more feeding injury on leaves from control plants ( x = 10.3, SE = 3.0) than on leaves from plants treated with 4.41 mg ai per plant of Cyazypyr™( x = 2.28; SE = 0.5)(t=2.54; df=1, 19; P=0.02). However, the proportion of dead F. fusca did not differ between foliage from Cyazypyr™-treated plants ( x = 0.41; SE = 0.07) or control plants ( x = 0.37; SE = 0.06) (t=0.79; df=1, 19; P=0.4367).

Because Cyazypyr™ caused a significant reduction in feeding injury without a corresponding increase in mortality of F. fusca adults, it is likely that antifeedant effects are responsible for the decreased transmission of TSWV by F. fusca observed in this study. It is possible that mortality effects may have been observed with a different experimental design, i.e. using a longer time window to observe mortality (> 5 d) or waiting longer before exposing treated plants to thrips (>48 h). Mortality effects on thrips and mobility of

Cyazypyr™ through C. annuum is unknown. Future studies should also be conducted utilizing techniques such as electronic penetration graph (EPG) methods (e.g. Harrewijn et al., 1996; Kindt et al., 2003, 2006) that are capable of making precise characterizations of thrips feeding behavior to better understand the responses of both F. fusca and F. occidentalis to Cyazypyr™-treated foliage. EPG methods have previously been used to

study the effects of imidacloprid on thrips feeding behavior (Groves et al., 2001; Joost and

Riley, 2005).

The results presented suggest that Cyazypyr™ has potential to reduce transmission of

TSWV by F. fusca, with greater reduction at 4.41 than at 2.90 and 1.45 mg ai per plant, but is not effective in reducing transmission by F. occidentalis at 4.41 mg ai per plant. Further studies are needed to determine if this holds true for other crop plants affected by TSWV, and whether or not it is effective under field conditions. Reduced virus incidence was not observed in the experiments with F. occidentalis at the rate of 4.41 mg ai/plant, however, higher rates may prove to be more effective at reducing transmission of TSWV by this vector.

Acknowledgements

We would like to thank Carol Berger for her instruction and assistance with rearing and maintaining TSWV isolates, and Robert Williams of DuPont for providing the

Cyazypyr™ used in these experiments. We would also like to thank Chris Franck from the

Department of Statistics at North Carolina State University for his assistance with our statistical analysis.

Disclosure

DuPont has sponsored field evaluations of Cyazypyr™ for insect control by G.G. Kennedy during 2008, 2009 and 2010 and is providing support for additional research on antifeedant effects of Cyazypyr™.

REFERENCES

Burt, A., Karr, D., 2008. DuPont and Syngenta enter into crop protection technology exchange.http://vocuspr.vocus.com/VocusPR30/Newsroom/Query.aspx?SiteName=DuPontN ew&Entity=PRAsset&SF_PRAsset_PRAssetID_EQ=110201&XSL=PressRelease&Cache=

Chatzivassiliou, E.K., 2005. Thrips tabaci: an ambiguous vector of TSWV in perspective, in: Proceedings of the 7th International Symposium on Thysanoptera. CSIRO, Australia, pp. 69- 75.

Csinos, A.S., Pappu, H.R., McPherson, R.M., Stephenson, M.G., 2001. Management of Tomato spotted wilt virus in flue-cured tobacco with Acibenzolar-S-Methyl and Imidacloprid. Plant Dis. 85, 292-296.

Davies, H.T.O., Crombie, I.K., Tavakoli, M., 1998. When can odds ratios mislead? BMJ 316, 989-991.

DuPont, 2007. Rynaxypyr™ Technical Bulletin. http://www2.dupont.com/Production_Agriculture/en_US/assets/downloads/pdfs/Rynaxypyr_ Tech_Bulletin.pdf

Eckel, C.S., Cho, K., Walgenbach, J.F., Kennedy, G.G., Moyer, J.W., 1996. Variation in thrips species composition in field crops and implications for tomato spotted wilt epidemiology in North Carolina. Entomol. Exp. Appl. 78, 19-29.

Gonzales-Coloma, A., Gutierrez, C., Hubner, H., Achenbach, H., Terrero, D., Fraga, B.M., 1999. Selective insect antifeedant and toxic action of ryanoid diterpenes. J. Agric. Food. Chem. 47, 4419-4424.

Groves, R.L., Sorenson, C.E., Walgenbach, J.F., Kennedy, G.G., 2001. Effects of imidacloprid on transmission of tomato spotted wilt tospovirus to pepper, tomato and tobacco by Frankliniella fusca Hinds (Thysanoptera: Thripidae). Crop Prot. 20, 439-445.

Harrewijn, P., Tjallingii, W.F., Mollema, C., 1996. Electrical recording of plant penetration by western flower thrips. Entomol. Exp. App. 79, 345-353.

Herbert, D.A. Jr., Malone, S., Aref, S., Brandenburg, R.L., Jordan, D.L., Royals, B.M., Johnson, P.D., 2007. Role of insecticides in reducing thrips injury to plants and incidence of tomato spotted wilt virus in Virginia market-type peanut. J. Econ. Entomol. 100, 1241-1247.

Insecticide Resistance Action Committee(IRAC), 2007. IRAC Mode of Action Classification Version 5.3. http://www.iraconline.org/documents/IRAC%20MoA%20Classification%20v5_3.pdf

Joost, P.H., Riley, D.G., 2005. Imidacloprid effects on probing and settling behavior of Frankliniella fusca and Frankliniella occidentalis (Thysanoptera: Thripidae) in tomato. J. Econ. Entomol. 98, 1622-1629.

Kindt, F., Joosten, N.N., Peters, D., Tjallingii, W.F., 2003. Characterisation of the feeding behavior of western flower thrips in terms of electrical penetration graph (EPG) waveforms. J. Insect Physiol. 49, 183-191.

Kindt, F., Joosten, N.N., Tjallingii, W.F., 2006. Electrical penetration graphs of thrips revised: combining DC- and AC-EPG signals. J. Insect Physiol. 52, 1-10.

Kucharek, T., Brown, L., Johnson, F., Funderburk, J., 2000. Tomato Spotted Wilt Virus of Agronomic,

Vegetable, and Ornamental Crops. Plant Pathology Fact Sheet Circ-914. Florida Cooperative Extension Service http://plantpath.ifas.ufl.edu/takextpub/FactSheets/circ0914.pdf

Loomans, A.J.M., Murai, T., 1997. Culturing thrips and parasitoids, in: Lewis, T. (Ed.), Thrips as Crop Pests. CAB International, New York, pp. 484-485.

Mandal, B., Mandal, S., Csinos, A.S., Martinez, N., Culbreath, A.K., Pappu H.R., 2008. Biological and molecular analysis of the Acibenzolar-S-Methyl-induced systemic acquired resistance in flue-cured tobacco against Tomato spotted wilt virus. Phytopathology 98, 196- 204.

McPherson, R.M., Pappu, H.R., Jones, D.C., 1999. Occurrence of five thrips species on flue- cured tobacco and impact on spotted wilt disease incidence in Georgia. Plant Dis. 83, 765- 767.

Pesticide Action Network (PAN), 2008. DuPont/Syngenta enter product sharing agreement. The Pesticide Monitor. 8, http://www.panap.net/uploads/media/Pesticide_Monitor- _Vol_8_No_3.pdf

Riley, D.G., Pappu, H.R., 2004. Tactics for management of thrips (Thysanoptera: Thripidae) and tomato spotted wilt virus in tomato. J. Econ. Entomol. 97, 1648-1658.

Rosello, S., Díez, M.J., Nuez, F., 1996. Viral diseases causing the greatest economic losses to the tomato crop. I. The Tomato spotted wilt virus — a review. Scientia Horticulturae. 67, 117-150.

SAS Institute, Inc. 2005. SAS® 9.1.3 Intelligence Platform: Single-User Installation Guide. Cary, North Carolina, USA.

Sattelle, D.B., Cordova, D., Cheek, T.R., 2008. Insect ryanodine receptors: molecular targets for novel control chemicals. Invert. Neurosci. 8, 107-119. DOI 10.1007/s10158-008-0076-4

Whitfield, A.E, Ullman, D.E., German, T.L., 2005. Tospovirus-thrips interactions. Annu. Rev. Phytopathology. 43, 459-489.

Wijkamp, I., Almarza, N., Peters, D., 1995. Median latent period and transmission of tospoviruses vectored by thrips, in: Parker, B.L. (Ed.) Thrips Biology and Management. Plenum Press, New York, pp. 153-156.

Wijkamp, I., Van De Wettering, F., Goldbach, R., Peters, D., 1996. Transmission of tomato spotted wilt virus by Frankliniella occidentalis median acquisition and inoculation access period. Ann. App. Biol. 129, 303-313.

Table 1. Final incidence of TSWV transmission by Frankliniella fusca and F. occidentalis to water- treated and Cyazypyr™ treated Capsicum annuum seedlings. Different rates of Cyazypyr™ and their respective controls were evaluated in separate experiments; F. fusca and F. occidentalis were evaluated in separate experiments. Frankliniella Fusca Cyazypyr Odds P Ratea Control b Nc N 95% CL χ2 (df) ™b Ratiod Value 0.31 0.0273 1.45 71 0.17 (0.38) 72 2.70 1.118-6.527* 4.871 (1) (0.47) * 0.25 72 0.0496 2.90 0.13 (0.33) 72 2.50 1.002-6.238* 3.856 (1) (0.44) * 0.50 6.102- 25.845 <.0001 4.41 72 0.06 (0.23) 72 18.98 (0.50) 59.059* (1) * Frankliniella occidentalis 0.72 4.41 64 0.60 (0.49) 63 1.78 0.810-3.918 2.066 (1) 0.1506 (0.45) a Rate in mg ai/plant. b Proportion of plants infected; mean (standard deviation). c N is the total number of plants tested. d Ratio of odds of transmission to the control listed to the odds of transmission in the Cyazypyr™ treatment listed in a given row. * Indicates the Cyazypyr™ treatment is significantly different from the water-treated control.

Table 2. Comparison of the final incidence of TSWV transmission by Frankliniella fusca among water-treated and Capsicum annuum seedlings treated with three different rates of Cyazypyr™. Contrast of Cyazypyr™ Odds Ratioa 95% CL χ 2 (df) P Value Treatments (mg ai/plant) 0b versus 1.45 2.24 1.059-5.567* 4.391 (1) 0.0361* 0 versus 2.90 2.47 0.996-6.103 3.812 (1) 0.0509 0 versus 4.41 20.83 6.659-65.12* 27.240 (1) <0.0001* 2.90 versus 1.45 1.02 0.298-3.46 0.0006 (1) 0.9804 1.45 versus 4.41 8.55 2.105-34.48* 8.992 (1) 0.0027* 2.90 versus 4.41 8.45 1.976-36.07* 8.290 (1) 0.0040* a Ratio of odds of transmission to the first treatment listed to the odds of transmission in the second treatment listed in a given row. b Pooled control data from the separate experiments. * Indicates significant differences exist between the two treatments

SUMMARY AND CONCLUSIONS

In Eastern Europe and Australia T. tabaci is still considered to be the primary vector of TSWV. However, elsewhere T. tabaci is disregarded as a vector and generally not considered to contribute significantly to spread of TSWV. This is due to a large amount of variation in TSWV transmission efficiency that exists among populations of T. tabaci (Paliwal 1973, 1976, Lemetty and Lindqvist 1993, Trjapitzin 1995, Wijkamp et al. 1995, Chatzivassiliou et al. 1999, 2002, Jenser et al. 2003, Nagata et al. 2004, Cabrera-La Rosa and Kennedy 2007, Chatzivassiliou 2008) and the popular belief that the widely distributed thelytokous populations of T. tabaci, including those found in the U.S., belong to a non- vector competent subspecies group (Chatzivassiliou et al. 2002, Jenser et al. 2011). In this study, 19 out of 21 isofemale lines tested for their ability to transmit TSWV were thelytokous, and exhibited transmission rates up to 45%, indicating that the genetics for vector competence exist in thelytokous populations of T. tabaci in NC (Jacobson 2012 chapter 1). In addition, characterization of the vector competence of T. tabaci requires knowledge of the specific TSWV isolate being transmitted, as this study showed that the ability of T. tabaci isofemale lines to transmit TSWV was specific to the isofemale line- isolate combination tested. When a subset of the isofemale lines used in the transmission study was examined for transmission efficiency based on clonal groups assigned using microsatellite DNA marker data, again, the interaction of the clonal group and the isolate was statistically significant (Jacobson 2012, Chapter 3), indicating that the vector competency of a given clonal group was dependent on the specific TSWV isolate present. Furthermore, results suggest that local adaptation between virus and vector may be occurring due to transmission rates being higher, on average, between sympatric vector-isolate pairings than allopatric vector-isolate pairings. Therefore, the importance of T. tabaci as a vector of TSWV will depend upon the interactions occurring between local thrips vectors and virus populations. An examination of the population genetic structure of T.tabaci also revealed that geographic structuring of T. tabaci populations occurs across NC (Jacobson 2012, Chapter 3). The presence of some clonal groups in multiple locations also suggests that T. tabaci can disperse across a large part of the sampled area. Dispersal may introduce T. tabaci

100

individuals with genotypes conferring vector competence to areas where vector competence is generally low. Depending on the compatibility of the isolate with the introduced genotype, however, this may or may not result in significantly greater spread of TSWV by T. tabaci in any given location. In addition, the occurrence of polyploidy in T. tabaci may be influencing population structure and the spread and abundance of clonal groups, as polyploidy has been thought to contribute to the successful spread and establishment of individuals into new habitats (Lundmark and Saura 2006). The occurrence of polyploidy and its effect on the abundance and distribution of clonal groups of T. tabaci need to be examined further. Finally, the effect of cyantraniliprole treatments on the incidence of TSWV resulting from transmission by F. fusca and F. occidentalis in banana pepper was examined in a greenhouse study (Jacobson 2012, Chapter 4). Transmission of TSWV by F. fusca was significantly reduced at all three rates tested; however, transmission by F. occidentalis was not reduced by treatments of cyantraniliprole when tested at the high rate of 4.41 mg ai/plant. The reduction of TSWV using applications of cyantraniliprole warrants further investigation to test the ability of cyantraniliprole to reduce infestations in field trials, and indifferent crops. Higher rates of cyantraniliprole may prove effective at reducing TSWV transmission by F. occidentalis.

101

REFERENCES

Cabrera-LaRosa, J.C. and Kennedy, G.G. (2007) Thrips tabaci and Tomato spotted wilt virus: inheritance of vector competence. Entomol. Expt Appl. 124: 161-166.

Jenser, G., Almási, A., Fail, J., and Tóbiás, I. (2011) Differences in the vector efficiency of Thrips tabaci in Europe and North America. Acta Phytopathologica et Entomologica Hungarica. 46: 311-317.

Lemmetty, A., and Lindqvist, I. (1993) Thrips tabaci (Lind.) (Thysanoptera: Thripidae), another vector for tomato spotted wilt virus in Finland. Agric. Sci. Finl. 2:189-194.

Lundmark, M and Saura, A. (2006) Asexuality alone does not explain the success of clonal forms in insects with geographical parthenogenesis. Hereditas 143: 23-32.

Nagata, T., Almeida, A.C.L., Resende, R. de O., and de Avila, A.C. (2004) The competence of four thrips species to transmit and replicate four tospoviruses. Plant Pathol. 53: 136-140.

Paliwal, Y.C. (1974) Some properties and thrips transmission of tomato spotted wilt virus in Canada. Can. J. Bot. 52: 1177-82.

Paliwal, Y.C. (1976) Some characteristics of the thrips vector relationships of tomato spotted wilt virus in Canada. Can. J. Bot. 54: 402-405.

102

Vandel, A. (1928) La parthénogénèse geographique. Contribution à l’étude biologique et cytologique de la parthénèse naturelle. Bull. Biol. France Belg. 62: 164-281.

Wijkamp, I., Almarza, N., Goldbach, R., and Peters, D. (1995) Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathol. 85: 1069-1074.

Wilson, C.R. (1997) Incidence of weed reservoirs and vectors of tomato spotted wilt tospovirus on southern Tasmanian lettuce farms. Plant Pathol. 47: 171-176.

Zawirska, I. (1976) Untersuchungen uber zwei biologische Typen von Thrips tabaci Lind. (Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopath. Plant Prot. 12: 411-422.

103