DOCSLIB.ORG

RNA-Seq Day Two

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RNA-Seq Day Two Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University [email protected] RNA-Seq Day two Intro to Unix File formats RNA-Seq QC Lecture outline • What is Unix? • Tufts Cluster • Unix Introduction • File formats – FASTA – FASTQ – SAM/BAM – GFF/GTF – BED What is Unix? An operating system Why does bioinformatics use Unix? Open source fits with academic ideals Best software development environment Programming languages already installed and configured - difficult on Windows Why does bioinformatics use Unix? Software is free and easily available Shell tools – bioinformatics is mostly about processing text in some way Mac OS is based on Unix and (for the most part) works the same Unix directory structure Unix components Kernel The operating system. Allocates hardware resources in response to software and user requests. Shell The interface between the user and the kernel. We will use the Bash shell. Files and Processes Everything in Unix is a file or a process A file is a destination for or a source of data (this includes directories, the screen, printers) A process is a program that is running A file stores the instructions for a process, and a process may interact with files Interacting with Unix Text-based command line You type in commands and the OS assigns resources to utilize the appropriate process(es) and file(s) $ command –options targets Tufts High-performance computing research cluster 172 RedHat 6 systems 8-16 cores/node 16-128 GB RAM/node Access using ssh (secure shell) Terminal on Mac/Linux PuTTY on Windows Why use a cluster? NGS data is big and getting bigger Your desktop/laptop aren’t good enough Run many simultaneous programs (jobs) Cloud computing from Amazon, Illumina (computer rental) Lecture outline • What is Unix? • Tufts Cluster • Unix Introduction • File formats – FASTA – FASTQ – SAM/BAM – GFF/GTF – BED Login to Tufts Cluster Mac Terminal cluster.uit.tufts.edu Windows Putty.exe ssh [email protected] Your first Unix commands $ ls lists the contents of a directory $ pwd shows your current directory $ whoami shows your user name $ touch file.txt interacts with a file (requires a target) Command manuals $ man shows the manual for a target command $ man ls navigate with arrow keys, PgUp, PgDn press “q” to exit Some useful options for ls: -l –a –t –S -lat Editing files in Unix Requires a text editor. We’ll use nano. $ nano Unix intro exercises Lecture outline • What is Unix? • Tufts Cluster • Unix Introduction • File formats – FASTA – FASTQ – SAM/BAM – GFF/GTF – BED Important file formats FASTA – nucleotide sequence FASTQ – sequence + quality information SAM/BAM – alignments GFF/GTF – transcript information BED – misc. feature coordinates FASTA >gi|212549564|ref|NM_015981.3| Homo sapiens calcium/calmodulin- dependent protein kinase II alpha (CAMK2A), transcript variant 1, mRNA GGTTGCCATGGGGACCTGGATGCTGACGAAGGCTCGCGAGGCTGTGAGCAGCCACAGTGCCCTGCTCAGA AGCCCCGGGCTCGTCAGTCAAACCGGTTCTCTGTTTGCACTCGGCAGCACGGGCAGGCAAGTGGTCCCTA GGTTCGGGAGCAGAGCAGCAGCGCCTCAGTCCTGGTCCCCCAGTCCCAAGCCTCACCTGCCTGCCCAGCG CCAGGATGGCCACCATCACCTGCACCCGCTTCACGGAAGAGTACCAGCTCTTCGAGGAATTGGGCAAGGG AGCCTTCTCGGTGGTGCGAAGGTGTGTGAAGGTGCTGGCTGGCCAGGAGTATGCTGCCAAGATCATCAAC ACAAAGAAGCTGTCAGCCAGAGACCATCAGAAGCTGGAGCGTGAAGCCCGCATCTGCCGCCTGCTGAAGC ACCCCAACATCGTCCGACTACATGACAGCATCTCAGAGGAGGGACACCACTACCTGATCTTCGACCTGGT CACTGGTGGGGAACTGTTTGAAGATATCGTGGCCCGGGAGTATTACAGTGAGGCGGATGCCAGTCACTGT ATCCAGCAGATCCTGGAGGCTGTGCTGCACTGCCACCAGATGGGGGTGGTGCACCGGGACCTGAAGCCTG Tab completion Save time typing and reduce spelling errors by using tab completion. Type in enough letters to uniquely identify a command/file/path, and press tab. Unix will automatically fill in the rest. If pressing tab does nothing, what you have typed is not enough. Press tab twice to see a list of possible matches. Text manipulation commands less - displays part of a file head - display beginning of file tail - display end of file sort – sorts a file cut - select columns of a file tr - replace or remove characters grep – searches a file sed - stream editor, edits a file line by line awk - programming language, very useful for advanced text manipulation Handling text output > Redirects output to a target (overwrites) >> Appends output to a target | “Pipe” - Sends output to another program. Very useful for multi-step text manipulation. FASTA exercises Minute cards Break FASTQ Stores sequence information and quality scores associated with the sequence Quality represented as a Phred score ଵ଴ where Q = quality and P = error probability Phred Prob. Incorrect Accuracy 10 1 in 10 90% 20 1 in 100 99% 30 1 in 1000 99.9% 40 1 in 10000 99.99% 50 1 in 100000 99.999% FASTQ To save space, Phred scores are represented as ASCII characters Phred scales Sanger format Phred+33 from 0-40 Illumina 1.0/Solexa Phred+64 from -5-40 Illumina 1.3+ Phred+64 from 3-40 Illumina 1.8+ Phred+33 from 0-41 Look for “B” tails or “#” tails. FASTQ @42JV5AAXX_HWI-EAS229_1:6:87:886:1289 CTACACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTGCCAGCAGGCGGC + B?6<..11@A(=11//664.7.46<6888646.6886668688846588888 @42JV5AAXX_HWI-EAS229_1:6:91:843:1848 CATATTTAGGAGTCTACTGAGACCAAACAGCATATGCTCCGGGTGTTTCCCT + B@B:BBB>AA@C>B@@ABB@A;AB@@>B?@@@@?AA@A@@BBA5C>>?>?7; First line = unique identifier (starts with “@”) Second line = sequence Third line = spacer (may repeat identifier, starts with “+”) Fourth line = quality scores FastQC FastQC is used to generate summary information about FASTQ sequences You will use this every time you receive RNA-Seq data Babraham Bioinfomatics http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FastQC – Basic Statistics FastQC – Per base sequence quality FastQC – Per base sequence content FastQC – Sequence duplication levels FastQC – Kmer content What’s wrong here? #1 What’s wrong here? #1 Random hexamer bias at start AT rich due to mitochondrial and polyA reads Solution: remove the reads before analysis What’s wrong here? #2 What’s wrong here? #2 Adapter sequences due to short insert Solution: trim the reads before mapping What’s wrong here? #3 What’s wrong here? #3 This sample is almost entirely adapter- adapter ligation products Solution: None. Data unusable. Add the ligase last!! LSF (Load Sharing Facility) Resource allocator - how programs are assigned to nodes in the cluster You interact with the head node, along with everyone else Programs should not be run on the head node Submitting jobs to the cluster bsub Submits a job to the cluster bjobs Displays information about current jobs bkill Stops a job bqueues Displays information about the queues (different nodes that can run programs) Cluster modules Modules exist for specific software packages on the cluster Sets environment parameters to correctly run the software Path: tells the OS where to find programs Using WinSCP WinSCP is an FTP/SFTP program for transferring files Useful for transferring files between the cluster and your computer Login credentials are the same as with PuTTY WinSCP Create stored sessions on your personal computers FastQC exercises SAM (Sequence Alignment/Map) Standard format for alignment data Tab delimited text format Header lines and alignment lines All header lines start with “@” Header contains metadata about alignments One line per alignment BAM is a binary form of SAM http://samtools.sourceforge.net/SAM1.pdf @HD VN:1.0 SO:coordinate @SQ SN:chr1 LN:249250621 @SQ SN:chr10 LN:135534747 @SQ SN:chr11 LN:135006516 SAM header @SQ SN:chr12 LN:133851895 @SQ SN:chr13 LN:115169878 @SQ SN:chr14 LN:107349540 @HD is the header @SQ SN:chr15 LN:102531392 @SQ SN:chr16 LN:90354753 line. Shows sort order @SQ SN:chr17 LN:81195210 @SQ SN:chr18 LN:78077248 @SQ SN:chr19 LN:59128983 @SQ SN:chr2 LN:243199373 @SQ are the sequence @SQ SN:chr20 LN:63025520 dictionary lines. Show @SQ SN:chr21 LN:48129895 @SQ SN:chr22 LN:51304566 what sequences the @SQ SN:chr3 LN:198022430 @SQ SN:chr4 LN:191154276 reads were aligned to. @SQ SN:chr5 LN:180915260 @SQ SN:chr6 LN:171115067 @SQ SN:chr7 LN:159138663 @SQ SN:chr8 LN:146364022 Other lines specified in @SQ SN:chr9 LN:141213431 SAM format document @SQ SN:chrX LN:155270560 @SQ SN:chrY LN:59373566 SAM alignment section Col Field Type Brief description 1 QNAME String Query template NAME 2FLAGInt bitwise FLAG 3 RNAME String Reference sequence NAME 4POSInt1‐based leftmost mapping POSition 5 MAPQ Int MAPping Quality (sometimes) 6CIGARString CIGAR string 7 RNEXT String Ref. name of the mate/next segment 8 PNEXT Int Position of the mate/next segment 9TLENInt observed Template LENgth 10 SEQ String segment SEQuence 11 QUAL String ASCII of Phred‐scaled base QUALity+33 42JV5AAXX_HWI-EAS229_1:6:87:886:1289 272 chr1 11320 1 76M * 0 0 TTGCTTACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCT… 62664(1666646648848668688888856488868666886.6468886<64.7.466… bitwise FLAG FLAG Description 1Read is paired 2Both paired reads mapped 4Read unmapped 8Mate unmapped 16 Read reverse strand 32 Mate reverse strand 64 First in pair 128 Second in pair 256 Not primary alignment 512 not passing quality controls 1024 PCR or optical duplicate http://picard.sourceforge.net/explain-flags.html CIGAR string Symbol Description M alignment match (can be a sequence match or mismatch) I insertion to the reference D deletion from the reference N skipped region from the reference S soft clipping (clipped sequences present in SEQ) Hhard clipping (clipped sequences NOT present in SEQ) P padding (silent deletion from padded reference) = sequence match X sequence mismatch SAM optional fields Aligner specific information
Load more

Recommended publications
  • State Notation Language and Sequencer Users' Guide
    State Notation Language and Sequencer Users’ Guide Release 2.0.99 William Lupton ([email protected]) Benjamin Franksen ([email protected]) June 16, 2010 CONTENTS 1 Introduction 3 1.1 About.................................................3 1.2 Acknowledgements.........................................3 1.3 Copyright...............................................3 1.4 Note on Versions...........................................4 1.5 Notes on Release 2.1.........................................4 1.6 Notes on Releases 2.0.0 to 2.0.12..................................7 1.7 Notes on Release 2.0.........................................9 1.8 Notes on Release 1.9......................................... 12 2 Installation 13 2.1 Prerequisites............................................. 13 2.2 Download............................................... 13 2.3 Unpack................................................ 14 2.4 Configure and Build......................................... 14 2.5 Building the Manual......................................... 14 2.6 Test.................................................. 15 2.7 Use.................................................. 16 2.8 Report Bugs............................................. 16 2.9 Contribute.............................................. 16 3 Tutorial 19 3.1 The State Transition Diagram.................................... 19 3.2 Elements of the State Notation Language.............................. 19 3.3 A Complete State Program...................................... 20 3.4 Adding a
    [Show full text]
  • A Rapid, Sensitive, Scalable Method for Precision Run-On Sequencing
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.18.102277; this version posted May 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 A rapid, sensitive, scalable method for 2 Precision Run-On sequencing (PRO-seq) 3 4 Julius Judd1*, Luke A. Wojenski2*, Lauren M. Wainman2*, Nathaniel D. Tippens1, Edward J. 5 Rice3, Alexis Dziubek1,2, Geno J. Villafano2, Erin M. Wissink1, Philip Versluis1, Lina Bagepalli1, 6 Sagar R. Shah1, Dig B. Mahat1#a, Jacob M. Tome1#b, Charles G. Danko3,4, John T. Lis1†, 7 Leighton J. Core2† 8 9 *Equal contribution 10 1Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853, USA 11 2Department of Molecular and Cell Biology, Institute of Systems Genomics, University of 12 Connecticut, Storrs, CT 06269, USA 13 3Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, 14 NY 14853, USA 15 4Department of Biomedical Sciences, College of Veterinary Medicine, Cornell University, 16 Ithaca, NY 14853, USA 17 #aPresent address: Koch Institute for Integrative Cancer Research, Massachusetts Institute of 18 Technology, Cambridge, MA 02139, USA 19 #bPresent address: Department of Genome Sciences, University of Washington, Seattle, WA, 20 USA 21 †Correspondence to: [email protected] or [email protected] 22 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.18.102277; this version posted May 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Specification of the "Sequ" Command
    1 Specification of the "sequ" command 2 Copyright © 2013 Bart Massey 3 Revision 0, 1 October 2013 4 This specification describes the "universal sequence" command sequ. The sequ command is a 5 backward-compatible set of extensions to the UNIX [seq] 6 (http://www.gnu.org/software/coreutils/manual/html_node/seq-invo 7 cation.html) command. There are many implementations of seq out there: this 8 specification is built on the seq supplied with GNU Coreutils version 8.21. 9 The seq command emits a monotonically increasing sequence of numbers. It is most commonly 10 used in shell scripting: 11 TOTAL=0 12 for i in `seq 1 10` 13 do 14 TOTAL=`expr $i + $TOTAL` 15 done 16 echo $TOTAL 17 prints 55 on standard output. The full sequ command does this basic counting operation, plus 18 much more. 19 This specification of sequ is in several stages, known as compliance levels. Each compliance 20 level adds required functionality to the sequ specification. Level 1 compliance is equivalent to 21 the Coreutils seq command. 22 The usual specification language applies to this document: MAY, SHOULD, MUST (and their 23 negations) are used in the standard fashion. 24 Wherever the specification indicates an error, a conforming sequ implementation MUST 25 immediately issue appropriate error message specific to the problem. The implementation then 26 MUST exit, with a status indicating failure to the invoking process or system. On UNIX systems, 27 the error MUST be indicated by exiting with status code 1. 28 When a conforming sequ implementation successfully completes its output, it MUST 29 immediately exit, with a status indicating success to the invoking process or systems.
    [Show full text]
  • Transcriptome-Wide M a Detection with DART-Seq
    Transcriptome-wide m6A detection with DART-Seq Kate D. Meyer ( [email protected] ) Duke University School of Medicine https://orcid.org/0000-0001-7197-4054 Method Article Keywords: RNA, epitranscriptome, RNA methylation, m6A, methyladenosine, DART-Seq Posted Date: September 23rd, 2019 DOI: https://doi.org/10.21203/rs.2.12189/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/7 Abstract m6A is the most abundant internal mRNA modication and plays diverse roles in gene expression regulation. Much of our current knowledge about m6A has been driven by recent advances in the ability to detect this mark transcriptome-wide. Antibody-based approaches have been the method of choice for global m6A mapping studies. These methods rely on m6A antibodies to immunoprecipitate methylated RNAs, followed by next-generation sequencing to identify m6A-containing transcripts1,2. While these methods enabled the rst identication of m6A sites transcriptome-wide and have dramatically improved our ability to study m6A, they suffer from several limitations. These include requirements for high amounts of input RNA, costly and time-consuming library preparation, high variability across studies, and m6A antibody cross-reactivity with other modications. Here, we describe DART-Seq (deamination adjacent to RNA modication targets), an antibody-free method for global m6A detection. In DART-Seq, the C to U deaminating enzyme, APOBEC1, is fused to the m6A-binding YTH domain. This fusion protein is then introduced to cellular RNA either through overexpression in cells or with in vitro assays, and subsequent deamination of m6A-adjacent cytidines is then detected by RNA sequencing to identify m6A sites.
    [Show full text]
  • Introduction to Shell Programming Using Bash Part I
    Introduction to shell programming using bash Part I Deniz Savas and Michael Griffiths 2005-2011 Corporate Information and Computing Services The University of Sheffield Email [email protected] [email protected] Presentation Outline • Introduction • Why use shell programs • Basics of shell programming • Using variables and parameters • User Input during shell script execution • Arithmetical operations on shell variables • Aliases • Debugging shell scripts • References Introduction • What is ‘shell’ ? • Why write shell programs? • Types of shell What is ‘shell’ ? • Provides an Interface to the UNIX Operating System • It is a command interpreter – Built on top of the kernel – Enables users to run services provided by the UNIX OS • In its simplest form a series of commands in a file is a shell program that saves having to retype commands to perform common tasks. • Shell provides a secure interface between the user and the ‘kernel’ of the operating system. Why write shell programs? • Run tasks customised for different systems. Variety of environment variables such as the operating system version and type can be detected within a script and necessary action taken to enable correct operation of a program. • Create the primary user interface for a variety of programming tasks. For example- to start up a package with a selection of options. • Write programs for controlling the routinely performed jobs run on a system. For example- to take backups when the system is idle. • Write job scripts for submission to a job-scheduler such as the sun- grid-engine. For example- to run your own programs in batch mode. Types of Unix shells • sh Bourne Shell (Original Shell) (Steven Bourne of AT&T) • csh C-Shell (C-like Syntax)(Bill Joy of Univ.
    [Show full text]
  • MEDIPS: Genome-Wide Differential Coverage Analysis of Sequencing Data Derived from DNA Enrichment Experiments
    MEDIPS: genome-wide differential coverage analysis of sequencing data derived from DNA enrichment experiments. 1 Lukas Chavez [email protected] May 19, 2021 Contents 1 Introduction ..............................2 2 Installation ...............................2 3 Preparations..............................3 4 Case study: Genome wide methylation and differential cover- age between two conditions .....................5 4.1 Data Import and Preprocessing ..................5 4.2 Coverage, methylation profiles and differential coverage ......6 4.3 Differential coverage: selecting significant windows ........8 4.4 Merging neighboring significant windows .............9 4.5 Extracting data at regions of interest ...............9 5 Quality controls ............................ 10 5.1 Saturation analysis ........................ 10 5.2 Correlation between samples ................... 12 5.3 Sequence Pattern Coverage ................... 13 5.4 CpG Enrichment ......................... 14 6 Miscellaneous............................. 14 6.1 Processing regions of interest ................... 15 6.2 Export Wiggle Files ........................ 15 6.3 Merging MEDIPS SETs ...................... 15 6.4 Annotation of significant windows ................. 16 6.5 addCNV ............................. 16 6.6 Calibration Plot .......................... 16 6.7 Comments on the experimental design and Input data ....... 17 MEDIPS 1 Introduction MEDIPS was developed for analyzing data derived from methylated DNA immunoprecipita- tion (MeDIP) experiments [1] followed by
    [Show full text]
  • MEDIPS: DNA IP-Seq Data Analysis
    Package ‘MEDIPS’ September 30, 2021 Type Package Title DNA IP-seq data analysis Version 1.44.0 Date 2020-02-15 Author Lukas Chavez, Matthias Lienhard, Joern Dietrich, Isaac Lopez Moyado Maintainer Lukas Chavez <[email protected]> Description MEDIPS was developed for analyzing data derived from methylated DNA immunoprecipitation (MeDIP) experiments followed by sequencing (MeDIP- seq). However, MEDIPS provides functionalities for the analysis of any kind of quantitative sequencing data (e.g. ChIP-seq, MBD-seq, CMS-seq and others) including calculation of differential coverage between groups of samples and saturation and correlation analysis. License GPL (>=2) LazyLoad yes Depends R (>= 3.0), BSgenome, Rsamtools Imports GenomicRanges, Biostrings, graphics, gtools, IRanges, methods, stats, utils, edgeR, DNAcopy, biomaRt, rtracklayer, preprocessCore Suggests BSgenome.Hsapiens.UCSC.hg19, MEDIPSData, BiocStyle biocViews DNAMethylation, CpGIsland, DifferentialExpression, Sequencing, ChIPSeq, Preprocessing, QualityControl, Visualization, Microarray, Genetics, Coverage, GenomeAnnotation, CopyNumberVariation, SequenceMatching NeedsCompilation no git_url https://git.bioconductor.org/packages/MEDIPS git_branch RELEASE_3_13 git_last_commit 4df0aee git_last_commit_date 2021-05-19 Date/Publication 2021-09-30 1 2 MEDIPS-package R topics documented: MEDIPS-package . .2 COUPLINGset-class . .3 MEDIPS.addCNV . .4 MEDIPS.correlation . .5 MEDIPS.couplingVector . .6 MEDIPS.CpGenrich . .7 MEDIPS.createROIset . .8 MEDIPS.createSet . 10 MEDIPS.exportWIG . 11
    [Show full text]
  • Gnu Coreutils Core GNU Utilities for Version 5.93, 2 November 2005
    gnu Coreutils Core GNU utilities for version 5.93, 2 November 2005 David MacKenzie et al. This manual documents version 5.93 of the gnu core utilities, including the standard pro- grams for text and file manipulation. Copyright c 1994, 1995, 1996, 2000, 2001, 2002, 2003, 2004, 2005 Free Software Foundation, Inc. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.1 or any later version published by the Free Software Foundation; with no Invariant Sections, with no Front-Cover Texts, and with no Back-Cover Texts. A copy of the license is included in the section entitled “GNU Free Documentation License”. Chapter 1: Introduction 1 1 Introduction This manual is a work in progress: many sections make no attempt to explain basic concepts in a way suitable for novices. Thus, if you are interested, please get involved in improving this manual. The entire gnu community will benefit. The gnu utilities documented here are mostly compatible with the POSIX standard. Please report bugs to [email protected]. Remember to include the version number, machine architecture, input files, and any other information needed to reproduce the bug: your input, what you expected, what you got, and why it is wrong. Diffs are welcome, but please include a description of the problem as well, since this is sometimes difficult to infer. See section “Bugs” in Using and Porting GNU CC. This manual was originally derived from the Unix man pages in the distributions, which were written by David MacKenzie and updated by Jim Meyering.
    [Show full text]
  • Systems Supplement for COP 3601
    Systems Guide for COP 3601: Introduction to Systems Software Charles N. Winton Department of Computer and Information Sciences University of North Florida 2010 Chapter 1 A Basic Guide for the Unix Operating System 1. 1 Using the Unix On-line Manual Pages Facility The following are some of the Unix commands for which you may display manual pages: cal cat cd chmod cp cut date echo egrep ex fgrep file find gcc gdb grep kill less ln locate ls mail make man mesg mkdir mv nohup nl passwd pr ps pwd rm rmdir set sleep sort stty tail tee time touch tr tty uname umask unset vim wall wc which who whoami write For example, to display the manual pages for the command "cp" enter man cp Note that you may also enter man man to find out more about the "man" command. In addition there may be commands unique to the local environment with manual pages; e.g., man turnin accesses a manual page for a project submission utility named Aturnin@ that has been added to the system. If you enter a command from the Unix prompt that requires an argument, the system will recognize that the command is incomplete and respond with an error message. For example, if the command "cp" had been entered at the Unix prompt the system would respond with the information such as shown below: cp: missing file arguments Try `cp --help' for more information. The "cp" command is a copy command. If the arguments which tell the command which file to copy and where to locate the copied file are missing, then the usage error message is generated.
    [Show full text]
  • Command Line Unix BLAST, RM, Herne
    Command Line Unix BLAST, RM, Herne Christopher Shaffer Genomics Education Workshop Washington University, Summer ‘06 Command line • Why use BLAST command line? – Avoid slow responses at NCBI – Use a static database, so answers does not change – Search unpublished data (search all fosmids) • Finishing • Level 3 Annotation 1 Building a BLAST command >blastall -p blastx Search Type -i 99M21.seq Query -d ../../../Databases/protein/melanogaster Database -o dmel_blastx.html Output -T -e 1e-2 -F F Settings Goals • Unix directories & command line • BLAST (via command line) • RepeatMasker (via command line) • herne (blast visualization) 2 General Unix Tips • To use the command line start X11 and type commands into the “xterm” window • A few things about unix commands: – UNIX is case sensitive – Little or no feedback if successful, “no news is good news” Unix Help on the Web Here is a list of a few online Unix tutorials: • Unix for Beginners http://www.ee.surrey.ac.uk/Teaching/Unix/ • Unix Guru Universe http://www.ugu.com/sui/ugu/show?help.beginners • Getting Started With The Unix Operating System http://www.leeds.ac.uk/iss/documentation/beg/beg8/beg8.html 3 Unix directories • Unix systems can have many thousands of files • Directories are a means of organizing your files on a Unix computer. – They are equivalent to folders in Windows and Macintosh computers Directory Structure The directory that holds / everything is called “root”and is symbolized by “/” Applications Users System Administrator Student4342 Shared Documents Music Desktop 4 Unix directories (cont) • When logged into a unix computer there is always one directory called the “current working directory” • When you type a command with a filename unix will look for that file in the “current working directory” • You can change the “current working directory” at any time with the cd command.
    [Show full text]
  • Disentangling Srna-Seq Data to Study RNA Communication Between Species
    bioRxiv preprint doi: https://doi.org/10.1101/508937; this version posted January 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Disentangling sRNA-Seq data to study RNA communication between species 1 1 2,§ 2 Bermúdez-Barrientos JR *,​ Ramírez-Sánchez O *,​ Chow FWN ,​ Buck AH **,​ Abreu-Goodger 1 ​ ​ ​ ​ C **​ ​ 1 Unidad​ de Genómica Avanzada (Langebio), Centro de Investigación y de Estudios Avanzados del IPN, Irapuato, Guanajuato 36824, México 2 Institute​ of Immunology and Infection Research and Centre for Immunity, Infection & Evolution, School of Biological Sciences, The University of Edinburgh, Edinburgh EH9 3JT, UK § Current​ Address: Department of Microbiology, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong * these authors contributed equally ** to whom correspondence should be addressed: [email protected], [email protected] ​ ​ ​ KEYWORDS Small RNA, extracellular RNA, RNA communication, symbiosis, extracellular vesicles, dual RNA-Seq, sRNA-Seq ABSTRACT Many organisms exchange small RNAs during their interactions, and these RNAs can target or bolster defense strategies in host-pathogen systems. Current sRNA-Seq technology can determine the small RNAs present in any symbiotic system, but there are very few bioinformatic tools available to interpret the results. We show that one of the biggest challenges comes from sequences that map equally well to the genomes of both interacting organisms. This arises due to the small size of the sRNA compared to large genomes, and because many of the produced sRNAs come from genomic regions that encode highly conserved miRNAs, rRNAs or tRNAs.
    [Show full text]
  • SAMMY-Seq Reveals Early Alteration of Heterochromatin and Deregulation of Bivalent Genes in Hutchinson-Gilford Progeria Syndrome
    ARTICLE https://doi.org/10.1038/s41467-020-20048-9 OPEN SAMMY-seq reveals early alteration of heterochromatin and deregulation of bivalent genes in Hutchinson-Gilford Progeria Syndrome Endre Sebestyén 1,8,9, Fabrizia Marullo 2,9, Federica Lucini 3, Cristiano Petrini1, Andrea Bianchi2,4, Sara Valsoni 4,5, Ilaria Olivieri 2, Laura Antonelli 5, Francesco Gregoretti 5, Gennaro Oliva5, ✉ ✉ Francesco Ferrari 1,6,10 & Chiara Lanzuolo 3,7,10 1234567890():,; Hutchinson-Gilford progeria syndrome is a genetic disease caused by an aberrant form of Lamin A resulting in chromatin structure disruption, in particular by interfering with lamina associated domains. Early molecular alterations involved in chromatin remodeling have not been identified thus far. Here, we present SAMMY-seq, a high-throughput sequencing-based method for genome-wide characterization of heterochromatin dynamics. Using SAMMY-seq, we detect early stage alterations of heterochromatin structure in progeria primary fibroblasts. These structural changes do not disrupt the distribution of H3K9me3 in early passage cells, thus suggesting that chromatin rearrangements precede H3K9me3 alterations described at later passages. On the other hand, we observe an interplay between changes in chromatin accessibility and Polycomb regulation, with site-specific H3K27me3 variations and tran- scriptional dysregulation of bivalent genes. We conclude that the correct assembly of lamina associated domains is functionally connected to the Polycomb repression and rapidly lost in early molecular events of progeria pathogenesis. 1 IFOM, The FIRC Institute of Molecular Oncology, Milan, Italy. 2 Institute of Cell Biology and Neurobiology, National Research Council, Rome, Italy. 3 Istituto Nazionale Genetica Molecolare “Romeo ed Enrica Invernizzi”, Milan, Italy.
    [Show full text]