D3-Deficient Mice Is Compensated by Cyclin D2 in Cyclin of Normal B-1A

Disruption of Cyclin D3 Blocks Proliferation of Normal B-1a Cells, but Loss of Cyclin D3 Is Compensated by Cyclin D2 in Cyclin D3-Deficient Mice This information is current as of September 28, 2021. Jennifer M. Mataraza, Joseph R. Tumang, Maria R. Gumina, Sean M. Gurdak, Thomas L. Rothstein and Thomas C. Chiles J Immunol 2006; 177:787-795; ; doi: 10.4049/jimmunol.177.2.787 Downloaded from http://www.jimmunol.org/content/177/2/787

References This article cites 51 articles, 21 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/177/2/787.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Disruption of Cyclin D3 Blocks Proliferation of Normal B-1a Cells, but Loss of Cyclin D3 Is Compensated by Cyclin D2 in Cyclin D3-Deﬁcient Mice1

Jennifer M. Mataraza,* Joseph R. Tumang,† Maria R. Gumina,* Sean M. Gurdak,† Thomas L. Rothstein,2†‡ and Thomas C. Chiles3*

Peritoneal B-1a cells differ from splenic B-2 cells in the molecular mechanisms that control G0-S progression. In contrast to B-2 cells, cyclin D2 is up-regulated in a rapid and transient manner in phorbol ester (PMA)-stimulated B-1a cells, whereas cyclin D3 does not accumulate until late G1 phase. This nonoverlapping expression of cyclins D2 and D3 suggests distinct functions for these proteins in B-1a cells. To investigate the contribution of cyclin D3 in the proliferation of B-1a cells, we transduced p16INK4a peptidyl mimetics

(TAT-p16) into B-1a cells before cyclin D3 induction to specifically block cyclin D3-cyclin-dependent kinase 4/6 assembly. TAT-p16 Downloaded from inhibited DNA synthesis in B-1a cells stimulated by PMA, CD40L, or LPS as well as endogenous pRb phosphorylation by cyclin D-cyclin-dependent kinase 4/6. Unexpectedly, however, cyclin D3-deficient B-1a cells proliferated in a manner similar to wild-type B-1a cells following PMA or LPS stimulation. This was due, at least in part, to the compensatory sustained accumulation of cyclin D2 throughout G0-S progression. Taken together, experiments in which cyclin D3 was inhibited in real time demonstrate the key role this cyclin plays in normal B-1a cell mitogenesis, whereas experiments with cyclin D3-deficient B-1a cells show that cyclin D2 can compensate for cyclin D3 loss in mutant mice. The Journal of Immunology, 2006, 177: 787–795. http://www.jimmunol.org/

he D-type cyclins are regulatory subunits of cyclin-de- of cyclin D-independent mechanisms to initiate mitogen-induced pendent kinase (cdk)4 4 and cdk6 (1–6). Unlike other proliferation (13–15). T cyclins whose protein levels oscillate during the cell cy- The three D-type cyclins (cyclins D1, D2, and D3) are encoded cle, accumulation of D-type cyclins is dependent on mitogenic and by separate genes that exhibit a high degree of amino acid homol- oncogenic signals (1, 2). Cyclin D-cdk4/6 complexes initiate phos- ogy and are expressed in adult tissues in a partially overlapping phorylation of the retinoblastoma tumor suppressor protein (pRb) fashion (16, 17). Mice homologous for genetic disruptions in in- and pRb-related “pocket proteins” p107 and p130; this promotes dividual D-type cyclin genes are viable and display narrow, tissue- by guest on September 28, 2021 dissociation of E2F from pRb, which reverses its G1-S inhibitory specific phenotypes, suggesting redundant function contributing to function, in part, by induction of E2F target genes (4–9). In ad- viable animals (18). Splenic B-2 lymphocytes express cyclins D2 dition, several lines of evidence point to a second noncatalytic and D3, but not cyclin D1 following BCR cross-linking (19–20). function of D-type cyclin-cdk complexes in G0-S progression by Evaluation of bone marrow and spleen from cyclin D2-deficient sequestering members of the Cip/Kip family (9). By contrast, the mice reveals normal numbers of B220ϩIgMϩ B lymphocytes (21, INK4a p16 tumor suppressor protein uniquely interacts with cdk4 22); however, the peritoneal CD5ϩ B-1 cell population is severely and cdk6, blocking cdk4/6-mediated pRb phosphorylation and diminished in cyclin D2-deficient mice (22). Cyclin D2-deficient leading to G -phase arrest (10–12). Recent analyses of mice lack- 1 B-2 cells also exhibit impaired proliferation in response to BCR ing D-type cyclins, or their catalytic partners cdk4 and cdk6, reveal cross-linking; that proliferation is not completely blocked may be that these proteins are critically required for proliferation only in due to redundancy with cyclin D3 in this tissue (23). Although selected tissues of the developing embryo, suggesting the existence little is known about the regulation and function of cyclin D3 in B cell subsets, B-2 cells deficient in c-Rel exhibit diminished cyclin *Department of Biology, Boston College, Chestnut Hill, MA 02467; †Department of D3 induction in response to BCR cross-linking (24). Interestingly, Medicine, Boston University School of Medicine, Boston, MA 02118 and Immuno- the cyclin D3 gene promoter contains multiple transcription factor biology Unit, Evans Memorial Department of Clinical Research, Boston University ␬ Medical Center, Boston, MA 02118; and ‡Department of Microbiology, Boston Uni- recognition sites, including NF- B-binding sites (25). versity School of Medicine, Boston, MA 02118 B-1 cells constitute a unique set of B lymphocytes, distinguished Received for publication December 20, 2005. Accepted for publication April from B-2 cells by numerous phenotypic and functional character- 19, 2006. istics (26–29). B-1 cells are further subdivided into CD5ϩ (B-1a) The costs of publication of this article were defrayed in part by the payment of page or CD5Ϫ (B-1b) cells and in adult mice represent the principal charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. lymphocyte population in the peritoneal cavity (26, 28, 30). B-1a 1 This work was supported by U.S. Public Health Service Grants AI-49994 (to cells are responsible for the majority of nonimmune serum IgM T.C.C.) and AI-60896 (to T.L.R.). and contribute considerable amounts of “resting” IgA (30). B-1a 2 Current address: Center for Oncology and Cell Biology, The Feinstein Institute for cells are associated with several human disease states character- Medical Research, 350 Community Drive, Manhasset, NY 11030. ized by aberrant B cell growth. In mice, monoclonal expansions of 3 Address correspondence and reprint requests to Dr. Thomas C. Chiles, Department B-1a cells that resemble human chronic lymphocytic leukemia de- of Biology, Boston College, 414 Higgins Hall, Chestnut Hill, MA 02467. E-mail address: [email protected] velop as a function of age; further, New Zealand Black mice, 4 Abbreviations used in this paper: cdk, cyclin-dependent kinase; MZ, marginal zone; which contain increased numbers of B-1a cells, develop several AML1, acute myeloid leukemia 1. types of B-1a-derived lymphoid malignancies in early life (31–33).

In adult animals, peritoneal B-1a cells are self-replenishing, giv- LT software (Verity Software House). To measure proliferation, B cells ing rise to their own progeny, following establishment early during (1–2 ϫ 104 in 0.2 ml) were cultured in quadruplicate and stimulated as ontogeny, whereas B-2 cells arise continually from surface Ig- indicated in the figure legends. DNA synthesis was measured by incubating B cells with 0.5 ␮Ci [3H]thymidine (20 Ci/mmol; New England Nuclear) negative stem cell precursors and fail to proliferate following mat- during the last6hofculture. Cells were then harvested onto glass fiber uration in the absence of exogenous stimulation (30, 34). Ex vivo filters and [3H]thymidine incorporation into DNA was quantitated by liquid B-1a cells fail to proliferate following BCR cross-linking, which scintillation spectroscopy. drives B-2 cells into S phase (35, 36). Conversely, B-1a cells enter Western blotting S phase in response to PMA and do so unusually rapidly, whereas B-2 cells require the combination of PMA and a calcium iono- B cells were solubilized in Triton X-100 buffer (20 mM Tris (pH 7.4), 100 mM NaCl, 0.1% Triton X-100) containing 2.5 ␮g/ml leupeptin/aprotinin, phore (35, 37). These results establish that B-1a cells differ from ␤ 10 mM -glycerophosphate, 1 mM PMSF, 1 mM NaF, and 1 mM Na3VO4. B-2 cells in the molecular mechanisms that control G0-S phase Insoluble debris was removed by centrifugation at 15,000 ϫ g for 15 min progression. In support of this, cyclins D2 and D3 are expressed in (4°C). Lysate protein was separated by electrophoresis through a 10% polyacrylamide SDS gel (SDS-PAGE) and transferred to an Immobilon-P a nonoverlapping manner during G0-S progression in PMA-stimulated B-1a cells (38, 39). Notably, cyclin D2 is up-regulated in a membrane. The membrane was blocked in TBS-T (20 mM Tris (pH 7.6), 137 mM NaCl, and 0.05% Tween 20) containing 5% nonfat dry milk for rapid and transient fashion in B-1a cells, whereas cyclin D3 in- 5 h and then incubated overnight (4°C) with primary Ab at 1 ␮g/ml in duction and assembly into active cdk4/6-containing complexes oc- TBS-T. The membrane was washed several times in TBS-T, incubated curs after cyclin D2 degradation and parallels peak endogenous with a 1/2500 dilution of anti-rabbit or anti-mouse IgG-coupled HRP Ab (60 min) and developed by ECL. pRb phosphorylation in late G1 phase (39). In marked distinction, mitogenic stimulation of B-2 cells leads to coordinate induction of Fluorescence microscopy Downloaded from cyclins D2 and D3 (19, 20, 40). Thus, in B-1a cells, but not B-2 For imaging the TAT-p16-FITC, slides were washed once with PBS and cells, stimulated expression of cyclin D2 and cyclin D3 is tempo- then mounted with Aqua Polymount. For imaging D-type cyclins, lympho- rally distinct. Taken together, these observations suggest that cy- cytes (2.5 ϫ 105) were fixed with methanol for 10 min at Ϫ20°C and then clin D3 is uniquely positioned in B-1a cells to mediate transition permeabilized with 0.1% Triton X-100 at room temperature. Cells were through the G -S boundary, which may, as well, reflect its role in blocked for 30 min with 2% BSA in PBS and then washed several times 1 with PBS. Detection of cyclin D2 and cyclin D3 was performed by incu- conventional B-2 cells where cyclin D3 expression overlaps that of bating cells with 1/50 anti-cyclin D2 or anti-cyclin D3 mAbs at 4°C, re- http://www.jimmunol.org/ cyclin D2. To investigate the need for cyclin D3-cdk complexes spectively. After several washes with PBS, cells were incubated with a for G0-S phase progression in normal B-1a cells, we used protein 1/200 FITC-conjugated Affinipure goat anti-mouse Ab (Jackson Immu- transduction technology to specifically block assembly and acti- noResearch Laboratories) for2hatroom temperature. The slides were then vation of cyclin D3 holoenzyme complexes in normal peritoneal dried, mounted with Aqua Polymount, and immunofluorescence images were captured with a Leica confocal microscope. B-1a cells, and we examined the proliferative responses of B-1a cells from cyclin D3-deficient mice. Gene expression RNA was prepared from B cells using Ultraspec reagent (BiotecX) and was Materials and Methods DNase treated. cDNA was prepared using an iScript cDNA Synthesis kit

␤ by guest on September 28, 2021 Preparation of murine B-1a and B-2 lymphocytes (Bio-Rad), and normalized by PCR for 2-microglobulin expression as previously described (42). Gene expression was then assessed by real-time The generation of cyclin D3-deficient mice has been described (41). ␤ PCR (Stratagene) using the following primers (forward/reverse): 2-mi- BALB/cByJ mice were purchased from The Jackson Laboratory and croglobulin (CCCGCCTCACATTGAAATCC/GCGTATGTATCAGTCT housed at Boston University Medical Center or Boston College. The stud- CAGTGG); cyclin D2 (TGGGCTTCAGCAGGATGATG/ACGGAAC ies described below were reviewed and approved by institutional animal TGCTGCAGGCTGT); cyclin E1 (TGGATTTGCTGGACAAAGCC/ care and use committees at both institutions. Mice were cared for and TGGATTTGCTGGACAAAGCC); cyclin E2 (TAGGAATTGTTGGCCA handled at all times in accordance with National Institutes of Health and CCTGT/AATCTGGCAGAGGTGAGGGAT); E2F-1 (GAGGCTGGATC University guidelines. Unseparated cells were obtained by peritoneal wash- TGGAGACTGA/CAAGAAGCGTTTGGTGGTCA); and VH11 (GCAAT out and splenic disruption, were stained with immunofluorescent Abs di- AAACTACGCACCATCCA/TGTCCTCCGATCGCACATT). Primers for rected against B220 and CD5, and were subjected to FACS at 4°C using a GAPDH and a GAPDH TaqMan probe were obtained from Applied Mo-Flo flow cytometer (DakoCytomation) to yield purified peritoneal B-1a Biosystems. (B220ϩCD5ϩ) and splenic B-2 (B220ϩCD5Ϫ) cells, including the use of an anti-CD8 “dump” channel for B cell purification, as previously de- ELISPOT scribed (42). Sort-purified B cell populations were reanalyzed by immunofluorescent staining with Abs directed against CD3 and CD14. Sort- Spontaneous secretion of IgM was measured as described previously (45). Ͼ Naive, FACS-sorted B-1 and B-2 cells, and FACS-sorted B-2 cells stim- purified peritoneal B-1a cells and splenic B-2 cells were found to be 95% ␮ (SEM Ϯ 0.98%) and Ͼ96% (SEM Ϯ 0.84%) pure, respectively. In addi- ulated with LPS at 25 g/ml for 48 h, were distributed at various concen- Ͻ ϩ ϩ trations onto Multiscreen-IP plates (Millipore) precoated with goat anti- tion, both populations contained 1.8% and 1.2% CD3 or CD14 cells, ϩ respectively. B cells were cultured in RPMI 1640 medium supplemented mouse Ig (H L; Southern Biotechnology Associates) and then incubated with 10% heat-inactivated FCS (Atlanta Biologicals) as previously de- for3hat37°C and 5% CO2. Plates were treated with alkaline phosphatase- scribed (39). conjugated goat anti-mouse IgM (Southern Biotechnology Associates) and developed with 5-bromo-4-chloro-3-indolyl phosphate/p-NBT chloride TAT-p16 peptides substrate (KPL). Spots reflecting Ig-secreting cells were enumerated using Phoretix Expression software (NonLinear Dynamics). Peptides were synthesized by the Biotechnology and Genomics Research Center (Utah State University, Logan, UT). The 32-mer peptides contain Reagents and Abs an NH -terminal 11 residue TAT protein transduction domain 2 Protein G agarose and anti-mouse IgG-coupled HRP, anti-mouse cdk4, (YGRKKRRQRRR) immediately followed by a glycine residue and either anti-cyclin D2, and anti-cyclin D3 Abs (Abs) were purchased from Santa a 20-mer wild-type p16 sequence (DAAREGFLATLVVLHRAGAR) or a Cruz Biotechnology. The phospho-pRb (Ser807/811) and phospho-cdk2 charge-match control sequence (ARGRALTAHVDRLGEFVAAL), as de- (Thr172) Abs were obtained from Cell Signaling Technologies. Rabbit scribed (43, 44). complement and Lympholyte M were purchased from Accurate Chemical Cell cycle analysis and proliferation assay and Scientific. All other chemicals were obtained from Sigma-Aldrich. Fluorescent-labeled Abs directed against B220, CD5, CD23, Mac-1, CD4, B cells (105) were resuspended in 300 ␮l of PBS containing 0.1% (v/v) CD8, CD3, and CD14 for FACS and flow cytometric analysis were ob- Triton X-100, 200 ␮g/ml DNase-free RNase A, and 20 ␮g/ml propidium tained from BD Pharmingen. ECL reagents were obtained from Kirkegaard iodide (42). B cell fluorescence was then acquired with a BD FACSCanto & Perry Laboratories. PMA and LPS from Salmonella typhimurium (LPS) flow cytometer (BD Biosciences) and the data were analyzed by ModFit were obtained from Sigma-Aldrich and used at 300 ng/ml and 25 ␮g/ml, The Journal of Immunology 789

respectively. Soluble rCD40L was obtained from transfected J558L cells that secrete a chimeric CD40L/CD8␣ fusion protein and prepared as previously described (46, 47). Anti-CD8␣ Ab was obtained from the supernatant of 53-6-72 hybridoma cells and was used to cross-link rCD40L (47). CD40L was used at a 1/10 dilution of supernatant and anti-CD8␣ Ab was used at a 1/40 dilution of supernatant. Results TAT-p16INK4a peptidyl mimetics are transduced into ex vivo peritoneal B-1a cells and disrupt endogenous D-type cyclin-cdk4/6 complexes Our strategy for determining whether cyclin D3-cdk4/6 complexes are required for proliferation of B-1a cells was to precisely target cyclin D3-cdk4/6 holoenzymes by transducing p16INK4a peptidyl mimetics into ex vivo B-1a cells. Lane and coworkers (43) dem- onstrated that a 20-mer peptide derived from the third ankyrin-like repeat of the p16INK4a tumor suppressor protein selectively bound to cdk4 and cdk6 and inhibited cdk4/6-mediated pRb phosphory- FIGURE 2. TAT-p16 wild-type peptide blocks formation of cyclin D3- lation in vitro. To mediate efficient transduction into B-1a cells, we cdk4 complexes in B-1a cells. A, Peritoneal B-1a cells were stimulated with 300 ng/ml PMA to induce the expression of cyclin D3 and assembly Downloaded from coupled the p16INK4a peptidyl mimetic to an 11-mer peptide con- of cyclin D3-cdk4 complexes (Control). In parallel sets of B-1a cells, 10 sisting of the NH2-terminal HIV TAT protein domain (denoted ␮M TAT-p16 wild-type (p16 WT) or TAT-p16 mutant (p16 Mut) peptides herein as TAT-p16 wild type) (44). Flow cytometry revealed trans- were added at 14 h after PMA, before cyclin D3 induction. At 20 h, B-1a duction of nearly 100% of B-1a cells that had been incubated with cells were collected and immunoprecipitated (IP) with 1.5 ␮g of anti-cdk4 TAT-p16-FITC wild-type peptide for 120 min (Fig. 1A). Confocal Ab as described (39). The immune complexes were separated by SDS- microscopy of parallel B-1a cells confirmed intracellular transduc- PAGE and Western blotted with anti-cyclin D3 Ab. The blot was also tion of TAT-p16-FITC wild-type peptide into B-1a cells (Fig. 1B). probed with anti-cdk4 Ab to ensure that equal amounts of cdk4 were im- http://www.jimmunol.org/ To demonstrate in vivo efficacy, 10 ␮M TAT-p16 wild-type munoprecipitated. B, Asynchronously growing Bal17 B cells were simi- peptides were transduced into PMA-stimulated B-1a cells, which larly treated with the TAT-p16 peptides for 4 h; B cells were then collected, ␮ express cyclin D3-cdk4 complexes as evidenced by immunoreac- immunoprecipitated (IP) with 1.5 g of anti-cyclin D2 Ab, and the immune complexes were analyzed by Western blot with anti-cdk4 Ab. The blot was tive cyclin D3 in nondenatured anti-cdk4 immunoprecipitates (Fig. also probed with anti-cyclin D2 Ab to ensure that equal amounts of cyclin 2A, Control) (39). Transduction of TAT-p16 wild-type peptide into D2 were immunoprecipitated. C, B-1a cells were cultured in medium alone B-1a cells before cyclin D3 induction prevented cyclin D3-cdk4 (M) or stimulated with 300 ng/ml PMA for 24 h to induce cyclin E-cdk2 assembly. Where indicated, 10 ␮M TAT-p16 wild-type (p16 WT) or TAT- p16 mutant (p16 Mut) peptides were added during the last4hofPMA by guest on September 28, 2021 treatment. Phosphorylation of cdk2 on Thr172 was detected by Western blotting with an anti-phospho(Thr172)-cdk2 Ab. The blot was stripped and reprobed with an anti-␤-actin Ab. The data are representative of two independent experiments.

complex assembly (Fig. 2A, p16WT); a control charge-matched TAT-p16 (TAT-p16 mutant) peptide, that is unable to bind to cdk4 or cdk6, did not block cyclin D3-cdk4 complex assembly (Fig. 2A, p16Mut). Similar results were obtained when evaluating the efficacy of TAT-p16 peptides with respect to endogenous cyclin D3- cdk6 complexes (data not shown). Asynchronously growing murine Bal17 B cells were analyzed in parallel, as they constitutively express assembled cyclin D2-cdk4 complexes (Fig. 2B, Control). Transduction of TAT-p16 wild-type peptide disrupted endogenous cyclin D2-cdk4 complexes, whereas the TAT-p16 mutant peptide had minimal effect (Fig. 2B). As a control for specificity, we measured cdk-activating kinase-mediated Thr172 phosphorylation of cdk2; this modification occurs subsequent to the nuclear translo- cation of cyclin E-cdk2 and, thus, serves as an indicator for the presence of cyclin E-cdk2 complexes. Transduction of TAT-p16 wild-type peptide into PMA-stimulated B-1a cells before cyclin E-cdk2 assembly did not measurably affect PMA-induced Thr172 phosphorylation of cdk2 (Fig. 2C, PMA). FIGURE 1. Transduction of TAT-p16 wild-type peptide into B cells. A, B-1a cells were incubated for 120 min in the presence of 10 ␮M TAT- Transduction of TAT-p16 wild-type peptide into normal p16-FITC peptide, washed once in PBS, and analyzed by flow cytometry peritoneal B-1a cells inhibits proliferation (TAT-p16). Untreated cells were analyzed for comparison (Control). B, Parallel B cells were visualized by microscopy as described in Materials To directly evaluate the contribution of cyclin D3-cdk4/6 com- and Methods. Both bright field (left panel) and fluorescence (right panel) plexes in B-1a cell proliferation, we took advantage of the non- images were collected at ϫ100 magnification. The data are representative overlapping expression of cyclins D2 and D3 in PMA-stimulated for three independent experiments. B-1a cells (38, 39). Blocking the assembly of temporally expressed 790 ROLE OF CYCLIN D3 IN B-1a CELL PROLIFERATION cyclin D3-cdk4/6 complexes was achieved by transducing the dogenous pRb on Ser807/811 was markedly inhibited following TAT-p16 wild-type peptide into B-1a cells at 14 h after stimulation transduction of TAT-p16 wild-type, but not TAT-p16 mutant, pep- with PMA. This time corresponds to a point in the cell cycle tides into B-1a cells (Fig. 3C). Total pRb protein levels were not wherein cyclin D2 protein is not detectable and cyclin D3 protein altered by transduction of the TAT-p16 peptides. These results induction has not yet begun (initially detectable at 17 h). B-1a cells indicate that TAT-p16 wild-type peptide blocks endogenous pRb transduced with TAT-p16 wild-type peptide exhibited a Ͼ70% phosphorylation by cyclin D-cdk4/6 complexes in PMA stimulated reduction in PMA-stimulated tritiated thymidine incorporation in B-1a cells. comparison to control B-1a cells or B-1a cells transduced with TAT-p16 mutant peptide (Fig. 3A). Similar results were obtained Cyclin D3-deficient mice have normal peripheral B-1 and B-2 with B-1a cells stimulated with LPS or CD40L (Fig. 3A). Of note, lymphocyte compartments incubation of nonstimulated B-1a cells with TAT-p16 peptides did Because the results above indicate that cyclin D3-cdk4/6 com- not alter the basal level of tritiated thymidine incorporation (Fig. plexes are required for mitogenic stimulation of normal B-1a cells, 3A, Medium). To corroborate these findings, we analyzed B-1a we were interested in determining whether B-1a cell development cells for cell cycle position by propidium iodide staining and flow and proliferation were affected by loss of cyclin D3 (41). To pur- cytometry. Transduction of TAT-p16 mutant peptide into PMA- sue this, we initially evaluated the splenic and peritoneal lymphoid stimulated B-1a cells had a minimal effect on the percentage of compartments of cyclin D3-deficient mice. To confirm the absence ϩ B-1a cells in S/G2 M phases of the cell cycle in comparison to of cyclin D3 in D3-deficient animals, total splenic lymphocytes control B-1a cells (Fig. 3B, PMA). By contrast, transduction of were stimulated with a combination of mitogens known to induce

ϩ Downloaded from TAT-p16 wild-type peptide reduced the percentage of S/G2 M cyclins D2 and D3 in both T and B lymphocyte populations (19, B-1a cells by 70% in comparison to B-1a cells transduced with 20, 24, 40); whereas up-regulation of both cyclins D2 and D3 was TAT-p16 mutant peptide. Similar results were obtained with LPS- apparent in spleen cells from wild-type mice, only cyclin D2 was or CD40L-stimulated B-1a cells (Fig. 3B). induced in cyclin D3-deﬁcient splenic lymphocytes and no cyclin To determine the status of endogenous pRb phosphorylation in D3 protein was observed (Fig. 4A). Cyclin D3-deﬁcient spleens B-1a cells treated with TAT-p16 wild-type peptide, whole cell contained a decreased number of total lymphocytes as compared

extracts were prepared and immunoblotted with anti- with spleens obtained from wild-type littermate animals, which http://www.jimmunol.org/ phospho(Ser807/811)pRb Ab that specifically detects cyclin immunofluorescent staining showed was largely attributable to de- D-cdk4/6-mediated phosphorylation of pRb. Unstimulated B-1a creased numbers of B-2 cells (Fig. 4, B and C). However, there cells did not express measurable pRb phosphorylation, whereas was no difference between cyclin D3-deficient mice and wild-type PMA stimulated B-1a cells exhibited abundant phosphorylation of littermates in the total number of peritoneal cells, and, more spe- endogenous pRb on Ser807/811 (Fig. 3C). Phosphorylation of en- cifically, the numbers of B-1a cells (CD5ϩB220lowMac-1ϩ), B-1b by guest on September 28, 2021

FIGURE 3. TAT-p16 wild-type peptide inhibits DNA synthesis in B-1a cells in response to PMA, LPS, or CD40L. B-1a cells were cultured in medium alone, 300 ng/ml PMA, 25 ␮g/ml LPS, or CD40L for 24 h. Where indicated, 10 ␮M TAT-p16 wild-type (WT) or TAT-p16 mutant (Mut) peptides were added at 14-h postmitogen addition. Control (C) denotes B-1a cells cultured in the absence of added peptides. A, DNA synthesis was monitored by tritiated thymidine incorporation. Mean results are shown, along with lines indicating SEs of the means (n ϭ 4). B, B-1a cells were stained with propidium iodide ϩ and analyzed by ﬂow cytometry as described in Materials and Methods. The data are represented as the percentage of B-1a cells in the S G2-M phase of the cell cycle. The data are representative of three independent experiments. C, B-1a cells were cultured in medium alone (M) or stimulated with 300 ng/ml PMA in the absence or presence of 10 ␮M TAT-p16 wild-type (p16WT) or TAT-p16 mutant (p16Mut) peptides as described in A. Whole cell extracts were prepared, and Western blotting was performed with an anti-phospho-pRbSer807/811 Ab. The blot was stripped and reprobed with anti-pRb Ab. The Journal of Immunology 791 Downloaded from

FIGURE 4. Characteristics of B-1a cell lymphoid compartments in wild-type and cyclin D3-deficient mice. A, Total splenic lymphocytes were isolated from wild-type (ϩ/ϩ) and cyclin D3-deficient mice (Ϫ/Ϫ) and were either left untreated (M) or were stimulated (S) with a mitogenic combination consisting of 300 ng/ml PMA plus 400 ng/ml ionomycin and 25 ␮g/ml LPS. At 24 h, lymphocytes were collected, detergent extracts were prepared, and http://www.jimmunol.org/ then Western blotting was performed with anti-cyclin D2 or anti-cyclin D3 Abs. The blot was stripped and reprobed with an anti-␤-actin Ab to verify equal loading of each lane. B, Peritoneal washouts (peritoneum) and spleen cell suspensions (spleen) were obtained from cyclin D3-deficient mice (Ϫ/Ϫ, Ⅺ) and wild-type littermate control animals (ϩ/ϩ, u), and total cell numbers were determined. Mean results are shown, along with lines indicating SEs of the means (n ϭ 6). C, Spleen cell suspensions were obtained from cyclin D3-deficient (Ϫ/Ϫ) and littermate control mice (ϩ/ϩ). The distribution of splenic T cells (T-S; B220ϪCD5ϩ), B-2 cells (B-2S; B220ϩCD5Ϫ), and MZ cells (MZ-S; CD21highCD23low) was determined by immunofluorescent staining and flow cytometric analysis and converted to cell number based on initial cell counts. Mean numbers of cells in each lymphoid population are shown, along with lines indicating SEs of the means (n ϭ 6 except for MZ-S where n ϭ 2 and the line depicts the range of values). D, Peritoneal washout cells were obtained from cyclin D3-deficient (Ϫ/Ϫ) and littermate control mice (ϩ/ϩ). The distribution of peritoneal B-1a cells (B-1aP; B220lowCD5ϩMac-1ϩ), B-1b low Ϫ ϩ ϩ ϩ Ϫ ϩ Ϫ

cells (B-1bP; B220 CD5 Mac-1 ), B-2 cells (B-2P; B220 CD23 ), T cells (T-P; B220 CD5 Mac-1 ), and macrophages (M0-P); forward and side by guest on September 28, 2021 scatter high, Mac-1ϩ) was determined by immunofluorescent staining and flow cytometric analysis and converted to cell number based on initial cell counts. Mean numbers of cells in each lymphoid population are shown, along with lines indicating SEs of the means (n ϭ 6). cells (CD5ϪB220lowMac-1ϩ), B-2 cells, T cells and macrophages, compared the gene expression pattern of cyclin D2 and cyclin E in recovered by peritoneal washout (Fig. 4, B and D). wild-type and cyclin D3-deficient B-1a cells. These analyses re- Furthermore, as determined by real-time PCR, there was no dif- vealed little difference in the expression of mRNAs encoding cy- ference between cyclin D3-deficient and wild-type animals in the clins E1 and E2 in the PMA-stimulated B-1a cell populations (Fig. typically high level of peritoneal B-1a cell VH11 expression as 6A). In B-2 cells, E2F-1 induction by BCR cross-linking corre- compared with the relatively low level expression found in splenic sponds to late G1 phase of the cell cycle and coincides with pRb B-2 cells (Fig. 5A). In addition, as shown by ELISPOT (Fig. 5B), hyperphosphorylation (23). The expression of E2F-1 mRNA in there was no difference between cyclin D3-deficient and control PMA-stimulated B-1a cells from cyclin D3-deficient mice was animals in the typically high level of spontaneous B-1a cell IgM comparable to wild-type B-1a cells (Fig. 6A). In agreement with secretion as compared with the relatively low level characteristic our previous results in normal B-1a cells stimulated with PMA of naive B-2 cells which, as expected, was increased by LPS stim- (38), cyclin D2 mRNA was elevated at 2 h and reached a maximal ulation for 2 days. Thus, by several measures, the development and level within 4 h, which corresponded to a 1.3- and 2-fold increase function of cyclin D3-deficient peritoneal B-1a cells is normal. above nonstimulated B-1a cells, respectively (Fig. 6A). However, We next evaluated the role of cyclin D3 in peritoneal B-1a cell in PMA-stimulated cyclin D3-deficient B-1a cells, we detected a proliferation induced by PMA. In contrast to the results obtained 4.5- and 8.3-fold increase in cyclin D2 mRNA above the levels when cyclin D3-cdk4/6 complex assembly was prevented by trans- observed in nonstimulated B-1a cells at 2 and 4 h, respectively. In duction of TAT-p16 wild-type peptide into normal B-1a cells, we keeping with this, in PMA-stimulated cyclin D3-deficient B-1a found that cyclin D3-deficient B-1a cells responded comparably to cells, the level of endogenous cyclin D2 protein measured at 4 h wild-type B cells stimulated by PMA (Fig. 5C). In addition, the proliferation of cyclin D3-deficient B-1a cells in response to LPS was greater than that of parallel PMA-stimulated B-1a cells from ϳ was similar to wild-type B-1a cells (Fig. 5C). In data not shown, control wild-type mice ( 4.5-fold, based on scanning densitome- similar results were obtained with B-1a cell populations stimulated try of the ECL exposed film obtained after Western blot of B-1a with CD40L. cell lysates) (Fig. 6B). To obtain further evidence that this elevated induction of cyclin Deregulation of cyclin D2 expression in cyclin D3-deficient D2 may act to compensate for the loss of cyclin D3, we determined B-1a cells the expression of cyclin D2 protein in wild-type and mutant B-1a To understand the molecular basis of the apparently normal pro- cells by indirect immunofluorescence microscopy. As expected, liferation of cyclin D3-deficient B-1a cells in response to PMA, we cyclins D2 and D3 were not detected in nonstimulated B-1a cells 792 ROLE OF CYCLIN D3 IN B-1a CELL PROLIFERATION

and cyclin D3-deﬁcient B-1a cells (data not shown). Taken together, these results suggest that in contrast to wild-type B-1a cells, wherein cyclin D2 protein is induced in a rapid and transient manner, expression of cyclin D2 remains elevated throughout the

G0-S interval in cyclin D3-deficient B-1a cells stimulated with PMA. Evidence that cyclin D2 protein was functional in cyclin D3- deficient B-1a cells was provided by the measurable level of endogenous pRb phosphorylation on cyclin D-cdk4/6-targeted residues, detected by Western blotting of B-1a cell lysates at 21 h following PMA stimulation (Fig. 6B, lower panel); this level of pRb phosphorylation was comparable to wild-type B-1a cells stimulated with PMA. It is important to note that in addition to cyclin D3, cyclin D1 was not expressed in PMA stimulated cyclin D3- deficient B-1a cells (data not shown). Further evidence that PMA- induced proliferation of B-1a cells in the absence of cyclin D3 may result from compensation by cyclin D2 was obtained by transduction of TAT-p16 wild-type peptide into cyclin D3-deficient B-1a

cells, wherein only cyclin D2 expression is detectable, that resulted Downloaded from in an ϳ80% reduction of PMA-stimulated tritiated thymidine incorporation (in comparison to control B-1a cells or B-1a cells transduced with TAT-p16 mutant peptide) (Fig. 6D).

Discussion

To summarize the ﬁndings herein, the temporal disjunction be- http://www.jimmunol.org/ tween cyclin D2 and cyclin D3 expression in B-1a cells provided

the means to dissect the role of late G1-phase cyclin D3 in mediating mitogenic responses. Inhibition of cyclin D3-cdk4/6 complexes with TAT-p16 wild-type peptide blocked normal B-1a cell proliferation in response to PMA, LPS, and CD40L, indicating that unfettered early and transient up-regulation of cyclin D2 is insuf- ficient to drive normal B-1a cells into S phase of the cell cycle. However, complete loss of cyclin D3 did not adversely affect B-1a by guest on September 28, 2021 FIGURE 5. Functional aspects of B-1a cells in cyclin D3-deficient cell proliferation, because of a countervailing compensatory in- mice. A, Splenic B-2 (B-2S) and peritoneal B-1 (B-1P) cells were isolated crease in cyclin D2 mRNA and sustained accumulation of func- by cell sorting from cyclin D3-deficient (Ϫ/Ϫ) and littermate control mice tioning cyclin D2 protein in cyclin D3-null B-1a cells after stim- ϩ ϩ ( / ). VH11 expression was determined by real-time PCR and normalized ulation with PMA. Thus, dysregulated cyclin D2 can compensate to expression of GAPDH using primer sets described in Materials and for the loss of cyclin D3 in fostering B-1a cell cycle progression in Methods. Mean normalized values for three independent experiments are knock out mice. Our results also strike a cautionary note by dem- shown along with lines indicating SEs of the means. B, Splenic B-2 (B-2S) onstrating that compensation by cyclin D2 at the molecular or and peritoneal B-1 (B-1P) cells were isolated by cell sorting from cyclin cellular level in cyclin D3-deficient mice can mask the normal Ϫ Ϫ ϩ ϩ u D3-deficient ( / ) and littermate control mice ( / ). Naive B cells ( ), function that cyclin D3 provides in the mitogenesis of B-1a cells. and B-2S cells stimulated with 25 ␮g/ml LPS for 48 h (f), were applied Our previous findings raised the possibility that cyclin D3 is to precoated plates that were incubated for 3 h, after which IgM secretion was assessed by ELISPOT assay, as described in Materials and Methods. uniquely positioned to mediate G1-to-S phase progression in B-1a Results are shown for two mice per group, with lines indicating the range cells (38, 39). Notably, PMA stimulation of B-1a cells resulted in of values. C, B-1a cells from wild-type (WT) or cyclin D3-deficient (KO) an early and transient induction of cyclin D2; the assembled cyclin were cultured in medium alone (inset) or stimulated with 300 ng/ml PMA D2-cdk4/6 complexes were transiently active, but only accounted or 25 ␮g/ml LPS for the times indicated. Incorporation of tritiated thymi- for a relatively minor amount of the total endogenous pRb phos- dine was assessed for the final6hofculture as described in Materials and phorylation (38). Evidence for a second D-type cyclin functioning Methods. Results represent mean values of triplicate cultures with lines in G1-S progression was supported by our findings that cdk4/6- indicating SEs of the means. The data are representative of three indepen- mediated phosphorylation of endogenous pRb increased dramati- dent experiments. cally in late G1 phase (during a time period wherein cyclin D2 protein and its associated pRb kinase activity was not detectable); this coincided with the induction of cyclin D3 and its assembly (Fig. 6C, lane M); the weak fluorescence signal detected in non- with cdk4/6 into active pRb phosphorylating complexes (39). In stimulated B-1a cells was similar in intensity to that of parallel the present work, we were able to rapidly and efficiently transduce B-1a cells stained with a control isotype mAb (data not shown). TAT-p16 peptides into primary B-1a cells. This methodology al- Stimulation of wild-type B-1a cells with PMA resulted in the non- lows for biochemical manipulation of the entire ex vivo B-1a cell overlapping expression of cyclin D2 and cyclin D3 at 4 and 21 h, population at precisely timed intervals and avoids many of the respectively (Fig. 6C). In contrast, immunofluorescent staining of problems associated with transduction of expression plasmids, cyclin D2 in cyclin D3-deficient B-1a cells revealed that cyclin D2 such as artifacts induced by the unregulated expression of recom- was expressed at both 4 and 21 h post-PMA stimulation. It should binant proteins (44). p16 is known to bind to cdk4 and cdk6 and, be mentioned that similar results were obtained using flow cytom- consistent with that, TAT-p16 peptide, but not a charge-matched etry to evaluate intracellular D-type cyclin expression in wild-type mutant TAT-p16 peptide, blocked cyclin D3-cdk4/6 assembly and The Journal of Immunology 793 Downloaded from

FIGURE 6. Expression of cyclin D2 is dysregulated in PMA-stimulated cyclin D3-deﬁcient B-1a cells. A, Expression levels of cyclins D2, E1, and E2

ϩ ϩ F Ϫ Ϫ E ␤ http://www.jimmunol.org/ as well as E2F-1 in PMA-stimulated wild-type ( / )( ) and cyclin D3-deficient ( / )( ) B-1a cells relative to 2-microglobulin were determined by real-time PCR as described in Materials and Methods. Results are representative of two independent experiments. B, B-1a cells were isolated from wild-type (ϩ/ϩ) and cyclin D3-deficient mice (Ϫ/Ϫ) and cultured in medium alone (M) or stimulated with 300 ng/ml PMA (P) for 4 h. Whole cell extracts were prepared, and Western blotting was performed with anti-cyclin D2 Ab. The blot was stripped and reprobed with anti-␤-actin Ab. Parallel B-1a cells were cultured in medium alone (M) or stimulated with 300 ng/ml PMA (P) for 21 h and then Western blotted with anti-phospho-pRbSer807/811 Ab. C, B-1a cells from wild-type (cyclin D3ϩ/ϩ) and cyclin D3-deficient (cyclin D3Ϫ/Ϫ) mice were cultured in medium alone (M) or stimulated with 300 ng/ml PMA for 4 and 21 h. B-1a cells were collected and prepared for indirect immunofluorescence staining of cyclin D2 and cyclin D3 as described in Materials and Methods. The data are representative of two independent experiments. D, Cyclin D3-deficient B-1a cells were cultured in medium alone or stimulated with 300 ng/ml PMA for 24 h. Where indicated, 10 ␮M TAT-p16 wild-type (WT) or TAT-p16 mutant (Mut) peptides were added together with PMA. C denotes control B-1a cells cultured in the absence of added peptide. DNA synthesis was monitored by tritiated thymidine incorporation. Results represent mean values of triplicate cultures with lines indicating SEs of the means. The data are representative of two independent experiments. by guest on September 28, 2021 resulted in a loss of PMA-induced phosphorylation of endogenous revealed significantly decreased numbers of peritoneal B-1a cells, pRb specifically on D-type cyclin-cdk4/6-targeted residues. Trans- the molecular mechanism(s) underlying this loss remain to be duction of TAT-p16 peptide into normal B-1a cells results in in- established (22). hibition of proliferation, as evidenced by reduced PMA-stimulated It is recognized that although D-type cyclins show high amino tritiated thymidine incorporation and reduced percentage of B-1a acid homology within the cdk-binding region (75–78%), the extent ϩ cells in S/G2 M phases of the cell cycle. Similar results were of homology outside of this region is 39–47% (16, 17). Thus, we obtained with B-1a cells stimulated via LPS or CD40L. cannot rule out the possibility that separate from mediating pRb

Our results also indicate that in normal B-1a cells where cyclin phosphorylation and G1-S phase progression, cyclin D3 may carry D3-cdk4/6 complex assembly has been selectively blocked by out additional functions in B-1a cells. For example, D-type cyclins TAT-p16 peptide, the early and transient induction of cyclin D2 is exhibit cdk-independent functions that act as either negative or not sufficient to mediate proliferation induced by PMA, LPS, or positive regulators of transcription factors, such as STAT3 and CD40L. This might reflect the relatively low pRb kinase activity cyclin D-interacting myb-like protein-1, in addition to having a associated with cyclin D2-cdk4/6 complexes and/or the transient role in cell cycle regulation (reviewed in Ref. 2). Cyclin D3 was nature of cyclin D2 holoenzyme activation in stimulated B-1a cells identified as a negative regulator of the hemopoietic transcription (38). In the absence of additional pRb phosphorylation (mediated factor acute myeloid leukemia 1 (AML1), presumably by a mech- via cyclin D3-cdk4/6), the activity and duration of cyclin D2/cdk- anism that involves displacement of core-binding factor ␤ from mediated pRb phosphorylation alone may not be of sufficient AML1, thereby inhibiting AML1’s DNA binding to target gene strength to drive progression through the G1-S transition. On a promoters (49). Recent reports by Gu and coworkers (50, 51) have related point, it is highly unlikely that TAT-p16 peptide blocked served to extend the list of cyclin D3 partner proteins beyond tran- B-1a cell proliferation by interfering with levels of cyclin D2 that scriptional regulators to include the signal transduction protein ki- may be below the level of detection, because the pRb kinase ac- nase ERK3, and the translational regulator eIF3k. Notwithstand- tivity of cyclin D2 is relatively low as compared with cyclin D3 ing, our results provide the first direct evidence that cyclin D3 in and no measurable cyclin D2 kinase activity has been detected at the context of assembled cyclin D3-cdk complexes is required for

17 h after stimulation. Alternatively, cyclin D2 function may not the G1-S phase progression in stimulated, normal B-1a cells. be directly involved in proliferation, but rather may be limited to We further analyzed the function of cyclin D3 by isolating and promoting B-1a cell growth (i.e., accumulation of cell mass), oc- then stimulating B-1a cells from cyclin D3-deficient mice. Mice curring in early G1 phase of the cell cycle (48). It should be men- homozygous for a mutant allele containing a targeted deletion of tioned that while the analysis of cyclin D2-deficient mice has the first two coding exons of cyclin D3 are viable, but suffer from 794 ROLE OF CYCLIN D3 IN B-1a CELL PROLIFERATION defects in thymocyte development characterized by reduced ablation of cyclin D3 would then be envisaged to relieve this re- CD4ϩCD8ϩ double-positive T cells (41). Cyclin D3-null thymo- striction, thereby allowing for sustained accumulation of cyclin D2 cytes fail to undergo the proliferative burst associated with the throughout the G0-S interval. It remains unclear whether the ap- CD4ϪCD8Ϫ double-negative 3 to double-negative 4 transition. parent compensatory mechanism for cyclin D2 up-regulation iden- Our analyses herein of cyclin D3-deficient splenocytes revealed a tified here is present (but not activated) in wild-type B-1a cells, or decrease over wild-type littermates in the total cell number pro- only comes into play when cyclin D3 is completely absent. Addi- duced, in large part, by a decrease in the number of splenic B-2 tional experiments are underway to understand the molecular basis (and not marginal zone) B cells that remains unexplained. Impor- for the sustained accumulation of cyclin D2 in cyclin D3-deficient tantly, we found that cyclin D3 deficiency did not impact the peri- B-1a cells. toneal B-1a cell compartment, as the numbers of peritoneal B-1a and B-1b cells in cyclin D3-deficient mice were comparable to Acknowledgments wild-type littermates. Furthermore, increased VH usage and spon- We thank Dr. Peter Sicinski (Department of Cancer Biology, Dana-Farber taneous IgM secretion were similar for peritoneal B-1a cells in Cancer Institute and Department of Pathology, Harvard Medical School, cyclin D3-deficient mice as compared with wild-type littermates. Boston, MA) for providing the cyclin D3-deficient mice. We also thank Consistent with this, we found that the serum levels of IgA and Blair Bleiman for studies of D-type cyclin expression in B-1a cells by flow IgM were not significantly altered in cyclin D3-null mice in com- cytometry. parison to wild-type mice (data not shown). These results suggest that cyclin D3 is dispensable for B-1a cell development, self-re- Disclosures newal, and function. As noted above, this contrasts with the situ- The authors have no financial conflict of interest. Downloaded from ation in cyclin D2-deficient mice, wherein a dramatic decrease in the number of peritoneal CD5ϩ B cells has been reported (22). References Thus, cyclin D2, but not cyclin D3 provides a nonredundant func- 1. Matsushime, H., M. F. Roussel, R. A. Ashmun, and C. J. Sherr. 1991. Colony- tion in the development and/or self-renewal of peritoneal B-1a stimulating factor 1 regulates novel cyclins during the G1 phase of the cell cycle. Cell. 65: 701–713. cells in the animal. 2. Kozar, K., and P. Sicinski. 2005. Cell cycle progression without cyclin D-CDK4

Our analysis of the potential for ex vivo peritoneal B-1a cells to and cyclin D-CDK6 complexes. Cell Cycle 4: 388–391. http://www.jimmunol.org/ proliferate in response to PMA indicated that cyclin D3-deficient 3. Bates, S., L. Bonetta, D. Macallan, D. Parry, A. Holder, C. Dickson, and G. Peters. 1994. CDK6 (PLSTIRE) and CDK4 (PSK-J3) are a distinct subset of B-1a cells proliferate at a normal tempo in comparison to wild- the cyclin-dependent kinases that associate with cyclin D1. Oncogene 9: 71–79. type B-1a cells. Although our results with the use of TAT-p16 4. Kato, J. Y., M. Matsuoka, D. K. Strom, and C. J. Sherr. 1994. Regulation of peptides in normal B-1a cells demonstrate that cyclin D3 is im- cyclin D-dependent kinase 4 (cdk4) by cdk4-activating kinase. Mol. Cell. Biol. 14: 2713–2721. portant for mediating proliferative signals from several mitogens 5. Meyerson, M., and E. Harlow. 1994. Identification of G1 kinase activity for cdk6, (e.g., PMA, LPS, and CD40L), the findings in cyclin D3-deficient a novel cyclin D partner. Mol. Cell. Biol. 14: 2077–2086. mice suggest that cyclin D3 is dispensable for B-1a cell prolifer- 6. Matsushime, H., M. E. Ewen, D. K. Strom, J.-Y. Kato, S. K. Hanks, M. F. Roussel, and C. J. Sherr. 1992. Identification and properties of an atypical ation in ex vivo primary cultures stimulated with PMA or LPS and catalytic subunit (p34PSK-J3/Cdk4) for mammalian D-type G1 cyclins. Cell 71: under certain conditions. Such conditions include cyclin D2 gene 323–334. by guest on September 28, 2021 7. Lundberg, A. S., and R. A. Weinberg. 1998. Functional inactivation of the reti- expression increased 4-fold above the level found in wild-type noblastoma protein requires sequential modification by at least two distinct cy- B-1a cells stimulated by PMA. Furthermore, the elevated induc- clin-cdk complexes. Mol. Cell. Biol. 18: 753–761. tion of cyclin D2 mRNA in cyclin D3-deficient B-1a cells is as- 8. Harbour, J. W., R. Luo, A. Dei Santi, A. Postigo, and D. Dean. 1999. Cdk phosphorylation triggers sequential intramolecular interactions that progressively sociated with early and sustained expression of cyclin D2 protein block Rb functions as cells move through G1. Cell 98: 859–869. throughout G0-S progression. This sustained expression of cyclin 9. Sherr, C. J., and J. M. Roberts. 1999. CDK inhibitors: positive and negative Genes Dev. D2 contrasts with the early and short-lived induction of cyclin D2 regulators of G1-phase progression. 13: 1501–1512. 10. Ortega, S., M. Malumbres, and M. Barbacid. 2002. Cyclin D-dependent kinases, in wild-type B-1a cells stimulated with PMA. INK4 inhibitors and cancer. Biochim. Biophys. Acta 1602: 73–87. The possibility that cyclin D2 may functionally replace cyclin 11. Serrano, M., G. J. Hannon, and D. Beach. 1993. A new regulatory motif in cell D3 is strengthened by the observation that the level of endogenous cycle control causing specific inhibition of cyclin D/CDK4. Nature 366: 704–707. pRb phosphorylation on cdk4/6-targeted residues in cyclin D3- 12. Bruce, J. L., R. K. Hurford, Jr., M. Classon, J. Koh, and N. Dyson. 2000. Re- deficient B-1a cells is comparable to that of wild-type B-1a cells quirements for cell cycle arrest by p16INK4a. Mol. Cell 6: 737–742. similarly stimulated with PMA for 21 h. Additional support for the 13. Sherr, C. J., and J. M. Roberts. 2004. Living with or without cyclins and cyclin- dependent kinases. Genes Dev. 18: 2699–2711. notion that cyclin D2 can compensate for cyclin D3 loss in driving 14. Malumbres, M., R. Sotillo, D. Santamaria, J. Galan, A. Cerezo, S. Ortega, B-1a cell proliferation by PMA was obtained in that DNA synthe- P. Dubus, and M. Barbacid. 2004. Mammalian cells cycle without the D-type cyclin-dependent kinases Cdk4 and Cdk6. Cell 118: 493–504. sis was blocked by transduction of TAT-16 wild-type, but not 15. Kozar, K., M. A. Ciemerych, V. I. Rebel, H. Shigematsu, A. Zagozdzon, TAT-p16 mutant, peptides into cyclin D3-deficient B-1a cells. Al- E. Sicinska, Y. Geng, Q. Yu, S. Bhattacharya, R. T. Bronson, et al. 2004. Mouse though we cannot entirely rule out the possibility of a compensa- development and cell proliferation in the absence of D-cyclins. Cell 118: 477–491. tory role by a cyclin D-independent pathway in PMA-induced 16. Inaba, T., H. Matsushime, M. Valentine, M. F. Roussel, C. J. Sherr, and B-1a cell proliferation, it is noteworthy that no measurable changes A. T. Look. 1992. Genomic organization, chromosomal localization, and inde- in the timing and level of gene expression for the E-type cyclins pendent expression of human cyclin D genes. Genomics 13: 565–574. 17. Xiong, Y., J. Menninger, D. Beach, and D. C. Ward. 1992. Molecular cloning and were observed between wild-type and cyclin D3-deficient B-1a chromosomal mapping of CCND genes encoding human D-type cyclins. Genom- cells stimulated with PMA. Taken together, we interpret these ics 13: 575–584. findings as indicating that, although cyclin D3 normally fulfills a 18. Sicinski, P., J. L. Donaher, Y. Geng, S. B. Parker, H. Gardner, M. Y. Park, R. L. Robker, J. S. Richards, L. K. McGinnis, J. D. Biggers, et al. 1996. Cyclin critical role in late G1 phase, in the absence of cyclin D3, PMA can D2 is an FSH-responsive gene involved in gonadal cell proliferation and onco- drive B-1a cell proliferation via sustained expression of cyclin D2. genesis. Nature 384: 470–474.24. 19. Solvason, N., W. W. Wu, N. Kabra, X. Wu, E. Lees, and M. C. Howard. 1996. Currently, the molecular mechanism underlying the sustained Induction of cell cycle regulatory proteins in anti-immunoglobulin-stimulated expression of cyclin D2 in cyclin D3-deficient mice is unknown. mature B lymphocytes. J. Exp. Med. 184: 407–417. This compensatory accumulation of cyclin D2 raises the possibil- 20. Reid, S., and E. C. Snow. 1996. The regulated expression of cell cycle-related proteins as B- lymphocytes enter and progress through the G1 cell cycle stage ity of a negative feedback loop, in which cyclin D3 limits the following delivery of complete versus partial activation stimuli. Mol. Immunol. duration of cyclin D2 accumulation in normal B-1a cells. Genetic 33: 1139–1151. The Journal of Immunology 795

21. Mohamedali, A., I. Soeiro, N. C. Lea, J. Glassford, L. Banerji, G. J. Mufti, 38. Tanguay, D. A., T. P. Colarusso, S. Pavlovic, M. Irigoyen, R. G. Howard, E. W.-F. Lam, and S. B. Thomas. 2003. Cyclin D2 controls B cell progenitor J. Bartek, T. C. Chiles, and T. L. Rothstein. 1999. Early induction of cyclin D2 numbers. J. Leukocyte Biol. 74: 1141–1145. expression in phorbol ester-responsive B-1a lymphocytes. J. Exp. Med. 189: 22. Solvason, N., W. W. Wu, D. Parry, D. Mahony, E. W. Lam, J. Glassford, 1685–1690. G. G. Klaus, P. Sicinski, R. Weinberg, Y. J. Liu, et al. 2000. Cyclin D2 is 39. Tanguay, D. A., T. P. Colarusso, C. Doughty, S. Pavlovic, T. L. Rothstein, and essential for BCR-mediated proliferation and CD5 B cell development. Int. Im- T. C. Chiles. 2001. Differences in the signaling requirements for activation of munol. 12: 631–638. assembled cyclin D3-cdk4 complexes in B-1a and B-2 lymphocytes. J. Immunol. 23. Lam, E. W., J. Glassford, L. Banerji, N. S. Thomas, P. Sicinski, and G. G. Klaus. 166: 4273–4277. 2000. Cyclin D3 compensates for loss of cyclin D2 in mouse B-lymphocytes 40. Tanguay, D. A., and T. C. Chiles. 1996. Regulation of the catalytic subunit activated via the antigen receptor and CD40. J. Biol. Chem. 275: 3479–3484. (p34PSK-J3/cdk4) for the major D- type cyclin in mature B lymphocytes. J. Im- 24. Hsia, C. Y., S. Cheng, A. M. Owyang, S. F. Dowdy, and H. C. Liou. 2002. c-Rel munol. 156: 539–548. regulation of the cell cycle in primary mouse B lymphocytes. Int. Immunol. 14: 41. Sicinska, E., I. Aifantis, L. Le Cam, W. Swat, C. Borowski, Q. Yu, 905–916. A. A. Ferrando, S. D. Levin, Y. Geng, H. von Boehmer, and P. Sicinki. 2003. 25. Wang, Z., P. Sicinski, R. A. Weinberg, Y. Zhang, and K. Ravid. 1996. Charac- Requirement for cyclin D3 in lymphocyte development and T cell leukemias. terization of the mouse cyclin D3 gene: exon/intron organization and promoter Cancer Cell 4: 451–461. activity. Genomics 35: 156–163. 42. Tumang, J. R., W. D. Hastings, C. Bai, and T. L. Rothstein. 2004. Peritoneal and 26. Berland, R., and H. H. Wortis. 2002. Origins and functions of B-1 cells with notes splenic B-1a cells are separable by phenotypic, functional, and transcriptomic on the role of CD5. Annu. Rev. Immunol. 20: 253–300. characteristics. Eur. J. Immunol. 34: 2158–2167. 27. Herzenberg, L. A. 2000. B-1 cells: the lineage question revisited. Immunol. Rev. 43. Fahraeus, R., J. M. Paramio, K. L. Ball, S. Lain, and D. P. Lane. 1996. Inhibition 175: 9–22. of pRb phosphorylation and cell cycle progression by a 20-resdiue peptide de- 28. Rothstein, T. L. 2002. Cutting edge commentary: two B-1 or not to be one. J. rived from p16CDKN2/INK4A. Curr. Biol. 6: 84–91. Immunol. 168: 4257–4261. 44. Gius, D. R., S. A. Ezhevsky, M. Becker-Hapak, H. Nagahara, M. C. Wei, and 29. Hardy R. R., and K. Hayakawa. 2001. B cell development pathways. Annu. Rev. S. F. Dowdy. 1999. Transduced p16INK4a peptides inhibit hypophosphorylation Immunol. 19: 595–621. of the retinoblastoma protein and cell cycle progression prior to activation of 30. Herzenberg, L. A., A. M. Stall, P. A. Lalor, C. Sidman, W. A. Moore, D. R. Cdk2 complexes in late G1. Cancer Res. 59: 2577–2580. Parks, and L. A. Herzenberg. 1986. The Ly-1 B cell lineage. Immunol. Rev. 93: 45. Tumang, J. R., R. Frances, S. G. Yeo, and T. L. Rothstein. 2005. Cutting edge: Downloaded from 81–102. spontaneously Ig-secreting B-1 cells violate the accepted paradigm for expression 31. Caligaris-Cappio, F., M. Gobbi, M. Boﬁll, and G. Janossy. 1982. Infrequent of differentiation-associated transcription factors. J. Immunol. 174: 3173–3177. normal B lymphocytes express features of B-chronic lymphocytic leukemia. 46. Lane, P., T. Brocker, S. Hubele, E. Padovan, A. Lanzavecchia, and F. McConnell. J. Exp. Med. 155: 623–628. 1993. Soluble CD40 ligand can replace the normal T cell-derived CD40 ligand 32. Stall, A. M., M. C. Farinas, D. M. Tarlinton, P. A. Lalor, L. A. Herzenberg, and signal to B cells in T cell-dependent activation. J. Exp. Med. 177: 1209–1213. S. Strober. 1988. Ly-1 B-cell clones similar to human chronic lymphocytic leu- 47. Francis, D. A., J. G. Karras, X. Y. Ke, R. Sen, and T. L. Rothstein. 1995. In- kemias routinely develop in older normal mice and young autoimmune (New duction of the transcription factors NF-␬B, AP-1 and NF-AT during B cell stim-

Zealand Black-related) animals. Proc. Natl. Acad. Sci. USA 85: 7312–7316. ulation through the CD40 receptor. Int. Immunol. 7: 151–161. http://www.jimmunol.org/ 33. Marti, G. E., R. A. Metcalf, and E. Raveche. 1995. The natural history of a 48. Kushnuer, J. A., M. A. Ciemerych, E. Sicinska, L. M. Wartschow, M. Teta, lymphoproliferative disorder in aged NZB mice. Curr. Top. Microbiol. Immunol. S. Y. Long, P. Sicinski, and M. F. White. 2005. Cyclins D2 and D1 are essential 194: 117–126. for postnatal pancreatic ␤-cell growth. Mol. Cell. Biol. 25: 3752–3762. 34. Hayakawa, K., R. R. Hardy, A. M. Stall, and L. A. Herzenberg. 1986. Immuno- 49. Peterson, L. F., A. Boyapati, V. Ranganathan, A. Iwama, D. G. Tenen, S. Tsai, globulin bearing B cells reconstitute and maintain the murine Ly- 1 B cell lin- and D.-E. Zhang. 2005. The hematopoietic transcription factor AML1 (RUNX1) eage. Eur. J. Immunol. 16: 1313–1316. is negatively regulated by the cell cycle protein cyclin D3. Mol. Cell. Biol. 25: 35. Rothstein, T. L., and D. L. Kolber. 1988. Anti-Ig antibody inhibits the phorbol 10205–10219. ester-induced stimulation of peritoneal B cells. J. Immunol. 141: 4089–4093. 50. Sun, M., Y. Wei, L. Yao, J. Xie, X. Chen, H. Wang, J. Jang, and J. Gu. 2006. 36. Morris, D. L., and T. L. Rothstein. 1993. Abnormal transcription factor induction Identiﬁcation of extracellular signal-regulated kinase 3 as a new interaction part- through the surface immunoglobulin M receptor of B-1 lymphocytes. J. Exp. ner of cyclin D3. Biochem. Biophys. Res. Commun. 340: 209–214. Med. 177: 857–861. 51. Shen, X., Y. Yang, W. Liu, M. Sun, J. Jaing, H. Zong, and J. Gu. 2004. Identi-

37. Rothstein T. L., and D. L. Kolber. 1988. Peritoneal B cells respond to phorbol ﬁcation of the p28 subunit of eukaryotic initiation factor 3(eIF3k) as a new in- by guest on September 28, 2021 esters in the absence of a co-mitogen. J. Immunol. 140: 2880–2885. teraction partner of cyclin D3. FEBS Lett. 573: 139–146.