The Ski Oncoprotein Interacts with Skip, the Human Homolog of Drosophila Bx42

The Ski oncoprotein interacts with Skip, the human homolog of Drosophila Bx42

Richard Dahl, Bushra Wani and Michael J Hayman

Department of Microbiology, State University of New York, Stony Brook, New York 11794, USA

The v-Ski avian retroviral oncogene is postulated to act Little is known about how Ski functions. Both the as a transcription factor. Since protein ± protein interac- cellular and the viral genes share transforming and tions have been shown to play an important role in the muscle inducing ability. Ski localizes to the nucleus and transcription process, we attempted to identify Ski is observed to associate with chromatin (Barkas et al., protein partners with the yeast two-hybrid system. Using 1986; Sutrave et al., 1990a). Because of its nuclear v-Ski sequence as bait, the human gene skip (Ski localization and its ability to induce expression of Interacting Protein) was identi®ed as encoding a protein muscle speci®c genes in quail cells (Colmenares and which interacts with both the cellular and viral forms of Stavnezer, 1989), Ski has been assumed to be a Ski in the two-hybrid system. Skip is highly homologous transcription factor. Consistent with this assumption, to the Drosophila melanogaster protein Bx42 which is c-Ski has been shown to bind DNA in vitro with the found associated with chromatin in transcriptionally help of an unknown protein factor (Nagase et al., active pus of salivary glands. The Ski-Skip interaction 1990), and has been recently shown to enhance MyoD is potentially important in Ski's transforming activity dependent transactivation of a myosin light chain since Skip was demonstrated to interact with a highly enhancer linked reporter gene in muscle cells (Engert conserved region of Ski required for transforming et al., 1995). activity. Like Ski, Skip is expressed in multiple tissue Protein-protein interactions are an established types and is localized to the cell nucleus. mechanism of transcriptional regulation. As discussed above, Ski has been proposed to be involved in Keywords: Ski oncogene transcriptional regulation and presumably achieves this regulation by binding to DNA following interaction with an unknown protein(s). Thus in order to understand the mechanism of action of the Ski protein Introduction it will be necessary to identify these putative binding partners. In this report the yeast two-hybrid system The v-Ski oncogene was originally identi®ed as the was used to identify the human gene skip encoding a transforming protein of the SKV avian retroviruses Ski interacting protein which is highly homologous to which were isolated by their ability to transform avian the Drosophila melanogaster nuclear protein Bx42. ®broblasts in vitro (Stavnezer et al., 1981). V-Ski is truncated at the amino and carboxyl termini compared to the cellular proto-oncogene c-Ski. Ski has been Results cloned from several species including human, chicken, and Xenopus (Nomura et al., 1989; Sleeman and Identi®cation of a Ski binding partner Laskey, 1993; Sutrave et al., 1990a); and is the founding member of a family of proteins which To identify putative Ski binding proteins the yeast two- includes itself and the Ski related protein Sno (Boyer hybrid system was utilized. We chose to use Ski et al., 1993). sequence derived from v-Ski as bait since all identi®ed For an oncogene Ski has the unusual property of biological activity is shared between c-Ski and the being able to aect cellular proliferation, and also smaller v-Ski (Colmenares et al., 1991a; Sutrave et al., initiate dierentiation. Quail embryo ®broblasts infected 1990a). V-Ski sequence was cloned into the two-hybrid with a retrovirus expressing Ski dierentiate into GAL4 DNA binding vector pGBT9 and the resultant myoblasts capable of forming myotubes in culture plasmid was used to screen a previously constructed (Colmenares and Stavnezer, 1989), and transgenic mice two-hybrid library made from cDNA of EBV overexpressing a truncated c-Ski protein display transformed human lymphoid cells (Durfee et al., enlarged skeletal muscle mass compared to their normal 1993). litter mates (Sutrave et al., 1990b). Despite evidence for The yeast strain Y153 was used for the screening a role in muscle development, c-Ski is only expressed at since it allows for double selection using two GAL4 very low levels in normal skeletal muscle tissue, similar regulatable reporter genes: lacZ and HIS3. Colonies to its expression levels detected in other adult tissues positive for an interaction will result in a phenotype (Colmenares and Stavnezer, 1990; Nomura et al., 1989). that allows Y153 to grow on His7 media and express lacZ. Approximately 26106 yeast colonies were screened, and four colonies were isolated that were consistently His+ and lacZ+. The library plasmids from Correspondence: MJ Hayman these colonies were isolated and assayed to determine if Received 4 December 1996; revised 29 October 1997; accepted 29 the activation of the reporter genes was dependent on October 1997 the presence of the Ski sequence in the DNA binding Identification of a Ski interacting protein RDahlet al 1580 vector. The isolated plasmids were either transformed Identi®cation of the Skip binding domain of Ski into Y153 alone or co-transformed with one of the following: GBT9, VA3 (murine p53 aa's 70-390), or We were next interested in determining if Skip pGTB9-vSki. Three of the four isolated plasmids were associated with any of Ski's de®ned structural dependent on Ski for their activation of lacZ (data not domains. Ski has several putative domains including a shown). These three clones were shown also to interact proline rich region, two cysteine rich regions, two with the full length c-Ski in the two-hybrid system. putative amphipathic helices, a basic domain and a Subsequent analysis of the three isolated plasmids coiled-coil domain (Sleeman and Laskey, 1993; Stavne- revealed that they all contained the same 2.2 kb insert. zer et al., 1989). Two of these, the coiled-coil domain This insert was fully sequenced and found to code for a and the putative amphipathic helices domain have novel gene, skip (Ski Interacting Protein). Because the known functional activity. The coiled-coil domain has two-hybrid clone lacked an initiating methionine, a been shown to mediate homo-multimerization of Ski, RACE (Rapid Ampli®cation of cDNA ends) procedure and hetero-multimerization of Ski and the Ski related was used to isolate additional 5' sequence containing protein Sno (Heyman and Stavnezer, 1994; Nagase et an ATG surrounded by a minimal Kozak consensus al., 1993). By mutational analysis, the amphipathic sequence (Kozak, 1989). The composite nucleotide helices have been shown to be required for Ski sequence and deduced amino acid sequence of the transformation of ®broblasts and induction of quail skip clone from the two-hybrid and RACE search is ®broblasts into myoblasts (Colmenares et al., 1991b). shown in Figure 1. To identify potential Ski domains involved with A blast (Altschul et al., 1990) search of the mediating Skip interaction, Ski truncation mutants GenBank database demonstrated that Skip is highly were fused to the GAL4 DNA binding domain and homologous to the Drosophila melanogaster Bx42 assayed in the two-hybrid system using the originally protein. Skip and Bx42 share almost 60% identity isolated Skip-GAL4 activation domain plasmid. Ex- at the amino acid level. Recently other Skip homologous sequences have been deposited in GenBank from Caenorhabditis elegans, Schizosacchar- omyces pombe, and Dictyostelium discoideum; (Folk et a al., 1996) and Skip homologous expressed sequence tags (ESTs) have been identi®ed from mouse, Arabidopsis thaliana, and rice root. An amino acid alignment of Skip, Bx42 and the S. pombe Skip homolog is shown in Figure 2a. Additionally an essential gene from the yeast Saccharomyces cerevisiae, Fun20 (Diehl and Pringle, 1991; Harris et al., 1992), shares two regions of homology with Skip. An alignment of these two homologous regions with Skip is shown in Figure 2b.

Figure 2 (a) Alignment of the predicted amino acid sequences of Skip homologs from human, Drosophila, and S. pombe.(b) Alignment of Skip with two homologous regions from the S. Figure 1 Nucleotide sequence of human skip and predicted cerivisiae protein FUN20. Sequences were aligned using the amino acid (single letter code) sequence. Numbers on the left refer ClustalW algorithm. Capital letters in consensus sequence to nucleotide position, and numbers on the right refer to amino represent amino acids shared by all three sequences and lower acid position. (GenBank accession number U51432) case letters represent similar amino acids in all three sequences Identification of a Ski interacting protein RDahlet al 1581 pression of Ski fusion proteins was veri®ed by performed. C-Ski and v-Ski were expressed as immunoblot (data not shown). glutathione S-transferase (GST) fusion proteins in E. As shown in Figure 3, the last 566 carboxyl terminal coli. GST alone and GST-chicken SHP2 (SH2 domain amino acids of c-Ski were not required for Skip tyrosine phosphatase) were used as non-speci®c interaction (see mutant CT2). These amino acids controls in the binding reactions. Approximately 5 mg contain the coiled-coil domain, the Ski basic region, of each fusion protein bound to equivalent amounts of and one of Ski's cysteine rich regions. However, when glutathione agarose was incubated with an equivalent Ski was truncated to contain only the proline rich amount of cell lysate of COS1 cells transfected with a region Ski no longer could bind to Skip (CT3). When hemagglutinin (HA) epitope tagged version of Skip Ski was truncated at the amino end so that the proline (HA-Skip). After extensive washing proteins were rich region was deleted Ski still associated with Skip eluted and run on an SDS ± PAGE gel and Western (NT1), but when Ski was deleted further to remove the blotted. The blot was then subsequently probed with amino proximal cysteine region and the amphipathic an antibody against the HA epitope. In COS1 cells helices, Skip binding was no longer detected (NT2). expression of HA-Skip results in two new HA reactive The amino and carboxyl truncation mutants suggested bands: an approximately 66 kD full-length HA-Skip that the amino proximal cysteine region and amphipathic and a smaller 55 kD form presumably due to a helices were necessary and sucient to mediate Ski proteolytic cleavage at the carboxyl terminal end. As binding. To con®rm this, an amino and carboxyl shown in Figure 4a only GST-vSki and GST-c-Ski truncated Ski product containing only the amphipathic were able to bind HA-Skip whereas GST alone and helices and amino proximal cysteine rich region was fused GST-cSHP2 were unable to bind. to the GAl4 DNA binding domain. This 107 amino acid In order to determine whether Skip and Ski could segment was able to bind Skip (NCT1). Interestingly this also interact in vivo, the quail cell line, QT6, was region has been shown to be necessary for Ski's transiently transfected with c-Ski and HA-Skip transforming ability (Colmenares et al., 1991b) and this region is highly conserved between Ski proteins and the Ski-related protein, Sno. As expected from this data full- length chicken SnoN was also shown to interact with Skip a in a two-hybrid assay (data not shown).

In vitro and in vivo association of Skip with Ski To con®rm the Ski-Skip interaction that was identi®ed GST alone GST-cSHP2 GST-vSki GST-cSki in the two-hybrid system an in vitro binding assay was Input cell Iysate

68.0 kD — HA-Skip

43.0 kD —

b Whole cell extract Anti-HA I.P.

c-SKI + + + + HA-SKIP + – + – Figure 4 (a) In vitro binding of hemagglutinin (HA)-tagged Skip to Ski. COS1 cells were transiently transfected with HA-Skip. Equivalent amount of cell lysates were incubated with various glutathione S-transferase fusion proteins bound to glutathione agarose. Bound proteins were eluted, separated by SDS ± PAGE, and immunoblotted. The blot was probed with anti-HA (12CA5) antibody. The control lane was loaded with 5% of the amount of whole cell lysate used in the binding reactions. cSHP2 is a chicken SH2 domain containing tyrosine phosphatase. (b) In vivo association of HA-Skip with c-Ski. QT6 cells were transiently transfected either with a c-Ski expression plasmid or with c-Ski and HA-Skip expression plasmids. Cell extracts were prepared Figure 3 Mapping of the Skip binding site on Ski. Binding of Ski and immunoprecipitated with anti-HA antibody. Immune deletion mutants to Skip was determined using the two-hybrid complexes along with one-tenth of the whole cell lysates used system. A plus (+) indicates that an interaction was detected by for immunoprecipitation were separated by SDS ± PAGE, ®lter lift assay of b-galactosidase activity. Amino acid numbers immunoblotted, and probed with anti-Ski (G8). +/7 denotes refer to positions in chicken c-Ski whether transfected with c-Ski or HA-Skip Identification of a Ski interacting protein RDahlet al 1582 expression plasmids. Potential complexes were immu- identical. Figure 6e (anti-Ski) and f (anti-HA) show a noprecipitated from cell extracts with an anti-HA cell that has been transfected with HA-Skip and c-Ski. antibody. Immune complexes were separated by SDS- In this particular cell a much greater degree of overlap polyacrylamide electrophoresis and analysed via was observed although the pattern is still not exactly Western blot with an anti-Ski antibody. As a control identical. It should be noted that the overlap in this extracts were also prepared from cells transfected with particular cell does not re¯ect better co-localization of only c-Ski. As shown in Figure 4b c-Ski was only Skip with c-Ski compared to v-Ski when co-localization precipitated from cells that also expressed HA-Skip demonstrating that Ski and Skip can associate in vertebrate cells. Equal amounts of whole cell extracts from both c-Ski and c-Ski/HA-Skip expressing cells are shown to demonstrate that c-Ski was expressed in both sample extracts.

Skip localizes to the nucleus Cytoplasm/ mock Cytoplasm/ HA-skip Nuclear/ mock Since Ski is a nuclear protein and localizes to the Nuclear/ HA-skip nucleus in order to function, we wanted to con®rm that 97.4 kD — its putative partner, Skip, is also localized to the nucleus. COS1 cells were either mock transfected or transfected with HA-Skip. Approximately 60 h after 68.0 kD — transfection the cells were fractionated into nuclear and cytoplasmic fractions which were used for immunoblot HA-Skip analysis. As shown in Figure 5, only the two nonspeci®c bands that are normally seen with the anti-HA antibody were seen in the mock transfected cells and these bands were seen in the cytoplasm. In the 43.0 kD — HA-Skip transfected cells the two speci®c HA-Skip bands at approximately 66 kD and 55 kD were seen in the nuclear fraction. Faint bands seen in the cytoplasm were thought to be due to some nuclear leakage during Figure 5 Nuclear localization of HA-Skip. COS1 cells were fractionation. The integrity of the cytoplasmic fraction transiently transfected, or mock transfected with HA-Skip. Cells were fractionated into nuclear and cytoplasmic fractions. was veri®ed by reprobing the fractions for the Fractions were immunoblotted and probed with anti-HA anti- cytoplasmic protein h-Sos (Li et al., 1993) which was body (12CA5) correctly localized to the cytoplasm (data not shown). Nuclear localization was also analysed by immuno- ¯uorescence. COS1 cells transfected with HA-Skip were stained with anti-HA. Staining was seen in the nucleus as shown in Figure 6a and b, con®rming the biochemical fractionation data. No anti-HA nuclear ¯uorescence was observed in non-transfected cells (data not shown). In the majority of Skip expressing cells staining was predominantly granular in appearance with a few bright speckles of Skip expression as exempli®ed by the cell in Figure 6b. In a fewer number of cells Skip localized predominantly into the nuclear speckled domains. Immuno¯uorescence analysis of c-Ski expressing cells had previously shown that Ski localized into speckled domains within the nucleus (Sutrave et al., 1990a). Since Skip was also capable of localizing into nuclear speckles we wanted to determine if Ski and Skip were localizing to the same speckles. To look for potential co-localization of Skip and Ski we co- expressed either HA-Skip and v-Ski, or HA-Skip and c-Ski in COS1 cells. Cells expressing only Ski or HA- Skip were stained with anti-HA or anti-Ski respectively to demonstrate that antibody crossreactivity was not generating non-speci®c ¯uorescent labeling (data not shown). Figure 6c and d show a cell that has been Figure 6 Immuno¯uorescent localization of Skip and Ski in transfected with HA-Skip and v-Ski. Figure 6c is COS1 cells. (a and b) Cells were transfected with HA-Skip alone. stained with anti-Ski polyclonal antibody and Figure (c and d) Cells were transfected with HA-Skip and v-Ski. (e and f) 6d with anti-HA. As described previously Ski localized Cells were transfected with HA-Skip and c-Ski. (a, b, d, f) show anti-HA 12CA5 rhodamine staining. (c and e) show polyclonal to the nucleus and into bright nuclear speckles. A few anti-Ski ¯uorescein staining. Cells were visualized by a Nikon of the brighter dots of Ski and Skip expression do Diaphot inverted microscope with a Bio-Rad MRC 600 laser appear to overlap however the patterns are not confocal attachment using the Bio-Rad COSMOS software Identification of a Ski interacting protein RDahlet al 1583 is evaluated for all transfected cells. Co-localization of interact with Ski. Results from immuno¯uorescence Skip with both c-Ski and v-Ski was highly variable. In analysis show some degree of co-localization of the two some cells there were dramatic examples of co- proteins within the nucleus. However the nuclear localization (Figure 6e and f) whereas in other cells localization patterns of Skip and Ski are not the co-localization was relatively minimal regardless of identical. Skip staining in the nucleus is predominantly whether v-Ski or c-Ski was used. The reason for this granular with a few bright speckles whereas Ski variability was unclear, but it did not appear to re¯ect predominantly localizes into large bright speckles. dierences in expression levels based on staining The overlap that we see predominantly occurs in intensities (data not shown). these bright speckles. However the non-identical localization suggests that Ski and Skip are not always bound to each other and that their association may be Discussion regulated by other factors such as cell cycle progression and/or extracellular signaling. Ski not only has the ability to aect proliferation, but Tissue speci®c human cell lines were examined to can also act to stimulate cessation of growth and determine whether skip and ski were co-expressed. induce dierentiation. Little is known about the Previous reports have demonstrated that ski is molecular mechanism that Ski uses to achieve these ubiquitously expressed at low levels (Colmenares and disparate properties. Since Ski is postulated to function Stavnezer, 1990; Nomura et al., 1989). Reverse as a transcription factor and since protein ± protein transcriptase PCR analysis detected skip expression in interactions have been shown to be important in all cell lines that were tested (data not shown). In transcriptional regulation, we attempted to identify addition several Expressed Sequence Tag (EST) proteins that interact with Ski in order to potentially sequences deposited in the GenBank dbEST database elucidate Ski's mechanism of action. (Boguski, 1995) are identical to skip, and have been Previously an expression library was probed with isolated from several tissue speci®c human cDNA c-Ski to identify potential Ski interacting proteins, libraries. The EST data along with the RT ± PCR cell however only c-Ski and the Ski related protein Sno line analysis supports the conclusion that skip like ski were identi®ed (Nagase et al., 1993). Since screening of is expressed in most, if not all human tissues. an expression library did not yield any novel Ski Previously a protein activity in cell extracts was binding proteins we decided to use the yeast two- described that was required to mediate Ski DNA hybrid system. We chose to use v-Ski as bait instead of binding (Nagase et al., 1993). We have investigated c-Ski since known functional activities are shared whether Skip is this protein activity, but so far have between the two and by using v-Ski we hoped to not detected any DNA binding activity for Skip (data avoid pulling out numerous ski and sno clones since v- not shown). However Ski's interaction with Skip is still Ski lacks the coiled-coil interaction domain which has potentially very important since the minimal region been shown to predominantly mediate Ski-Ski and Ski- identi®ed that mediates Ski interaction with Skip Sno interactions (Heyman and Stavnezer, 1994; Nagase includes Ski sequence previously shown to be et al., 1993). necessary for transformation (Colmenares et al., The two-hybrid screen identi®ed a single protein 1991b). This region is also very highly conserved which we have named Skip for Ski interacting protein, sharing 75% identity over 107 amino acids between and appears to be the human homolog of Drosophila chicken Ski and Sno. Interestingly Ski and Sno share Bx42. Skip is highly conserved sharing 60% identity the in vitro activities of ®broblast transformation and with Bx42 and 40% identity with a S. pombe homolog muscle dierentiation of quail embryo cells (Boyer et identi®ed by the yeast genome project. Skip contains al., 1993). Important mediators of Ski/Sno function no homology to de®ned functional domains. Interest- would be assumed to function via interaction with this ingly, there is a region of 158 amino acids (Skip aa's highly conserved domain shared between Ski and Sno. 176-333) where the identity between the three The observation that Skip can interact with both Ski homologous proteins is 85 ± 90%, with similarity and Sno via this highly conserved domain implies that above 95%. This region also contains homology to this interaction may be central to the function of Ski the Bx42-related S. cerevisiae protein, FUN20, which and Sno. has been shown to be essential for cell viability (Diehl Unfortunately little is known about the function of and Pringle, 1991; Harris et al., 1992). For this region the Skip homolog Bx42. It was originally identi®ed by to be so highly conserved it would be assumed to be an raising monoclonal antibodies to the chromatin important functional domain. To support the conclu- fraction of Drosophila embryos (Frasch and Saumwe- sion of the two-hybrid system that Ski and Skip were ber, 1989). The Bx42 antigen was shown to be nuclear binding partners we performed gst pulldown and co- and present in several, but not all transcriptionally immunoprecipitation assays. In vitro association of active chromosomal pus of the Drosophila salivary Skip with Ski was demonstrated by the ability of GST- gland. Bx42 is postulated to play a role in the vSki and GST-cSki fusion proteins to recover Skip regulation of chromatin. from cell extract. GST and GST-cSHP2 were unable to There is some evidence that Bx42 is responsive to isolate Skip from the same extract. In vivo interaction the steroid hormone 20-OH ecdysone. During the late of Ski and Skip was detected in QT6 cells transiently third instar larval to pupae stage Bx42 is present on expressing HA-Skip and c-Ski. An anti-HA antibody several but not all chromatin loci that are known to was able to precipitate c-Ski in the presence of HA- form pus. During this time the pung pattern Skip but not from extracts expressing c-Ski alone. dramatically changes with the rise in titer of 20-OH Cell fractionation and immuno¯uorescence studies ecdysone and the Bx42 protein distribution also showed that Skip localizes to the nucleus where it can changes accordingly. One of the pus Bx42 is Identification of a Ski interacting protein RDahlet al 1584 associated with contains the sgs-4 gene. However, this Vectors expressing GST fusion proteins of c-Ski and v-Ski association is not seen in the Kochi mutant ¯y that were constructed by ligating c-Ski and v-Ski PCR products lacks a 52 bp DNA region upstream of sgs-4's from above into the vector pGEXKG. The complete coding transcriptional start site (Saumweber et al., 1990) that region for cSHP2 (Park et al., 1996) was ligated into partially contains an ecdysone response element pGEXKG to express GST-cSHP2. To express Skip in COS1 cells, Skip was subcloned into a (Lehmann and Korge, 1995). Potentially Bx42's modi®ed pCGN expression vector (Tanaka and Herr, 1990) association with the enhancer is due to an interaction generating pCGSP. A BglII fragment from the original Skip of Bx42 with DNA bound ecdysone receptor, however containing library plasmid was isolated and ligated into the to date this has not been demonstrated. BamHI site of pCGN, placing the Skip coding region in Bx42's responsiveness to ecdysone and potential frame with sequence encoding a 17 amino acid hemagglutinin interaction with the ecdysone receptor is intriguing tag and an initiating methionine. since there is some indirect evidence that Ski's actions To express vSki and cSki in COS1 cells, vSki from plasmid may partially involve nuclear hormone receptor path- pDcClavSki (Gift from E Stavnezer) and cSki from plasmid ways. We have shown previously that v-Ski has the pKS29 were subcloned into the transient expression vector ability to transform a myeloid-erythroid hematopoietic pMT2 (Kaufman et al., 1985). multipotential progenitor cell from avian bone marrow (Beug et al., 1995). V-Ski transformed bone marrow Yeast two-hybrid screen cultures contain immature cells of the myeloid and The yeast two-hybrid system was used to screen a erythroid lineages which are not blocked from lymphoid cell library as described (Bartel et al., 1993; dierentiation, and will respond to the dierentiating Durfee et al., 1993). The pGTB9/v-Ski plasmid was used as signals of growth factors. Interestingly a dominant bait and co-transformed with the cDNA library into yeast negative retinoic acid receptor expressed in mouse bone strain Y153 (Durfee et al., 1993) using a lithium acetate marrow cultures generated a similar phenotype (Tsai et protocol (Schiestel and Gietz, 1989). Approximately 26106 al., 1994). Work from our laboratory has also shown transformants were plated onto synthetic complete (SC) that v-Ski can functionally replace the nuclear media lacking tryptophan, leucine, and histidine, but including 25 mM 3-amino-triazole (Sigma). Colonies that hormone receptor family oncogene v-ErbA in an were His+ were isolated and assayed for lacZ expression avian retrovirus containing v-ErbA and the tyrosine using a ®lter lift assay (Bartel et al., 1993). kinase oncogene, v-Sea, which transforms avian DNA was isolated from yeast colonies that were HIS+ and erythroid cells (Larsen et al., 1992). So potentially v- expressed lacZ as described (Homan and Winston, 1987). Ski may be able to interact with a nuclear hormone Isolated DNA was used to transform the Leu7 bacterial receptor pathway. Since the Skip homolog Bx42 strain MH2. Transformants were plated on minimal media appears to be responsive to the Drosophila steroid lacking leucine and containing ampicillin to select for the hormone 2-OH ecdysone, Skip could potentially be library plasmid. mediating Ski's postulated entry into nuclear hormone receptor pathways. Rapid ampli®cation of cDNA ends Compared to other nuclear retroviral oncogenes little is known about how Ski functions. The Additional ®ve prime skip sequence was isolated using a identi®cation of Skip as a Ski binding protein should Gibco-BRL 5' RACE System according to manufacturer's instructions. 1 mg of total cellular RNA from Jurkat cells help increase understanding of how Ski functions at the was used as a template for a cDNA reaction. Primer molecular level. Future experiments will address the sequences used, cDNA rxn: CCTTTACAGTCATCT- role Skip may play in Ski's biological activities. TTCGG; GSP1: GACCTTGTCTTTTGACTGTCC; and GSP2: CCAAAATCCTCTAATAACCGAG.

Materials and methods Sequence analysis Plasmid construction Sequencing of the cDNA insert was performed on both To construct yeast expression plasmids containing GAL4- strands using the dideoxy termination method (Sanger et Ski fusion genes, Ski speci®c primers were used in a PCR al., 1977) manually and/or with an automatic sequencer reaction to amplify v-Ski sequence from the plasmid (Applied Biosystems model 373A). pRAVSKV (Stavnezer et al., 1986) and c-Ski sequence from the plasmid pKS29 (Sutrave and Hughes, 1989). GST pull down assay Forward and reverse primers used (i) c-Ski: TCCCCCGGGGATGGAGACTGTAAGTAGA and AC- COS1 cells were transiently transfected with the HA-Skip GCGTCGACTTAATTCTCCATGTTGCT; (ii) v-Ski: GG- expressing plasmid pCGSP using a Calcium Phosphate CCCGGGGTTTCATCTGAGCTCTATG and GGGTCG- method (Chen and Okayama, 1987). Approximately 60 h ACGCACCACTGTGGCACAGGG. PCR products were post transfection cells were washed three times in PBS restriction digested with SmaIandSalI and ligated in and lysed with HBN lysis buer [50 mM HEPES (N-2- frame with the GAL4 DNA binding domain sequence of hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.6), yeast expression vector, pGBT9. The NT1 plasmid was 150 mM NaCl, 10% glycerol, 0.875% Brj97 (polyox- constructed by using TCCCCCGGGCAGATCCACTGA- ylethylene-10-oleylether), and 0.125% Nonidet P-40] GAGG and the v-Ski reverse primer to amplify a Ski (Romero et al., 1996) containing 1 mM phenylmethylsul- fragment from pRAVSKV and the product was ligated into fonyl ¯uoride (PMSF) and 1 mM dithiothreitol (DTT) for pGBT9 as above. Other truncation amounts were 20 min on ice. Lysates were centrifuged and supernatant generated using standard molecular techniques with the was used in GST pull down experiments. appropriate restriction enzymes. Plasmid VA3 is the GBT9 Glutathione-S-transferase (GST) fusion proteins were vector with aa's 70-390 (lacks transactivation domain) of expressed in E. coli (DH5) and puri®ed as previously murine p53 fused in frame with the GAL4 activation described (Heyman and Stavnezerm, 1994; Smith and domain (Gift from Stanley Fields). Johnson, 1988). For each binding reaction approximately Identification of a Ski interacting protein RDahlet al 1585 5 mg of GST fusion protein bound to equivalent amounts of clonal tissue culture supernatant for 1 h at 378C. Cells glutathione agarose was incubated with equal amounts of expressing both HA-Skip and either c-Ski or v-Ski were cellular extract for 4 h at 48C. Glutathione-agarose bound treated with both anti-HA and a 1 : 100 dilution of a proteins were washed extensively in PBS containing 0.5% polyclonal anti-Ski antibody. Cells were washed three times Triton X-100. Proteins were eluted in SDS sample buer, in PBS and then incubated for 1 h at 378C either with a separated on a 10% SDS ± PAGE gel, and transferred onto a 1 : 100 dilution of rhodamine labeled goat anti-mouse nitrocellulose membrane. The membrane was developed with (Cappel) or a combination of diluted anti-mouse and a anti-HA (12CA5) using the ECL detection system (Amer- 1 : 100 dilution of ¯uorescein labeled goat anti-rabbit sham). (Cappel). All antibody dilutions were made in 1% BSA in PBS. Cells were washed three times in PBS and mounted with Gel/Mount (Biomeda). Co-immunoprecipitation assay Cells were visualized by a Nikon Diaphot inverted QT6 cells were transiently transfected with pCRNCM c-ski microscope with a Bio-Rad MRC 600 laser confocal or with pCRNCM c-ski along with pCRNCM HA-skip. attachment using the Bio-Rad COSMOS software. Approximately 60 h post transfection cells were harvested from plates and resuspended in 100 ml0.25MTris-HCl, pH Reverse transcriptase PCR analysis 7.5 and lysed by three alternating 5 min cycles of freezing and thawing. Cell extracts were precleared with 50 mlStaph Total RNA was isolated from cell lines using a guanidine A, incubated with 10 ml of polyclonal anti-HA antibody HCl extraction protocol (Sambrook et al., 1989). Approxi- (Santa Cruz Biotechnology) for 30 min followed by a mately 1 mg of RNA was denatured at 658Cfor10min. 30 min incubation with Staph A. Immune complexes were cDNA was synthesized with an oligo dT primer using the eluted from Staph A in SDS-sample buer and separated Promega AMV reverse transcription kit according to by SDS ± PAGE electrophoresis. manufacturer's instructions. The entire cDNA reaction was subsequently used in a PCR reaction. The PCR reaction included 1X ThermoPol Buer (NEB), 0.005% Cellular fractionation gelatin, 100 mM dNTPs, 60 pmol of each skip speci®c COS1 cells were either transfected with pCGSP (HA-Skip) primer, and 4U Vent DNA polymerase (NEB). One tenth or mock transfected. Approximately 60 h post transfection, of the PCR reaction was analysed on a 1% agarose gel. cells were harvested by scraping the cells o the plates into ThegelwasthenSouthernblottedtoanylonmembrane 2.5 ml PBS. Cell suspensions were centrifuged 5 min at (Hybond, Amersham) using standard protocols. The blot 1000 g. Cell pellets were lysed in 100 ml hypotonic buer was probed with a SmaI fragment isolated from skip, 32 (25 mM Tris-HCl pH 7.5, 1 mM MgCl2,5mM KCl, 1 mM which was random primed labeled with [a P]CTP PMSF) containing 0.5% NP-40. Immediately after lysis, (Amersham) using the Boehringer Mannheim Random sucrose was added to a ®nal concentration of 0.25 M. Prime Labeling kit. The following primers were used in Samples were centrifuged at 1000 g at 48C to pellet nuclei. the PCR reactions: SKIP forward CCATGTGGCCCAG- Supernatant was saved as the cytosolic fraction. Nuclei TATCC, and SKIP reverse GGAGAAGGTGGTC- were washed in hypotonic buer plus 0.5% NP-40 and CCCGGGG. then lysed in 100 mlRIPAbuer(10mMTris HCl, pH 7.4, 150 mM NaCl,1%DOC,1%NP40,and0.2%SDS). Samples were immunoblotted using standard techniques. Monoclonal antibody 12CA5 was used to recognize Acknowledgements hemagglutinin tagged Skip protein. We wish to thank S Fields for two-hybrid vectors, S Elledge for Y153 and the lymphoid cDNA library, C-Y Park for GST-cSHP2, E Stavnezer for monoclonal anti-Ski Immuno¯uorescence antibody (G8) and S Hughes for polyclonal anti-Ski COS1 cells seeded onto glass coverslips were transfected antibody and plasmid RCAS-SnoN. We are very grateful with 5 mg of the respecive expression vectors. Approxi- to J Scheppler for isolation of cell line RNA, W Theurkauf mately 36 h post transfection, cells were washed three times for help with immuno¯uorescence, and to P Chan and R in PBS, ®xed in 3.7% formaldehyde for 20 min at room Babb for help with subcloning of ski constructs. We are temperature, permeabilized for 3 min in 1% Triton X-100 also grateful to C Polk, and O Sibon for critical reading of in PBS, and incubated in 2% normal goat serum/1% BSA the manuscript. BW was funded in part by a Howard in PBS for 1 h at room temperature. After each step cells Hughes Medical Institute Undergraduate Fellowship. This were washed three times in PBS. HA-Skip transfected cells work was supported by a grant from the National Cancer were treated with 1 : 25 diluted anti-HA (12CA5) mono- Institute to MJH (CA42573).

References

Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ. Colmenares C and Stavnezer E. (1989). Cell, 59, 293 ± 303. (1990). J. Mol. Biol., 215, 403 ± 410. Colmenares C and Stavnezer E. (1990). Semin. Cancer Biol., Barkas AE, Brodeur D and Stavnezer E. (1986). Virology, 1, 383 ± 387. 151, 131 ± 138. Colmenares C, Sutrave P, Hughes SH and Stavnezer E. Bartel PL, Chien CT, Sternglanz R and Fields S. (1993). (1991a). J. Virol., 65, 4929 ± 4935. Cellular interactions in development: A practical approach. Colmenares C, Teumer JK and Stavnezer E. (1991b). Mol. Hartley, DA (ed). IRL Press: Oxford. Cell. Biol., 11, 1167 ± 1170. Beug H, Dahl R, Steinlein P, Meyer S, Deiner EM and Diehl BE and Pringle JR. (1991). Genetics, 127, 287 ± 298. Hayman MJ. (1995). Oncogene, 11, 59 ± 72. Durfee T, Becherer PL, Chen SH, Yeh Y, Yang Y, Kilburn Boguski MS. (1995). Trends Biochem. Sci., 20, 295 ± 296. AE, Lee WH and Elledge SJ. (1993). Genes Dev., 7, 555 ± Boyer PL, Colmenares C, Stavnezer E and Hughes SH. 569. (1993). Oncogene, 8, 457 ± 466. Engert JC, Servaes S, Sutrave P, Hughes SH and Rosenthal Chen C and Okayama H. (1987). Mol. Cell. Biol., 7, 2745 ± N. (1995). Nucleic Acids Res., 23, 2988 ± 2994. 2752. Identification of a Ski interacting protein RDahlet al 1586 Folk P, Puta F, Krpejsova L, Blahuskova A, Markos A, Sambrook J, Fritsch EF and Maniatis T. (1989). Molecular Rabino M and Dottin RP. (1996). Gene, 181, 229 ± 231. Cloning: A Laboratory Manual. Cold Spring Harbor Frasch M and Saumweber H. (1989). Chromosoma, 97, 272 ± Press, Cold Spring Harbor, New York. 281. Sanger F, Nicklen S and Coulson AR. (1977). Proc. Natl. Harris SD, Cheng J, Pugh TA and Pringle JR. (1992). J. Mol. Acad. Sci. USA, 74, 5463 ± 5467. Biol., 225, 53 ± 65. Saumweber H, Frasch M and Korge G. (1990). Chromosoma, Heyman HC and Stavnezer E. (1994). J. Biol. Chem., 269, 99, 52 ± 60. 26996 ± 27003. Schiestl RH and Gietz RD. (1989). Curr. Genet., 16, 339 ± Homan CS and Winston F. (1987). Gene, 57, 267 ± 272. 346. Kaufman RJ, Wasley LC, Spiliotes AJ, Gossels SD, Latt SA, Sleeman JP and Laskey RA. (1993). Oncogene, 8, 67 ± 77. Larsen GR and Kay RM. (1985). Mol. Cell. Biol., 5, Smith DB and Johnson KS. (1988). Gene, 67, 31 ± 40. 1750 ± 1759. Stavenezer E, Barkas AE, Brennan LA, Brodeur D and Li Y. Kozak M. (1989). J. Cell. Biol., 108, 229 ± 241. (1986). J. Virol., 57, 1073 ± 1083. Larsen J, Beug H and Hayman MJ. (1992). Oncogene, 7, Stavnezer E, Brodeur D and Brennan LA. (1989). Mol. Cell. 1903 ± 1911. Biol., 9, 4038 ± 4045. Lehmann M and Korge G. (1995). EMBO J., 14, 716 ± 726. Stavnezer E, Gerhard DS, Binari C and Balzas I. (1981). J. Li N, Batzer A, Daly R, Yajnik V, Skolnik E, Chardin P, Virol., 39, 920 ± 934. Bar-Sagi D, Margolis B and Schlessinger J. (1993). Nature, Sutrave P, Copeland TD, Showalter SD and Hughes SH. 363, 85 ± 88. (1990a). Mol. Cell. Biol., 10, 3137 ± 3144. Nagase T, Mizuguchi G, Nomura N, Ishizaki R, Ueno Y and Sutrave P and Hughes SH. (1989). Mol. Cell. Biol., 9, 4046 ± Ishii S. (1990). Nucleic Acids Res., 18, 337 ± 343. 4051. Nagase T, Nomura N and Ishii S. (1993). J. Biol. Chem., 268, Sutrave P, Kelly AM and Hughes SH. (1990b). Genes Dev., 4, 13710 ± 13716. 1462 ± 1472. Nomura N, Sasamoto S, Ishii S, Date T, Matsui M and Tanaka M and Herr W. (1990). Cell, 60, 375 ± 386. Ishizaki R. (1989). Nucleic Acids Res., 17, 5489 ± 5500. Tsai S, Bartelmez S, Sitnicka E and Collins S. (1994). Genes Park C-Y, La Montagne KR, Tonks NK and Hayman MJ. Dev., 8, 2831 ± 2841. (1996). Gene, 177, 93 ± 97. Romero F, Dargemont C, Pozo F, Reeves WH, Camonis J, Gisselbrecht S and Fischer S. (1996). Mol. Cell. Biol., 16, 37 ± 44.