DOCSLIB.ORG

Adipocyte Death, Adipose Tissue Remodeling, and Obesity Complications Katherine J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Adipocyte Death, Adipose Tissue Remodeling, and Obesity Complications Katherine J ORIGINAL ARTICLE Adipocyte Death, Adipose Tissue Remodeling, and Obesity Complications Katherine J. Strissel, Zlatina Stancheva, Hideaki Miyoshi, James W. Perfield, II, Jason DeFuria, Zoe Jick, Andrew S. Greenberg, and Martin S. Obin OBJECTIVE—We sought to determine the role of adipocyte death in obesity-induced adipose tissue (AT) inflammation and obesity complications. dipose tissue (AT) macrophages (ATM⌽s) pro- mote obesity-associated AT inflammation and RESEARCH DESIGN AND METHODS—Male C57BL/6 mice insulin resistance (1–5). Infiltrating ATM⌽s se- were fed a high-fat diet for 20 weeks to induce obesity. Every 4 crete proinflammatory mediators that are ele- weeks, insulin resistance was assessed by intraperitoneal insulin A tolerance tests, and epididymal (eAT) and inguinal subcutaneous vated in AT of obese mice and humans and are implicated AT (iAT) and livers were harvested for histological, immunohis- in the development of insulin resistance, including tumor tochemical, and gene expression analyses. necrosis factor (TNF)-␣, interleukin (IL)-6, and monocyte chemotactic protein (MCP)-1 (5–9). In obese mice and RESULTS—Frequency of adipocyte death in eAT increased humans, M⌽s infiltrate AT as circulating monocytes in from Ͻ0.1% at baseline to 16% at week 12, coincident with response to AT secretion of MCP-1, which recruits mono- increases in 1) depot weight; 2) AT macrophages (ATM⌽s) cytes expressing the C-C chemokine receptor (CCR)2 expressing F4/80 and CD11c; 3) mRNA for tumor necrosis factor (1,2,10–12,13). CCR2ϩ M⌽s expressing the M⌽ differen- (TNF)-␣, monocyte chemotactic protein (MCP)-1, and interleu- ⌽ tiation marker F4/80 and CD11c, a dendritic cell (DC) kin (IL)-10; and 4) insulin resistance. ATM s in crown-like marker (13) upregulated in M⌽ foam cells (14), were structures surrounding dead adipocytes expressed TNF-␣ and IL-6 proteins. Adipocyte number began to decline at week 12. At recently reported to infiltrate AT of obese mice and were ϳ distinguished from noninflammatory resident ATM⌽s (F4/ week 16, adipocyte death reached 80%, coincident with maxi- ϩ Ϫ Ϫ mal expression of CD11c and inflammatory genes, loss (40%) of 80 /CCR2 /CD11c ) isolated from nonobese mice eAT mass, widespread collagen deposition, and accelerated (12,15). However, the relationship between this obesity- hepatic macrosteatosis. By week 20, adipocyte number was associated ATM⌽ “phenotypic switch” (12) and the devel- restored with small adipocytes, coincident with reduced adipo- opment and progression of obesity complications is cyte death (fourfold), CD11c and MCP-1 gene expression (two- unclear (16,17). fold), and insulin resistance (35%). eAT weight did not increase at In addition to their roles in innate immunity, M⌽s week 20 and was inversely correlated with liver weight after perform vital functions in developmental and homeostatic week 12 (r ϭϪ0. 85, P Ͻ 0.001). In iAT, adipocyte death was first tissue remodeling (18,19). In AT, M⌽s promote angiogen- detected at week 12 and remained Յ3%. esis and vascular remodeling required for postnatal growth of mouse epididymal AT (eAT) (20). ATM⌽ pro- CONCLUSIONS—These results implicate depot-selective adi- pocyte death and M⌽-mediated AT remodeling in inflammatory duction of matrix-degrading proteinases is implicated in and metabolic complications of murine obesity. Diabetes 56: the matrix remodeling associated with adipocyte enlarge- 2910–2918, 2007 ment and AT expansion (21). We previously hypothesized that infiltrating ATM⌽s play an important role(s) in obe- sity-associated AT remodeling, based on our observation that ATM⌽s in obese mice and humans localize to dead adipocytes, which increase in frequency in obesity (22). At sites of adipocyte death, ATM⌽s aggregate to form a crown-like structure (CLS) that envelopes and ingests the From the Obesity and Metabolism Laboratory, Jean Mayer-U.S. Department of moribund adipocyte and its potentially cytotoxic remnant Agriculture Human Nutrition Research Center on Aging (JM-USDA HNRCA) at lipid droplet (22). As a consequence of lipid scavenging, Tufts University, Boston, Massachusetts. ATM⌽s within CLS become lipid-laden “foam cells” (22). Address correspondence and reprint requests to Martin S. Obin or Andrew ⌽ S. Greenberg, USDA, HNRCA at Tufts University, Boston, MA 02111. E-mail: M fusion within CLS is common, with multinucleate [email protected] or [email protected]. giant cells (MGCs) frequently observed (22). We propose Received for publication 5 June 2007 and accepted in revised form 27 that clearance of dead adipocytes by ATM⌽s is an initial August 2007. Published ahead of print at http://diabetes.diabetesjournals.org on 11 Sep- remodeling event required for AT repair and differentia- tember 2007. DOI: 10.2337/db07-0767. tion of new adipocytes at sites of adipocyte loss. M⌽- Additional information for this article can be found in an online appendix at mediated cell killing is a feature of various forms of tissue http://dx.doi.org/10.2337/db07-0767. ⌽ AT, adipose tissue; ATM⌽, AT macrophage; AUC, area under the curve; remodeling (18), rendering it plausible that ATM s ac- CCR, C-C chemokine receptor; CLS, crown-like structure; DC, dendritic cell; tively participate in adipocyte execution (22). DIO, diet-induced obesity; eAT, epididymal AT; HF, high fat; iAT, inguinal The clearance of dead adipocytes is likely to promote subcutaneous AT; IL, interleukin; ITT, intraperitoneal insulin tolerance test; proinflammatory ATM⌽ activation, reflecting both the LF, low fat; MCP, monocyte chemotactic protein; MGC, multinucleate giant cell; NEFA, nonesterified fatty acid; TNF, tumor necrosis factor. necrotic-like morphology of adipocyte death and ATM⌽ © 2007 by the American Diabetes Association. fusion (22). M⌽ fusion, which synergistically increases The costs of publication of this article were defrayed in part by the payment of page ⌽ ␣ charges. This article must therefore be hereby marked “advertisement” in accordance M absorptive capacity, requires TNF- autocrine/para- with 18 U.S.C. Section 1734 solely to indicate this fact. crine signaling (23), suggesting that CLS and MGCs may be 2910 DIABETES, VOL. 56, DECEMBER 2007 K.J. STRISSEL AND ASSOCIATES TABLE 1 were rat anti-mouse F4/80 (Serotec), Mac-2 (Cedarlane Labs), goat anti-mouse Primer sequences used for gene expression analysis by real-time TNF-␣, goat anti-mouse IL-6 (Santa Cruz), and rabbit anti-mouse perilipin (27). PCR Negative controls were nonimmune IgG and peptide-neutralized primary antibody. Gene target Sequences (5Ј–3Ј) Adipocyte death. Dead/dying adipocytes were identified by light microscopy as perilipin-negative lipid droplets surrounded by M⌽ crowns (22). The F4/80 F: CTTTGGCTATGGGCTTCCAGTC frequency of adipocyte death was calculated from micrographs as (number R: GCAAGGAGGACAGAGTTTATCGTG dead adipocytes/number total adipocytes) ϫ 100. CD11b F: CGGAAAGTAGTGAGAGAACTGTTTC Adipocyte volume and adipocyte number. Adipocyte volume was calcu- R: TTATAATCCAAGGGATCACCGAATTT lated from cross-sectional area obtained from perimeter tracings using Image CD11c F: CTGGATAGCCTTTCTTCTGCTG J software (28) (Sun Microsystems). Adipocyte number was calculated from fat pad weight and adipocyte volume (29) and corrected for percentage of R: GCACACTGTGTCCGAACTC dead adipocytes. CD68 F: CTTCCCACAGGCAGCACAG; Quantitative PCR. Adipose tissues (lymph nodes removed) were dissected, R: AATGATGAGAGGCAGCAAGAGG frozen in liquid nitrogen, and stored at Ϫ70°C. Total RNA was extracted, TNF-␣ F: ATGGCGTTTCCGAATTCAC quantified, and analyzed by SYBR Green real-time PCR on an Applied R: GAGGCAACCTGACCACTCTC Biosystems 7300 Real Time PCR system (30). Fold difference in gene MCP-1 F: ACTGAAGCCAGCTCTCTCTTCCTC expression was calculated as 2Ϫ⌬⌬Ct using cyclophilin B as the endogenous R: TTCCTTCTTGGGGTCAGCACAGAC control gene with mice fed the LF diet for 1 week as the “comparer” (31). IL-6 F: TCCAGTTGCCTTCTTGGGAC Genes and primer sequences are listed in Table 1. R: GTGTAATTAAGCGCCGACTTG Measures of insulin resistance. Fasted (overnight) serum insulin was measured by enzyme-linked immunosorbent assay using mouse insulin as a Adiponectin F: GAATCATTATGACGGCAGCA standard (Crystal Chem). Intraperitoneal insulin tolerance tests (ITTs) were R: TCATGTACACCGTGATGTGGTA performed on nonanesthetized mice fasted for 4–6 h in the morning. Glucose Cyclophilin B F: ATGTGGTTTTCGGCAAAGTT measures were obtained from whole–tail vein blood using an automated R: TGACATCCTTCAGTGGCTTG glucometer at baseline and 15, 30, 45, 60, and 90 min following intraperitoneal injection of human insulin (0.75 mU/kg). Glucose area under the curve F, forward; R, reverse. (AUC0–90) was determined for HF-fed and LF-fed cohorts and the difference (⌬AUC) reported. chronic sources of TNF-␣. Moreover, because each dead Biohumoral measures. Blood was obtained from fasted (overnight) mice by adipocyte “recruits” dozens of ATM⌽s, a low frequency of cardiac puncture. Serum leptin, resistin, adiponectin, and MCP-1 were mea- sured by enzyme-linked immunosorbent assay (Lincoplex mouse adipokine; adipocyte death may be sufficient to cause AT inflamma- Millipore Bioscience), and nonesterified fatty acids (NEFAs) were measured tion and promote insulin resistance. However, the proin- using the NEFA-C kit (Wako Chemicals). flammatory milieu at sites of tissue remodeling is typically Statistics. ANOVA or general linear model procedures were used in conjunc- transient, giving way to a “repair” program that promotes tion with Tukey’s honestly significant difference test (SYSTAT v10). Frequency
Load more

Recommended publications
  • Adipose Derived Mesenchymal Stem Cell Differentiation Into Adipogenic and Osteogenic Stem Cells
    vv ISSN: 2641-3000 DOI: https://dx.doi.org/10.17352/sscrt LIFE SCIENCES GROUP Hassan IH El Sayyad1*, Mohamed A Sobh2, Soad A Khalifa1 and Omnia KR Research Article 3 El-Sayyad Adipose Derived Mesenchymal Stem 1Zoology Department, Faculty of Science, Egypt 2Urology & Nephrology Center, Research Center, Egypt Cell Differentiation into Adipogenic 3Pediatric Mansoura University Hospital, Mansoura University, Egypt and Osteogenic Stem Cells Dates: Received: 08 December, 2016; Accepted: 23 December, 2016; Published: 29 December, 2016 *Corresponding author: Hassan IH El-Sayyad, Depart- Abstract ment of Zoology, Faculty of Science, Mansoura University, Mansoura, Egypt, Tel: 0020502254850; Objective: Lipoaspiration of human breast fats are important source of adipocyte stem cells E-mail: (hAMSCs) which play a great role in regenerative medicine. The present study illustrates its capability of its transformation and characterization of adipocyte, osteogenic or chondrogenic cells. https://www.peertechz.com Methods and results: The hAMSCs were positive for CD13, CD29, CD105 and CD90 and negative CD34 and CD 14. The hAMSCs were cultured in adipogenic or osteogenic culture for 4,7,14 & 21 days. Gene expression for adipogenic (PCR of leptin, peroxisome proliferator-activated receptor-γ and lipoprotein lipase) and osteogenic (osteocalcin) cells were carried out. Biochemical assessments of adipogenic (lipoprotein lipase enzyme and glycerol-3-phosphate dehydrogenase) and osteogenic (alkaline phosphatase, B-galactosidase and calcium content) markers. Also, light and transmission electron microscopic investigation of adipocyte stem cell culture were investigated at 4,7,14 & 21 days in both two models. Adipocyte derived from hAMSCs displayed fi broblastic morphology and confl uency at 7 days and fl at-shape with positive oil red staining at 14 &21 days.
    [Show full text]
  • Extracellular Matrix Grafts: from Preparation to Application (Review)
    INTERNATIONAL JOURNAL OF MOleCular meDICine 47: 463-474, 2021 Extracellular matrix grafts: From preparation to application (Review) YONGSHENG JIANG1*, RUI LI1,2*, CHUNCHAN HAN1 and LIJIANG HUANG1 1Science and Education Management Center, The Affiliated Xiangshan Hospital of Wenzhou Medical University, Ningbo, Zhejiang 315700; 2School of Chemistry, Sun Yat-sen University, Guangzhou, Guangdong 510275, P.R. China Received July 30, 2020; Accepted December 3, 2020 DOI: 10.3892/ijmm.2020.4818 Abstract. Recently, the increasing emergency of traffic acci- Contents dents and the unsatisfactory outcome of surgical intervention are driving research to seek a novel technology to repair trau- 1. Introduction matic soft tissue injury. From this perspective, decellularized 2. ECM-G characterization matrix grafts (ECM-G) including natural ECM materials, and 3. Methods of decellularization treatments their prepared hydrogels and bioscaffolds, have emerged as 4. Removal of residual cellular components and chemicals possible alternatives for tissue engineering and regenerative 5. Application of ECM-P in regenerative medicine medicine. Over the past decades, several physical and chemical 6. Challenges and future outlook on ECM-P decellularization methods have been used extensively to deal 7. Conclusions with different tissues/organs in an attempt to carefully remove cellular antigens while maintaining the non-immunogenic ECM components. It is anticipated that when the decellular- 1. Introduction ized biomaterials are seeded with cells in vitro or incorporated into irregularly shaped defects in vivo, they can provide the The extracellular matrix (ECM) derived from organs/tissues is appropriate biomechanical and biochemical conditions for a complex, highly organized assembly of macromolecules with directing cell behavior and tissue remodeling.
    [Show full text]
  • Extracellular Matrix Degradation and Remodeling in Development and Disease
    Downloaded from http://cshperspectives.cshlp.org/ on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Extracellular Matrix Degradation and Remodeling in Development and Disease Pengfei Lu1,2, Ken Takai2, Valerie M. Weaver3, and Zena Werb2 1Breakthrough Breast Cancer Research Unit, Paterson Institute for Cancer Research and Wellcome Trust Centre for Cell Matrix Research, Faculty of Life Sciences, University of Manchester, Manchester M20 4BX, United Kingdom 2Department of Anatomy and Program in Developmental Biology, University of California, San Francisco, California 94143-0452 3Department of Surgery and Center for Bioengineering and Tissue Regeneration, University of California, San Francisco, California 94143 Correspondence: [email protected] The extracellular matrix (ECM) serves diverse functions and is a major component of the cellular microenvironment. The ECM is a highly dynamic structure, constantly undergoing a remodeling process where ECM components are deposited, degraded, or otherwise modified. ECM dynamics are indispensible during restructuring of tissue architecture. ECM remodeling is an important mechanism whereby cell differentiation can be regulated, including processes such as the establishment and maintenance of stem cell niches, branch- ing morphogenesis, angiogenesis, bone remodeling, and wound repair. In contrast, abnor- mal ECM dynamics lead to deregulated cell proliferation and invasion, failure of cell death, and loss of cell differentiation, resulting in congenital defects and pathological processes including tissue fibrosis and cancer. Understanding the mechanisms of ECM remodeling and its regulation, therefore, is essential for developing new therapeutic inter- ventions for diseases and novel strategies for tissue engineering and regenerative medicine. he extracellular matrix (ECM) forms a milieu versatile and performs many functions in addi- Tsurrounding cells that reciprocally influ- tion to its structural role.
    [Show full text]
  • Altered Adipose Tissue and Adipocyte Function in the Pathogenesis of Metabolic Syndrome
    Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome C. Ronald Kahn, … , Guoxiao Wang, Kevin Y. Lee J Clin Invest. 2019;129(10):3990-4000. https://doi.org/10.1172/JCI129187. Review Series Over the past decade, great progress has been made in understanding the complexity of adipose tissue biology and its role in metabolism. This includes new insights into the multiple layers of adipose tissue heterogeneity, not only differences between white and brown adipocytes, but also differences in white adipose tissue at the depot level and even heterogeneity of white adipocytes within a single depot. These inter- and intra-depot differences in adipocytes are developmentally programmed and contribute to the wide range of effects observed in disorders with fat excess (overweight/obesity) or fat loss (lipodystrophy). Recent studies also highlight the underappreciated dynamic nature of adipose tissue, including potential to undergo rapid turnover and dedifferentiation and as a source of stem cells. Finally, we explore the rapidly expanding field of adipose tissue as an endocrine organ, and how adipose tissue communicates with other tissues to regulate systemic metabolism both centrally and peripherally through secretion of adipocyte-derived peptide hormones, inflammatory mediators, signaling lipids, and miRNAs packaged in exosomes. Together these attributes and complexities create a robust, multidimensional signaling network that is central to metabolic homeostasis. Find the latest version: https://jci.me/129187/pdf REVIEW SERIES: MECHANISMS UNDERLYING THE METABOLIC SYNDROME The Journal of Clinical Investigation Series Editor: Philipp E. Scherer Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome C. Ronald Kahn,1 Guoxiao Wang,1 and Kevin Y.
    [Show full text]
  • Adipose Tissue: SHH and Dermal Adipogenesis
    RESEARCH HIGHLIGHTS Nature Reviews Endocrinology | Published online 18 Nov 2016; doi:10.1038/nrendo.2016.192 ADIPOSE TISSUE SHH and dermal adipogenesis In the dermis, adipose tissue adipogenesis. SHH is secreted from overexpression increased skin thick- expands in sync with the growth of HF-TACs; by knocking out this ness, which was also associated with hair follicles, but the mechanism that protein specifically in HF-TACs of increased Pparg expression. couples the growth of the two tissues mice, the dermal adipose layer failed Hsu and his colleagues hope is unclear. In new research, investiga- to expand. that their findings will eventually tors have found that sonic hedgehog This effect was specific to SHH help to mitigate the adverse effects (SHH) secreted from hair follicle secreted from HF-TACs and not of chemotherapy, such as thinning transit-amplifying cells (HF-TACs) from hair follicles, as in mice with of the skin, hair loss and increased is required for expansion of both hair follicles lacking smoothened susceptibility to infections. “Some dermal adipocytes and hair follicles. (Smo), a protein that mediates the of these symptoms might be a con- “TACs are stem cell progeny downstream effect of SHH, dermal sequence of a compromised ability responsible for generating a large adipogenesis was unaffected but of HF-TACs to direct changes amount of downstream cell types the follicles are shorter. Moreover, in dermal adipocytes, which are directly,” explains Ya-Chieh Hsu by deleting Smo in different skin important for skin thickening and who led the study. “TACs might be cell types, Hsu and his colleagues innate immunity,” concludes Hsu.
    [Show full text]
  • Immune Clearance of Senescent Cells to Combat Ageing and Chronic Diseases
    cells Review Immune Clearance of Senescent Cells to Combat Ageing and Chronic Diseases Ping Song * , Junqing An and Ming-Hui Zou Center for Molecular and Translational Medicine, Georgia State University, 157 Decatur Street SE, Atlanta, GA 30303, USA; [email protected] (J.A.); [email protected] (M.-H.Z.) * Correspondence: [email protected]; Tel.: +1-404-413-6636 Received: 29 January 2020; Accepted: 5 March 2020; Published: 10 March 2020 Abstract: Senescent cells are generally characterized by permanent cell cycle arrest, metabolic alteration and activation, and apoptotic resistance in multiple organs due to various stressors. Excessive accumulation of senescent cells in numerous tissues leads to multiple chronic diseases, tissue dysfunction, age-related diseases and organ ageing. Immune cells can remove senescent cells. Immunaging or impaired innate and adaptive immune responses by senescent cells result in persistent accumulation of various senescent cells. Although senolytics—drugs that selectively remove senescent cells by inducing their apoptosis—are recent hot topics and are making significant research progress, senescence immunotherapies using immune cell-mediated clearance of senescent cells are emerging and promising strategies to fight ageing and multiple chronic diseases. This short review provides an overview of the research progress to date concerning senescent cell-caused chronic diseases and tissue ageing, as well as the regulation of senescence by small-molecule drugs in clinical trials and different roles and regulation of immune cells in the elimination of senescent cells. Mounting evidence indicates that immunotherapy targeting senescent cells combats ageing and chronic diseases and subsequently extends the healthy lifespan. Keywords: cellular senescence; senescence immunotherapy; ageing; chronic disease; ageing markers 1.
    [Show full text]
  • A Narrative Review on Plasminogen Activator Inhibitor-1 and Its (Patho)Physiological Role: to Target Or Not to Target?
    International Journal of Molecular Sciences Review A Narrative Review on Plasminogen Activator Inhibitor-1 and Its (Patho)Physiological Role: To Target or Not to Target? Machteld Sillen and Paul J. Declerck * Laboratory for Therapeutic and Diagnostic Antibodies, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven, B-3000 Leuven, Belgium; [email protected] * Correspondence: [email protected] Abstract: Plasminogen activator inhibitor-1 (PAI-1) is the main physiological inhibitor of plasminogen activators (PAs) and is therefore an important inhibitor of the plasminogen/plasmin system. Being the fast-acting inhibitor of tissue-type PA (tPA), PAI-1 primarily attenuates fibrinolysis. Through inhibition of urokinase-type PA (uPA) and interaction with biological ligands such as vitronectin and cell-surface receptors, the function of PAI-1 extends to pericellular proteolysis, tissue remodeling and other processes including cell migration. This review aims at providing a general overview of the properties of PAI-1 and the role it plays in many biological processes and touches upon the possible use of PAI-1 inhibitors as therapeutics. Keywords: plasminogen activator inhibitor-1; PAI-1; fibrinolysis; cardiovascular disease; cancer; inflammation; fibrosis; aging Citation: Sillen, M.; Declerck, P.J. 1. Introduction A Narrative Review on Plasminogen Plasminogen activator inhibitor-1 (PAI-1) belongs to the family of serine protease Activator Inhibitor-1 and Its inhibitors (serpins) and is an important regulator of the plasminogen/plasmin system (Patho)Physiological Role: To Target (Figure1)[ 1]. This system revolves around the conversion of the zymogen plasmino- or Not to Target?. Int. J. Mol. Sci. 2021, gen into the active enzyme plasmin through proteolytic cleavage that is mediated by 22, 2721.
    [Show full text]
  • Shockwaves Suppress Adipocyte Differentiation Via Decrease in Pparγ
    cells Article Shockwaves Suppress Adipocyte Differentiation via Decrease in PPARγ Wonkyoung Cho y, SeoYeon Kim y, Myeongsook Jeong and Young Mi Park * Department of Molecular Medicine, College of Medicine, Ewha Womans University, Seoul 03760, Korea; [email protected] (W.C.); [email protected] (S.K.); [email protected] (M.J.) * Correspondence: [email protected]; Tel.: +82-2-6986-6269 These authors contributed equally to this work. y Received: 25 October 2019; Accepted: 7 January 2020; Published: 9 January 2020 Abstract: Adipogenesis is a crucial cellular process that contributes to the expansion of adipose tissue in obesity. Shockwaves are mechanical stimuli that transmit signals to cause biological responses. The purpose of this study is to evaluate the effects of shockwaves on adipogenesis. We treated 3T3L-1 cells and human primary preadipocytes for differentiation with or without shockwaves. Western blots and quantitative real-time reverse transcriptase PCR (qRT-PCR) for adipocyte markers including peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT-enhancer-binding proteins (C/EBPα) were performed. Extracellular adenosine triphosphate (ATP) and intracellular cyclic adenosine monophosphate (cAMP) levels, which are known to affect adipocyte differentiation, were measured. Shockwave treatment decreased intracellular lipid droplet accumulation in primary human preadipocytes and 3T3-L1 cells after 11–12 days of differentiation. Levels of key adipogenic transcriptional factors PPARγ and/or C/EBPα were lower in shockwave-treated human primary preadipocytes and 3T3L-1 cells after 12–13 days of differentiation than in shockwave-untreated cells. Shockwave treatment induced release of extracellular ATP from preadipocytes and decreased intracellular cAMP levels. Shockwave-treated preadipocytes showed a higher level of β-catenin and less PPARγ expression than shockwave-untreated cells.
    [Show full text]
  • 2011: Macrophage Phenotype As a Determinant of Remodeling Outcome with the Use of Biologic Scaffolds
    Macrophage Phenotype as a Determinant of Remodeling Outcome with the use of Biologic Scaffolds Stephen F. Badylak1, Kathryn A. Kukla1,3, Li Zhang1, Neill J. Turner1, Bryan N. Brown1,2 Corresponding Author: Stephen F. Badylak 1McGowan Institute for Regenerative Medicine, University of Pittsburgh, Pittsburgh, PA, USA; 2Department of Biomedical Engineering, Cornell University, Ithaca, NY; and 3Department of Biomedical Engineering, Carnegie Mellon University, Pittsburgh, PA Statement of Purpose: The ultimate determination of deposition of dense and disorganized connective tissue clinical success for an implanted biomaterial is the consistent with encapsulation. Remodeling of the response of the host tissue following implantation. The autograft was characterized by necrosis of the muscular innate immune mechanisms that participate in and component of the tissue and deposition of dense mature modulate the host response include effector cells such as connective tissue and adipose tissue consistent with macrophages. Macrophages have been classified as scarring. having either an M1 or an M2 phenotype, depending upon gene expression, effector molecule production, and cell Despite differences in the tissue remodeling outcome, a function. To date, the causes and the effects of morphologically indistinguishable population of macrophage polarization towards an M1 or M2 phenotype macrophages was observed following implantation of have been studied largely in the context of the host each scaffold material. However, immunolabeling response to pathogens and in cancer biology. Recently, techniques showed that scaffolds which resulted in M1 and M2 macrophages have been shown to play constructive remodeling (i.e., UBM) were associated with distinct roles in the remodeling process following tissue a predominant M2 (regulatory, pro-wound healing) injury and the host response to biologic scaffold materials macrophage population, while scaffolds which resulted in (1).
    [Show full text]
  • Adipocyte-Based Cell Therapy in Oncology: the Role of Cancer-Associated Adipocytes and Their Reinterpretation As Delivery Platforms
    pharmaceutics Review Adipocyte-Based Cell Therapy in Oncology: The Role of Cancer-Associated Adipocytes and Their Reinterpretation as Delivery Platforms 1, 1, 1 1 Raluca Munteanu y , Anca Onaciu y, Cristian Moldovan , Alina-Andreea Zimta , Diana Gulei 1 , Angelo V. Paradiso 2, Vladimir Lazar 3 and Ioana Berindan-Neagoe 1,4,5,* 1 Research Center for Advanced Medicine-Medfuture, Iuliu Hatieganu University of Medicine and Pharmacy, 23 Marinescu Street, 400337 Cluj-Napoca, Romania; [email protected] (R.M.); [email protected] (A.O.); [email protected] (C.M.); [email protected] (A.-A.Z.); [email protected] (D.G.) 2 Oncologia Sperimentale, Istituto Tumori G Paolo II, IRCCS, 70125 Bari, Italy; [email protected] 3 Worldwide Innovative Network for Personalized Cancer Therapy, 94800 Villejuif, France; [email protected] 4 Research Center for Functional Genomics, Biomedicine and Translational Medicine, Iuliu Hatieganu University of Medicine and Pharmacy, 23 Marinescu Street, 400337 Cluj-Napoca, Romania 5 Department of Functional Genomics and Experimental Pathology, The Oncology Institute “Prof. Dr. Ion Chiricuta”, 34-36 Republicii Street, 400015 Cluj-Napoca, Romania * Correspondence: [email protected] These authors have contributed equally to the work. y Received: 2 April 2020; Accepted: 23 April 2020; Published: 28 April 2020 Abstract: Cancer-associated adipocytes have functional roles in tumor development through secreted adipocyte-derived factors and exosomes and also through metabolic symbiosis, where the malignant cells take up the lactate, fatty acids and glutamine produced by the neighboring adipocytes. Recent research has demonstrated the value of adipocytes as cell-based delivery platforms for drugs (or prodrugs), nucleic acids or loaded nanoparticles for cancer therapy.
    [Show full text]
  • A Mix of Natural Bioactive Compounds Reduces Fat Accumulation and Modulates Gene Expression in the Adipose Tissue of Obese Rats Fed a Cafeteria Diet
    nutrients Article A Mix of Natural Bioactive Compounds Reduces Fat Accumulation and Modulates Gene Expression in the Adipose Tissue of Obese Rats Fed a Cafeteria Diet Albert Gibert-Ramos 1,* , Miguel Z. Martín-González 1, Anna Crescenti 2,* and M. Josepa Salvadó 1 1 Department of Biochemistry and Biotechnology, Nutrigenomics Research Group, Universitat Rovira i Virgili, 43007 Tarragona, Spain; [email protected] (M.Z.M.-G.); [email protected] (M.J.S.) 2 Eurecat, Centre Tecnològic de Catalunya, Unitat de Nutrició i Salut, 43204 Reus, Spain * Correspondence: [email protected] (A.G.-R.); [email protected] (A.C.); Tel.: +34-97-7558-465 (A.G.-R.); +34-97-7752-965 (A.C.) Received: 24 August 2020; Accepted: 20 October 2020; Published: 23 October 2020 Abstract: Scientists are focusing on bioactive ingredients to counteract obesity. We evaluated whether a mix containing grape seed proanthocyanidin extract (GSPE), anthocyanins, conjugated linoleic acid (CLA), and chicken feet hydrolysate (CFH) could reduce body fat mass and also determined which mechanisms in the white adipose tissue (WAT) and the brown adipose tissue (BAT) were affected by the treatment. The mix or vehicle (VH) were administered for three weeks to obese rats fed a cafeteria (CAF) diet. Biometric measures, indirect calorimetry, and gene expression in WAT and BAT were analyzed as was the histology of the inguinal WAT (IWAT). The individual compounds were also tested in the 3T3-L1 cell line. The mix treatment resulted in a significant 15% reduction in fat (25.01 0.91 g) compared to VH treatment (21.19 1.59 g), and the calorimetry results ± ± indicated a significant increase in energy expenditure and fat oxidation.
    [Show full text]
  • Apoptosis During Embryonic Tissue Remodeling Is Accompanied by Cell Senescence
    www.impactaging.com AGING, November 2015, Vol 7 N 11 Research Paper Apoptosis during embryonic tissue remodeling is accompanied by cell senescence Carlos I. Lorda‐Diez1, Beatriz Garcia‐Riart1, Juan A. Montero 1, Joaquín Rodriguez‐León2, Juan A 1 1 Garcia‐Porrero , and Juan M. Hurle 1 Departamento de Anatomía y Biología Celular and IDIVAL, Universidad de Cantabria, Santander 39011, Spain; 2 Departamento de Anatomía y Biología Celular,Universidad de Extremadura, Badajoz 07006, Spain. , s , v l p n , , n l , AS , Key words: programmed cell death sene cence limb de e o me t β‐galactosidase sy dacty y S P INZ Received: 07/01/15; Accepted: 11/02/15; Published: 11/14/15 Correspondence to: Juan M. Hurlé, PhD; E‐mail: [email protected] Copyright: Lorda‐Diez et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Abstract This study re‐examined the dying process in the interdigital tissue during the formation of free digits in the developing limbs. We demonstrated that the interdigital dying process was associated with cell senescence, as deduced by induction of β‐gal activity, mitotic arrest, and transcriptional up‐regulation of p21 together with many components of the senescence ‐associated secretory phenotype. We also found overlapping domains of expression of members of the Btg/Tob gene family of antiproliferative factors in the regressing interdigits. Notably, Btg2 was up‐regulated during interdigit remodeling in species with free digits but not in the webbed foot of the duck.
    [Show full text]