Mathematical Modeling of Complex Biological Systems

Total Page:16

File Type:pdf, Size:1020Kb

Mathematical Modeling of Complex Biological Systems Mathematical Modeling of Complex Biological Systems From Parts Lists to Understanding Systems Behavior Hans Peter Fischer, Ph.D. To understand complex biological systems such as cells, tissues, or even the human body, it is not sufficient to identify and characterize the individual molecules in the system. It also is necessary to obtain a thorough understanding of the interaction between molecules and pathways. This is even truer for understanding complex diseases such as cancer, Alzheimer’s disease, or alcoholism. With recent technological advances enabling researchers to monitor complex cellular processes on the molecular level, the focus is shifting toward interpreting the data generated by these so-called “–omics” technologies. Mathematical models allow researchers to investigate how complex regulatory processes are connected and how disruptions of these processes may contribute to the development of disease. In addition, computational models help investigators to systematically analyze systems perturbations, develop hypotheses to guide the design of new experimental tests, and ultimately assess the suitability of specific molecules as novel therapeutic targets. Numerous mathematical methods have been developed to address different categories of biological processes, such as metabolic processes or signaling and regulatory pathways. Today, modeling approaches are essential for biologists, enabling them to analyze complex physiological processes, as well as for the pharmaceutical industry, as a means for supporting drug discovery and development programs. KEY WORDS: Systems biology; human biology; complex biological systems; mathematical modeling; computational models; transcriptomics; proteomics; metabolomics ver the last decade, DNA- edge of the human genome sequence which genes are active in a given cell sequencing technologies have researchers would be able to readily at a given time, proteomic studies are Oadvanced tremendously, culmi- develop new therapies for treating human discovering which proteins are present nating in the deciphering of the com- disease as yet has only partially been ful- and in what amounts, and analyses of plete human genome in 2001 (Landers filled. The availability of a fully sequenced the metabolome have begun to exam­ et al. 2001; Venter et al. 2001). This human genome is a prerequisite for ine which metabolic processes occur achievement is a major milestone in the elucidating the origins of complex under different conditions. Most understanding of human biology, as the human diseases, such as cancer, obesity, importantly, however, this work has human genome provides a catalogue of Alzheimer’s disease, or alcoholism but highlighted the fact that human genes all human genes and associated molecules unfortunately is by no means sufficient and the proteins they encode do not that are required for creating a living to provide answers to all of the ques­ work in isolation but are connected human being. To date, however, the tions surrounding these diseases. at various levels in networks and availability of this “parts” list specifying In the meantime, further techno­ most human biomolecules, including logical advances have led to a consid­ 1 For a definition of this and other technical terms, see the glossary, p. 84. DNA, proteins, and RNA, has answered erable increase in the understanding only some of the questions concerning of the workings of the human body the complex phenomena of human biol- under normal conditions and in various HANS PETER FISCHER, PH.D, is chief ogy, leaving many others unanswered. disease states. For example, transcrip- scientific officer of Genedata AG, Basel, Moreover, the hope that with the knowl- tomic1 studies are shedding light on Switzerland. Vol. 31, No. 1, 2008 49 pathways of varying complexity. A the various components of the plane’s “—Omics” Technologies: deeper understanding of these inter­ controls and the dynamic regulatory The Driving Force Behind actions is pivotal for understanding feedback loops that control this inter­ Systems Biology human diseases and developing appro­ play. Similarly, the processes that occur priate therapeutic approaches. One in living organisms during growth, A major reason for the advent of systems crucial element in this process is the metabolism, and regulation of cell biology activities is that only recently generation of mathematical models functions also are interrelated and analyses at the molecular level of the that capture the often-unexpected require equally tight and coordinated cell have become technically feasible on features of complex biological systems. control mechanisms. a larger scale. With the development of The development of these models is The characteristics of a complex these new, large-scale technologies to intimately linked to the generation of system that arise from the interaction identify and quantify molecules on the experimental data using various high- of various components are referred to DNA, mRNA, protein, and metabolite throughput genomic, transcriptomic, as the emergent properties of the sys­ level, researchers for first time are in a proteomic, and metabolomic experi­ tem. Because they are the result of position to gather comprehensive data mental strategies. interactions between the different parts, on the molecular state of a given bio­ This article summarizes the challenges these emergent properties cannot be logical system in a systematical manner. associated with the study of complex attributed to any single part of the These technologies are sometimes biological systems, the benefits of system. Thus, the ability of a passen­ collectively referred to as “–omics” technologies (see figure 2). In addition, systems biology approaches, and the ger jet to fly is not the consequence new techniques to manipulate cells in ways in which computational models of one particular screw (even though a directed manner allow researchers to can help consolidate and interpret this particular screw may be necessary perturb biological systems under con­ the experimental data obtained using for the plane to function). Similarly, these approaches. These principles are trolled conditions. For instance, single the development of a complex disease genes can be deactivated and the global exemplified by some concrete exam­ (e.g., alcoholism) likely is not caused ples from current research projects. response of the modified cell can be by a single gene, although a particular observed at the protein, transcript, and gene may be one of the elements nec­ metabolite level. Together, these experi­ Blueprints of Life: Emergent essary for the disease to develop. Such mental techniques allow researchers to Properties of a System a system is considered irreducible— obtain a comprehensive picture of the that is, the system is unlikely to be cell’s function as well as of the role of The human body consists of approxi­ fully understood by taking it apart the deactivated gene and its specific mately 1014 individual cells, each of and studying each part on its own. function. Such comprehensive and which is itself a complex system compris­ To understand irreducible systems and accurate experimental data are critical ing thousands of different proteins and fully appreciate their emergent prop­ for developing and testing models of other biomolecules. The information erties, one must study the systems as biological processes, and the data pro­ specifying the composition and struc­ a whole. duced by –omics technologies are ture of virtually all of these molecules The publication of the human expected to guide the development is encoded in the DNA. Although genome sequence provided biological of new and more complex models. researchers now have information on scientists with a list of all the individ­ The new –omics technologies are all genes at hand, they still lack a deeper ual parts that make up the human characterized by three distinct fea­ understanding of many seemingly body. However, just like having a pile tures. First, they allow for analyses on common biological effects. The reason of all the pieces of a passenger jet does different molecular levels, such as the for this can be exemplified by an analogy not allow a technician to put together DNA, RNA, protein, or metabolite with a modern passenger jet, another a functional plane without having a level. These different molecular levels complex, yet man-made, system. Modern blueprint of the wiring scheme, this sometimes behave asynchronously— passenger jets consist of thousands of genome sequence is not sufficient to that is, although some proteins are individual components, such as screws, understand the interactions between highly abundant in a cell, the levels wheels, cables, and other components the genes and their products. Advances of the corresponding mRNAs from that perform a specific function in a over the last few years in transcrip­ which they are produced may be very specific technical context. However, tomics, proteomics, and metabolomics low or vice versa. Because asyn­ knowledge of those individual compo­ that allow investigators to monitor chronous behavior can indicate the nents does not reveal functions that the biological response of cells, how­ effects of complex regulatory interac­ arise through interactions with other ever, will allow studies of physiological tions, it is important to examine the components, such as those related to systems as a whole in order to identify role and degree of synchronization of takeoff, navigation, communication, higher-level
Recommended publications
  • Evolution, Politics and Law
    Valparaiso University Law Review Volume 38 Number 4 Summer 2004 pp.1129-1248 Summer 2004 Evolution, Politics and Law Bailey Kuklin Follow this and additional works at: https://scholar.valpo.edu/vulr Part of the Law Commons Recommended Citation Bailey Kuklin, Evolution, Politics and Law, 38 Val. U. L. Rev. 1129 (2004). Available at: https://scholar.valpo.edu/vulr/vol38/iss4/1 This Article is brought to you for free and open access by the Valparaiso University Law School at ValpoScholar. It has been accepted for inclusion in Valparaiso University Law Review by an authorized administrator of ValpoScholar. For more information, please contact a ValpoScholar staff member at [email protected]. Kuklin: Evolution, Politics and Law VALPARAISO UNIVERSITY LAW REVIEW VOLUME 38 SUMMER 2004 NUMBER 4 Article EVOLUTION, POLITICS AND LAW Bailey Kuklin* I. Introduction ............................................... 1129 II. Evolutionary Theory ................................. 1134 III. The Normative Implications of Biological Dispositions ......................... 1140 A . Fact and Value .................................... 1141 B. Biological Determinism ..................... 1163 C. Future Fitness ..................................... 1183 D. Cultural N orm s .................................. 1188 IV. The Politics of Sociobiology ..................... 1196 A. Political Orientations ......................... 1205 B. Political Tactics ................................... 1232 V . C onclusion ................................................. 1248 I. INTRODUCTION
    [Show full text]
  • Biological Waste Water Treatment
    Wastewater Management 18. SECONDARY TREATMENT Secondary treatment of the wastewater could be achieved by chemical unit processes such as chemical oxidation, coagulation-flocculation and sedimentation, chemical precipitation, etc. or by employing biological processes (aerobic or anaerobic) where bacteria are used as a catalyst for removal of pollutant. For removal of organic matter from the wastewater, biological treatment processes are commonly used all over the world. Hence, for the treatment of wastewater like sewage and many of the agro-based industries and food processing industrial wastewaters the secondary treatment will invariably consist of a biological reactor either in single stage or in multi stage as per the requirements to meet the discharge norms. 18.1 Biological Treatment The objective of the biological treatment of wastewater is to remove organic matter from the wastewater which is present in soluble and colloidal form or to remove nutrients such as nitrogen and phosphorous from the wastewater. The microorganisms (principally bacteria) are used to convert the colloidal and dissolved carbonaceous organic matter into various gases and into cell tissue. Cell tissue having high specific gravity than water can be removed in settling tank. Hence, complete treatment of the wastewater will not be achieved unless the cell tissues are removed. Biological removal of degradable organics involves a sequence of steps including mass transfer, adsorption, absorption and biochemical enzymatic reactions. Stabilization of organic substances by microorganisms in a natural aquatic environment or in a controlled environment of biological treatment systems is accomplished by two distinct metabolic processes: respiration and synthesis, also called as catabolism and anabolism, respectively.
    [Show full text]
  • Bishop Scott Boys' School
    BISHOP SCOTT BOYS’ SCHOOL (Affiliated to CBSE, New Delhi) Affiliation No.: 330726, School Campus: Chainpur, Jaganpura, By-Pass, Patna 804453. Phone Number: 7061717782, 9798903550. , Web: www.bishopscottboysschool.com Email: [email protected] STUDY COURSE MATERIAL BIOLOGY SESSION-2020-21 CLASS-XII TOPIC: REPRODUCTION IN ORAGANISM DAY-1 TEACHING MATERIAL :- INTRODUCTION Life Span: Each and every organism is capable to live only for a limited period of time. Lifespan refers to the life expectancy or longevity of an individual. The period from birth to the natural death of an organism known as its life span. Reproduction: Reproduction is defined as a biological process in which an organism gives rise to young ones (offspring) similar to itself. The offspring grow mature and in turn produce new offspring. Thus there is a cycle of birth, growth and death. The main purpose of reproduction are to: continue and preserve the specie pass species genetic identity keep the evolutionary chain going Page 1 of 21 Types of reproduction: Based on whether there is participation of one organism or two in the process of reproduction, it is of two types. Asexual reproduction: When offspring is produced by a single parent with or without the involvement of gamete formation the reproduction is asexual. Sexual reproduction: When two parents (opposite sex) participate in the reproductive process and also involved fusion of male and female gametes it is called sexual reproduction. ASSIGNMENT Q.1. Why is reproduction essential for organisms? Q.2. Which is better mode of reproduction: sexual or asexual? Why? MULTIPLE CHOICE QUESTIONS : - Q.1. Which physiological process is necessary for birth, growth, death, production of offspring and for continuity of the species? (a) Digestion (b) Transportation (c) Reproduction (d) Nutrition Q.2.
    [Show full text]
  • Computational Models for the Study of Sexual Selection Dynamics
    UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL INSTITUTO DE INFORMÁTICA CURSO DE BACHARELADO EM CIÊNCIA DA COMPUTAÇÃO MARCELO DE OLIVEIRA ROSA PRATES Computational models for the study of sexual selection dynamics Monograph presented in partial fulfillment of the requirements for the degree of Bachelor of Computer Science Prof. Dr. Luis Lamb Advisor Porto Alegre, July 28th, 2014 CIP – CATALOGING-IN-PUBLICATION Marcelo de Oliveira Rosa Prates, Computational models for the study of sexual selection dy- namics / Marcelo de Oliveira Rosa Prates. – Porto Alegre: Graduação em Ciência da Computação da UFRGS, 2014. 87 f.: il. Monograph – Universidade Federal do Rio Grande do Sul. Curso de Bacharelado em Ciência da Computação, Porto Alegre, BR–RS, 2014. Advisor: Luis Lamb. 1. Keyword 1. 2. Keyword 2. 3. Keyword 3. 4. Keyword 4. 5. Keyword 5. I. Lamb, Luis. II. Título. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL Reitor: Prof. Carlos Alexandre Netto Vice-Reitor: Prof. Rui Vicente Oppermann Pró-Reitor de Graduação: Prof. Sérgio Roberto Kieling Franco Diretor do Instituto de Informática: Prof. Luís da Cunha Lamb Coordenador do CIC: Prof. Raul Fernando Weber Bibliotecário-chefe do Instituto de Informática: Beatriz Regina Bastos Haro Draft 1.0 June 19, 2015 morprates @inf.ufrgs.br http://inf.ufrgs.br/∼morprates “Because the history of evolution is that life escapes all barriers. Life breaks free. Life expands to new territories. Painfully, perhaps even dangerously. But life finds a way.” - Michael Crichton, Jurassic Park ACKNOWLEDGMENTS I owe a great deal to my teacher and supervisor, Luís Lamb, who not only provided help and made it possible for this monograph to take its actual form, but also persuaded me to venture into research and gave me freedom to work on projects of my own interest in all these years as a scientific initiation scholarship holder.
    [Show full text]
  • Introduction to Cell Biology (Lecture Iconography)
    Dr. Mircea Leabu - Introduction to cell biology (lecture iconography) Introduction to Cell Biology “All human beings by nature stretch themselves out toward knowing” Aristotle, METAPHYSICS (translated by Sachs J), 2nd edition (Green Lion Press, Santa Fe 2002) What’s cell biology • Etymology: βίος – life; λόγος – word, concept, speaking, opinion, reason ↓ speaking about cell life • Part of biology studying biological processes under the cell context (how the cell is structured, and how it acts) • Biological process – a chain of biochemical reactions occurring in a well defined sequence • Descriptive part (analytical cell biology) – morphological organization of the cell (cell organelles and other morphological elements) – microscopic approach (LM, EM) • Functional part (integrative cell biology) – how cell morphological elements act (by themselves and by cross- talking in-between) to assure cell survival and their doing the best 1 Dr. Mircea Leabu - Introduction to cell biology (lecture iconography) Cell definition The cell is the structural and functional elementary unit of all living organisms, conserving the features of the organism, having the ability of self-control, self-regulation, and self-reproduction, being the result of a long time of evolution A little bit of history • The word cell comes from the Latin cellula, a small room, and was chosen by Robert Hooke, in 1665, when he compared the cork cells he saw to the small rooms monks lived in • The cell theory, first developed in 1839 by Matthias Jakob Schleiden and http://en.wikipedia.org/wiki/Robert_Hooke Theodor Schwann, completed by Rudolf Virchow, in 1858 - all organisms are composed of one or more cells - all cells come from preexisting cells (omnis cellula e cellula) - vital functions of an organism occur within cells - all cells contain the hereditary information necessary for regulating cell functions and for transmitting information to the next generation of cells.
    [Show full text]
  • LECTURE NOTES : CELL BIOLOGY Author(S): Dr
    LECTURE NOTES: CELL BIOLOGY (BIOMEDICAL LABORATORY SCIENCE STUDENTS) By Dr. Callixte Yadufashije Senior lecturer INES Ruhengeri ( Ruhengeri Institute Of Higher Education) January, 2018 2018 Ideal International E – Publication Pvt. Ltd. www.isca.co.in 427, Palhar Nagar, RAPTC, VIP-Road, Indore-452005 (MP) INDIA Phone: +91-731-2616100, Mobile: +91-80570-83382 E-mail: [email protected] , Website: www.isca.co.in Title: LECTURE NOTES : CELL BIOLOGY Author(s): Dr. Callixte Yadufashije Edition: First Volume: I © Copyright Reserved 2018 All rights reserved. No part of this publication may be reproduced, stored, in a retrieval system or transmitted, in any form or by any means, electronic, mechanical, photocopying, reordering or otherwise, without the prior permission of the publisher. ISBN: 978-93-86675-40-8 Ideal International E- Publication www.isca.co.in iii Preface Cell biology also known as cytology. It deals with cells and its organelles. Inside this document you find curious of yours about cells and how they act like independent livings within bodies of living organisms. Preparation of this lecture notes has took much effort as needs high understanding in science of biology. Cells are important parts of life and without them life can be impossible. Understanding sciences like cytology, histology, genetics, biochemistry, molecular biology, are essential sciences to know are linked to knowledge of cells. During preparation of this lecture notes, content of module of cell biology taught in biomedical sciences courses in INES-Ruhengeri at undergraduate level has been used. A part from this content different source has been used to study each topic with much attention.
    [Show full text]
  • The Complexity of Cell-Biological Systems
    THE COMPLEXITY OF CELL-BIOLOGICAL SYSTEMS Olaf Wolkenhauer and Allan Muir PREFACE The structure of the essay is as follows: Introduction: The complexity of cell-biological systems has an “inherent” basis, related to the nature of cells (large number and variety of components, non- linear, spatio-temporal interactions, constant modification of the components) and arises also from the means we have for studying cells (technological and method- ological limitations). Section 1: Ontological and epistemological questions are intertwined: to study the nature of living systems, we require modeling and abstraction, which in turns requires assumptions and choices that will influence/constrain what we can know about cells. We study cells, organs and organisms at a particular, chosen level,are forced to select subsystems/parts of a larger whole, and pick a limited range of technologies to generate observations. The study of cell biological systems requires a pragmatic form of reductionism and the interpretation of data and models is sub- sequently linked to a context. The framework to develop (mathematical) models is systems theory. Systems theory is the study of organization per se. While investigations into the structural (material) organization of molecules and cells have dominated molecular and cell biology to this day, with the emergence of systems biology there is a shift of focus towards an understanding of the functional organization of cells and cell populations, i.e., the processes (“laws” and “mechanisms”) that determine the cell’s or organ’s behavior. The necessity to select a level and subsystem, leads inevitably to a conceptual close in the theory of dynamical systems: by classifying observables into dependent, independent and invariant ones (parameters) we draw a boundary between an interior and exterior.
    [Show full text]
  • Biological Treatment - Attached-Growth Processes Study Guide Subclass A2
    Wisconsin Department of Natural Resources Wastewater Operator Certification Biological Treatment - Attached-Growth Processes Study Guide Subclass A2 February 2016 Edition Wisconsin Department of Natural Resources Operator Certification Program PO Box 7921, Madison, WI 53707 http://dnr.wi.gov The Wisconsin Department of Natural Resources provides equal opportunity in its employment, programs, services, and functions under an Affirmative Action Plan. If you have any questions, please write to Equal Opportunity Office, Department of Interior, Washington, D.C. 20240. This publication is available in alternative format (large print, Braille, audio tape. etc.) upon request. Please call (608) 266-0531 for more information. Printed on 01/31/16 Biological Treatment - Attached-Growth Processes Study Guide - Subclass A2 Preface The Biological Treatment – Attached Growth Study Guide is an important resource for preparing for the certification exam and is arranged by chapters and sections. Each section consists of key knowledges with important informational concepts you need to know for the certification exam. This study guide also serves as a wastewater treatment plant operations primer that can be used as a reference on the subject. Any diagrams, pictures, or references included in this study guide are included for informational/educational purposes and do not constitute endorsement of any sources by the Wisconsin Department of Natural Resources. In preparing for the exams: 1. Study the material! Read every key knowledge until the concept is fully understood and known to memory. 2. Learn with others! Take classes in this type of wastewater operations to improve your understanding and knowledge of the subject. 3. Learn even more! For an even greater understanding and knowledge of the subjects, read and review the references listed at the end of the study guide.
    [Show full text]
  • A Systemic Multi-Scale Unified Representation of Biological Processes in Prokaryotes Vincent J
    Henry et al. Journal of Biomedical Semantics (2017) 8:53 DOI 10.1186/s13326-017-0165-6 RESEARCH Open Access The bacterial interlocked process ONtology (BiPON): a systemic multi-scale unified representation of biological processes in prokaryotes Vincent J. Henry 1,2†, Anne Goelzer2*† , Arnaud Ferré1, Stephan Fischer2, Marc Dinh2, Valentin Loux2, Christine Froidevaux1 and Vincent Fromion2 Abstract Background: High-throughput technologies produce huge amounts of heterogeneous biological data at all cellular levels. Structuring these data together with biological knowledge is a critical issue in biology and requires integrative tools and methods such as bio-ontologies to extract and share valuable information. In parallel, the development of recent whole-cell models using a systemic cell description opened alternatives for data integration. Integrating a systemic cell description within a bio-ontology would help to progress in whole-cell data integration and modeling synergistically. Results: We present BiPON, an ontology integrating a multi-scale systemic representation of bacterial cellular processes. BiPON consists in of two sub-ontologies, bioBiPON and modelBiPON. bioBiPON organizes the systemic description of biological information while modelBiPON describes the mathematical models (including parameters) associated with biological processes. bioBiPON and modelBiPON are related using bridge rules on classes during automatic reasoning. Biological processes are thus automatically related to mathematical models. 37% of BiPON classes stem from different well-established bio-ontologies, while the others have been manually defined and curated. Currently, BiPON integrates the main processes involved in bacterial gene expression processes. Conclusions: BiPON is a proof of concept of the way to combine formally systems biology and bio-ontology.
    [Show full text]
  • Linking Molecular Imaging Terminology to the Gene Ontology (GO)
    Linking Molecular Imaging Terminology to the Gene Ontology (GO) P.K. Tulipano, W. Millar, J.J. Cimino Pacific Symposium on Biocomputing 8:613-623(2003) LINKING MOLECULAR IMAGING TERMINOLOGY TO THE GENE ONTOLOGY (GO) P.K. TULIPANO,1 W.S. MILLAR,2 J.J. CIMINO1 Department of Medical Informatics1, Department of Radiology2 Columbia University, New York, NY 10032, USA Email: [email protected], [email protected], [email protected] The rapidly developing domain of molecular imaging represents the merging of current advances in the fields of molecular biology and imaging research. Despite this merger, an information gap continues to exist between the scientists who discover new gene products and the imaging scientists who can exploit this information. The Gene Ontology (GO) Consortium seeks to provide a set of structured terminologies for the conceptual annotation of gene product function, process and location in databases. However, no such structured set of concept-oriented terminology exists for the molecular imaging domain. Since the purpose of GO is to capture the information about the role of gene products, we propose that the mapping of GO’s established ontological concepts to a molecular imaging terminology will provide the necessary bridge to fill the information gap between the two fields. We have extracted terms and definitions from an already published molecular imaging glossary as well as molecular imaging research articles, and developed molecular imaging concepts. We then mapped our molecular imaging concepts to the existing gene ontology concepts as a method to comprehensively represent molecular imaging. 1 Introduction Advances in medical imaging such as improved image resolution, new imaging agents, and experimental micro imaging devices, have stimulated interest in the in vivo assessment of molecular interactions and pathways.1 These advancements coupled with the latest genomic discoveries have led to the rapid development of the molecular imaging domain.
    [Show full text]
  • Evolutionary Dynamics of Speciation and Extinction
    Scholars' Mine Doctoral Dissertations Student Theses and Dissertations Fall 2015 Evolutionary dynamics of speciation and extinction Dawn Michelle King Follow this and additional works at: https://scholarsmine.mst.edu/doctoral_dissertations Part of the Biophysics Commons Department: Physics Recommended Citation King, Dawn Michelle, "Evolutionary dynamics of speciation and extinction" (2015). Doctoral Dissertations. 2464. https://scholarsmine.mst.edu/doctoral_dissertations/2464 This thesis is brought to you by Scholars' Mine, a service of the Missouri S&T Library and Learning Resources. This work is protected by U. S. Copyright Law. Unauthorized use including reproduction for redistribution requires the permission of the copyright holder. For more information, please contact [email protected]. 1 EVOLUTIONARY DYNAMICS OF SPECIATION AND EXTINCTION by DAWN MICHELLE KING A DISSERTATION Presented to the Faculty of the Graduate Faculty of the MISSOURI UNIVERSITY OF SCIENCE AND TECHNOLOGY and UNIVERSITY OF MISSOURI AT SAINT LOUIS In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY in PHYSICS 2015 Approved by: Sonya Bahar, Advisor Ricardo Flores Nevena Marić Paul Parris Thomas Vojta 1 iii ABSTRACT Presented here is an interdisciplinary study that draws connections between the fields of physics, mathematics, and evolutionary biology. Importantly, as we move through the Anthropocene Epoch, where human-driven climate change threatens biodiversity, understanding how an evolving population responds to extinction stress could be key to saving endangered ecosystems. With a neutral, agent-based model that incorporates the main principles of Darwinian evolution, such as heritability, variability, and competition, the dynamics of speciation and extinction is investigated. The simulated organisms evolve according to the reaction-diffusion rules of the 2D directed percolation universality class.
    [Show full text]
  • Table S1 List of Primers Sequences of the Selected Genes for RT-Qpcr
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2016 Table S1 List of primers sequences of the selected genes for RT-qPCR Product Gene Gene ID Nucleotide sequences for primers size (bp) CAGCCAAAGCAATCAAGCGT TGA 138 c42668_g1_i1 TCAACCTGCTTTTCCTCGCT CTCTCCGCACTTTCCCTCAC SAUR 111 c12931_g1_i1 ACTGCCTCAACATCTGTCGG TTCCATGACCCGCTCGAAAA SAUR 147 c58902_g1_i1 ATGGAGCGGTTCGTCGTAAG GCGGCACCTTTGTTATCTGC PR1 114 c42413_g1_i1 CAATCATCACCTCACGCACG GGGTATCCCGTTGCCATGAA KAO 117 c27636_g1_i1 TTCATGGCTGGTGGTTGGAG CTCCTGGTGATATGGGCTGG KAO 109 c15090_g1_i1 AAATCGCTCGTCGTCCATCA GTCAGCGGCCTCCAGATTTT GA3ox-2 202 c10824_g1_i1 TAATATGCGTCGGAGGGCTG GGTCTTACCCGAGTGTGCTC GA3ox-2 176 c49690_g1_i1 TGTGCCAAGATACTCGCTCC TGAGACGCAACCTCTGCAAT SQLE 166 c26224_g1_i1 ACCAAACAGCGAATCTCGGA TCGTGCCTGTGATGTTGAGG MVD 130 c28767_g2_i1 AGCAGCAGAGGAAGCCAATC Table S2 Number of differentially expression genes (DEGs) in GO pathways GO Slim Category Description DEGs p-value GO:0008150 Biological Process biological_process 76 0.07373607 anatomical structure GO:0009653 Biological Process 36 0.5275879 morphogenesis cellular component GO:0016043 Biological Process 109 0.6072271 organization GO:0009987 Biological Process cellular process 541 0.8646903 GO:0016265 Biological Process death 13 0.1086476 GO:0009790 Biological Process embryo development 3 0.9994034 GO:0040007 Biological Process growth 10 0.9955565 GO:0008152 Biological Process metabolic process 772 5.37E-06 multicellular organismal GO:0007275 Biological Process 64 0.9574919
    [Show full text]