DOCSLIB.ORG

Differentiation Involved in Early Th1 and Th2 Cell Genome-Wide

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differentiation Involved in Early Th1 and Th2 Cell Genome-Wide Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation This information is current as Riikka J. Lund, Maritta Löytömäki, Tiina Naumanen, Craig of October 2, 2021. Dixon, Zhi Chen, Helena Ahlfors, Soile Tuomela, Johanna Tahvanainen, Joonas Scheinin, Tiina Henttinen, Omid Rasool and Riitta Lahesmaa J Immunol 2007; 178:3648-3660; ; doi: 10.4049/jimmunol.178.6.3648 http://www.jimmunol.org/content/178/6/3648 Downloaded from References This article cites 43 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/178/6/3648.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation1 Riikka J. Lund,2* Maritta Lo¨yto¨ma¨ki,2*† Tiina Naumanen,* Craig Dixon,* Zhi Chen,* Helena Ahlfors,*‡ Soile Tuomela,*† Johanna Tahvanainen,*§ Joonas Scheinin,* Tiina Henttinen,* Omid Rasool,* and Riitta Lahesmaa3* Th cell subtypes, Th1 and Th2, are involved in the pathogenesis or progression of many immune-mediated diseases, such as type 1 diabetes and asthma, respectively. Defining the molecular networks and factors that direct Th1 and Th2 cell differentiation will help to understand the pathogenic mechanisms causing these diseases. Some of the key factors regulating this differentiation have been identified, however, they alone do not explain the process in detail. To identify novel factors directing the early differentiation, we have studied the transcriptomes of human Th1 and Th2 cells after 2, 6, and 48 h of polarization at the genome scale. Based ϳ on our current and previous studies, 288 genes or expressed sequence tags, representing 1–1.5% of the human genome, are Downloaded from regulated in the process during the first 2 days. These transcriptional profiles revealed genes coding for components of certain pathways, such as RAS oncogene family and G protein-coupled receptor signaling, to be differentially regulated during the early Th1 and Th2 cell differentiation. Importantly, numerous novel genes with unknown functions were identified. By using short- hairpin RNA knockdown, we show that a subset of these genes is regulated by IL-4 through STAT6 signaling. Furthermore, we demonstrate that one of the IL-4 regulated genes, NDFIP2, promotes IFN-␥ production by the polarized human Th1 lymphocytes. Among the novel genes identified, there may be many factors that play a crucial role in the regulation of the differentiation process http://www.jimmunol.org/ together with the previously known factors and are potential targets for developing therapeutics to modulate Th1 and Th2 responses. The Journal of Immunology, 2007, 178: 3648–3660. helper cell subtypes, Th1 and Th2, originate from com- STAT1 signaling are important in driving Th1 polarization, mon naive precursor cells (Thp) in response to Ag and whereas IL-4/STAT6 signaling directs Th2 polarization (2). Tran- T cytokine stimulation. Although Th cells have a crucial scription factors TBX21 (T-bet) and GATA3 are also among the role in host defense against intracellular and extracellular patho- key factors required for the Th1 and Th2 differentiation, respec- gens, disturbances in the balance between Th1 and Th2 responses tively (3–6). Although many of the players implicated in the reg- can promote or lead to pathogenesis of immune-mediated diseases. ulation of differentiation have been recognized, the current model by guest on October 2, 2021 Enhanced Th2 response is involved in atopic diseases, such as as such is still too simple to explain the process in detail, and other asthma, whereas a dominating Th1 response is implicated in cer- yet unknown factors are likely to be involved. tain autoimmune diseases, like type 1 diabetes or rheumatoid ar- Recently, an increasing number of studies have used DNA mi- thritis (1). To understand the molecular mechanisms driving the croarrays to identify new factors involved in the Th1 and Th2 pathogenesis of these diseases, it is important to elucidate the early polarization in humans and mice (7–14). However, all of these differentiation process of Th1 and Th2 cells in detail. studies have focused on studying a limited number of primarily A number of the central factors involved in directing the differ- known genes. We have previously elucidated the regulation of entiation process have been identified. IL-12/STAT4 and IFN-␥/ ϳ9300 genes, most with known functions, during the early differ- entiation of human Th1 and Th2 cells (10, 15). In the present study, we have extended the previous work by exploring the reg- *Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku, ulation of the rest of the genes in the human genome. Based on the Finland; †Graduate School of Biomedical Sciences, University of Turku, Turku, Fin- ‡ combination of our current and previous studies, 288 genes or land; The National Graduate School in Informational and Structural Biology, Åbo 4 ϳ Akademi University, Turku, Finland; and §Drug Discovery Graduate School, Uni- expressed sequence tags (ESTs), representing 1–1.5% of the versity of Turku, Turku, Finland human genome, are differentially regulated during the first 2 days Received for publication March 9, 2005. Accepted for publication December of Th1 and Th2 cell polarization. Moreover, we demonstrate that 21, 2006. a panel of these genes or ESTs are induced by IL-4 through the The costs of publication of this article were defrayed in part by the payment of page STAT6 signaling or play a role in regulation of IFN-␥ production. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Materials and Methods 1 This work was supported by the Academy of Finland, Sigrid Juse´lius Foundation, National Technology Agency of Finland, Turku Graduate School of Biomedical Sci- In vitro differentiation of Th1 and Th2 cells ences, National Graduate School in Informational and Structural Biology, Drug Dis- Induction of human Th1 and Th2 cell differentiation was performed as covery Graduate School, Ida Montin Foundation, Finnish Society of Allergology and ϩ Immunology, Pulmonary Association Heli, Jenny and Antti Wihuri Foundation, previously described (10). Briefly, CD4 T cells isolated (Ficoll Isolation Va¨ino¨and Laina Kivi Foundation, Allergy Research Foundation of South-Western Paque; Amersham Biosciences and Dynal Biotech) from cord blood (Turku Finland, and Turku University Hospital Fund. 2 R.J.L. and M.L. made an equal contribution to this work. 4 Abbreviations used in this paper: EST, expressed sequence tag; CT, threshold cycle; 3 Address correspondence and reprint requests to Prof. Riitta Lahesmaa, Turku Centre shRNA, short-hairpin RNA. for Biotechnology, University of Turku and Åbo Akademi University, P.O. Box 123, FIN-20521, Turku, Finland. E-mail address: riitta.lahesmaa@btk.fi Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org The Journal of Immunology 3649 Table I. Primers and probes used in the real-time RT-PCR 1) 5Ј-6(FAM)-PROBE-(TAMRA)-3Ј 2) 5Ј-PRIMER 1–3Ј Public ID Gene Symbol 3) 5Ј-PRIMER 2–3Ј AW152437 1) 2) 5Ј-AGCTGAGAAGAATGAAGAGGACATA-3Ј 3) 5Ј-GTTCACAGCCCCTATGG-3Ј AW139719 1) 2) 5Ј-AGACTGGTTTGTTTTCACTTGAGGT-3Ј 3) 5Ј-GTTTTCCCAGGAGTCTGAGGC-3Ј R98767 1) 2) 5Ј-TTTGCCTCAAATCCATTACCAA-3Ј 3) 5Ј-AACTAGTCAAGTGTGATATAATCAGATTTGC-3Ј AA489100 1) 2) 5Ј-GAAAGCAATATGTTTAGCAGCTGTTT-3Ј 3) 5Ј-ACATTTATGCCTGGATTAAATAACAATAGT-3Ј BF056901 1) 2) 5Ј-AAATAAGGCCTAGGTCCGTCTATTG-3Ј 3) 5Ј-CGGCCTCGACCTTCAAAGA-3Ј AI494573 1) Ј Ј 2)5 -GCTGGGAAATCTACAAGTCACCTTA-3 Downloaded from 3)5Ј-TTGCTGGCCATTTTATTGTTGAG-3Ј AA088177 1) 2) 5Ј-ATGCAAGGTGGAATTTTGGG-3Ј 3) 5Ј-GTATTGCAGTTGTGGAAGAGCAGA-3Ј BE748563 1) 2) 5Ј-CCTTTCACTGCCATGGAATGA-3Ј 3) 5Ј-AGAAAATGCAAGCTCCCCATAA-3Ј AI674404 1) http://www.jimmunol.org/ 2) 5Ј-CTGGAACCTTGAGGCCTTCA-3Ј 3) 5Ј-GCCCCAATCTATGGACAGACA-3Ј AL389942 1) 5Ј-TGTGACAATGATTCTTTAGC-3Ј 2) 5Ј-CACGGGATCAGAGGGAACTAATA-3Ј 3) 5Ј-ACCAGAAGCCTCAGCAGTCC-3Ј AA237039 1) 5Ј-TTTATGCAGCGCACTGTCAGACTTCCAA-3Ј 2) 5Ј-GATGCATCTGCTTTTAACCCTTTT-3Ј 3) 5Ј-TTACGGAATGCTGTGGTACTCAA-3Ј AW629527 FLJ41238 1) 5Ј-ACCCATTTTGATTGAGACCTACACAGGGC-3Ј 5Ј-TGGAAGAGGAAAGAAACTGATGGT-3Ј 2) by guest on October 2, 2021 3) 5Ј-GCGGTTTCCAATGAATGACA-3Ј J04617 EF1␣ 1) 5Ј-AGCGCCGGCTATGCCCCTG-3Ј 2) 5Ј-CTGAACCATCCAGGCCAAAT-3Ј 3) 5Ј-GCCGTGTGGCAATCCAAT-3Ј NM_016651 DACT1 1) 5Ј-CACGAACTCGCCCTCGCTCACACT-3Ј 2) 5Ј-AGCAGAGCAATTACACCACCAA-3Ј 3) 5Ј-AGTCTGGACAAACTGGGACCAA-3Ј NM_005815 ZNF443 1) 5Ј-TCTCTTGGCTCACTTGCTTTCTACGACATG-3Ј 2) 5Ј-GAATGTAAGGAATGTGGGAAAGC-3Ј 3) 5Ј-CATAGGATTTCTCTCTCATGTGAATTCT-3Ј University Central Hospital, Turku, Finland)
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Borg Family of Cdc42 Effector Proteins Cdc42ep1–5
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institute of Cancer Research Repository Biochemical Society Transactions (2016) 0 1–8 DOI: 10.1042/BST20160219 1 2 The Borg family of Cdc42 effector proteins 3 4 Cdc42EP1–5 5 6 Aaron J. Farrugia and Fernando Calvo 7 8 Tumour Microenvironment Team, Division of Cancer Biology, Institute of Cancer Research, 237 Fulham Road, London SW2 6JB, U.K. 9 Correspondence: Fernando Calvo ([email protected]) 10 11 12 13 Despite being discovered more than 15 years ago, the Borg (binder of Rho GTPases) 14 – family of Cdc42 effector proteins (Cdc42EP1 5) remains largely uncharacterised and rela- 15 tively little is known about their structure, regulation and role in development and disease. 16 Recent studies are starting to unravel some of the key functional and mechanistic 17 aspects of the Borg proteins, including their role in cytoskeletal remodelling and signal- 18 ling. In addition, the participation of Borg proteins in important cellular processes such as 19 cell shape, directed migration and differentiation is slowly emerging, directly linking Borgs 20 with important physiological and pathological processes such as angiogenesis, neuro- 21 fi transmission and cancer-associated desmoplasia. Here, we review some of these nd- 22 ings and discuss future prospects. 23 24 25 26 27 28 29 Introduction 30 The Rho GTPase family member Cdc42 regulates a diverse range of cellular functions including cyto- 31 kinesis, cytoskeletal remodelling and cell polarity [1,2]. Like other Rho family members, Cdc42 cycles 32 between two tightly regulated conformational states, a GTP-bound active state and a GDP-bound 33 inactive state [3].
    [Show full text]
  • Molecular Characterization of Acquired Tolerance of Tumor Cells to Picropodophyllin (PPP)
    Molecular Characterization of Acquired Tolerance of Tumor Cells to Picropodophyllin (PPP) Jamileh Hashemi1*, Claire Worrall2, Daiana Vasilcanu2,Ma˚rten Frykna¨s3, Luqman Sulaiman1, Mohsen Karimi1, Wen-Hui Weng1¤a, Weng-Onn Lui1, Christina Rudduck1¤b, Magnus Axelson1, Helena Jernberg-Wiklund3, Leonard Girnita2, Olle Larsson2, Catharina Larsson1 1 Department of Molecular Medicine and Surgery, Center for Molecular Medicine, Karolinska Institutet, Karolinska University Hospital, CMM L8:01, Stockholm, Sweden, 2 Department of Oncology-Pathology, Karolinska Institutet, Karolinska University Hospital, CCK R8:04, Stockholm, Sweden, 3 Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden Abstract Background: Picropodophyllin (PPP) is a promising novel anti-neoplastic agent that efficiently kills tumor cells in vitro and causes tumor regression and increased survival in vivo. We have previously reported that PPP treatment induced moderate tolerance in two out of 10 cell lines only, and here report the acquired genomic and expression alterations associated with PPP selection over 1.5 years of treatment. Methodology/Principal Findings: Copy number alterations monitored using metaphase and array-based comparative genomic hybridization analyses revealed largely overlapping alterations in parental and maximally tolerant cells. Gain/ amplification of the MYC and PVT1 loci in 8q24.21 were verified on the chromosome level. Abnormalities observed in connection to PPP treatment included regular gains and losses, as well as homozygous losses in 10q24.1-q24.2 and 12p12.3- p13.2 in one of the lines and amplification at 5q11.2 in the other. Abnormalities observed in both tolerant derivatives include amplification/gain of 5q11.2, gain of 11q12.1-q14.3 and gain of 13q33.3-qter.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • Metastatic Adrenocortical Carcinoma Displays Higher Mutation Rate and Tumor Heterogeneity Than Primary Tumors
    ARTICLE DOI: 10.1038/s41467-018-06366-z OPEN Metastatic adrenocortical carcinoma displays higher mutation rate and tumor heterogeneity than primary tumors Sudheer Kumar Gara1, Justin Lack2, Lisa Zhang1, Emerson Harris1, Margaret Cam2 & Electron Kebebew1,3 Adrenocortical cancer (ACC) is a rare cancer with poor prognosis and high mortality due to metastatic disease. All reported genetic alterations have been in primary ACC, and it is 1234567890():,; unknown if there is molecular heterogeneity in ACC. Here, we report the genetic changes associated with metastatic ACC compared to primary ACCs and tumor heterogeneity. We performed whole-exome sequencing of 33 metastatic tumors. The overall mutation rate (per megabase) in metastatic tumors was 2.8-fold higher than primary ACC tumor samples. We found tumor heterogeneity among different metastatic sites in ACC and discovered recurrent mutations in several novel genes. We observed 37–57% overlap in genes that are mutated among different metastatic sites within the same patient. We also identified new therapeutic targets in recurrent and metastatic ACC not previously described in primary ACCs. 1 Endocrine Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 2 Center for Cancer Research, Collaborative Bioinformatics Resource, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 3 Department of Surgery and Stanford Cancer Institute, Stanford University, Stanford, CA 94305, USA. Correspondence and requests for materials should be addressed to E.K. (email: [email protected]) NATURE COMMUNICATIONS | (2018) 9:4172 | DOI: 10.1038/s41467-018-06366-z | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-06366-z drenocortical carcinoma (ACC) is a rare malignancy with types including primary ACC from the TCGA to understand our A0.7–2 cases per million per year1,2.
    [Show full text]
  • Deletion of 11Q in Neuroblastomas Drives Sensitivity to PARP Inhibition Elena Sanmartín1,2, Lisandra Munoz~ 1,2, Marta Piqueras3, J
    Published OnlineFirst August 22, 2017; DOI: 10.1158/1078-0432.CCR-17-0593 Personalized Medicine and Imaging Clinical Cancer Research Deletion of 11q in Neuroblastomas Drives Sensitivity to PARP Inhibition Elena Sanmartín1,2, Lisandra Munoz~ 1,2, Marta Piqueras3, J. Antoni Sirerol1,2, Pablo Berlanga2,4, Adela Canete~ 2,4, Victoria Castel2,4, and Jaime Font de Mora1,2 Abstract Purpose: Despite advances in multimodal therapy, neuroblas- define a subgroup of neuroblastomas with higher sensitivity to tomas with hemizygous deletion in chromosome 11q (20%– PARP inhibitors. Noteworthy, concomitant treatment with ola- 30%) undergo consecutive recurrences with poor outcome. We parib and DNA alkylating agent temozolomide potently inhibited hypothesized that patients with 11q-loss may share a druggable growth of cell lines harboring 11q-loss. This drug synergism was molecular target(s) that can be exploited for a precision medicine less potent when temozolomide was exchanged for cisplatin or strategy to improve treatment outcome. irinotecan. Intact 11q cells concomitantly treated with ATM Experimental Design: SNP arrays were combined with next- inhibitor displayed growth arrest and enhanced apoptosis, reveal- generation sequencing (NGS) to precisely define the deleted ing a role for ATM in the mechanism that mediates sensitivity to region in 17 primary 11q-loss neuroblastomas and identify allelic temozolomide–olaparib. Interestingly, functional TP53 is variants in genes relevant for neuroblastoma etiology. We required for efficacy of this treatment. In an in vivo model, assessed PARP inhibitor olaparib in combination with other coadministration of temozolomide–olaparib resulted in sus- chemotherapy medications using both in vitro and in vivo models. tained xenograft regression.
    [Show full text]
  • Fusion Transcripts and Transcribed Retrotransposed Loci Discovered Through Comprehensive Transcriptome Analysis Using Paired-End Ditags (Pets)
    Downloaded from genome.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Fusion transcripts and transcribed retrotransposed loci discovered through comprehensive transcriptome analysis using Paired-End diTags (PETs) Yijun Ruan,1,6 Hong Sain Ooi,2 Siew Woh Choo,2 Kuo Ping Chiu,2 Xiao Dong Zhao,1 K.G. Srinivasan,1 Fei Yao,1 Chiou Yu Choo,1 Jun Liu,1 Pramila Ariyaratne,2 Wilson G.W. Bin,2 Vladimir A. Kuznetsov,2 Atif Shahab,3 Wing-Kin Sung,2,4 Guillaume Bourque,2 Nallasivam Palanisamy,5 and Chia-Lin Wei1,6 1Genome Technology and Biology Group, Genome Institute of Singapore, Singapore 138672, Singapore; 2Information and Mathematical Science Group, Genome Institute of Singapore, Singapore 138672, Singapore; 3Bioinformatics Institute, Singapore 138671, Singapore; 4School of Computing, National University of Singapore, Singapore 117543, Singapore; 5Cancer Biology Group, Genome Institute of Singapore, Singapore 138672, Singapore Identification of unconventional functional features such as fusion transcripts is a challenging task in the effort to annotate all functional DNA elements in the human genome. Paired-End diTag (PET) analysis possesses a unique capability to accurately and efficiently characterize the two ends of DNA fragments, which may have either normal or unusual compositions. This unique nature of PET analysis makes it an ideal tool for uncovering unconventional features residing in the human genome. Using the PET approach for comprehensive transcriptome analysis, we were able to identify fusion transcripts derived from genome rearrangements and actively expressed retrotransposed pseudogenes, which would be difficult to capture by other means. Here, we demonstrate this unique capability through the analysis of 865,000 individual transcripts in two types of cancer cells.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]